Fischotter-Monitoring mittels DNA- Profilen aus Kotproben und Fang- Wiederfang-Analyse

Save this PDF as:

Größe: px
Ab Seite anzeigen:

Download "Fischotter-Monitoring mittels DNA- Profilen aus Kotproben und Fang- Wiederfang-Analyse"


1 Fischotter-Monitoring mittels DNA- Profilen aus Kotproben und Fang- Wiederfang-Analyse Dr. Beate Kalz Institut für Zoo und Wildtierforschung Berlin

2 Bedarf an Otter-Forschung? FFH Richtlinie: Anhang II (Tieru. Pflanzenarten von gemeinschaftlichem Interesse, für die besondere Schutzgebiete ausgewiesen werden müssen) und Anhang IV (streng zu schützende Tier- u. Pflanzenarten von gemeinschaftlichem Interesse) Rote Liste der gefährdeten Tierarten Deutschlands: Kategorie 1 (vom Aussterben bedroht)

3 Bestandsermittlung Für den Fischotter gibt es derzeit keine wissenschaftlich anwendbare Methode zur Ermittlung der Populations-/Bestandsgröße....Deshalb wird die Verbreitungsfeststellung auf Vorschlag der IUCN-Otter-specialist-group genutzt: das 10x10km UTM-Raster wird als Basis für Stichprobenpunkte über den Bezugsraum gelegt; letztere sind 1x auf Anwesenheit (als Nachweis gewertet werden ausschließlich Losung und Trittsiegel) des Fischotters zu prüfen (REUTHER et al. 2000). Diese Erhebung ist in einem 5-6 jährigen Rhythmus zu wiederholen.

4 Warum Bestandsermittlung? Bestandsentwicklung häufig umstritten z.z. gleichzeitig Indizien für Ausbreitung und Rückgang in mehreren Ländern recht plötzlich ausgestorben fehlende harte Daten können rechtzeitige Reaktion bei Rückgang verhindern Berücksichtigung bei Baumaßnahmen geringer Effizienz von Schutzmaßnahmen nicht optimal

5 Probleme der Otter-Forschung Optische Differenzierung kaum möglich Sehr variables Verhalten Ungeeignet für die meisten wildbiologischen Methoden (Direktbeobachtungen, Telemetrie) Untersuchungen am Einzeltier schwierig Individualerkennung ist Grundlage jeder Zählung

6 Individualerkennung Kombination mehrerer Merkmale nötig Otter unter Feldbedingungen mittels phänotypischer Merkmale nicht unterscheidbar -> Verwendung genotypischer Merkmale

7 Genotypische Merkmale Verwendung von DNA-Abschnitten, die keinem Selektionsdruck unterliegen (repetitive Sequenzen nicht-codierender Bereiche) hohe Variabilität Jedes Merkmal kann in unterschiedlichen Ausprägungen vorliegen (Allele) Allele werden chromosomal vererbt (je 1 von Mutter und Vater) -> verwendbar für Verwandtschaftsanalyse

8 DNA-Analysen aus Kotproben nicht-invasive Methode Kotproben sind relativ leicht zu finden werden an exponierten Stellen deponiert Basis für innerartliche Kommunikation? Extraktion von DNA- Material aus Kotproben PCR PCR (Polymerase-Kettenreaktion) Erhitzen (Denaturieren) Anlagerung der Primer DNS-Synthese mittels Taq-Polymerase (Primer-Verläng.) ATCGCATCGTGACGGTCAGTCAG TAGCGTAGCACTGCCAGTCAGTC doppelsträngige DNS Bereich, der vermehrt werden soll einzelsträngige DNS Primer bildet mit Ziel-DNS kurzen Doppelstrang aus aus einem Doppelstrang sind zwei identische Doppelstränge entstanden Primer

9 DNA-Profile homozygous alleles 126 bp / 126 bp heterozygous alleles 120 bp / 128 bp heterozygous alleles 126 bp / 128 bp Nr. Primer 1 Primer 2 Primer 3 Primer 4 Primer 5 Primer 6 Indiv. Fundort Bearbeiter Datum / / / / / / Arnds / / / / / / Arnds / / / / / / Mahnke / / / / / / Arnds / / / / / / Koch / / / / / / Koch / / / / / / Erlebach / / / / / / Koch

10 Fehlerdiskussion Überschätzung der Tierzahl bzw. Populationsgröße (overestimation) Fehler bei der Erstellung des DNA-Profils ( Geister -Allele) -> Proben des gleichen Tieres mehreren Tieren zugeordnet Gehegeuntersuchungen, Plausibilitätskontrolle Unterschätzung der Tierzahl bzw. Populationsgröße (underestimation) nicht-markierende Tiere, nicht gefundene Markierungen zwei Tiere mit gleichem DNA-Profil (z.b. Zwillinge) DNA-Profile von zwei Tieren mit geringem Unterschied falsch zusammengefasst

11 Populationsdichte im NP NSH 1 Tier pro 611,7 ha Gesamtfläche 1 Tier pro 77,2 ha Wasserfläche 1 Tier pro 4,7 km Uferlänge mehr als 2,5 mal so hoch wie vorher geschätzt (Behl & Korzetz 1999) entspricht den Angaben von Erlinge (1968) nach der Analyse von Fußspuren und Kot Kruuk (1995) fand in Schottland 1 Otter pro 1,2 km Küste Hung et al. (2004) fanden 1 Tier pro 0,7 km Uferlänge an zwei verschiedenen Flüssen auf der Insel Kinmen bei China

12 Ergebnisse der ersten 12 Monate 59 verschiedene Individuen wurden ermittelt (6 Totfunde, 53 DNA-Profile aus Kotproben) 35 Otter waren miteinander 1. Grades verwandt (Eltern- Kind-Kombinationen), 14 Tiere hatten keine verwandten Tiere im Gebiet (bei 10 Tieren waren die DNA-Profile unvollständig und deshalb keine Analyse möglich)

