A. Sak, S. Grehl, M. Engelhard, A. Wierlemann, HP. Kaelberlah, P. Erichsen, C. Pöttgen, M. Groneberg, M. Stuschke

Größe: px
Ab Seite anzeigen:

Download "A. Sak, S. Grehl, M. Engelhard, A. Wierlemann, HP. Kaelberlah, P. Erichsen, C. Pöttgen, M. Groneberg, M. Stuschke"


1 γ-h2ax Foci Induktion in Lymphocten des peripheren Bluts von Tumorpatienten: in vivo und in vitro Interaktion von Cisplatin mit Doppelstrangbruch-Signalen ionisierender Strahlen A. Sak, S. Grehl, M. Engelhard, A. Wierlemann, HP. Kaelberlah, P. Erichsen, C. Pöttgen, M. Groneberg, M. Stuschke Universitätsklinikum Essen, Strahlentherapie

2 Material und Methodik: Insgesamt wurden 28 Tumorpatienten mit intra-thorakalen-, Becken- und Kopf- Hals-Tumoren, die einer simultanen Radio-Chemotherapie mit Cisplatin unterzogen wurden, in die Studie einbezogen. Peripheres Blut wurde den Patienten vor Cisplatin-Gabe und verschiedene Zeiten nach Cisplatin (1h, 1-7 Tage) sowie jeweils vor und nach der täglichen Bestrahlungsfraktion entnommen. Für die in vitro Exposition von Lymphozyten mit Cisplatin und ionisierender Strahlung wurde peripheres Blut von Patienten, die weder Cisplatin noch Bestrahlung in den letzten Wochen erhalten haben, verwendet. Der Effekt von Cisplatin auf die Induktion von g-h2ax-foci nach Bestrahlung, als ein Maß für die Induktion von DSB, wurde gemessen. Zusätzlich wurde die Apoptoserate nach in vitro und in vivo Behandlung mit Cisplatin und in vitro Bestrahlung bestimmt.

3 Cisplatin reduziert die γ-h2ax Foci sowohl nach in vitro und in vivo Behandlung A B C Abbildung 1: Interaktion von Cisplatin und ioniserenden Strahlen auf die Induktion von γ-h2ax Foci. A: Induktion von γ-h2ax Foci 30 min nach Bestahlung als Maß für die Induktion von DSB. Lymphozyten wurden für 1 h mit Cisplatin behandelt, mit 1 Gy bestrahlt und 30 min später für die γ- H2AX Foci Bestimmung. Links oben: Lymphozyten mit g-h2ax Foci B: Lymphozyten wurden unterschiedliche Zeiten nach Behandlung der Patienten mit Cisplatin isoliert, in vitro mit 0 Gy, 0.1 Gy, 0.25 Gy, 0.5 Gy und 1 Gy bestrahlt und die Steilheit der Induktionskurven mit und ohne Cisplatin bestimmt. Blau: Patienten mit Cisplatin Monotherapie, Grün: Patienten mit Cisplatin-Navelbine Therapie, Rot: Patienten mit Cisplatin-Etoposid Therapie.

4 Cisplatin steigert additiv die Apoptose von Lymphozyten nach Bestrahlung A B C H2AX Apoptose Abbildung 2: Einfluss von Cisplatin auf die Apoptose nach Bestrahlung. A: Rückbildung von γ-h2ax Foci, als Maß für die DSB-Reparatur (grün), sowie apoptotische Zellen (rot). Rechts ist ein Ausschnitt mit apoptotischen Zellen. Apoptose wurde anhand starker Färbung mit γ-h2ax (grün) ermittelt. B: Die Lymphozyten von unbestrahlten Patienten wurden isoliert und in vitro für 1h mit Cisplatin behandelt, in vitro bestrahlt und die Apoptose 24 h nach Bestrahlung ermittelt. C: Lymphozyten wurden unterschiedliche Zeiten nach Behandlung der Patienten mit Cisplatin isoliert in vitro bestrahlt und 24h nach Bestrahlung die Apoptose bestimmt. Schwarze Dreiecke: 0 Gy, Rote Kästchen: 4 Gy, Schwarze Kästchen: 10 Gy. Apoptose wurde anhand starker gleichmäßiger Färbung mit H2AX (grün) ermittelt.

5 Zusammenfassung: Die Entwicklung des γ-h2ax Signals (Fociausprägung) tritt verzögert ein und hat ein Maximum bei etwa 30 min nach Bestrahlung. Danach nimmt es kontunierlich ab. Die Anzahl γ-h2ax Foci zeigt eine lineare Abhängigkeit von der Bestrahlungsdosis nach in vitro und auch von der mittleren in vivo Ganzkörperdosis. Behandlung von Patienten mit Cisplatin führte zu einer signifikanten Reduktion von Strahlen induzierten γ-h2ax Foci in Lymphozyten sowohl nach in vitro und nach in vivo Bestrahlung um etwa 35% (p<0.0001). Dieser Effekt von Cisplatin blieb bis zu 6 Tage nach Behandlung signifikant. Die Behandlung mit Cisplatin führte zu einer additiven Erhöhung der Apoptoserate von Lymphozyten. Die Konzentrationsabhängigkeit und die Dauer der Cisplatin-Wirkung spiegelten sich auch auf dem Apoptoseendpunkt wieder. Schlussfolgerung: Cisplatin führt zu lang andauernde Interaktion mit dem frühen Signalmechanismus der Induktion von γ-h2ax Foci nach Bestrahlung. Diese Interaktion ist aber nicht durch eine Änderung der tatsächlichen Induktion von DSB bedingt, noch hat Sie eine beeinträchtigte Wiederverknüpfung von DSB im Gelektrophorese-Test zur Folge. Die gestörte γ-h2ax Foci Bildung nach Cisplatin kann jedoch weitere durch Strahlen induzierte Signalmechanismen (homologe Rekombination, Zellzyklusblockade) beeinflussen, die in Tumorzellen eine wichtige Bedeutung für das Überleben nach Bestrahlung haben. Sak et al. 2009, Clin Cancer Res, 15,

