ethische Probleme im Kontext der Humangenetik

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "ethische Probleme im Kontext der Humangenetik"

Transkript

1 ethische Probleme im Kontext der Humangenetik

2 ethische Probleme im Kontext der Humangenetik / Lernziele molekulargenetische Diagnostik pränatale Diagnostik / Interruptio Elternalter

3 Human-Genetik A C Genetik G T

4 Humangenet(h)ik Wissenschaft von der genetisch bedingten Variabilität des Menschen Vererbung: Mechanismen/Gesetzmäßigkeiten Genotyp Phänotyp allgemeine Theorie der Entstehung von Erkrankungen

5 genetische Beratung...ist ein ärztliches Angebot an alle, die Risiken für sich / andere im Zusammenhang mit genetischen Erkrankungen befürchten (Deutsche Gesellschaft für Humangenetik)

6 genetische Beratung medizinische Fakten, Diagnose, Therapie Wahlmöglichkeiten angemessene Einstellung zur Krankheit /Behinderung bzw. Wiederholungsrisiko

7 moderne Gen-Diagnostik

8 - recreational genomics

9 Koketterie

10 Schärfen der Begrifflichkeiten Krankheit Patient gesunder Mutationsträger

11 Genom-Sequenzanalyse

12 Genom-Sequenzanalyse methodische Probleme lange repetitive DNA-Sequenzen Sequenz-Lücken G/C reiche-sequenzen DNA-Veränderungen (Modifikation/Degradation)

13 Kosten pro Genom

14 Genom-Sequenzanalyse + Neugebornen-Screening Helfen DNA-Daten, Krankheiten zu verhindern? Varianten mit unklarer Bedeutung für das gegebene Individuum Welche DNA-Informationen werden mitgeteilt? bei Kindern / Erwachsenen oder Gesunden / Kranken Wem gehören die DNA-Daten? Sollten DNA-Daten anderen Forschern zur Verfügung stehen? auch DNA-Daten Un- / Neugeborener, bevor sie zustimmen können? Effizienz des klinischen DNA-Sequenzierens? je mehr untersucht wird desto mehr falsch positive Befunde

15 Anzahl Neumutationen Neumutationen + Elternalter Elternalter in Jahren Kong et al., Nature 2012

16 Schlußfolgerungen Autismus- + Schizophrenie-Erkrankungen Spermien einfrieren in jungen Jahren? Selektionsdruck erhöhen?

17 Gendiagnostikgesetz (GenDG; ) Medizin Recht Arbeit Versicherung

18 moderne DNA/Gen-Diagnostik Tatsachen + Thesen GenD klärt schwierigste DD, auch prädiktiv/pränatal GenD absolut präzise + effizient für s ganze Genom mitunter schwierige Interpretation + nur Wahrscheinlichkeitsaussagen möglich GenD ethisch unbedenklich bei suffizienter Beratung ethische Problemfelder: Menschen nach Maß merkantile Aspekte Glaube an genetische Determination

19 Diagnostik Therapie

20 moderne Gentechnologie erste direkte DNA-Tests DNA-Tests für >4000/7500 monogenen Erbleiden; Pharmaka- Verträglichkeit DNA-Tests für (alle) monogenen + einige Volks- Krankheiten personalisierte Medizin Gentherapie auf breiter Basis

21 ethische Probleme im Kontext der Humangenetik genetische Beratung + Diagnostik pränatale Diagnostik (Therapie?) Präimplantations-Diagnostik

22 Pränataldiagnostik Möglichkeiten / Techniken Nicht invasiv - Ultraschall - Ersttrimester-Screening {Triple-Suchtest}

23 + ß-HCG, PAPP-A

24

25 Arbeitskreis Down-Syndrom e.v. Bundesweite Beratung und Information

26 Wahrscheinlichkeit für Trisomie 21-Geburt bezogen auf das mütterliche Alter mütterliches Alter

27 umfassende, ergebnisoffene Beratung, medizinische, psychosoziale Aspekte, Fördermöglichkeiten, Kontakt zu SHG 90 % Schwangerschaftsabbruch

28 zellfreie fetale DNA im mütterlichen Blut

29 mütterliche Quellen fetalen Materials fetale Zellen maternale Zellen

30 Geburten / Interruptiones in D

31 und Schwangerschaftsabbrüche Beratungsregelung medizin. Indikation

32 Pränataldiagnostik Möglichkeiten / Techniken Nicht invasiv - Ultraschall - Ersttrimester screening Invasiv CVS - Chromosomen, DNA AZ - Chromosomen, DNA, -FP

33 in Zukunft: Diagnostik aus mütterlichem Blut Testbatterien für multiple Erkrankungen höchste soziale und ethische Brisanz!

34

35 Beratung individuelle Notsituation, Gewissenskonflikt Unterstützung bei Urteilsfindung Aufzeigen von Handlungsmöglichkeiten Bestärkung gegen sozialen Druck Entscheidungsautonomie

36 Hintergrund Angebot von Pränataldiagnostik, Abtreibungsrecht politische Entscheidung, sozialer Konsens Entscheidungsautonomie?

37 Alternativen Verzicht auf weitere Kinder? als Schicksal annehmen? Pränataldiagnostik? Präimplantationsdiagnostik?

38 Präimplantationsdiagnostik (PID) geringeres Übel? Schuld? Dammbruch?

39 Zielgruppe PID (kinderlose) Paare mit hohem genetischen Risiko Duchenne Muskeldystrophie CF bekannte chromos. Translokation

40 PID Tourismus zulässig: B, DK, GB, F, GR, NL, N, S, E, A, CH

41 Pränataldiagnostik im Interesse... des Kindes? der Mutter bzw. Familie? des nächsten Kindes Wert des Lebens? der Gesellschaft? Güterabwägung

42 ethische Aspekte der Pränataldiagnostik initiale Begründung - verbesserte genetische Beratung - Prävention [- ökonomische Aspekte; nicht in D] contra Menschenwürde (moral. Status des Embryos) Verwerfen des Embryos / Fetus was machbar ist wird gefordert (Haftungsabwehr) unübersehbare Entwicklungsmöglichkeiten höchstrichterl. Rechtsprechung: PD kann keiner Frau vorenthalten werden, bei noch so geringem Risiko Veränderung der Wertentscheidungen; slippery slope kein 100%iger Krankheitsausschluß Kosten pro Linderung individuellen Leids (psych. Entlastung > 98%) im Ausland verfügbar Diagnostik-Chips... Selbstbestimmungsrecht der Frau viele schwerwiegende Leiden verhinderbar Kosten

43 invasive Diagnostik + genetische Beratung Ziele: humangenetische Beratung vor jeder invasiven Diagnostik - Information über Aussagekraft der Untersuchung, schwer interpretierbare Ergebnisse möglich - Besprechen der Konsequenzen eines pathologischen Befundes - Familienanamnese, Hinweise auf Erbleiden?