13 Verwandtschaftsanalyse Ermittlung potentiell verwandter Tiere nur Verwandtschaft 1. Grades (Eltern Kinder) ohne Altersangaben keine Familienstrukturen Anzahl potentieller Verwandter erlaubt Aussagen über genetische Verankerung in der Population 2 Tiere sind potentiell verwandt, wenn sie je Primer (= Merkmal) mindestens 1 Allel teilen Nr. Primer 1 Primer 2 Primer 3 Primer 4 Primer 5 Primer 6 Indiv. Fundort / / / / / /167 Fe / / / / / /171 Ma / / / / / /167 Ju

14 Geschlechtsbestimmung Genetische Geschlechtsbestimmung mit SRY-Marker Lut74 (Dallas et al. 2000) -> männliche Tiere erkennbar, da nur sie das Y-Chromosom haben Hormon-Analyse durch Messung der Konzentration von männlichen und weiblichen Geschlechtshormonen in Kotproben -> Geschlecht und Reproduktionsstatus von adulten Tieren

15 Raumnutzung (Tier 37) Goldberger See 6.01 Junges Männchen Damerower See ,0 km ,0 km ,3 km ,3 km ,3 km ,7 km ,8 km ,4 km km

16 Verteilung der Tiere im Raum

17 Populationsstruktur (1. Jahr) A C D B F E

18 Fang-Wiederfang-Analyse Methode zur Ermittlung exakter Populationsgrößen durch Bestimmung der Relation von markierten und unmarkierten Tieren ursprünglich entwickelt für kleine, leicht zu fangende Tierarten Anwendung für DNA-Profile möglich der Erstnachweis eines Tieres entspricht einem Fang, der erneute Nachweis einem Wiederfang

19 Voraussetzungen Es müssen bestimmte Annahmen (mindestens näherungsweise) erfüllt sein: Die Fangwahrscheinlichkeit variiert nicht individuell. In jedem Fangintervall ist die Fangwahrscheinlichkeit für jedes Individuum gleich groß. Markierungen werden weder verloren noch übersehen. Die Markierung hat keinen Einfluss auf das Überleben. Die Markierung hat keinen Einfluss auf die Fangwahrscheinlichkeit des Individuums. Die markierten Individuen mischen sich vollständig unter die unmarkierten.

20 Populationstypen geschlossene Population kurze Fangintervalle d.h. keine / sehr wenige Zu- und Abwanderung, Geburten und Todesfälle Länge des Fangintervalls abhängig von der Biologie der untersuchten Art offene Populationen lange Fangintervalle, in denen Zuund Abwanderung, Geburten und Todesfälle stattfinden ermöglicht Ermittlung von Überlebensraten Vielzahl verschiedener statistischer Modelle etabliert, bei denen jeweils ein Teil der Grundannahmen nicht erfüllt sein muss (z.b. CAPTURE, MARK) Kombination zweier Modelle: kurze Fangintervalle werden (möglichst mehrfach) wiederholt ( robuster Versuchsplan )

21 Fang-Wiederfang-Methode im NP NSH Ergebnis: 43 Tiere pro Monat anwesend, davon 34 konstant anwesend ( residents ) und im Durchschnitt 9 nur kurzzeitig da ( transients ) kleines Konfidenzintervall (= hohe Präzision der Schätzung) Zahl der dauerhaft anwesenden Tiere (34 residents) entspricht in der Größenordnung der ermittelten Zahl miteinander verwandter Fischotter (35 Tiere)

22 Schlussfolgerungen Methode erlaubt Ermittlung von (im Untersuchungszeitraum) ortsansässigen und wandernden Tieren und die Schätzung der Bleiberate (= Überlebensrate ) ermittelte Tierzahl nicht notwendig exakt richtig, (im Gehege Allelfehler ± 7,8 %, Tierzahl richtig bestimmt) Populationsdichte entspricht der mit anderen Methoden (Sichtbeobachtungen, Funkortung) ermittelten, d.h. Größenordnung korrekt zu wenig Informationen über Markierungsverhalten im Freiland, -> es besteht Forschungsbedarf Unterschätzung wahrscheinlicher als Überschätzung, da mehr Fehlerquellen, auch abhängig von Anzahl verwendeter Primer Fehler kann vernachlässigt werden bei Vergleichsuntersuchungen unter gleichen Bedingungen

23 Monitoring mit DNA-Profilen Anwendung Vergleich der Otterzahl und Populationsstruktur eines Gebietes im Zeitverlauf -> Entwicklung einer Population bei Auswahl geeigneter Gebiete kann die Entwicklung der Otterpopulation ganzer Regionen untersucht werden Vergleich von mehreren Lebensräumen z.b. vor Ausweisung von Schutzgebieten und Bauprojekten

24 Vorschlag für Arbeitsplan in neuen Gebieten vorab potentielle Markierungsstellen und Anzahl auffindbarer frischer Proben ermitteln Festlegung von 2-3 Sammelintervallen Modellrechnung: Population von 35 Tieren, benötigt werden 45 DNA-Profile, Erfolgsquote 23 %, 200 Proben müssen je Intervall gesammelt werden (z.b. sollte im NP NSH 2x ca. 4 Wochen lang gesammelt werden) günstigste Zeit: September bis März bei Vergleich mehrerer Gebiete gleiche Bedingungen einhalten, eventuell abwechselnde Beprobung bei Langzeitprojekten gleichen Zeitraum verwenden Auswertung: Kombination von Ermittlung der potentiellen genetischen Verwandten und Fang-Wiederfang-Analyse

25 Kooperationspartner und Sponsoren Staatliches Amt für Umwelt und Natur Lübz Institut für Zoo- und Wildtierforschung

26 The end

Zählmethode Rotwild Genotypisierung - Anwendung und Aussagekraft für die Erfassung von Schalenwildpopulationen

Zählmethode Rotwild Genotypisierung - Anwendung und Aussagekraft für die Erfassung von Schalenwildpopulationen Neue Scheinwerferzählung, Zählmethode Rotwild Befliegung und Genotypisierung - Anwendung und Aussagekraft für die Erfassung von Schalenwildpopulationen Treffen Forstamt Burkhart Stöcker Dr. Ulf Hohmann


Abschlußbericht. für das Projekt 31.07.2005

Abschlußbericht. für das Projekt 31.07.2005 31.07.2005 Abschlußbericht für das Projekt Untersuchungen an freilebenden Fischottern im Naturpark Nossentiner / chwinzer Heide (Mecklenburg-Vorpommern): Individualerkennung mittels DNA-Analyse aus Kotproben


Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst

Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst Überblick Einleitung und Zielstellung Was ist ein Marker? Analyse mit Mikrosatelliten-Markern


Bei Einbeziehung von neun Allelen in den Vergleich ergibt sich eine Mutation in 38 Generationen (350:9); das entspricht ca. 770 Jahren.