Um eine notwendige Strahlentherapie

Um eine notwendige Strahlentherapie Ursachen individueller Strahlenempfindlichkeit: DNA-Reparatur und andere zelluläre Antworten auf Bestrahlung Causes of individual radio sensitivity: DNA repair and other cellular responses to radiation


DNA-Reparaturfoci als Indikator der individuellen Strahlenempfindlichkeit

DNA-Reparaturfoci als Indikator der individuellen Strahlenempfindlichkeit Onkologisches Zentrum Klinik für Strahlentherapie und Radioonkologie 6. Senftenberger Innovationsforum; 16.3.2012, Hochschule Lausitz, Senftenberg DNA-Reparaturfoci als Indikator der individuellen Strahlenempfindlichkeit


Die LNT-Hypothese im Lichte der Strahlenforschung

Die LNT-Hypothese im Lichte der Strahlenforschung Die LNT-Hypothese im Lichte der Strahlenforschung Jürgen Kiefer Universität Giessen Strahlenwirkungen auf den Menschen Akute Wirkungen Funktionsstörungen von Organen: Blutbildendes System, Magen Darm-Trakt,


Intraoperative Strahlentherapie bei Brustkrebs

Intraoperative Strahlentherapie bei Brustkrebs Intraoperative Strahlentherapie bei Brustkrebs Uniklinik Köln 1 Kein Grund für Verzweiflung Wenn die Diagnose Brustkrebs festgestellt wird, ist erst einmal die Sorge groß. Beruhigend zu wissen, dass es


Dosismessungen der Augenlinse (Schwerpunkt: Patient CT) Gabriele Schüler Unfallkrankenhaus Berlin (vorgetragen von K. Ewen)

Dosismessungen der Augenlinse (Schwerpunkt: Patient CT) Gabriele Schüler Unfallkrankenhaus Berlin (vorgetragen von K. Ewen) (Schwerpunkt: Patient CT) Gabriele Schüler Unfallkrankenhaus Berlin (vorgetragen von K. Ewen) Katarakte der Augenlinse SSK bis 2009: Schwellendosis für f r Katarakt: 2 Gy bei kurzzeitiger Strahlenexposition.


Drexler G.A. 1, Derer A 1, Dirks W.G. 2, Hable V. 3, Greubel C. 3, Burgdorfer C. 3, Dollinger G. 3, Du G. 4, Friedl A.A. 1

Drexler G.A. 1, Derer A 1, Dirks W.G. 2, Hable V. 3, Greubel C. 3, Burgdorfer C. 3, Dollinger G. 3, Du G. 4, Friedl A.A. 1 Nutzung von bi-cistronischen Vektoren für die Beobachtung der Rekrutierung von Signal- und Reparaturproteinen an DNA-Schäden nach Ionen- Mikrobestrahlung durch Live-Cell Imaging Drexler G.A. 1, Derer A


1.1 Einführung in die Problematik 1 1.2 Zielsetzung 9

1.1 Einführung in die Problematik 1 1.2 Zielsetzung 9 Inhaltsverzeichnis 1. Einleitung 1.1 Einführung in die Problematik 1 1.2 Zielsetzung 9 2. Material und Methoden 2.1 Material 2.1.1 Chemikalien 11 2.1.2 Materialien für die Säulenchromatographie 12 2.1.3


Strahlen- und chemoinduzierte multiple Medikamentenresistenz bei Kolonkarzinomzellen - differentielles Ansprechen verschiedener biologischer Parameter

Strahlen- und chemoinduzierte multiple Medikamentenresistenz bei Kolonkarzinomzellen - differentielles Ansprechen verschiedener biologischer Parameter Strahlen- und chemoinduzierte multiple Medikamentenresistenz bei Kolonkarzinomzellen - differentielles Ansprechen verschiedener biologischer Parameter Detlef Bartkowiak, Michael Stempfhuber, Thomas Wiegel,


Extrakorporale Photopherese. Dr. med. Carolin Bouveret Klinik für Dermatologie und Allergologie HELIOS Klinikum Berlin-Buch

Extrakorporale Photopherese. Dr. med. Carolin Bouveret Klinik für Dermatologie und Allergologie HELIOS Klinikum Berlin-Buch Extrakorporale Photopherese Dr. med. Carolin Bouveret Klinik für Dermatologie und Allergologie HELIOS Klinikum Berlin-Buch Extrakorporale Photopherese Erstbeschreibung 1987 in der Behandlung kutaner T-Zell-


Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie

Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie Prof. Dr. Wolfgang Herr Innere Medizin III Hämatologie und intern. Onkologie Klinik und Poliklinik für Innere Medizin III


Nicht-kleinzelliges Bronchialkarzinom

Nicht-kleinzelliges Bronchialkarzinom Rolle der Chemotherapie in der Behandlung des nicht-kleinzelligen Bronchialkarzinoms Was ist gesichert, was ist experimentell? Die Prognose der Gesamtheit der Patienten im Stadium III ist über die letzten


Fettgeweberegeneration. für die Rekonstruktive und Plastische Chirurgie

Fettgeweberegeneration. für die Rekonstruktive und Plastische Chirurgie Fettgeweberegeneration für die Rekonstruktive und Plastische Chirurgie Prof. Dr. Torsten Blunk Klinik und Poliklinik für Unfall-, Hand-, Plastische und Wiederherstellungschirurgie Universitätsklinikum


Universitätsklinikum Regensburg Standards und Aktuelles in der Therapie des Malignen Melanoms

Universitätsklinikum Regensburg Standards und Aktuelles in der Therapie des Malignen Melanoms Standards und Aktuelles in der Therapie des Malignen Melanoms Sebastian Haferkamp Häufigkeit des Malignen Melanoms Fälle pro 100.000 www.rki.de Therapie des Melanoms Universitätsklinikum Regensburg 1975