44 pränatale Diagnostik Konsequenzen I meist Beruhigung der Schwangeren durch Normal- Befund Beispiel Röteln-Infektion: durch Ausschluss fetaler Infektion (PCR aus Chorionzotten oder Fruchtwasser) Schwangerschaftsabbruch heute seltener

45 pränatale Diagnostik Konsequenzen II intrauterine Therapie Blutgruppen- unverträglichkeit Wahl des Entbindungsortes Herzfehler, Spina bifida Vorbereitung Eltern Lippen-/Kiefer-/ Gaumen-Spalte

46 von der genetischen Glaskugel zum Menschen nach Maß gtcctggatag attttgctcttgcatcgatac ctctggggaacagcatcacacccc tgagggaggaggatggagaggaggagg gccgacgcccctgcaccttctctccagtcaa acaccgggctggagttgacatccactcctgtt tcgctggatcctgccgtccagctcagccaggagg ctagtggtctcaacttgttcaccgagcgcaaccag atgtgacgctgacagaactgcgaagggtgcaccctt cagaagacgagatcctcgctcagtacctggtgccta cagctgccgtccttgggatggacaaggccgtggcg gtgtcagccgcctgctggagagcacgctcaggag cccagcagggttggagccctgcacggcgtcctc tggagtgcgacctgctggacgacactgccaa tcatcagcgactatctcctctccaaccc actgcgtgaacattcacagccagca acgtactggtcatgtgtgcc atacctcattga

ethische Probleme im Kontext der Humangenetik

ethische Probleme im Kontext der Humangenetik ethische Probleme im Kontext der Humangenetik 12.12.2014 ethische Probleme im Kontext der Humangenetik / Lernziele molekulargenetische Diagnostik pränatale Diagnostik / Interruptio Elternalter Human-Genetik

Mehr

Grundlagen Humangenetik

Grundlagen Humangenetik Grundlagen Humangenetik Allgemeines Humangenetik ist da `was anders? Erbgänge pränatale Diagnostik 7.11.2016 homepage http://www.rub.de/mhg/ links On-line Mendelian Inheritance in Man OMIM-Statistik 2.

Mehr

Medizinethische Fragen am Lebensanfang

Medizinethische Fragen am Lebensanfang Medizinethische Fragen am Lebensanfang Dr. med. Gisbert Voigt Kinder- und Jugendarzt / Kinderpneumologe Stellv. Vorsitzender PID Kommission Nord Symposium zur Medizinethik 23.09.2015 23. September 2015

Mehr

Alcaiseda, 22.5.2015

Alcaiseda, 22.5.2015 Alcaiseda, 22.5.2015 Nicht-invasive Diagnostik Ersttrimester Screening (Ultraschall + Biochemie) Cell-Free Fetal DNA im mütterlichen Blut (NIPT) PRC Risk Calculation-Programm der FMF Deutschland mit einem

Mehr

Pränataldiagnostik und Schwangerschaftsabbruch

Pränataldiagnostik und Schwangerschaftsabbruch Wintersemester 2015/16 Vorlesung Ethik in der Medizin Pränataldiagnostik und Schwangerschaftsabbruch Prof. Dr. Alfred Simon Institut für Ethik, Geschichte und Theorie der Medizin Fallbeispiel In Ihre Geburtshilfliche

Mehr

Methoden der invasiven Pränataldiagnostik. Methoden zur Beurteilung der fetalen Kondition

Methoden der invasiven Pränataldiagnostik. Methoden zur Beurteilung der fetalen Kondition Pränataldiagnostik Nicht-invasive invasive Methoden der Pränataldiagnostik Sonographie-Screening (10., 20., 30. SSW) und weiterführende Sonographie Ersttrimesterscreening Methoden der invasiven Pränataldiagnostik

Mehr

Genetische Diagnostik vor der Geburt: Was ist heute möglich und wie kann unsere Gesellschaft damit verantwortlich umgehen?

Genetische Diagnostik vor der Geburt: Was ist heute möglich und wie kann unsere Gesellschaft damit verantwortlich umgehen? Genetische Diagnostik vor der Geburt: Was ist heute möglich und wie kann unsere Gesellschaft damit verantwortlich umgehen? Ute Hehr Genetische Pränataldiagnostik Beratung Dysmorphologie Labor Genetische

Mehr

Was sind die Gründe, warum die Frau, der Mann, das Paar die Beratungsstelle aufsucht?

Was sind die Gründe, warum die Frau, der Mann, das Paar die Beratungsstelle aufsucht? 6 Checkliste 3 Checkliste der relevanten Fragestellungen für die psychosoziale Beratung bei vorgeburtlichen Untersuchungen mit dem Ziel der informierten und selbstbestimmten Entscheidung Es müssen nicht

Mehr

Praxis für Pränatalmedizin Darmstadt Prof. Scharf Ihre Praxis für vorgeburtliche Diagnostik und Therapie

Praxis für Pränatalmedizin Darmstadt Prof. Scharf Ihre Praxis für vorgeburtliche Diagnostik und Therapie Praxis für Pränatalmedizin Darmstadt Prof. Scharf Ihre Praxis für vorgeburtliche Diagnostik und Therapie Tel +49-(0)6151-10 11 981 Fax +49-(0)6151-10 11 982 Karlstr. 45 Mobil +49-(0)176-23 76 63 09 64283

Mehr

Humangenetik-Vorlesung

Humangenetik-Vorlesung Humangenetik-Vorlesung Do, 20.04.2017 8 15-9 45 Einführung klinische Genetik: genet. Medizin + Beratung,prä-/ postnat. Diagnostik, GenDG 10 00-10 45 Mukoviszidose / CF: Patientenvorstellung, Einleitung

Mehr

Bluttest und Praxis der Pränataldiagnostik fördern Diskriminierung und untergraben Bemühungen zur Inklusion

Bluttest und Praxis der Pränataldiagnostik fördern Diskriminierung und untergraben Bemühungen zur Inklusion Pressemitteilung Bluttest und Praxis der Pränataldiagnostik fördern Diskriminierung und untergraben Bemühungen zur Inklusion Stellungnahme zum 5. Jahrestag der Unterzeichnung der UN- Behindertenrechtskonvention