Bei Einbeziehung von neun Allelen in den Vergleich ergibt sich eine Mutation in 38 Generationen (350:9); das entspricht ca. 770 Jahren. 336 DNA Genealogie Das Muster genetischer Variationen im Erbgut einer Person - zu gleichen Teilen von Mutter und Vater ererbt - definiert seine genetische Identität unveränderlich. Neben seiner Identität


PCR-ELISA. Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke

PCR-ELISA. Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke PCR-ELISA Eine Methode zur Pathogendiagnose und zur Ermittlung der Befallsstärke Luitgardis Seigner und Stefan Knabel * Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz * Ehemaliger


ID-Labor GmbH. Der genetische Fingerabdruck und Abstammungsuntersuchungen

ID-Labor GmbH. Der genetische Fingerabdruck und Abstammungsuntersuchungen Der genetische Fingerabdruck und Abstammungsuntersuchungen Genetischer Fingerabdruck Grundlagen DNA-Analyse Gen-Analyse: untersuchte DNA-Bereiche: Short Tandem Repeats (STR), nicht-codierende Regionen


Molekulare Spurenanalytik und Abstammungsbegutachtung. Dr. rer. nat. Micaela Poetsch, Institut für Rechtsmedizin, Universitätsklinikum Essen

Molekulare Spurenanalytik und Abstammungsbegutachtung. Dr. rer. nat. Micaela Poetsch, Institut für Rechtsmedizin, Universitätsklinikum Essen Molekulare Spurenanalytik und Abstammungsbegutachtung Spurenanalytik Ziel: Identifikation Also die Zuordnung einer bestimmten Spur zu einer bestimmten Person! Denn Spuren bei einer forensischen Untersuchung


Abitur - Grundkurs Mathematik. Sachsen-Anhalt 2002. Gebiet G1 - Analysis

Abitur - Grundkurs Mathematik. Sachsen-Anhalt 2002. Gebiet G1 - Analysis Abitur - Grundkurs Mathematik Sachsen-Anhalt Gebiet G - Analsis Aufgabe.. Der Graph einer ganzrationalen Funktion f dritten Grades mit einer Funktionsgleichung der Form f a b c d a,b,c,d, R schneidet die


Foto: Kate Whitley,

Foto: Kate Whitley, Foto: Kate Whitley, Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische


VDI-Kompetenzfeld Biotechnologie

VDI-Kompetenzfeld Biotechnologie VDI-Kompetenzfeld Die europäische Richtlinie über die absichtliche Freisetzung gentechnisch veränderter Organismen in die Umwelt (2001/18/EG) sowie deren Umsetzung in das deutsche Gentechnikrecht fordern


Fachtagung Otter & Fischerei in Mitwitz 25.6.09. Projektziele

Fachtagung Otter & Fischerei in Mitwitz 25.6.09. Projektziele Fachtagung Otter & Fischerei in Mitwitz 25.6.09 Wildtier und Mensch im Dreiländereck Bayern-Tschechien-Österreich am Beispiel des Fischotters R. Schreiber, H. Bayerl, C. Ludt, M. Friedrich, N. Hahn Projektziele


l2l (Frage 1): Die Hardy-Weinberg-Gleichung wird häufig in der

l2l (Frage 1): Die Hardy-Weinberg-Gleichung wird häufig in der Maikelnummer: Seite 1 Semesterklausur,,Evol utionsbiologie" SeruesrERKLAUsu R zur Vonlesu NG,, Evol utions biolog ie" ws 2014t2015 Wiederholungsklausur EnlAurenuruc: Die Zahlen in eckigen Klammern vor


Fragen Sie Ihren Arzt/Ihrer Ärztin

Fragen Sie Ihren Arzt/Ihrer Ärztin Ein einfacher, sicherer Bluttest, der verlässliche Ergebnisse bietet Ein nicht-invasiver Test zur Bewertung des Risikos einer chromosomalen Erkrankung wie Down-Syndrom, der auch eine freiwillige Analyse


Der Wolf in Österreich

Der Wolf in Österreich Der Wolf in Österreich Rückeroberung eines Lebensraums und mögliche Auswirkungen Wolf, Luchs & Co. Dr. Georg Rauer Bärenanwalt und Wolfsbeauftragter Forschungsinstitut für Wildtierkunde und Ökologie 0664


Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher


Genetische Diversität der Zoopopulation des Waldrapp

Genetische Diversität der Zoopopulation des Waldrapp 1 Genetische Diversität der Zoopopulation des Waldrapp Der Waldrapp ist eine vom Aussterben bedrohte Ibisart. Kolonien sind nur noch in Marokko und der Türkei/Syrien zu finden. Die Art wird in Zoos gehalten,


FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom

FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom HAMBURG SCHOOL OF FOOD SCIENCE Institut für Lebensmittelchemie Universität Hamburg, AiF/


Einführung Laboratoire de Biologie de la Conservation

Einführung Laboratoire de Biologie de la Conservation Einführung Das 1999 gegründete Laboratoire de Biologie de la Conservation (LBC, Labor für Umweltschutzbiologie) ist eine Einheit des Departements für Ökologie und Evolution der Universität Lausanne, die


Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion


1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?