Prostatakrebs: in Deutschland

Prostatakrebs: in Deutschland Prostatakrebs: in Deutschland Häufigster bösartiger Tumor bei Männern ca. 32.000 Neuerkrankungen/Jahr in Deutschland Zweithäufigste Todesursache bei Männern Etwa 12.000 Todesfälle/Jahr wegen Prostatakrebs


in vivo -- Das Magazin der Deutschen Krebshilfe vom 09.11.2010

in vivo -- Das Magazin der Deutschen Krebshilfe vom 09.11.2010 Seite 1/5 in vivo -- Das Magazin der Deutschen Krebshilfe vom 09.11.2010 Expertengespräch zum Thema Retinoblastom Und zu diesem Thema begrüße ich jetzt Professor Norbert Bornfeld, Direktor des Zentrums


Statische Magnetfelder

Statische Magnetfelder Statische Magnetfelder Messung, Wirkung, Bewertung Dr. Heinrich Eder Bay. Landesamt für 1 2 Erdmagnetisches Feld 30 60 µt 3 Wirkungen von magnetischen Gleichfeldern < 1 mt: Störfestigkeit von Herzschrittmachern,


Strahleninduzierte Apoptose bei ESRT im Mausmodell

Strahleninduzierte Apoptose bei ESRT im Mausmodell Strahleninduzierte Apoptose bei ESRT im Mausmodell Die Apoptose ist von vielen ineinandergreifenden Mechanismen abhängig, in deren Regulationsmittelpunkt die Caspasen als ausführende Cysteinproteasen stehen.


Wechselwirkung verschiedener Reparaturwege bei der Prozessierung von DNA Strahlenschäden

Wechselwirkung verschiedener Reparaturwege bei der Prozessierung von DNA Strahlenschäden 02NUK001 02.2008 09.2013 Projektleitung: G. Taucher-Scholz Wechselwirkung verschiedener Reparaturwege bei der Prozessierung von DNA Strahlenschäden Projektstatusgespräch Nukleare Sicherheitsforschung KIT


Brustkrebs von der Diagnose bis zur Nachsorge

Brustkrebs von der Diagnose bis zur Nachsorge Brustkrebs von der Diagnose bis zur Nachsorge Schaffhausen 28.10.2014 Dr. U.R. Meier Direktor Klinik für Radio-Onkologie Kantonsspital Winterthur Radio-Onkologie Die Lehre von der Behandlung bösartiger


Supportive Therapie. Patiententag 24. Oktober 2010. Dr. med. Christoph Heining

Supportive Therapie. Patiententag 24. Oktober 2010. Dr. med. Christoph Heining Supportive Therapie Patiententag 24. Oktober 2010 Dr. med. Christoph Heining Was ist supportive Therapie? Management und Vorbeugung unerwünschter Nebenwirkungen der Tumortherapie und von Tumorsymptomen.


Thomas G. Wendt Stand 31. Januar 2013

Thomas G. Wendt Stand 31. Januar 2013 Thomas G. Wendt Stand 31. Januar 2013 Prätherapeutisch: Posttherapeutisch: FIGO ptnm (UICC) ( Féderation Internationale de Gynécologie et d Obstétrique) TNM (UICC) (UICC= Union International Contre le


Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch Forschungsbericht über das Projekt Einfluss der TLR3-Aktivierung des retinalen Pigmentepithels auf das Verhalten von Makrophagen, gefördert durch die DOG im Rahmen der Forschungsförderung innovativer wissenschaftlicher


Therapieergebnisse randomisierter Studien bei HNO-Tumoren. Prof. Dr. Rainer Fietkau

Therapieergebnisse randomisierter Studien bei HNO-Tumoren. Prof. Dr. Rainer Fietkau Therapieergebnisse randomisierter Studien bei HNO-Tumoren Prof. Dr. Rainer Fietkau HNO-Tumoren: Therapeutische Entscheidungen bei kurativer Zielsetzung Primärtumor resektabel aber gravierende Funktionseinschränkung


Thema. Hodenkarzinom. Aufbaukurs Krebswissen WS 2015.16. Gero Kramer. Urologie. Autor, Einrichtung, Abteilung...

Thema. Hodenkarzinom. Aufbaukurs Krebswissen WS 2015.16. Gero Kramer. Urologie. Autor, Einrichtung, Abteilung... Aufbaukurs Krebswissen WS 2015.16 Hodenkarzinom Gero Kramer Urologie 1 Hodenkarzinom Epidemiologie 1% aller bösartiger Neubildungen beim Mann 3-10 neue Fälle / 100 000 Männer / Jahr (Westen) Anstieg in


Vergleich der Reparaturfähigkeit von γh2ax zu immunologischen Eigenschaften bei Patienten mit Mamma- und Rektumkarzinom

Vergleich der Reparaturfähigkeit von γh2ax zu immunologischen Eigenschaften bei Patienten mit Mamma- und Rektumkarzinom Aus der Strahlenklinik der Friedrich-Alexander-Universität Erlangen-Nürnberg Direktor: Prof. Dr. R. Fietkau Vergleich der Reparaturfähigkeit von γh2ax zu immunologischen Eigenschaften bei Patienten mit


Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom

Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom Von Navneet Ramesh und Maike Haehle, übersetzt von Sabine Schock Vom 8. Apr 2014 7:41 Uhr; aktualisiert am 8. Apr


Medizinische Universität Innsbruck Klinik für Strahlentherapie-Radioonkologie

Medizinische Universität Innsbruck Klinik für Strahlentherapie-Radioonkologie Medizinische Universität Innsbruck Klinik für Strahlentherapie-Radioonkologie Epithelial-mesenchymale Transition und Expression von c-myc sind entscheidend für cetuximab-gesteigertes Ansprechen auf Bestrahlung


3.19 Non-Hodgkin-Lymphome

3.19 Non-Hodgkin-Lymphome 140 Ergebnisse zur Non-Hodgkin-Lymphome 3.19 Non-Hodgkin-Lymphome Kernaussagen Inzidenz und Mortalität: Die altersstandardisierten Inzidenzraten von n und in Deutschland sind von 1980 bis zur Mitte der


Körperliches Training und Sport - Gibt es ein Potenzial bei der Prävention und Therapie von Prostatakrebs??