Mehr

Vom Anfang des Lebens medizinethische Betrachtungen

Vom Anfang des Lebens medizinethische Betrachtungen Vom Anfang des Lebens medizinethische Betrachtungen Pro und Con der Präimplantationsdiagnostik PID Beispiel einer kontroversen bioethischen Debatte Gliederung des Vortrags Darstellung der med.-naturwissenschaftlichen

Mehr

Medizinische Diagnoseverfahren Schwerpunkt genetische Tests + Pränataldiagnostik

Medizinische Diagnoseverfahren Schwerpunkt genetische Tests + Pränataldiagnostik Medizinische Diagnoseverfahren Schwerpunkt genetische Tests + Pränataldiagnostik Jörg T. Epplen Humangenetik RUB + UWH www.rub.de/mhg/vorlesungen/ 7. 12. 2017 Humangenetik Zytogenetik Chromosomenuntersuchungen

Mehr

Molekulare Grundlagen der Humangenetik

Molekulare Grundlagen der Humangenetik Molekulare Grundlagen der Humangenetik Aufbau und Funktion des Genoms... Grundlagen... Eukaryontengenom... Variabilität des Genoms... Transkription und Translation der genetischen Information... DNAundRNA...

Mehr

Haftungsrechtliche Aspekte der Pränataldiagnostik

Haftungsrechtliche Aspekte der Pränataldiagnostik Haftungsrechtliche Aspekte der Pränataldiagnostik Das Kind als Schaden? Dr. Sascha Berst Wallstraße 15 79098 Freiburg 0761/282850 Chronologie: Die ersten Urteile 1980 Sterilisationsentscheidung(en) Der

Mehr

Neuapostolische Kirche International

Neuapostolische Kirche International Verlautbarung zum Thema PRÄNATALDIGANOSTIK UND PRÄIMPLANTATIONSDIAGNOSTIK 1. Einleitung Die moderne Medizin bietet verschiedene vorgeburtliche Untersuchungen an, mittels derer festgestellt werden soll,

Mehr

Fragen Sie Ihren Arzt/Ihrer Ärztin

Fragen Sie Ihren Arzt/Ihrer Ärztin Ein einfacher, sicherer Bluttest, der verlässliche Ergebnisse bietet Ein nicht-invasiver Test zur Bewertung des Risikos einer chromosomalen Erkrankung wie Down-Syndrom, der auch eine freiwillige Analyse

Mehr

Pränatale Analytik Informationen für die Eltern

Pränatale Analytik Informationen für die Eltern Pränatale Analytik Informationen für die Eltern Liebe Eltern Sie entscheiden. Diese Broschüre vermittelt Ihnen wichtige Informationen zur pränatalen Diagnostik fetaler Trisomien. Die Entscheidung, einen

Mehr

Humangenetische Beratung

Humangenetische Beratung Humangenetische Beratung Dr MEd. Martin GEncik Diagenos www.diagenos.com Allgemeines Indikation Inanspruchnahme, Rahmenbedingungen Qualifikationen Aufklärung vor Genetischer Beratung Anamnese und Befunderhebung

Mehr

Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia

Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Grundwissen Pränataldiagnostik 4 Grafik Pränataldiagnostiken 6 Die Produktefamilie 9 Robustheit von

Mehr

Pränataldiagnostik Dr. med. Regina Rasenack Universitäts-Frauenklinik Freiburg

Pränataldiagnostik Dr. med. Regina Rasenack Universitäts-Frauenklinik Freiburg Pränataldiagnostik Dr. med. Regina Rasenack Universitäts-Frauenklinik Freiburg Pränataldiagnostik Definition Untersuchungen zur Erkennung von angeborenen Fehlbildungen und Krankheiten Kleine Fehlbildungen:

Mehr

6WDWHPHQW 3URIHVVRU'U-RFKHQ7DXSLW],QVWLWXWI U'HXWVFKHV(XURSlLVFKHVXQG,QWHUQDWLRQDOHV 0HGL]LQUHFKW*HVXQGKHLWVUHFKWXQG%LRHWKLN 8QLYHUVLWlWHQ+HLGHOEHUJXQG0DQQKHLP 6FKORVV 0DQQKHLP )D[ (0DLOWDXSLW]#MXUDXQLPDQQKHLPGH

Mehr

Der neue PraenaTest - die vorgeburtliche Bestimmung der Trisomie 21 aus mütterlichem Blut

Der neue PraenaTest - die vorgeburtliche Bestimmung der Trisomie 21 aus mütterlichem Blut Der neue PraenaTest - die vorgeburtliche Bestimmung der Trisomie 21 aus mütterlichem Blut Stellungnahme Juni 2012 Erarbeitet durch den medizinischen Arbeitskreis von pro familia NRW Ab Mitte Juli 2012

Mehr

Einsatz von PND und PID bei der Erfüllung eines Kinderwunsches medizinethische Aspekte

Einsatz von PND und PID bei der Erfüllung eines Kinderwunsches medizinethische Aspekte Einsatz von PND und PID bei der Erfüllung eines Kinderwunsches medizinethische Aspekte Ethische Fragestellungen in der Schwangerschaftsberatung 4. November 2014 Prof. Dr. Jeanne Nicklas-Faust Gliederung

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

1.1 Motivation und Zielsetzung des Vorhabens 13. 1.2 Methodik und Struktur des Berichts 19

1.1 Motivation und Zielsetzung des Vorhabens 13. 1.2 Methodik und Struktur des Berichts 19 Inhalt 1. Einleitung: Gentechnologie in Deutschland 13 1.1 Motivation und Zielsetzung des Vorhabens 13 1.2 Methodik und Struktur des Berichts 19 2. Themenbereich Stammzellen: Pluripotente humane Stammzellen

Mehr

Kapitel 19 Pränataldiagnostik bei Fanconi-Anämie

Kapitel 19 Pränataldiagnostik bei Fanconi-Anämie 183 Kapitel 19 Pränataldiagnostik bei Fanconi-Anämie Prof. Dr. rer. nat. Susan Olson Oregon Health Sciences University, Portland OR, USA Pränatale Diagnose Mit Hilfe der pränatalen Diagnose kann man feststellen,

Mehr

Gendiagnose. Als nächstes möchte ich einige Verfahren von Gentests nennen und erläutern.