Voraussetzungen für die Genomische Selektion beim Pferd

Voraussetzungen für die Genomische Selektion beim Pferd Agrar- und Ernährungswissenschaftliche Fakultät Institut für Tierzucht und Tierhaltung Voraussetzungen für die Genomische Selektion beim Pferd Prof. Dr. Georg Thaller 32. Jahrestagung zur Pferdegesundheit


Vererbungsgesetze, Modell

Vererbungsgesetze, Modell R Vererbungsgesetze, Modell 65564.00 Betriebsanleitung Das Model besteht aus einem Satz von 204 Symbolkarten und 3 Kreuzungs- und Nachkommenslinien. 81 der Symbolkarten zeigen Erscheinungsbilder (Phänotypen),


Grundlagen der Vererbung beim Hund

Grundlagen der Vererbung beim Hund Grundlagen der Vererbung beim Hund Züchterstammtisch: 10. August 2013 Referentin: Diana Ringpfeil Tätigkeit: Tierärztin Mail: Referent: Kay Rostalski Diana Ringpfeil, Tierärztin, Kay


Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge


DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet


PCR basierte- Detektionstechniken

PCR basierte- Detektionstechniken PCR basierte- Detektionstechniken Warum überhaupt? Forensische Analysen: Vaterschaftstests, Kriminalistik Mikrobielle Gemeinschaften: Biofilme, medizinische Mikrobiologie 2 Warum überhaupt? minimale Mengen


Merkmal "Amelogenin" ist geschlechtsspezifisch, für eine zusätzliche Kontrolle des Ergebnisses.

Merkmal Amelogenin ist geschlechtsspezifisch, für eine zusätzliche Kontrolle des Ergebnisses. Vaterschaftstest 1. Methode Ausgangspunkt Ausgangspunkt der Untersuchung ist die Erstellung des genetischen Profils ("Fingerprints"), der bei jedem Mensch einzigartig ist. Hierfür werden sogenannte STR


Interne und externe Modellvalidität

Interne und externe Modellvalidität Interne und externe Modellvalidität Interne Modellvalidität ist gegeben, o wenn statistische Inferenz bzgl. der untersuchten Grundgesamtheit zulässig ist o KQ-Schätzer der Modellparameter u. Varianzschätzer


Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz Luitgardis Seigner Schaderregernachweis mit der Polymerase-Kettenreaktion (PCR) Schaderregernachweis mit der Polymerase- Kettenreaktion


Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign


Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP Informationsveranstaltung Heimtierfuttermittel PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln C. Haldemann, ALP Grundidee des Nachweises von GVOs mittels PCR Die Bestimmung genveränderter


5. Schließende Statistik. 5.1. Einführung

5. Schließende Statistik. 5.1. Einführung 5. Schließende Statistik 5.1. Einführung Sollen auf der Basis von empirischen Untersuchungen (Daten) Erkenntnisse gewonnen und Entscheidungen gefällt werden, sind die Methoden der Statistik einzusetzen.


q = 1 p = 0.8 0.2 k 0.8 10 k k = 0, 1,..., 10 1 1 0.8 2 + 10 0.2 0.8 + 10 9 1 2 0.22 1 = 0.8 8 [0.64 + 1.6 + 1.8] = 0.678

q = 1 p = 0.8 0.2 k 0.8 10 k k = 0, 1,..., 10 1 1 0.8 2 + 10 0.2 0.8 + 10 9 1 2 0.22 1 = 0.8 8 [0.64 + 1.6 + 1.8] = 0.678 Lösungsvorschläge zu Blatt 8 X binomialverteilt mit p = 0. und n = 10: a PX = = 10 q = 1 p = 0.8 0. 0.8 10 = 0, 1,..., 10 PX = PX = 0 + PX = 1 + PX = 10 10 = 0. 0 0.8 10 + 0. 1 0.8 9 + 0 1 10 = 0.8 8 [


Warum Windenergie im Wald? (4)

Warum Windenergie im Wald? (4) Warum Windenergie im Wald? (4) Moderne Anlagentechnik nutzt das Windpotenzial des Waldes und ermöglicht gute Stromerträge. 140m hoher Windmessmast hohe Bodenrauhigkeit Turbulenzen über dem Kronendach Im


Projektmanagement. Qualitätsmanagement. Version: 2.1 Stand: 12.05.2015

Projektmanagement. Qualitätsmanagement. Version: 2.1 Stand: 12.05.2015 Projektmanagement Qualitätsmanagement Version: 2.1 Stand: 12.05.2015 Lernziel Sie können die Ziele des Qualitätsmanagements in Projekten erläutern Sie können wichtige Begriffe des Qualitätsmanagements


Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens 6 Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens Von der Gemeinsamen Naturwissenschaftlichen Fakultät der Technischen Universität


Definition und Abgrenzung des Biodiversitätsschadens

Definition und Abgrenzung des Biodiversitätsschadens Fachtagung Schöner Schaden! Biodiversitätsschäden in der Umwelthaftungsrichtlinie Definition und Abgrenzung des Biodiversitätsschadens Universität für Bodenkultur Wien Department für Raum, Landschaft und


Grundlagen und Basisalgorithmus

Grundlagen und Basisalgorithmus Grundlagen und Basisalgorithmus Proseminar -Genetische Programmierung- Dezember 2001 David König Quelle: Kinnebrock W.: Optimierung mit genetischen und selektiven Algorithmen. München, Wien: Oldenbourg


Methoden-Wahl für den BVDV-Nachweis aus Ohrgewebeproben und Konsequenzen für die Praxis

Methoden-Wahl für den BVDV-Nachweis aus Ohrgewebeproben und Konsequenzen für die Praxis Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit Methoden-Wahl für den BVDV-Nachweis aus Ohrgewebeproben und Konsequenzen für die Praxis Christian, J., Kupča, A., Drdlicek, J., Bogner, K.