Körperliches Training und Sport - Gibt es ein Potenzial bei der Prävention und Therapie von Prostatakrebs?? Körperliches Training und Sport - Gibt es ein Potenzial bei der Prävention und Therapie von Prostatakrebs?? Prof. Dr. Andreas M. Nieß Medizinische Universitätsklinik Tübingen Abteilung Sportmedizin http://www.medizin.uni-tuebingen.de/sportmedizin


Aktuelle Behandlungsprinzipien der Alzheimer-Demenz

Aktuelle Behandlungsprinzipien der Alzheimer-Demenz Aktuelle Behandlungsprinzipien der Alzheimer-Demenz Alexander Kurz Klinik für Psychiatrie und Psychotherapie Klinikum rechts der Isar Technische Universität München Alzheimer: Ein neurodegenerativer Prozess


Frühe Apoptose. 10 0 4 8 12 16 20 24 Zeit nach Bestrahlung [h]

Frühe Apoptose. 10 0 4 8 12 16 20 24 Zeit nach Bestrahlung [h] 1.1 APOPTOSE-NACHWEIS BEI LYMPHOZYTEN UND BEI TUMORZELLINIEN 1.1.1 FRAGESTELLUNG Die folgenden Untersuchungen sollten zum einen klären, inwieweit bei Normalspender-Lymphozyten und bei 4 Tumorzellinien


Lungenmetastasen Chirurgie

Lungenmetastasen Chirurgie Lungenmetastasen Chirurgie Definition Als Metastasierung (griechisch: meta weg; stase: Ort; Übersiedlung) bezeichnet man die Absiedlungen bösartiger Zellen eines Tumors, stammend aus einer anderen primären


Optimierung mit intraoperativer Radiotherapie

Optimierung mit intraoperativer Radiotherapie Optimierung mit intraoperativer Radiotherapie Dr. Christiane Reuter Leitende Ärztin Radioonkologie Spital Thurgau AG Seite 1 Optimierung Unter einem Optimum (lateinisch optimum, Neutrum von optimus Bester,


Aktueller Stellenwert des PET-CT s in der Tumordiagnostik

Aktueller Stellenwert des PET-CT s in der Tumordiagnostik Aktueller Stellenwert des PET-CT s in der Tumordiagnostik Prof. Dr. med. Florian Lordick Chefarzt am Klinikum Braunschweig Sprecher des Cancer Center Braunschweig PET Positronen-Emissions-Tomographie (PET)......


Die Wirkung kleiner Dosen (ionisierender Strahlung) Dr. Susanne Schlagner 17. APT-Veranstaltung, Berlin 22.06.2013

Die Wirkung kleiner Dosen (ionisierender Strahlung) Dr. Susanne Schlagner 17. APT-Veranstaltung, Berlin 22.06.2013 Die Wirkung kleiner Dosen (ionisierender Strahlung) Dr. Susanne Schlagner 17. APT-Veranstaltung, Berlin 22.06.2013 Und das erwartet Sie Einführung Strahlenschäden - Strahlenrisiko Wirkung kleiner Dosen


Körperliche Aktivität nach Stammzelltransplantation Must have or nice to have?!

Körperliche Aktivität nach Stammzelltransplantation Must have or nice to have?! Informationstag für Patienten & deren Angehörigen; 22. Juni 2013, Universitätsspital Basel Körperliche Aktivität nach Stammzelltransplantation Must have or nice to have?! Dr. Ruud Knols, PT, Ph.D. Direktion


Verfahren der Haltbarmachung. 03 / Wie Lebensmittel überleben

Verfahren der Haltbarmachung. 03 / Wie Lebensmittel überleben 03 / Wie Lebensmittel überleben Drei Arten von Verfahren Kälte und Hitze physikalisch Bestrahlung Wasserentzug Pökeln Säuern chemisch biolologisch Zuckern Salzen Räuchern Konservierunsstoffe Physikalisches


Direkter ex vivo Nachweis autoreaktiver T- Helferzellen bei Patienten mit progressiver systemischer Sklerose (PSS)

Direkter ex vivo Nachweis autoreaktiver T- Helferzellen bei Patienten mit progressiver systemischer Sklerose (PSS) Aus der Klinik für Dermatologie, Venerologie und Allergologie der Medizinischen Fakultät Charité Universitätsmedizin Berlin DISSERTATION Direkter ex vivo Nachweis autoreaktiver T- Helferzellen bei Patienten


ACO Wärmebrückenkatalog

ACO Wärmebrückenkatalog Mai 2014 Wärmebrückenkatalog 1.0 Kundeninfo ACO Wärmebrückenkatalog Die Energieverluste über der Gebäudehülle werden nicht unerheblich durch Wärmebrücken beeinflusst. Praktisch heißt das, es sollte der


Wo Anleger schneller punkten.

Wo Anleger schneller punkten. Wo Anleger schneller punkten. Punkt 5. Januar 2012 auf Ihrem Bildschirm. Schwarze Zahlen dank rotem Punkt. Punkt 5. Januar 2012 auf Ihrem Bildschirm. Jetzt lassen wir den Worten Daten folgen. folgen. Jetzt


Adoptive Immuntherapie dendritische Zellen, Killerzellen, T-Zellen

Adoptive Immuntherapie dendritische Zellen, Killerzellen, T-Zellen Adoptive Immuntherapie dendritische Zellen, Killerzellen, T-Zellen Priv. Doz. Dr. med. Torsten Tonn Institut für Transfusionsmedizin und Immunhämatologie Johann Wolfgang Goethe Universitätsklinikum Frankfurt


Corpus uteri. 3.4 Corpus uteri

Corpus uteri. 3.4 Corpus uteri 77 Corpus uteri 3.4 Corpus uteri Das Korpuskarzinom ist nach Brust- und Darmkrebs gleich häufig wie Tumoren der Atmungsorgane und somit die dritthäufigste Krebserkrankung der Frau in Deutschland, die allerdings


Intraoperative Strahlentherapie bei Brustkrebs Patienteninformation zur intraoperativen Radiotherapie (IORT-Boost)