Gendiagnose. Als nächstes möchte ich einige Verfahren von Gentests nennen und erläutern. Gendiagnose Gentest Der Gentest ist ein molekularbiologisches Verfahren. Bei diesem wird die DNA untersucht, um Rückschlüsse auf genetische Aspekte zu erhalten. Gentests haben vielfältige Anwendungsmöglichkeiten,

Mehr

Informationen für werdende Eltern Ultraschall-Untersuchungen in der Schwangerschaft Pränatale Diagnostik

Informationen für werdende Eltern Ultraschall-Untersuchungen in der Schwangerschaft Pränatale Diagnostik Informationen für werdende Eltern Ultraschall-Untersuchungen in der Schwangerschaft Pränatale Diagnostik Frauenklinik Inhaltsverzeichnis Ultraschall-Screening 4 Weitere nicht-invasive Untersuchungsmethoden

Mehr

Literaturhinweise. Genanalyse und diagnostik

Literaturhinweise. Genanalyse und diagnostik Literaturhinweise Genanalyse und diagnostik Wiese, Gendiagnostikgesetz und Arbeitsleben, BB 2009 Schultz, DNA-Tests in der Migrationskontrolle, ZRP 2009, 115 Präve, Das Gendiagnostikgesetz aus versicherungsrechtlicher

Mehr

Schmid M. Non-Invasive Prenatal Testing (NIPT) - Screening auf fetale Aneuploidien durch Analyse der zellfreien DNA im mütterlichen Blut.

Schmid M. Non-Invasive Prenatal Testing (NIPT) - Screening auf fetale Aneuploidien durch Analyse der zellfreien DNA im mütterlichen Blut. Geburtshilfe / Frauen-Heilkunde / Strahlen-Heilkunde / Forschung / Konsequenzen Schmid M Non-Invasive Prenatal Testing (NIPT) - Screening auf fetale Aneuploidien durch Analyse der zellfreien DNA im mütterlichen

Mehr

Untersuchung, Beratung und Vorsorge bei familiärem Brustkrebs

Untersuchung, Beratung und Vorsorge bei familiärem Brustkrebs Untersuchung, Beratung und Vorsorge bei familiärem Brustkrebs 20. Onkologisches Symposium Tumorzentrum Regensburg e.v. Teresa Neuhann MGZ München Einführung Brustkrebs häufigste Tumorerkrankung der Frau

Mehr

Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind

Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind Information und Aufklärung für Schwangere Qualität aus Deutschland Liebe Schwangere, Vorgeburtliche Untersuchungsmethoden im Vergleich

Mehr

Medizinethische theoretische Voraussetzungen

Medizinethische theoretische Voraussetzungen I Medizinethische theoretische Voraussetzungen 1 Relevante Aspekte der Medizinethik... 3 1.1 Ethik im medizinischen Kontext... 3 1.2 Vorgehen beim Analysieren von Fallbeispielen... 6 1.3 Entscheidungsspielråume...

Mehr

HUMANGENETIK. Herausgegeben von Jan Murken und Hartwig Cleve. 5., neu bearbeitete Auflage 206 Einzeldarstellungen, 56 Tabellen

HUMANGENETIK. Herausgegeben von Jan Murken und Hartwig Cleve. 5., neu bearbeitete Auflage 206 Einzeldarstellungen, 56 Tabellen HUMANGENETIK Herausgegeben von Jan Murken und Hartwig Cleve 5., neu bearbeitete Auflage 206 Einzeldarstellungen, 56 Tabellen Ferdinand Enke Verlag Stuttgart 1994 Inhalt 1 Molekulare Grundlagen der Humangenetik

Mehr

Entwicklungsstörung. Abklären, erkennen, vorsorgen. Informationen für Eltern mit einem Sorgenkind

Entwicklungsstörung. Abklären, erkennen, vorsorgen. Informationen für Eltern mit einem Sorgenkind Entwicklungsstörung Abklären, erkennen, vorsorgen Informationen für Eltern mit einem Sorgenkind Entwicklungsstörungen haben oft genetische Ursachen Was sind genetisch bedingte Störungen und Erkrankungen?

Mehr

Pränatal-Medizin und Genetik

Pränatal-Medizin und Genetik Pränatal-Medizin und Genetik Informationen zur pränatalen Diagnostik Dr. med Darius Jakubowski Facharzt für Frauenheilkunde und Geburtshilfe Spezielle Geburtshilfe und Perinatalmedizin Degum II Sehr geehrte

Mehr

Hauptsache, es ist gesund! Über die Praxis der modernen vorgeburtlichen Diagnostik und Selektion Artikel von Dr. Bartholomeus Maris

Hauptsache, es ist gesund! Über die Praxis der modernen vorgeburtlichen Diagnostik und Selektion Artikel von Dr. Bartholomeus Maris Hauptsache, es ist gesund! Über die Praxis der modernen vorgeburtlichen Diagnostik und Selektion Artikel von Dr. Bartholomeus Maris Hauptsache, es ist gesund! ist der Satz, womit viele werdende Eltern

Mehr

07.072. Forschung am Menschen. Verfassungsbestimmung ARGUMENTARIEN CONTRA

07.072. Forschung am Menschen. Verfassungsbestimmung ARGUMENTARIEN CONTRA 07.072 Forschung am Menschen. Verfassungsbestimmung ARGUMENTARIEN CONTRA Verfassungsartikel über die Forschung am Menschen Art. 118b Hauptkritikpunkt: Abs 2,Bst c «Fremdnützige Forschung an urteilsunfähigen

Mehr

Dr. Jung und Dr. Mansfeld informieren: Erweiterte Schwangerschaftsvorsorge

Dr. Jung und Dr. Mansfeld informieren: Erweiterte Schwangerschaftsvorsorge Dr. Jung und Dr. Mansfeld informieren: Erweiterte Schwangerschaftsvorsorge Der Grundgedanke Durch die gesetzlichen Krankenversicherungen erhalten Sie nach wie vor alle notwendigen ärztlichen Leistungen

Mehr

Möglichkeiten und Grenzen der molekulargenetischen Diagnostik am Beispiel der Cystischen Fibrose (CF) PD Dr. Sabine Hoffjan 5.1.