Statische Versuchsplanung (DoE - Design of Experiments)

Statische Versuchsplanung (DoE - Design of Experiments) Statische Versuchsplanung (DoE - Design of Experiments) Übersicht Bei der statistischen Versuchsplanung wird die Wirkung von Steuerparametern unter dem Einfluss von Störparametern untersucht. Mit Hilfe


Ökosysteme unter Druck: der Einfluss von Nährstoffen in Gewässern

Ökosysteme unter Druck: der Einfluss von Nährstoffen in Gewässern Ökosysteme unter Druck: der Einfluss von Nährstoffen in Gewässern Piet Spaak Eawag: Das Wasserforschungs-Institut des ETH-Bereichs Zu viel Phosphor verursacht Probleme in Seen 2 Zu viel Phosphor verursacht


Unterlagen für die Lehrkraft

Unterlagen für die Lehrkraft Ministerium für Bildung, Jugend und Sport Zentrale Prüfung zum Erwerb der Fachhochschulreife im Schuljahr 01/01 Mathematik. Juni 01 09:00 Uhr Unterlagen für die Lehrkraft 1. Aufgabe: Differentialrechnung


V_Sim - software to calculate inbreeding coefficients

V_Sim - software to calculate inbreeding coefficients V_Sim - software to calculate inbreeding coefficients Ein Programm zur Berechnung von Inzuchtkoeffizienten und Abstammungskoeffizienten. Von Holger Krause Zweck des Programms Der Verwandtschaft-Simulator


Orientierungsaufgaben für das ABITUR 2014 MATHEMATIK

Orientierungsaufgaben für das ABITUR 2014 MATHEMATIK Orientierungsaufgaben für das ABITUR 01 MATHEMATIK Im Auftrag des TMBWK erarbeitet von: Aufgabenkommission Mathematik Gymnasium, Fachberater Mathematik Gymnasium, CAS-Multiplikatoren Hinweise für die Lehrerinnen


Tierzüchtung. Anforderung des Marktes. Zuchtziel. Zuchtverfahren Leistungsprüfung

Tierzüchtung. Anforderung des Marktes. Zuchtziel. Zuchtverfahren Leistungsprüfung Tierzüchtung nforderung des Marktes Zuchtziel Zuchtverfahren Leistungsprüfung Selektion Verpaarung Populationsgenetik Rechentechnik Mathem. Statistik iotechnologie der Fortpflanzung -Züchtungstechniken


Bachelorabschlussseminar Dipl.-Kfm. Daniel Cracau

Bachelorabschlussseminar Dipl.-Kfm. Daniel Cracau 1 Einführung in die statistische Datenanalyse Bachelorabschlussseminar Dipl.-Kfm. Daniel Cracau 2 Gliederung 1.Grundlagen 2.Nicht-parametrische Tests a. Mann-Whitney-Wilcoxon-U Test b. Wilcoxon-Signed-Rank


JWG B3-35. Substation Earthing System Design Optimisation through the Application of Quantified Risk Analysis

JWG B3-35. Substation Earthing System Design Optimisation through the Application of Quantified Risk Analysis JWG B3-35 Substation Earthing System Design Optimisation through the Application of Quantified Risk Analysis Univ.-Prof. Dipl.-Ing. Dr. Lothar Fickert Institut für Elektrische Anlagen Technische Universität


Insiderwissen 2013. Hintergrund

Insiderwissen 2013. Hintergrund Insiderwissen 213 XING EVENTS mit der Eventmanagement-Software für Online Eventregistrierung &Ticketing amiando, hat es sich erneut zur Aufgabe gemacht zu analysieren, wie Eventveranstalter ihre Veranstaltungen


Bundesgesetz über die Verwendung von DNA-Profilen im Strafverfahren und zur Identifizierung von unbekannten oder vermissten Personen

Bundesgesetz über die Verwendung von DNA-Profilen im Strafverfahren und zur Identifizierung von unbekannten oder vermissten Personen Bundesgesetz über die Verwendung von DNA-Profilen im Strafverfahren und zur Identifizierung von unbekannten oder vermissten Personen (DNA-Profil-Gesetz) 363 vom 20. Juni 2003 (Stand am 1. Januar 2015)


ENERGIEAUSWEIS für Wohngebäude gemäß den 16 ff. Energieeinsparverordnung (EnEV)

ENERGIEAUSWEIS für Wohngebäude gemäß den 16 ff. Energieeinsparverordnung (EnEV) 60 Anhang 6 Muster Energieausweis Wohngebäude (zu den 18 und 19) ENERGIEAUSWEIS für Wohngebäude Gültig bis: 1 typ Adresse teil Baujahr Baujahr Anlagentechnik foto (freiwillig) Anzahl Wohnungen nutzfläche


PR Statistische Genetik und Bioinformatik

PR Statistische Genetik und Bioinformatik PR Statistische Genetik und Bioinformatik Johanna Bertl Institut für Statistik und OR, Universität Wien Oskar-Morgenstern-Platz 1/6.344, 1090 Wien, Tel.: 01-4277-38617,


Business Value Launch 2006

Business Value Launch 2006 Quantitative Methoden Inferenzstatistik alea iacta est 11.04.2008 Prof. Dr. Walter Hussy und David Tobinski UDE.EDUcation College im Rahmen des dokforums Universität Duisburg-Essen Inferenzstatistik Erläuterung


Was ist ein genetischer Fingerabdruck?

Was ist ein genetischer Fingerabdruck? Was ist ein genetischer Fingerabdruck? Genetischer Fingerabdruck od. DNA-Fingerprint ist ein molekularbiologisches Verfahren zur individuellen Identifizierung von Lebewesen Der genetische Fingerabdruck


Einführung in die Logistische Regression. Fortbildung zur 19.Informationstagung Tumordokumentation

Einführung in die Logistische Regression. Fortbildung zur 19.Informationstagung Tumordokumentation Einführung in die Logistische Regression Fortbildung zur 9.Informationstagung Tumordokumentation Bernd Schicke, Tumorzentrum Berlin FB Bayreuth, 29.März 20 Gliederung Einleitung Schätzen von Maßzahlen


Grundkurs Biologie Abitur 2010 Sachgebiet: Ökologie und Nachhaltigkeit Aufgabe: See-Elefanten