Intraoperative Strahlentherapie bei Brustkrebs Patienteninformation zur intraoperativen Radiotherapie (IORT-Boost) Intraoperative Strahlentherapie bei Brustkrebs Patienteninformation zur intraoperativen Radiotherapie (IORT-Boost) Behandlung mit konventioneller Strahlentherapie Kein Grund für Verzweiflung Wenn die Diagnose


Und wie geht es den Angehörigen? Berücksichtigung des sozialen Umfeldes. Sonja Stutz

Und wie geht es den Angehörigen? Berücksichtigung des sozialen Umfeldes. Sonja Stutz Und wie geht es den Angehörigen? Berücksichtigung des sozialen Umfeldes Sonja Stutz Übersicht 1. Rolle der Angehörigen in der Suchttherapie 2. Einbezug der Angehörigen in die stationäre Therapie 3. Studie


ARTCLINE GmbH BMBF-Innovationsforum Bioaktive Zellfilter. März 2011

ARTCLINE GmbH BMBF-Innovationsforum Bioaktive Zellfilter. März 2011 ARTCLINE GmbH BMBF-Innovationsforum Bioaktive Zellfilter März 2011 Aktueller Stand der Extrakorporalen Zelltherapie für Sepsis-Patienten SEPSIS 1,5 Mio. Tote in Industrieländern Definition: = Generalisierte


Beilage 1 Zertifikat WAVEEX / W-LAN. A. Morphographische Vermessung der W-LAN-Emission (Verbindung Router-MacBook) ohne und mit WAVEEX

Beilage 1 Zertifikat WAVEEX / W-LAN. A. Morphographische Vermessung der W-LAN-Emission (Verbindung Router-MacBook) ohne und mit WAVEEX A. Morphographische Vermessung der W-LAN-Emission (Verbindung Router-MacBook) ohne und mit WAVEEX Grafik A1: Basismessung Folie 1 Diese Grafik stellt das Ergebnis der Messung dar, bei der die neutrale


Diagnostik und Therapie primärer und metastasierter Mammakarzinome

Diagnostik und Therapie primärer und metastasierter Mammakarzinome Diagnostik und Therapie primärer und metastasierter Mammakarzinome ZNS-Metastasen beim Mammakarzinom ZNS-Metastasen beim Mammakarzinom AGO e.v. in der DGGG e.v. Guidelines Version 2010.1.1 Breast D Versionen


Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: "Hip or Hype"

Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: Hip or Hype Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: "Hip or Hype" 3. Nationales Biobankensymposium 2014 Berlin, 04.12.2014 Prof. Dr. rer. nat Edgar Dahl RWTH zentralisierte Biomaterialbank


Serologische Zöliakiediagnostik

Serologische Zöliakiediagnostik Serologische Zöliakiediagnostik Thomas Mothes Institut für Laboratoriumsmedizin, Klinische Chemie und Molekulare Diagnostik Universitätsklinikum Leipzig Pädiatrischer Arbeitskreis 30. Oktober 2009, Wermsdorf


Informationen zur Hormontherapie des Prostatakarzinoms mittels LHRH-Agonisten

Informationen zur Hormontherapie des Prostatakarzinoms mittels LHRH-Agonisten Informationen zur Hormontherapie des Prostatakarzinoms mittels LHRH-Agonisten Inhaltsverzeichnis Einleitung... Seite 3 LHRH-Agonisten... Seite 4 Antiandrogene... Seite 6 Lieber Patient, bei Ihnen ist kürzlich


3 Methoden. 3.1 Zellkultivierung und Zellpassagierung

3 Methoden. 3.1 Zellkultivierung und Zellpassagierung 3 Methoden 3.1 Zellkultivierung und Zellpassagierung Für die Zellkultivierung der WTS-Zellinie wurden Standardprotokolle unserer Abteilung Zell- und Gewebezüchtung genutzt (leicht modifiziert nach Freshney,


Ich sehe was, was du nicht siehst. Visuelle Wahrnehmung

Ich sehe was, was du nicht siehst. Visuelle Wahrnehmung Ich sehe was, was du nicht siehst Visuelle Wahrnehmung Prof. Dr. Horst O. Mayer Warum sind die Augen rot? 1 Die Netzhaut ist rot Und bei Katzen? reflektierende Schicht 2 Warum sind in der Nacht alle Katzen


Nachweis der adaptiven Antwort nach Bestrahlung von Schilddrüsenzellen mit offenen Radionukliden

Nachweis der adaptiven Antwort nach Bestrahlung von Schilddrüsenzellen mit offenen Radionukliden Nachweis der adaptiven Antwort nach Bestrahlung von Schilddrüsenzellen mit offenen Radionukliden Dissertation Zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) vorgelegt der


Faktenblatt: Traditionelle Chinesische Medizin. (Siehe auch: Mind-Body-Therapien und Medizinische Pilze) Methode/Substanz

Faktenblatt: Traditionelle Chinesische Medizin. (Siehe auch: Mind-Body-Therapien und Medizinische Pilze) Methode/Substanz Faktenblatt: Traditionelle Chinesische Medizin Mai 2015 Verantwortlich: PD Dr. J. Hübner, Prof. K. Münstedt, Prof. O. Micke, PD Dr. R. Mücke, Prof. F.J. Prott, Prof. J. Büntzel, Prof. V. Hanf, Dr. C. Stoll


Elektrosmog, Handys, Solarien etc.

Elektrosmog, Handys, Solarien etc. Elektrosmog, Handys, Solarien etc. Gesundheitsrisiken durch nichtionisierende Strahlen R. Matthes Bundesamt für Strahlenschutz www.bfs.de Inhalt Nichtionisierende Strahlung Mobilfunktechnik Gesundheitliche


Multimodale Therapiekonzepte in der Radioonkologie des fortgeschrittenen Rektumkarzinoms: Funktions- und Organerhalt, ist weniger mehr?

Multimodale Therapiekonzepte in der Radioonkologie des fortgeschrittenen Rektumkarzinoms: Funktions- und Organerhalt, ist weniger mehr? Klinik und Poliklinik für Radioonkologie und Strahlentherapie Multimodale Therapiekonzepte in der Radioonkologie des fortgeschrittenen Rektumkarzinoms: Funktions- und Organerhalt, ist weniger mehr? Prof.