Möglichkeiten und Grenzen der molekulargenetischen Diagnostik am Beispiel der Cystischen Fibrose (CF) PD Dr. Sabine Hoffjan 5.1. Möglichkeiten und Grenzen der molekulargenetischen Diagnostik am Beispiel der Cystischen Fibrose (CF) PD Dr. Sabine Hoffjan 5.1.2015 Klinik der CF CF-Patienten haben einen zähflüssige Sekrete Betroffene

Mehr

FAQ: Präimplantationsdiagnostik

FAQ: Präimplantationsdiagnostik FAQ: Präimplantationsdiagnostik Stand: Januar 2011 Präimplantationsdiagnostik (PID) Die PID ist die genetische Untersuchung von Embryonen im Rahmen einer künstlichen Befruchtung, bevor er in die Gebärmutter

Mehr

Qualität aus ärztlichen Händen. Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter

Qualität aus ärztlichen Händen. Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter Qualität aus ärztlichen Händen Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter Liebe Schwangere, als werdende Mutter befinden Sie sich wahrscheinlich in einer der emotionalsten Phasen

Mehr

Pränatale Diagnostik. Methoden:

Pränatale Diagnostik. Methoden: Ziel = Früherkennung von Schädigungen bei Föten Nicht-Ziel = Prävention oder medizinisch-therapeutische Intervention hinsichtlich erkannter Schädigungen und Beeinträchtigungen Methoden: 1. Nicht-invasive

Mehr

Reproduktionsmedizin und Embryonenforschung

Reproduktionsmedizin und Embryonenforschung Wintersemester 2014/15 Vorlesung Ethik in der Medizin Reproduktionsmedizin und Embryonenforschung PD Dr. Alfred Simon Institut für Ethik, Geschichte und Theorie der Medizin Gliederung der Vorlesung Ethisch

Mehr

Unser aller Dilemma: so viele Möglichkeiten so wenig Zeit

Unser aller Dilemma: so viele Möglichkeiten so wenig Zeit Symposion Winter 2015 Unser aller Dilemma: so viele Möglichkeiten so wenig Zeit NIPT Ersttrimesterscreening Diagnostische Punktion Sonografie Genetische Beratung Ethik Array-CGH 7. Februar 2015 Vortragssaal

Mehr

Pränatales Screening auf Chromosomenstörungen. Pränatales Screening. Leitfaden für werdende Mütter und Väter. Leitfaden für werdende Mütter und Väter

Pränatales Screening auf Chromosomenstörungen. Pränatales Screening. Leitfaden für werdende Mütter und Väter. Leitfaden für werdende Mütter und Väter Unsere Patienten-Information Pränatales auf Chromosomenstörungen Pränatales auf Chromosomenstörungen Leitfaden für werdende Mütter und Väter Leitfaden für werdende Mütter und Väter Labor Enders & Partner,

Mehr

Vorgeburtliche Untersuchung aus dem Blut der Schwangeren zur Abklärung einer möglichen fetalen Trisomie 21, 18 und 13

Vorgeburtliche Untersuchung aus dem Blut der Schwangeren zur Abklärung einer möglichen fetalen Trisomie 21, 18 und 13 Patientinneninformation zum NIPT ( nicht-invasiver pränataler Test ) Vorgeburtliche Untersuchung aus dem Blut der Schwangeren zur Abklärung einer möglichen fetalen Trisomie 21, 18 und 13 Sehr geehrte Patientin,

Mehr

Inhaltsverzeichnis. Stand der Medizin. Florian Steger, Simone Ehm, Michael Tchirikov. Adam Gasiorek-Wiens. Michael Tchirikov VII. 1 Einleitung...

Inhaltsverzeichnis. Stand der Medizin. Florian Steger, Simone Ehm, Michael Tchirikov. Adam Gasiorek-Wiens. Michael Tchirikov VII. 1 Einleitung... VII Inhaltsverzeichnis 1 Einleitung........................................................................... 1 Florian Steger, Simone Ehm, Michael Tchirikov I Stand der Medizin 2 Ultraschalldiagnostik,

Mehr

prenatal Nicht invasiver pränataler Test

prenatal Nicht invasiver pränataler Test prenatal Nicht invasiver pränataler Test 1 Sie sind schwanger. Herzlichen Glückwunsch! 2 Liebe zukünftige Eltern, wahrscheinlich ist alles gerade sehr aufregend für Sie, und es ist nur natürlich, dass

Mehr

Ethische und rechtliche Fragen der Pränataldiagnostik und Präimplantationsdiagnostik Eckhard Nagel

Ethische und rechtliche Fragen der Pränataldiagnostik und Präimplantationsdiagnostik Eckhard Nagel Ethische und rechtliche Fragen der Pränataldiagnostik und Präimplantationsdiagnostik Eckhard Nagel Publikation Vorlage: Datei des Autors Eingestellt am 15.05.2012 unter www.hss.de/download/nagel_praesentation.pdf

Mehr

Gentechnologie und Neurobiologie: Das Ende der Versicherbarkeit? Vom Gen zum Versicherungsantrag. Priv. Doz. Dr. Stephan Becher Berlin 10.11.

Gentechnologie und Neurobiologie: Das Ende der Versicherbarkeit? Vom Gen zum Versicherungsantrag. Priv. Doz. Dr. Stephan Becher Berlin 10.11. Gentechnologie und Neurobiologie: Das Ende der Versicherbarkeit? Vom Gen zum Versicherungsantrag Priv. Doz. Dr. Stephan Becher Berlin 10.11.2014 Vom Gen zum Versicherungsantrag 1 Einführung 2 Begriffe

Mehr

Unerfüllter Kinderwunsch. Ursachen erkennen, Lösungen finden. Informationen für Paare, die auf ein Baby warten

Unerfüllter Kinderwunsch. Ursachen erkennen, Lösungen finden. Informationen für Paare, die auf ein Baby warten Unerfüllter Kinderwunsch Ursachen erkennen, Lösungen finden Informationen für Paare, die auf ein Baby warten Das lange Warten auf ein Baby. Was können Sie tun? Wann sollten Sie sich untersuchen lassen?

Mehr

Nicht invasive Chromosomendiagnostik aus maternalem Blut: Möglichkeiten und Grenzen

Nicht invasive Chromosomendiagnostik aus maternalem Blut: Möglichkeiten und Grenzen Nicht invasive Chromosomendiagnostik aus maternalem Blut: Möglichkeiten und Grenzen PD Dr. rer. nat. Markus Stumm Zentrum für Pränataldiagnostik und Humangenetik Kudamm-199 stumm@kudamm-199.de Nicht invasive

Mehr

Listen Sie auf, welche Verdachtsdiagnosen mit dem First-Trimester-Screening abgeklärt werden können!