Grundkurs Biologie Abitur 2010 Sachgebiet: Ökologie und Nachhaltigkeit Aufgabe: See-Elefanten Grundkurs Biologie Abitur 2010 Sachgebiet: Ökologie und Nachhaltigkeit Aufgabe: See-Elefanten Schwerpunkt Konkurrenzvermeidung bei begrenzten Ressourcen Unterrichtliche Voraussetzungen gemäß Rahmenplan


Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia

Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Grundwissen Pränataldiagnostik 4 Grafik Pränataldiagnostiken 6 Die Produktefamilie 9 Robustheit von


Die Anwendung der Gentechnologie in der Rechtsmedizin

Die Anwendung der Gentechnologie in der Rechtsmedizin Mai 1998 Nr. 50 Der Verein «Forschung für Leben» informiert: Die Anwendung der Gentechnologie in der Rechtsmedizin Prof. Dr. med. Walter Bär Dr. phil. Adelgunde Kratzer Impressum Der Verein «Forschung


Eltern-Broschüre. Hinweise zum Umgang mit Nabelschnurrestblut in katholischen Krankenhäusern. caritas

Eltern-Broschüre. Hinweise zum Umgang mit Nabelschnurrestblut in katholischen Krankenhäusern. caritas Eltern-Broschüre Hinweise zum Umgang mit Nabelschnurrestblut in katholischen Krankenhäusern Katholischer Krankenhausverband der Diözese Osnabrück e.v. für die Diözese Osnabrück e.v. für die Diözese Münster


DNA-Fingerprint. (Syn. DNA Profiling)

DNA-Fingerprint. (Syn. DNA Profiling) DNA-Fingerprint (Syn. DNA Profiling) Dient dazu Individuen genetisch zu unterscheiden Dazu braucht man genetischen Polymorphismus (Bsp. Blutgruppen-Polymorphismus/Landsteiner). Als Polymorphismus ( Vielgestaltigkeit


Eine Einführung in R: Statistische Tests

Eine Einführung in R: Statistische Tests Eine Einführung in R: Statistische Tests Bernd Klaus, Verena Zuber Institut für Medizinische Informatik, Statistik und Epidemiologie (IMISE), Universität Leipzig zuber/teaching/ws12/r-kurs/


Programmiertechnik II

Programmiertechnik II Analyse von Algorithmen Algorithmenentwurf Algorithmen sind oft Teil einer größeren Anwendung operieren auf Daten der Anwendung, sollen aber unabhängig von konkreten Typen sein Darstellung der Algorithmen


Profil A 49,3 48,2 50,7 50,9 49,8 48,7 49,6 50,1 Profil B 51,8 49,6 53,2 51,1 51,1 53,4 50,7 50 51,5 51,7 48,8

Profil A 49,3 48,2 50,7 50,9 49,8 48,7 49,6 50,1 Profil B 51,8 49,6 53,2 51,1 51,1 53,4 50,7 50 51,5 51,7 48,8 1. Aufgabe: Eine Reifenfirma hat für Winterreifen unterschiedliche Profile entwickelt. Bei jeweils gleicher Geschwindigkeit und auch sonst gleichen Bedingungen wurden die Bremswirkungen gemessen. Die gemessenen


Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring. Elisabeth Haring Naturhistorisches Museum Wien

Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring. Elisabeth Haring Naturhistorisches Museum Wien Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring Elisabeth Haring Naturhistorisches Museum Wien Sieben Jahre genetisches Monitoring der niederösterreichisch-steirischen


Genetisch... Unterschied. DNA zu... 99,9% identisch

Genetisch... Unterschied. DNA zu... 99,9% identisch Genetisch... Unterschied DNA zu... 99,9% identisch Alle Menschen unterscheiden sich aus genetischer Sicht nur um 0,1% Die übrigen 99,9% sind exakt gleich, egal ob miteinander verwandt oder nicht. Diese


Borkenbild und genetische Muster bei der Weisstanne

Borkenbild und genetische Muster bei der Weisstanne Projekt Weisstanne 1 Borkenbild und genetische Muster bei der Weisstanne Zwischenstand Oktober 2013 Netzwerkveranstaltung der PROHOLZ Lignum Luzern Catherine Folly Felix Gugerli Eidg. Forschungsanstalt


Die Rolle von Krediten und Zahlungsrückständen bei Verschuldungssituationen

Die Rolle von Krediten und Zahlungsrückständen bei Verschuldungssituationen Eidgenössisches Departement des Innern EDI Bundesamt für Statistik BFS 20 Wirtschaftliche und soziale Situation der Bevölkerung Neuchâtel, Juni 2013 Die Rolle von Krediten und Zahlungsrückständen bei Verschuldungssituationen


Analyse der Riversurfcommunity im deutschsprachigen Raum. durch den. Rivermates Surfclub Salzkammergut

Analyse der Riversurfcommunity im deutschsprachigen Raum. durch den. Rivermates Surfclub Salzkammergut Analyse der Riversurfcommunity im deutschsprachigen Raum durch den Rivermates Surfclub Salzkammergut Inhaltsverzeichnis 1 Analyse der Riversurfcommunity im deutschsprachigen Raum... 3 2 Fragebogen... 4


Actinobacillus pleuropneumoniae Infektion, Verbesserung der Diagnostik

Actinobacillus pleuropneumoniae Infektion, Verbesserung der Diagnostik Actinobacillus pleuropneumoniae Infektion, Verbesserung der Diagnostik Dr. Sylvia Baier, LWK Niedersachsen, Schweinegesundheitsdienst, Dr. Jens Brackmann, LWK Niedersachsen, Institut für Tiergesundheit


Bebauungsplan XVI-81 Fürstenwalder Allee Ergebnisse der Zauneidechsenumsetzung 2014

Bebauungsplan XVI-81 Fürstenwalder Allee Ergebnisse der Zauneidechsenumsetzung 2014 Bebauungsplan XVI-81 Fürstenwalder Allee Ergebnisse der Zauneidechsenumsetzung 2014 Zauneidechsenmännchen gefangen am 2. Juni 2014 in Falle 37 Bebauungsplan XVI-81 Fürstenwalder Allee Ergebnisse der Zauneidechsenumsetzung


Ein molekularer Stammbaum der Greifvögel

Ein molekularer Stammbaum der Greifvögel Powered by Seiten-Adresse: Ein molekularer Stammbaum der Greifvögel An der Universität Heidelberg leitet Prof.