Medienart: Print Medientyp: Publikumszeitschriften Auflage: 312'871 Erscheinungsweise: 26x jährlich

Medienart: Print Medientyp: Publikumszeitschriften Auflage: 312'871 Erscheinungsweise: 26x jährlich Ausschnitt Seite: 1/10 Bericht Seite: 8/28 Datum: 28.05.2010 Ausschnitt Seite: 2/10 Bericht Seite: 9/28 Datum: 28.05.2010 Ausschnitt Seite: 3/10 Bericht Seite: 10/28 Datum: 28.05.2010 Ausschnitt Seite:


Empfehlungen der Projektgruppe Mammakarzinom am Tumorzentrum Bonn

Empfehlungen der Projektgruppe Mammakarzinom am Tumorzentrum Bonn Empfehlungen der Projektgruppe Mammakarzinom am Tumorzentrum Bonn zum Einsatz der Sentinel-Technik bei der Behandlung des Mammakarzinoms September 2006 Diese Konsensusempfehlung wurde durch folgende Mitglieder


3.1 Das kognitive Modell 45 3.2 Annahmen 47 3.3 Der Zusammenhang zwischen Verhalten und automatischen Gedanken 51

3.1 Das kognitive Modell 45 3.2 Annahmen 47 3.3 Der Zusammenhang zwischen Verhalten und automatischen Gedanken 51 http://www.beltz.de/de/nc/verlagsgruppe-beltz/gesamtprogramm.html?isbn=978-3-621-27955-0 Inhaltsverzeichnis Vorwort 12 1 Einführung in die Kognitive Verhaltenstherapie 15 1.1 Was ist Kognitive Verhaltenstherapie?


Vergleich der Strahlensensitivität von Zellen aus oralen Plattenepithelkarzinomen und gesunder Mundschleimhaut

Vergleich der Strahlensensitivität von Zellen aus oralen Plattenepithelkarzinomen und gesunder Mundschleimhaut Aus der Strahlenklinik der Friedrich-Alexander-Universität Erlangen-Nürnberg Direktor: Prof. Dr. R. Fietkau Vergleich der Strahlensensitivität von Zellen aus oralen Plattenepithelkarzinomen und gesunder


Erythrozyten-Verformbarkeit und Training

Erythrozyten-Verformbarkeit und Training Forschungskolloquium Erythrozyten-Verformbarkeit und Training Dr. Marijke Grau Verformbarkeit Fähigkeit des Erythrozyten seine Form den dynamischen Bedingungen des Blutflusses anzupassen Kapillarpassage


Eigenschaften der Röntgenstrahlen

Eigenschaften der Röntgenstrahlen Physikalische Grundlagen der Röntgentechnik und Sonographie Eigenschaften der Röntgenstrahlen PD Dr. Frank Zöllner Computer Assisted Clinical Medicine Faculty of Medicine Mannheim University of Heidelberg


Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt


Informationsgehalt von Messungen von IR-Bildsensor und FTIR Spektrometer für die Bestimmung von CO2 und CO Säulengehalten über Vegetationsfeuern

Informationsgehalt von Messungen von IR-Bildsensor und FTIR Spektrometer für die Bestimmung von CO2 und CO Säulengehalten über Vegetationsfeuern Informationsgehalt von Messungen von IR-Bildsensor und FTIR Spektrometer für die Bestimmung von CO2 und CO Säulengehalten über Vegetationsfeuern M.HESS, F.SCHREIER und A.DOICU Institut für Methodik der


Identification of microrna-mrna functional interactions in UVB-induced senescence of human diploid fibroblasts

Identification of microrna-mrna functional interactions in UVB-induced senescence of human diploid fibroblasts Identification of microrna-mrna functional interactions in UVB-induced senescence of human diploid fibroblasts Ruth Greussing, Matthias Hackl, Pornpimol Charoentong, Alexander Pauck, Rossella Monteforte,


Onkologischer Arbeitskreis Mittelhessen e.v. www.krebs-in-hessen.de

Onkologischer Arbeitskreis Mittelhessen e.v. www.krebs-in-hessen.de Strahlentherapie Die Strahlentherapie gehört neben Operation und Chemotherapie zu den 3 Säulen der Krebstherapie. Diese drei Therapieoptionen werden heute in exakter Abstimmung und enger Zusammenarbeit


Hautkrebs! Welches Risiko haben Sie?

Hautkrebs! Welches Risiko haben Sie? Hautkrebs! Welches Risiko haben Sie? Liebe Patientin, lieber Patient, mit den folgenden Fragen können Sie Hinweise darüber erhalten, ob Sie ein besonderes Risiko für eine Hautkrebserkrankung haben. Wenn


Medizin für Nichtmediziner: Tumore der Haut

Medizin für Nichtmediziner: Tumore der Haut Brennpunkt Haut was wollen wir uns als Gesellschaft leisten? Medizin für Nichtmediziner: Tumore der Haut Rudolf A. Herbst HELIOS Hauttumorzentrum Erfurt IGES Berlin 29. Juni 2011 Tumore der Haut - Überblick


UV-Strahlung auf den Menschen

UV-Strahlung auf den Menschen UV-Strahlung auf den Menschen Von Michaela, Alisha, Cindy und Dilba Einleitung: Immer wenn man ein Sonnenbad nehmen möchte, sollte man sich vorerst mit Sonnencreme eincremen. Doch warum machen wir das


Strahlenquellen. Strahlenarten. Ultraviolett (UV) Licht / Wärme (IR) Laser. Röntgenstrahlung. Radioaktivität. Elektromagnetische Felder (EMF), HF, NF

Strahlenquellen. Strahlenarten. Ultraviolett (UV) Licht / Wärme (IR) Laser. Röntgenstrahlung. Radioaktivität. Elektromagnetische Felder (EMF), HF, NF Strahlenarten Radioaktivität α - Strahlung β - Strahlung Röntgenstrahlung γ - Strahlung Ultraviolett (UV) Licht / Wärme (IR) Laser Handy Elektromagnetische Felder (EMF), HF, NF Photonenstrahlung Korpuskularstrahlung