Listen Sie auf, welche Verdachtsdiagnosen mit dem First-Trimester-Screening abgeklärt werden können! Ersttrimester-Screening Fallbeschreibung 37-jährige Patientin. Sie befindet sich in der 11. Schwangerschaftswoche (SSW) ihrer ersten Schwangerschaft und lässt in ein Ersttrimester-Screening (First-Trimester-Screening)

Mehr

Next Generation Gene Sequencing bei Brustkrebs

Next Generation Gene Sequencing bei Brustkrebs Institut für Medizinische Genetik Next Generation Gene Sequencing bei Brustkrebs Prof. Dr. med. Anita Rauch 08.10.2015 Seite 1 Benefit der Krebsfrüherkennung Antilla et al. 2014 08.10.2015 Anita Rauch

Mehr

Labor information. Pränatale Array-CGH (Comparative Genomic Hybridization) Microarray-basierte vergleichende genomische Hybridisierung

Labor information. Pränatale Array-CGH (Comparative Genomic Hybridization) Microarray-basierte vergleichende genomische Hybridisierung www.bioscientia-humangenetik.de Labor information Pränatale Array-CGH (Comparative Genomic Hybridization) Microarray-basierte vergleichende genomische Hybridisierung Die Array-CGH-Analyse (kurz: Array-CGH)

Mehr

Klinik für Transplantationsmedizin Univ.-Prof. Dr. med. Hartmut H.-J. Schmidt [Adresse] Patienteninformation/Einwilligungserklärung

Klinik für Transplantationsmedizin Univ.-Prof. Dr. med. Hartmut H.-J. Schmidt [Adresse]  Patienteninformation/Einwilligungserklärung Universitätsklinikum Münster. Klinik für Transplantationsmedizin. 48149 Münster [Adresse] Klinik für Transplantationsmedizin Univ.-Prof. Dr. med. Hartmut H.-J. Schmidt Direktor Albert-Schweitzer-Campus

Mehr

Genetische Beratung bei psychiatrischen Erkrankungen. Sozialpsychiatrische und ethische Aspekte

Genetische Beratung bei psychiatrischen Erkrankungen. Sozialpsychiatrische und ethische Aspekte Genetische Beratung bei psychiatrischen Erkrankungen Sozialpsychiatrische und ethische Aspekte 1 Prinzipien der genetischen Beratung die Möglichkeiten ihrer Anwendung bei den genannten Krankheiten. die

Mehr

Non-Invasive Prenatal Testing (NIPT)

Non-Invasive Prenatal Testing (NIPT) Non-Invasive Prenatal Testing (NIPT) Methode & klinische Anwendung Information für Fachkreise Qualität aus Deutschland Non-Invasive Prenatal Testing (NIPT) Die Untersuchungsmethode des PraenaTest basiert

Mehr

Ersttrimestertest und Nicht-Invasiver Pränatal-Test Informationen für die Patientin

Ersttrimestertest und Nicht-Invasiver Pränatal-Test Informationen für die Patientin ETT und NIPT Ersttrimestertest und Nicht-Invasiver Pränatal-Test Informationen für die Patientin www.medica.ch Der klassische Ersttrimestertest (ETT) Neben einigen Ultraschalluntersuchungen bei Ihrer Frauenärztin

Mehr

Pränataldiagnostik: Medizinischer Fortschritt erfordert eine Debatte über grundlegende Werte. Procap Positionen

Pränataldiagnostik: Medizinischer Fortschritt erfordert eine Debatte über grundlegende Werte. Procap Positionen Pränataldiagnostik: Medizinischer Fortschritt erfordert eine Debatte über grundlegende Werte Procap Positionen Einleitung In den vergangenen Wochen titelten Medien: «Neuer Embryo-Check», «Down-Syndrom-Test

Mehr

1.-Trimester-Test (1.-TT) Informationen für die Eltern

1.-Trimester-Test (1.-TT) Informationen für die Eltern 1.-Trimester-Test (1.-TT) Informationen für die Eltern Liebe Eltern Sie entscheiden! Dieses Faltblatt wurde geschrieben, um Ihnen wichtige Informationen zum 1.-Trimester-Test (1.-TT) zu vermitteln. Die

Mehr

Aktuelle Situation in Österreich: Status Quo Umsetzung des Fortpflanzungsmedizingesetzes in der Praxis.

Aktuelle Situation in Österreich: Status Quo Umsetzung des Fortpflanzungsmedizingesetzes in der Praxis. Aktuelle Situation in Österreich: Status Quo Umsetzung des Fortpflanzungsmedizingesetzes in der Praxis. Alle Bilder: KinderWunschKlinik, Abdruck honorarfrei Bilder von der PK auf www.pressefotos.at Weitere

Mehr

Nicht-invasive molekulargenetische Pränataldiagnostik

Nicht-invasive molekulargenetische Pränataldiagnostik Nicht-invasive molekulargenetische Pränataldiagnostik Dr. rer. medic. Wera Hofmann Medical Director LifeCodexx AG Dr. Wera Hofmann, Medical Director Porto, ECA 2011 July 2, 2011 page 1 2011 LifeCodexx

Mehr

Seminar Frühjahr 2014. Die Herzkonferenz

Seminar Frühjahr 2014. Die Herzkonferenz Seminar Frühjahr 2014 Die Herzkonferenz Untersuchung des fetalen Herzens Kurs und praktische Übungen Transposition der großen Arterien Hypoplastisches Linksherz Bradykarde Rhythmusstörungen Therapie, Verlauf,

Mehr

Moderne und zielgerichtete Therapie der akuten Leukämie

Moderne und zielgerichtete Therapie der akuten Leukämie Universitätsklinikum Regensburg Moderne und zielgerichtete Therapie der akuten Leukämie Wolfgang Herr Innere Medizin III (Hämatologie u. internistische Onkologie) Klinik und Poliklinik für Innere Medizin

Mehr

Ersttrimesterscreening

Ersttrimesterscreening Universitäts-Frauenklinik Essen Ersttrimesterscreening Was ist das Ersttrimesterscreening? Im Ersttrimesterscreening wird das individuelle Risiko der Mutter/des Paares für ein Kind mit einer numerischen

Mehr

(Molekulare-) Zytogenetik

(Molekulare-) Zytogenetik (Molekulare-) Zytogenetik whole chromosome painting numerische Chromosomenaberrationen autosomale Aneuploidien Trisomie 13: Pätau-Syndrom (47,XX+13) Trisomie 18: Edwards-Syndrom (47,XY+18) Trisomie 21:

Mehr

PRÄNATALDIAGNOSTIK. was Sie darüber wissen sollten

PRÄNATALDIAGNOSTIK. was Sie darüber wissen sollten Schwanger sein, heißt guter Hoffnung sein. Hoffen heißt, die Möglichkeiten des Guten zu erwarten. Wir sind guter Hoffnung mit Ihnen. PRÄNATALDIAGNOSTIK was Sie darüber wissen sollten WARUM PRÄNATALDIAGNOSTIK?