Wer ist wem überlegen?

Wer ist wem überlegen? Arbeitsblatt 1: Wer ist wem überlegen? Ziel: Die Jungen erhalten die Gelegenheit, die unterschiedliche Bewertung der Eigenschaften zu erkennen, die mit männlichen und weiblichen Rollen verbunden sind.


Transcriptomics: Analysis of Microarrays

Transcriptomics: Analysis of Microarrays Transcriptomics: Analysis of Microarrays Dion Whitehead Division of Bioinformatics, Westfälische Wilhelms Universität Münster Microarrays Vorlesungsüberblick : 1. Überblick von Microarray





Molekulargenetischer Nachweis und Genotypisierung von HPV

Molekulargenetischer Nachweis und Genotypisierung von HPV Molekulargenetischer Nachweis und Genotypisierung von HPV Dr. Sabine Sussitz-Rack Institut für Labordiagnostik und Mikrobiologie Vorstand: Prim. Prof. DDr. Pranav Sinha Humanes Papillomavirus HPV HPV ist


Gewinnung und Nutzung von Braunkohle im Spiegel der EU- Wasserrahmenrichtlinie

Gewinnung und Nutzung von Braunkohle im Spiegel der EU- Wasserrahmenrichtlinie Umweltnetzwerk zur Unterstützung des ehrenamtlichen Naturschutzes bei der Beteiligung an der Umsetzung des Wasserrahmenrichtlinie Gewinnung und Nutzung von Braunkohle im Spiegel der EU- Wasserrahmenrichtlinie


1 Einleitung... 1. 1.4 Glucoserepression...3. 1.8 Zielsetzung... 24. 2 Material und Methoden... 25

1 Einleitung... 1. 1.4 Glucoserepression...3. 1.8 Zielsetzung... 24. 2 Material und Methoden... 25 Inhaltsverzeichnis 1 Einleitung... 1 1.1 Zuckerstoffwechsel von Saccharomyces cerevisiae... 1 1.2 Glucoseinaktivierung... 2 1.3 Glucoseinduzierter gezielter mrna-abbau... 3 1.4 Glucoserepression...3 1.5


Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus?

Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Gliederung Seminar des Ausschusses für Genetik der ZAR, Salzburg, 18.03.2010 Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Versuch einer Begriffserklärung Wie weiß man,


Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61 Tier-Biotechnologie Inhaltsverzeichnis Vorwort. 9 Mitarbeiter. 10 Einführung in die Tier-Biotechnologie. 11 Teil I: Zellkultur- und Bioverfahrenstechniken. 23 1 Kultivierung tierischer Zellen. 25 1.1 Voraussetzungen


Vererbung und Epilepsie

Vererbung und Epilepsie epi-info Vererbung und Epilepsie 1 Was versteht man unter Vererbung, und welche Hauptformen gibt es? Vererbung ist die Weitergabe von Merkmalen von Eltern an ihre Kinder. Dies erfolgt


GenoProof. Vergleich GenoProof 1.3 und GenoProof 2. Qualitype AG. Moritzburger Weg 67 01109 Dresden

GenoProof. Vergleich GenoProof 1.3 und GenoProof 2. Qualitype AG. Moritzburger Weg 67 01109 Dresden GenoProof Vergleich GenoProof 1.3 und GenoProof 2 Qualitype AG Moritzburger Weg 67 01109 Dresden Phone +49 (0)351 8838 2800 Fax +49 (0)351 8838 2809 Vergleich GenoProof


Kugel-Fächer-Modell. 1fach. 3fach. Für die Einzelkugel gibt es 3 Möglichkeiten. 6fach. 3! Möglichkeiten

Kugel-Fächer-Modell. 1fach. 3fach. Für die Einzelkugel gibt es 3 Möglichkeiten. 6fach. 3! Möglichkeiten Kugel-Fächer-Modell n Kugeln (Rosinen) sollen auf m Fächer (Brötchen) verteilt werden, zunächst 3 Kugeln auf 3 Fächer. 1fach 3fach Für die Einzelkugel gibt es 3 Möglichkeiten } 6fach 3! Möglichkeiten Es


Methoden Quantitative Datenanalyse

Methoden Quantitative Datenanalyse Leitfaden Universität Zürich ISEK - Andreasstrasse 15 CH-8050 Zürich Telefon +41 44 635 22 11 Telefax +41 44 635 22 19 11. September 2014 Methoden Quantitative Datenanalyse Vorbereitung


5 Zusammenhangsmaße, Korrelation und Regression

5 Zusammenhangsmaße, Korrelation und Regression 5 Zusammenhangsmaße, Korrelation und Regression 5.1 Zusammenhangsmaße und Korrelation Aufgabe 5.1 In einem Hauptstudiumsseminar des Lehrstuhls für Wirtschafts- und Sozialstatistik machten die Teilnehmer


Pressekonferenz, 14. Juli 2014, Berlin. Die Zukunft der Sozialen Pflegeversicherung Fakten und Reformperspektiven. Materialien

Pressekonferenz, 14. Juli 2014, Berlin. Die Zukunft der Sozialen Pflegeversicherung Fakten und Reformperspektiven. Materialien Pressekonferenz, 14. Juli 2014, Berlin Die Zukunft der Sozialen Pflegeversicherung Fakten und Reformperspektiven Materialien Abbildung 1 Pflegefallrisiko nach Alter und Geschlecht Anteil der pflegebedürftigen


Anhang 2: Auswertungsschema zum Ermittlungsbogen G1

Anhang 2: Auswertungsschema zum Ermittlungsbogen G1 : Auswertungsschema zum Ermittlungsbogen G1 In der Regel sind die Ermittlungsbögen sorgfältig getrennt auszuwerten. Bei größeren Gruppen ist es jedoch häufig sinnvoll, sich einen Überblick über die Verteilung