Patienteninformation AML 97 (OSHO-Protokoll #45) Rolle der allogenen Stammzelltransplantation (SCT) im Vergleich zu einer zweiten Konsolidierung auf das leukämiefreie Überleben (LFS) von Patienten über 60 Jahre in kompletter


Alzheimer Demenz. Demenz - Definition. - Neueste Forschungsergebnisse - Neuropathologie der Demenz n=1050. Alzheimer Krankheit: Neuropathologie

Alzheimer Demenz. Demenz - Definition. - Neueste Forschungsergebnisse - Neuropathologie der Demenz n=1050. Alzheimer Krankheit: Neuropathologie Demenz - Definition Alzheimer Demenz - Neueste Forschungsergebnisse - Beeinträchtigung von geistigen (kognitiven) Funktionen (z.b. Gedächtnis, Sprache, Orientierung) dadurch bedingte deutliche Beeinträchtigung


Adjuvante und neoadjuvante Therapie des Pankreaskarzinoms

Adjuvante und neoadjuvante Therapie des Pankreaskarzinoms Pankreaszentrum München Adjuvante und neoadjuvante Therapie des Pankreaskarzinoms Axel Kleespies Chirurgische Klinik und Poliklinik - Campus Großhadern und Campus Innenstadt Klinikum der Universität München


Compliance: Drei Mal täglich nach dem Essen?

Compliance: Drei Mal täglich nach dem Essen? Compliance: Drei Mal täglich nach dem Essen? 3. TK-Zukunftskongress, Berlin, 22. Februar 2011 Dr. Frank Verheyen, Wissenschaftliches Institut der TK für Nutzen und Effizienz im Gesundheitswesen WINEG 1


Innovationen der Medizintechnik

Innovationen der Medizintechnik Innovationen der Medizintechnik Verbesserte Früherkennung und Therapie- Kontrolle durch nuklearmed. Verfahren Winfried Brenner Klinik für Nuklearmedizin Innovation Nutzen Kosten Innovationen verbesserte


Protokoll. Farben und Spektren. Thomas Altendorfer 9956153

Protokoll. Farben und Spektren. Thomas Altendorfer 9956153 Protokoll Farben und Spektren Thomas Altendorfer 9956153 1 Inhaltsverzeichnis Einleitung Ziele, Vorwissen 3 Theoretische Grundlagen 3-6 Versuche 1.) 3 D Würfel 7 2.) Additive Farbmischung 8 3.) Haus 9


Diagnose und Therapie

Diagnose und Therapie Brustkrebs Diagnose und Therapie Seminar Untermarchtal 01 Wie entsteht Brustkrebs? Die gesunde weibliche Brustdrüse (Mamma) besteht aus Drüsengewebe, Fett und Bindegewebe. Das Drüsengewebe ist aus Drüsenläppchen


Einfluss von einem Computerspiel auf Depression, Angststörungen und Schmerzen bei stationären Patienten: rct. Institut für Physiotherapie

Einfluss von einem Computerspiel auf Depression, Angststörungen und Schmerzen bei stationären Patienten: rct. Institut für Physiotherapie Einfluss von einem Computerspiel auf Depression, Angststörungen und Schmerzen bei stationären Patienten: rct Institut für Physiotherapie Der rote Faden Wie ist die epidemiologische Datenlage? Nehmen psychische


Komplexität der oralen Tumortherapie. Justyna Rawluk 11.11.2015

Komplexität der oralen Tumortherapie. Justyna Rawluk 11.11.2015 Komplexität der oralen Tumortherapie Justyna Rawluk 11.11.2015 Orale Tumortherapie Bessere Kentnisse der molekulargenetischen Biologie des Tumors => Entdeckung der zahlreichen molekularen therapeutischen


EGF-R-Familie als Target für zytotoxische T-Lymphozyten. Helga Bernhard

EGF-R-Familie als Target für zytotoxische T-Lymphozyten. Helga Bernhard EGF-R-Familie als Target für zytotoxische T-Lymphozyten Helga Bernhard Adoptiver Transfer von HER2-spezifischen T-Zellen zur Therapie des HER2-positiven Mammakarzinoms Patientin mit HER2 + Mammakarzinom


Auswirkungen der vierten Novelle des Medizinproduktegesetzes auf Wissensbasierte

Auswirkungen der vierten Novelle des Medizinproduktegesetzes auf Wissensbasierte Wissensbasierte Entscheidungsunterstützung zwischen Forschung und Medizinprodukt Auswirkungen der vierten Novelle des Medizinproduktegesetzes auf Wissensbasierte Systeme in der Medizin Wilfried Honekamp


Direktnachweis mit Agglutination nicht mehr üblich Direktnachweis von Toxinen auf Zellkultur nur für Forschung

Direktnachweis mit Agglutination nicht mehr üblich Direktnachweis von Toxinen auf Zellkultur nur für Forschung Konventioneller Nachweis der Bakterien in Patientenmaterial Gram-Präparat von Direktpräparat Normalflora berücksichtigen, z.b. bei Sputum Beispiele von Hinweis auf Erreger im Gram-Präparat Prinzip der


Station 1. Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese

Station 1. Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese Station 1 Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese 1 I. Vorinformationen An der GSI wurde eine weltweit neuartige Krebstherapie mit Ionenstrahlen entwickelt. Dazu werden in


IGV Sport als Therapie

IGV Sport als Therapie IGV Sport als Therapie Training Motivation IGV-Vertrag Motivation TK Rekrutierung Coaching Motivation Ambulante Rehazentren Klinikum Rechts der Isar TU-München Anamnese Planung Motivation Supervision 2


Behandlung mit Mistelextrakten Mistelpräparate in der Evidenz basierten Medizin

Behandlung mit Mistelextrakten Mistelpräparate in der Evidenz basierten Medizin Behandlung mit Mistelextrakten Mistelpräparate in der Evidenz basierten Medizin Berlin (25. März 2006) - Die Behandlung mit Mistelextrakten wie Iscador ist ein fester Bestandteil der Krebstherapie. Mistelpräparate


3.9 Brustdrüse der Frau

3.9 Brustdrüse der Frau ICD-10 C50 Ergebnisse zur 77 3.9 Brustdrüse der Frau Kernaussagen Inzidenz und Mortalität: Die altersstandardisierte Inzidenz von Krebserkrankungen der weiblichen Brustdrüse (Mammakarzinom) ist seit den


Autismus. autism spectrum disorders

Autismus. autism spectrum disorders Autismus autism spectrum disorders Index Was ist Autismus? Wissenschaftliche Grundlagen Phelan-McDermid-Syndrome (PMDS) Pharmakologische Tests Zusammenfassung Schlussfolgerungen Methoden Elektrophysiologische


Strahlenwirkung und Strahlenschutz. Medizintechnik Bildgebende Verfahren

Strahlenwirkung und Strahlenschutz. Medizintechnik Bildgebende Verfahren Strahlenwirkung und Strahlenschutz Medizintechnik Bildgebende Verfahren Die Deutsche Röntgen-Gesellschaft hat festgestellt, dass die Hälfte der Röntgenaufnahmen in Deutschland überflüssig ist. aus: Strahlenthemen,


Der Typ 2 Diabetiker mit arterieller Hypertonie. 1. zu spät gehandelt. 2. zu spät behandelt. 3. zu ineffektiv therapiert.

Der Typ 2 Diabetiker mit arterieller Hypertonie. 1. zu spät gehandelt. 2. zu spät behandelt. 3. zu ineffektiv therapiert. 1. zu spät gehandelt 2. zu spät behandelt 3. zu ineffektiv therapiert Torsten Schwalm Häufige Koinzidenz, Problemstellung - gemeinsame pathogenetische Grundlagen - Diabetiker sind 3 x häufiger hyperton


Molekulare Diagnostik in der Zytologie

Molekulare Diagnostik in der Zytologie Molekulare Diagnostik in der Zytologie Nicole Pawlaczyk Karsten Neumann Institut für Pathologie Pneumologische Onkologie Lungenkarzinom häufigste krebsbedingte Todesursache für beide Geschlechter dritthäufigste


Beantwortung der Anfrage

Beantwortung der Anfrage Nr. 649 der Beilagen zum stenographischen Protokoll des Salzburger Landtages (3. Session der 15. Gesetzgebungsperiode) Beantwortung der Anfrage der Abg. Klubobmann Naderer, Fürhapter und Konrad MBA an


Stammzellentransplantation als mögliche Heilungsmethode für Leukämie

Stammzellentransplantation als mögliche Heilungsmethode für Leukämie Stammzellentransplantation als mögliche Heilungsmethode für Leukämie Facharbeit im Fach : Biologie Name : Hamda Datum : 13.03.2005 - 3 - Inhaltsverzeichnis 1. Vorwort Seite 3 2. Einleitung Seite 3 3. Was


Neoadjuvante Therapie beim NSCLC im Stadium IIIA was ist möglich?

Neoadjuvante Therapie beim NSCLC im Stadium IIIA was ist möglich? Neoadjuvante Therapie beim NSCLC im Stadium IIIA was ist möglich? Dirk Behringer AugustaKrankenAnstalt, Bochum Thoraxzentrum Ruhrgebiet ExpertenTreffen Lungenkarzinom 26. November 2010, Düsseldorf NSCLC


Computer Graphik II Tesselierung impliziter Kurven und Flächen

Computer Graphik II Tesselierung impliziter Kurven und Flächen Computer Graphik II impliziter Kurven und Flächen 1 impliziter Flächen Problem: Nullstellenmenge kann nicht explizit berechnet werden! Lösung: ApproximaCon der Fläche auf Zellen Beispiel 2D: f p ( )


Plate Test) Opioid-Rezeptor Bindung in. ex vivo Audioradiographie mit μ- Ligand ([3H]DAMGO. Autoradiography)

Plate Test) Opioid-Rezeptor Bindung in. ex vivo Audioradiographie mit μ- Ligand ([3H]DAMGO. Autoradiography) Tabelle: Tierstudien zum Effekt von Schlafdeprivation auf die Schmerzwahrnehmung Tierstudien Autor Tiere Behandlung a Maße Ergebnisse Nascimento Wistar Kontrolle vs. REM-SD über 4 Tage Schmerzschwellen


(neo)adjuvantetherapie des kolorektalen Karzinoms

(neo)adjuvantetherapie des kolorektalen Karzinoms (neo)adjuvantetherapie des kolorektalen Karzinoms C. Salat/OJ. Stötzer Hämato-Onkologische Schwerpunktpraxis Chirurgie Chemotherapie Strahlentherapie Immuntherapie zielgerichtete Therapie Hyperthermie


Die Relative Biologische Wirksamkeit

Die Relative Biologische Wirksamkeit 047_052_isb_akt.qxd 14.05.2004 8:56 Uhr Seite 47 Relative Biologische Wirksamkeit von CASTOR-Neutronen am Beispiel von Chromosomenaberrationen in menschlichen Lymphozyten Relative biological effectiveness


Stand der IMRT-QA an der Uni Heidelberg

Stand der IMRT-QA an der Uni Heidelberg Stand der IMRT-QA an der Uni Heidelberg Karl-Heinz Grosser, Oliver Schramm, Gerald Major Abteilung für Radioonkologie und Strahlentherapie Im Neuenheimer Feld 400 69120 Heidelberg karlheinz_grosser@med.uni-heidelberg.de


LUMIMAX Beleuchtungsworkshop. iim AG 19.03.2015

LUMIMAX Beleuchtungsworkshop. iim AG 19.03.2015 LUMIMAX Beleuchtungsworkshop iim AG 19.03.2015 Bedeutung der Beleuchtung Der Einfluss der Beleuchtung auf die Bildverarbeitungslösung wird häufig unterschätzt. Jede BV-Applikation benötigt ein optimales


Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel. Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar

Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel. Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar Rejektion Hartono et al., 2009 Seite 2 Untersuchungsmaterial Nierengewebe