Mehr

Agnes Glaus, PhD, MSc, T u m o r- und B r u s t z e n t r u m Z e T u P S t. G a l l e n

Agnes Glaus, PhD, MSc, T u m o r- und B r u s t z e n t r u m Z e T u P S t. G a l l e n Risiko-Assessment Brust- und Ovarialkarzinom: Grundlage für Gentestung, Vorsorge und prophylaktische Therapie Agnes Glaus, PhD, MSc, Pflegeexpertin Onkologie Risiko-Assessment Brust- und Ovarialkrebs Wieso

Mehr

Antrag zur Durchführung einer epidemiologischen Untersuchung

Antrag zur Durchführung einer epidemiologischen Untersuchung Materialien zu Genetisch-Epidemiologischen Methoden Absender: Antrag zur Durchführung einer epidemiologischen Untersuchung Musterantrag der ad hoc Arbeitsgruppe Epidemiologie des Arbeitskreises Medizinischer

Mehr

Information zur Schwangerenvorsorge

Information zur Schwangerenvorsorge Information zur Schwangerenvorsorge Sehr geehrte Patientin! Wir freuen uns mit Ihnen über Ihre Schwangerschaft. Zum weiteren Verlauf möchten wir Ihnen einige Informationen geben. Sie sollten sich vor Augen

Mehr

Milde Formen des Hypothyreoidismus beim Neugeborenen

Milde Formen des Hypothyreoidismus beim Neugeborenen Cnopf sche Kinderklinik Kinder- und Jugendmedizin Milde Formen des Hypothyreoidismus beim Neugeborenen Dr. Egbert Voß Milder Hypothyreoidismus Definition:...wenn die Serum-TSH Konzentration oberhalb des

Mehr

Pränataldiagnostik und Schwangerschaftsabbruch

Pränataldiagnostik und Schwangerschaftsabbruch Wintersemester 2017/18 Vorlesung Ethik in der Medizin Pränataldiagnostik und Schwangerschaftsabbruch Prof. Dr. Alfred Simon Institut für Ethik, Geschichte und Theorie der Medizin Fallbeispiel In Ihre Geburtshilfliche

Mehr

Beispiel für eine innovative Versorgungsstruktur. Der Selektivvertrag mit dem Netzwerk Genomische Medizin Lungenkrebs

Beispiel für eine innovative Versorgungsstruktur. Der Selektivvertrag mit dem Netzwerk Genomische Medizin Lungenkrebs Beispiel für eine innovative Versorgungsstruktur. Der Selektivvertrag mit dem Netzwerk Genomische Medizin Lungenkrebs AOK Rheinland/Hamburg Dr. med. Astrid Naczinsky Düsseldorf, 15. Dezember 2015 Lungenkrebs

Mehr

Eltern-Broschüre. Hinweise zum Umgang mit Nabelschnurrestblut in katholischen Krankenhäusern. caritas

Eltern-Broschüre. Hinweise zum Umgang mit Nabelschnurrestblut in katholischen Krankenhäusern. caritas Eltern-Broschüre Hinweise zum Umgang mit Nabelschnurrestblut in katholischen Krankenhäusern Katholischer Krankenhausverband der Diözese Osnabrück e.v. für die Diözese Osnabrück e.v. für die Diözese Münster

Mehr

Informationsbogen zum Aufklärungsgespräch

Informationsbogen zum Aufklärungsgespräch Informationsbogen zum Aufklärungsgespräch Patientinneninformation zum PraenaTest Vorgeburtliche Untersuchung aus dem Blut der Schwangeren zur Abklärung einer möglichen fetalen Trisomie 21 Sehr geehrte

Mehr

Individualisierte Medizin - Wirkungen und Auswirkungen. Sicht der Privaten Krankenversicherungen

Individualisierte Medizin - Wirkungen und Auswirkungen. Sicht der Privaten Krankenversicherungen Individualisierte Medizin - Wirkungen und Auswirkungen Sicht der Privaten Krankenversicherungen Jürgen Fritze (Verband der privaten Krankenversicherung, Köln) Mögliche Interessenkonflikte In den letzten

Mehr

Angebot und Nachfrage: Die Entwicklung von Gentests. Dr. Eva Fisher Geschäftsstelle der Gendiagnostik-Kommission Robert Koch-Institut

Angebot und Nachfrage: Die Entwicklung von Gentests. Dr. Eva Fisher Geschäftsstelle der Gendiagnostik-Kommission Robert Koch-Institut Angebot und Nachfrage: Die Entwicklung von Gentests Dr. Eva Fisher Geschäftsstelle der Gendiagnostik-Kommission Robert Koch-Institut Themen Welche (neuen) genetischen Tests werden heute in der klinischen

Mehr

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held ACT/CVS neueste gendiagnostische Verfahren 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held DNA, Gene, Chromosomen DNA besteht aus den Basenpaaren Adenin - Thymin

Mehr

Diagnostik einer Chromosomenverteilungsstörung

Diagnostik einer Chromosomenverteilungsstörung Diagnostik einer Chromosomenverteilungsstörung beim Kind aus dem mütterlichen Blut Trägerinterne ethische Empfehlungen für die ctt Ethik-Kommission der ctt März 2014 Impressum Herausgeber cusanus trägergesellschaft

Mehr

EWOG-SAA 2010 Genetische und immunologische Charakterisierung der Schweren Aplastischen Anämie (SAA) bei Kindern und Jugendlichen

EWOG-SAA 2010 Genetische und immunologische Charakterisierung der Schweren Aplastischen Anämie (SAA) bei Kindern und Jugendlichen Studienbeschreibung Titel der Studie EWOG-SAA 2010 Genetische und immunologische Charakterisierung der Schweren Aplastischen Anämie (SAA) bei Kindern und Jugendlichen Studienakronym EWOG-SAA 2010 Internetseite

Mehr

SYMPOSIUM INSTAND GENETIK 2013 Freitag 25. Oktober 2013. Zytogenetische Ringversuche entsprechend RiliBäk B-5-2

SYMPOSIUM INSTAND GENETIK 2013 Freitag 25. Oktober 2013. Zytogenetische Ringversuche entsprechend RiliBäk B-5-2 Zytogenetische Ringversuche entsprechend RiliBäk B-5-2 Prof. Dr. Jürgen Kunz Berufsverband Deutscher Humangenetiker e.v. Linienstrasse 127 10115 Berlin Zytogenetische Diagnostik: Indikationen und Ausgangsmaterial

Mehr

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Prof. Dr. med. Brigitte Schlegelberger 670513011/15 Olaparib Zulassung in Europa: Rezidiv eines Platin-sensitiven Ovarialkarzinoms

Mehr

Ersttrimester- Screening Was wird untersucht? MUSTER

Ersttrimester- Screening Was wird untersucht? MUSTER Ersttrimester- Screening Was wird untersucht? Sehr geehrte Patientin, schon seit vielen Jahrzehnten besteht die Möglichkeit durch eine Fruchtwasseruntersuchung (Amniocentese, AC) oder einer Mutterkuchenprobe

Mehr

Soll der Mensch biotechnisch machbar werden?

Soll der Mensch biotechnisch machbar werden? Otto Speck Soll der Mensch biotechnisch machbar werden? Eugenik, Behinderung und Pädagogik Ernst Reinhardt Verlag München Basel Prof. em. Dr. phil. Otto Speck, Ludwig-Maximilians-Universität München Pfarrer-Grimm-Straße

Mehr

Fäden des Lebens. Pränatal-Medizin München. Genetische Beratung. Pränatale Diagnostik Sonographie. Pränatale Diagnostik Invasive Methoden

Fäden des Lebens. Pränatal-Medizin München. Genetische Beratung. Pränatale Diagnostik Sonographie. Pränatale Diagnostik Invasive Methoden Fäden des Lebens 50 Jahre DNA - Doppelhelix Münchner Wissenschaftstage 16. - 20. Juli 2003 Pränatal-Medizin München Genetische Beratung Pränatale Diagnostik Sonographie Pränatale Diagnostik Invasive Methoden

Mehr

Dokumentation molekularbiologischer Untersuchungen gemäß Gentechnikgesetz

Dokumentation molekularbiologischer Untersuchungen gemäß Gentechnikgesetz Dokumentation molekularbiologischer Untersuchungen gemäß Gentechnikgesetz Alexander Nader 23. Frühjahrstagung der ÖGP IAP Austria und 10. gemeinsame Fortbildungstagung für Biomedizinische AnalytikerInnen

Mehr

Präimplantationsdiagnostik aus genetischer Sicht. P. Wieacker Institut für Humangenetik Münster

Präimplantationsdiagnostik aus genetischer Sicht. P. Wieacker Institut für Humangenetik Münster Präimplantationsdiagnostik aus genetischer Sicht P. Wieacker Institut für Humangenetik Münster Häufigkeit genetisch bedingter Erkrankungen Geburt Leben Chromosomenstörungen ca. 0,6% ca. 0,6% Monogene Erkrankungen

Mehr

Ethische Fragestellungen zur Personalisierten Medizin

Ethische Fragestellungen zur Personalisierten Medizin Ethische Fragestellungen zur Personalisierten Medizin Softskills Seminar Ethik 05.02.2013 Ethik in der Personalisierten Medizin Personalisierte Medizin Ihre Anwendungsgebiete Fallbeispiele Wohin mit der

Mehr

Ultraschalltagung.de. I.Trimester-Screening - Optimierung der Methode. PD Dr. Karl Oliver Kagan, Universitätsfrauenklinik Tübingen.

Ultraschalltagung.de. I.Trimester-Screening - Optimierung der Methode. PD Dr. Karl Oliver Kagan, Universitätsfrauenklinik Tübingen. I.Trimester-Screening - Optimierung der Methode 1 Risiko für Trisomie 21 (1 in X) 10 100 1000 10000 1 in 1000 1 in 285 1 in 85 15 20 25 30 35 40 45 50 Mütterliches Alter (Jahren) PD Dr. Karl Oliver Kagan,

Mehr

Fragen Sie Ihren Gesundheitsdienstleister

Fragen Sie Ihren Gesundheitsdienstleister Ein einfacher, sicherer Bluttest, der hochsensible Ergebnisse bietet Ein moderner nicht invasiver Test zur Bewertung von fetaler Trisomie und Beurteilung des Y-Chromosoms Fragen Sie Ihren Gesundheitsdienstleister

Mehr

PATIENTENINFORMATION

PATIENTENINFORMATION PATIENTENINFORMATION Dr. med. Peter Bernhard Dr. med. Birgit Kirschey Fachärzte für Frauenheilkunde und Geburtshilfe SCHWERPUNKTPRAXIS FÜR GYNÄKOLOGISCHEN UND PRÄNATALEN ULTRASCHALL DEGUM II ERSTTRIMESTER-SCREENING

Mehr

Vorlesung - Medizinische Biometrie

Vorlesung - Medizinische Biometrie Vorlesung - Medizinische Biometrie Stefan Wagenpfeil Institut für Medizinische Biometrie, Epidemiologie und Medizinische Informatik Universität des Saarlandes, Homburg / Saar Vorlesung - Medizinische Biometrie

Mehr

Gentechnologie in der Medizin - Diagnose & Therapie

Gentechnologie in der Medizin - Diagnose & Therapie Gentechnologie in der Medizin - Diagnose & Therapie Die Gentechnologie umfasst alle Methoden zum Nachweis und Isolierung von Erbmaterial (DNA). Gentechnische Verfahren ermöglichen eine gezielte Veränderung,

Mehr

Gentests Klinisch relevant oder genetisches Horoskop?

Gentests Klinisch relevant oder genetisches Horoskop? Gentests Klinisch relevant oder genetisches Horoskop? Prof. Dr. Sabina Gallati Abteilung für Humangenetik Universitätsklinik für Kinderheilkunde Bedeutung und Aufgaben der Humangenetik Interdisziplinäres

Mehr

Labortests für Ihre Gesundheit. Suchtests bei Schwangeren und Neugeborenen 25

Labortests für Ihre Gesundheit. Suchtests bei Schwangeren und Neugeborenen 25 Labortests für Ihre Gesundheit Suchtests bei Schwangeren und Neugeborenen 25 01IPF Labortests für Ihre Gesundheit Suchtests bei Schwangeren und Neugeborenen Schutz für Mutter und Kind Werdende Eltern wünschen

Mehr

Die Bewertung der sozio-kulturellen Aspekte in HTA-Berichten

Die Bewertung der sozio-kulturellen Aspekte in HTA-Berichten Die Bewertung der sozio-kulturellen Aspekte in HTA-Berichten Warum findet sie nicht statt? Ansgar Gerhardus 1, Marcial Velasco-Garrido 2 1 Universität Bielefeld, Abteilung Epidemiologie & International

Mehr