Einflußfaktoren auf die serologische Einzeltierdiagnostik der Paratuberkulose mittels ELISA

Einflußfaktoren auf die serologische Einzeltierdiagnostik der Paratuberkulose mittels ELISA Einflußfaktoren auf die serologische Einzeltierdiagnostik der Paratuberkulose mittels ELISA Heike Köhler Bundesforschungsanstalt für Viruskrankheiten der Tiere, Standort Jena NRL Paratuberkulose Diagnostik


Multiple Regression. Ziel: Vorhersage der Werte einer Variable (Kriterium) bei Kenntnis der Werte von zwei oder mehr anderen Variablen (Prädiktoren)

Multiple Regression. Ziel: Vorhersage der Werte einer Variable (Kriterium) bei Kenntnis der Werte von zwei oder mehr anderen Variablen (Prädiktoren) Multiple Regression 1 Was ist multiple lineare Regression? Ziel: Vorhersage der Werte einer Variable (Kriterium) bei Kenntnis der Werte von zwei oder mehr anderen Variablen (Prädiktoren) Annahme: Der Zusammenhang


Kompetenzzentrum Telemetrie

Kompetenzzentrum Telemetrie Institut für Experimentelle und Klinische Pharmakologie und Toxikologie UMM Universitätsmedizin Mannheim Ruprecht-Karls-Universität Heidelberg Maybachstr. 14 68169 Mannheim T +496213839607 F +496213839611


Genetik und Entwicklung: Das Fragile-x-Syndrom. Urs Hunziker NGW, 9. Januar 2015

Genetik und Entwicklung: Das Fragile-x-Syndrom. Urs Hunziker NGW, 9. Januar 2015 Genetik und Entwicklung: Das Fragile-x-Syndrom Urs Hunziker NGW, 9. Januar 2015 Themen Genotyp: Wie wird das Fragile-X-Syndrom vererbt? - Phänotyp: Wie erkennt man Kinder mit Fragilem-X-Syndrom? Wie entwickeln


Grundlagen der Inferenzstatistik

Grundlagen der Inferenzstatistik Grundlagen der Inferenzstatistik (Induktive Statistik oder schließende Statistik) Dr. Winfried Zinn 1 Deskriptive Statistik versus Inferenzstatistik Die Deskriptive Statistik stellt Kenngrößen zur Verfügung,


Schätzung des Lifetime Values von Spendern mit Hilfe der Überlebensanalyse

Schätzung des Lifetime Values von Spendern mit Hilfe der Überlebensanalyse Schätzung Lifetime Values von Spenn mit Hilfe Überlebensanalyse Einführung in das Verfahren am Beispiel Einzugsgenehmigung Überlebensanalysen o Ereignisdatenanalysen behandeln das Problem, mit welcher


Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen Fotos: M. Rindlisbacher Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen H. Hasler 1, F. Berruex 3, B. Haase 2, C. Flury 1, T. Leeb 2, V. Gerber 4, H. Simianer 5, D. Burger 3, P.A. Poncet


Bartgeier Westschweiz 2006

Bartgeier Westschweiz 2006 Bartgeier Westschweiz 2006 Bartgeier Life (Haute-Savoie 2002), am 9. April 2006 beim Diableretgletscher VD. Auf anderen Bildern wurde er anhand seiner Ringe identifiziert. Sowohl die Anzahl der übermittelten


Hintergrundpapier. Länderöffnungsklausel im BauGB Länderspezifische Mindestabstände für Windenergieanlagen und ihre räumlichen Auswirkungen

Hintergrundpapier. Länderöffnungsklausel im BauGB Länderspezifische Mindestabstände für Windenergieanlagen und ihre räumlichen Auswirkungen Hintergrundpapier Länderöffnungsklausel im BauGB Länderspezifische Mindestabstände für Windenergieanlagen und ihre räumlichen Auswirkungen Autorin: Brigitte Zaspel-Heisters Mai 2014 Hintergrundpapier 1.


Luke Alphey. DNA-Sequenzierung. Aus dem Englischen übersetzt von Kurt Beginnen. Spektrum Akademischer Verlag

Luke Alphey. DNA-Sequenzierung. Aus dem Englischen übersetzt von Kurt Beginnen. Spektrum Akademischer Verlag Luke Alphey DNA-Sequenzierung Aus dem Englischen übersetzt von Kurt Beginnen Spektrum Akademischer Verlag Inhalt Abkürzungen 11 Vorwort 15 Danksagung 16 Teil 1: Grundprinzipien und Methoden 1. 1.1 1.2


5. Untersuchungsdesigns

5. Untersuchungsdesigns Dr. habil. Rüdiger Jacob Methoden und Techniken der empirischen Sozialforschung Vorlesung mit Diskussion 5. Untersuchungsdesigns Experimente als Instrument zur Prüfung von Kausalität Kohortenstudien, Fall-Kontroll-Studien,


Die Situation von Familien in der gesetzlichen Krankenversicherung

Die Situation von Familien in der gesetzlichen Krankenversicherung Die Situation von Familien in der gesetzlichen Krankenversicherung Dr. Frank Niehaus Mannheim, 23.3.2013 Überblick 1. Familien in Deutschland 2. Die Finanzierung der GKV und die Situation der Familien


Sanierung Wasserkraft / Fischgängigkeit Ablauf, aktueller Stand, Anforderungen

Sanierung Wasserkraft / Fischgängigkeit Ablauf, aktueller Stand, Anforderungen Eidgenössisches Departement für Umwelt, Verkehr, Energie und Kommunikation UVEK Bundesamt für Umwelt BAFU Abteilung Arten, Ökosysteme, Landschaften Sanierung Wasserkraft / Fischgängigkeit Ablauf, aktueller


Kursmaterial: Geld und Kredit

Kursmaterial: Geld und Kredit Handout : Die Entstehung von Geld in einer Tauschwirtschaft Prof. Dr. Thomas Lux Lehrstuhl für Geld, Währung und Internationale Finanzmärkte Institut für Volkswirtschaftslehre Universität Kiel Kursmaterial:
