Genomische Selektion in der Pflanzenzüchtung

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Genomische Selektion in der Pflanzenzüchtung"

Transkript

1 Genomische Selektion in der Pflanzenzüchtung Chris-CarolinCarolin Schön 30. März 2012

2 Hybridzüchtung Population 1 Population 2 Kreuzungen Linieni Prüfung 1 Umwelt Kreuzungen Linen Linien Prüfung 5 Umwelten Linen 50 Linien Prüfung 50 Linen >10 Umwelten Hybrid Komponenten Hybriden Hybrid Komponenten Überarbeitet nach Schmidt, 2004 Plant Breeding 2

3 Beobachtungsanbau Photo: KWS, W. Schmidt, M.Ouzunova Plant breeding 3

4 Leistungsprüfung Viele Gene mit kleinen Effekten Photo: W. Schmidt Plant Breeding 4

5 Genomik in einer Minute Plant Breeding 5

6 Overview on public maize Genomische genomics resources Resourcen Status maize genome sequencing: B73 Accessioned Golden Path V2: 2.1 Gb sequence available (of 2.3 Gb) genes identified De novo sequencing of 4 EU flint/dent founder lines (in progress) Resequencing of 27 US NAM founder lines in gene rich regions: 2.9Mio unique SNPs Resequencing of Mo17: 1Mio SNP compared to B73 Resequencing of 26 EU NAM founder lines (in progress) > 2 Mio ESTs Various ongoing projects Maps: Physical Map IBM Map LHRF Map NAM-Map Science Nov 19; 2009 Tools: BAC-Libraries 50K Community Chip Plant Breeding 6

7 DNA Polymorphismen SNP1 SNP2 Ind.1: ACATGGATCCAGGCATGGCTTAG TGGAACAACACACC Ind.2: ACATGGATCCAGACATGGCTTAG TGGAACAACATACC Ind.3: ACATGGATCCAGACATGGCTTAG TGGAACAACATACC Ind.4: ACATGGATCCAGGCATGGCTTAG TGGAACAACATACC SNP funktional oder zufällig Ind.5: ACATGGATCCAGACATGGCTTAG TGGAACAACATACCTGGAACAACATACC Mais: 1 SNP pro 50 Basenpaaren ~ 2.6 x 10 9 Basenpaare/Genom Plant Breeding 7

8 Kopplungsungleichgewicht A C A C A C A C A T A C A T A C G C G T G C G T G T G T G T G T Plant breeding 8

9 Genomische Selektion Reference population Selection candidates Unterschiede PZ - TZ Genotypes and phenotypes Prediction equation Genomic breeding value = w 1 x 1 + w 2 x 2 + w 3 x Marker genotypes Selected genotypes Estimated breeding values Homozygotie Testkreuzungen Familien und GPU Struktur Wiederholte Messungen Migration G x E Dominanz 9

10 Genomische Selektion SNP Marker Ind1 GBV Ind 2 GBV Genetischer Wert eines Individuums id wird aus seinem DNA Profil vorhergesagt Plant Breeding 10

11 Rekurrente Selektion Zyklus 1 Population Linien 200 Linien 50 Linien Elitelinien R i ˆ (, ) M M g r g g R i h P g Zyklus Linien 200 Linien 50 Linien Elitelinien 11

12 Genauigkeit der Vorhersage 732 SNPs 1377 DHs Ertrag Trockensubstanz 12

13 Vorhersage der Testkreuzungsleistung Ertrag 13

14 Erste experimentelle Ergebnisse aus der Maiszüchtung sind ermutigend. Technische Universität München 14

15 Genomische Selektion Harris, New Zealand,

16 Was können wir von der genomischen Selektion erwarten? Literatur bei Fremd- und Selbstbefruchtern empfiehlt den Einsatz genomischer Zuchtwerte für die Selektion. In naher Zukunft wird es bei einer Reihe von Fruchtarten belastbare experimentelle Ergebnisse über mehrere Rekombinationszyklen, Tester und Jahre geben. Die zukünftig verfügbare Datengrundlage wird die Analyse der genetischen Struktur von selektierten Populationen erlauben. Bei Einsatz genomischer Selektion müssen Zuchtschemata grundlegend überarbeitet werden. Plant Breeding 16

17 Pflanzenforschung am WZW Interdisziplinäres Zentrum für genom-basierte Tier- und Pflanzenzüchtung Plant Breeding 17

18 Partner Wissenschaftliche Exzellenz & Technologische Kompetenz U Göttingen Tierzüchtung U Hohenheim Pflanzenzüchtung Bioinformatik Züchtungsinformatik U Kiel Tierzüchtung FLI Mariensee Nutztiergenetik TUM Pflanzenzüchtung Tierzüchtung Genetik Populationsgenetik Bioinformatik Medizin HMGU Bioinformatik Humangenetik LfL Tierzüchtung Industrie KWS SAAT AG Lohmann Tierzucht Anwendungsbezug g 18

19 Datenintegration und Methodenentwicklung Breeders Phenotypes T1 Sequenzen 30 lines Trait Geneics 14 lines, amplicons T2 Genotyping SNP array Genotypes T3 Bioinformatik Metabolites T4 Biomarker Metabolites Geno-/Phenotypes Genotypes Metabolites A1 Statistical Methods A2 Genomic Selection A3 Genomic Prediction A4 Population Genomics 19

20 Investitionen in Ausbildung neue Technologien sind nur mit gut ausgebildetem Nachwuchs zu implementieren stärkere Verzahnung von pflanzen- und agrar- wissenschaftlichen Studiengängen Verbesserung der Durchlässigkeit zwischen benachbarten bioökonomierelevanten Fächern Vermittlung der Attraktivität des grünen Bereichs Plant Breeding 20

Individuelle Genomsequenzen Aussichten für die Tierzucht

Individuelle Genomsequenzen Aussichten für die Tierzucht Individuelle Genomsequenzen Aussichten für die Tierzucht Ruedi Fries WZW / Lehrstuhl für Tierzucht Agrarw. Symposium - 1 Auswirkungen der Genomischen Revolution auf die Tierzucht (und Pflanzenzucht) Agrarw.

Mehr

Themenblock Moderne Methoden in der. Vortrag: Markergestützte Selektion (MAS)

Themenblock Moderne Methoden in der. Vortrag: Markergestützte Selektion (MAS) Klaus Pillen, Markergestützte Selektion in der Pflanzenzüchtung, Magdeburg, 14.10.2010 1 Dialogreihe Innovationsfeld Pflanze Themenblock Moderne Methoden in der Pflanzenforschung und züchtung Vortrag:

Mehr

Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus?

Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Gliederung Seminar des Ausschusses für Genetik der ZAR, Salzburg, 18.03.2010 Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Versuch einer Begriffserklärung Wie weiß man,

Mehr

Potentiale und Herausforderungen der. genomischen Selektion in der Tierzucht

Potentiale und Herausforderungen der. genomischen Selektion in der Tierzucht Potentiale und Herausforderungen der genomischen Selektion in der Tierzucht Jörn Bennewitz Fachgebiet Tiergenetik & Züchtung Institut für Nutztierwissenschaften der Universität Hohenheim Gliederung Gliederung

Mehr

Vom Klimastress zur Genfunktion

Vom Klimastress zur Genfunktion Bayerische Landesanstalt für Landwirtschaft Vom Klimastress zur Genfunktion - genetische Analysen zur züchterischen Nutzung der genetischen Diversität bei Kulturpflanzen Dr. Günther Schweizer Kongress

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Genombasierte Selektion: neue Perspektiven für Zuchtwertschätzung und Zuchtprogramme

Genombasierte Selektion: neue Perspektiven für Zuchtwertschätzung und Zuchtprogramme Genombasierte Selektion: neue Perspektiven für Zuchtwertschätzung und Zuchtprogramme Prof. Dr. Henner Simianer Institut für Tierzucht und Haustiergenetik Georg-August-Universität Göttingen 1 Einleitung

Mehr

Anpassung von Nutzpflanzen an den Klimawandel Einsatz moderner Züchtungsmethoden

Anpassung von Nutzpflanzen an den Klimawandel Einsatz moderner Züchtungsmethoden Anpassung von Nutzpflanzen an den Klimawandel Einsatz moderner Züchtungsmethoden Eva Bauer Technische Universität München Wissenschaftszentrum Weihenstephan Lehrstuhl für Pflanzenzüchtung Freising, 21.

Mehr

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen Fotos: M. Rindlisbacher Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen H. Hasler 1, F. Berruex 3, B. Haase 2, C. Flury 1, T. Leeb 2, V. Gerber 4, H. Simianer 5, D. Burger 3, P.A. Poncet

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Aktuelle Arbeiten zur genomischen Selektion bei Qualitas

Aktuelle Arbeiten zur genomischen Selektion bei Qualitas Aktuelle Arbeiten zur genomischen Selektion bei Qualitas Swissherdbook Birgit Gredler, Beat Bapst, Franz Seefried Qualitas AG SABRE TP Workshop 4. Juni 2013, Zug Übersicht Genomische Selektion in der Routine-ZWS

Mehr

Voraussetzungen für die Genomische Selektion beim Pferd

Voraussetzungen für die Genomische Selektion beim Pferd Agrar- und Ernährungswissenschaftliche Fakultät Institut für Tierzucht und Tierhaltung Voraussetzungen für die Genomische Selektion beim Pferd Prof. Dr. Georg Thaller 32. Jahrestagung zur Pferdegesundheit

Mehr

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung FRAUNHOFER-INSTITUT FÜR GRENZFLÄCHEN- UND BIOVERFAHRENSTECHNIK IGB NEXT-GENERATION SEQUENCING Von der Probenvorbereitung bis zur bioinformatischen Auswertung »Progress in science depends on new techniques,

Mehr

Informationstechnologie in der Pflanzenzüchtung. Biocomputing in einem Züchtungsunternehmen. Andreas Menze KWS SAAT AG, Einbeck

Informationstechnologie in der Pflanzenzüchtung. Biocomputing in einem Züchtungsunternehmen. Andreas Menze KWS SAAT AG, Einbeck Informationstechnologie in der Pflanzenzüchtung Biocomputing in einem Züchtungsunternehmen Andreas Menze KWS SAAT AG, Einbeck Biocomputing in einem Züchtungsunternehmen Biocomputing Was ist das? Wozu wird

Mehr

Die Universität stellt sich vor

Die Universität stellt sich vor Die Universität stellt sich vor Prof. Dr. Till Tantau. Juni Überblick Die Universität zu Lübeck Exzellente Forschung...... führt zu exzellenter Lehre Die Universität in Zahlen Studierende. Professoren

Mehr

Einblicke in das menschliche Erbgut (Genom) am Computer

Einblicke in das menschliche Erbgut (Genom) am Computer Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Binger Nacht der Wissenschaft - 16.04.2010 Das menschliche Genom ist entschlüsselt

Mehr

Zukünftige Entwicklungen und Anwendungen der genomischen Selektion (GS)

Zukünftige Entwicklungen und Anwendungen der genomischen Selektion (GS) SV agung vom 29. März 2012, Universität Irchel, Zürich Zukünftige Entwicklungen und nwendungen der genomischen Selektion (GS) Ruedi Fries und Hubert Pausch Lehrstuhl für ierzucht echnische Universität

Mehr

Identifikation von genetischen Kopienzahl-Variationen in Zusammenhang mit der komplexen Lungenkrankheit Sarkoidose

Identifikation von genetischen Kopienzahl-Variationen in Zusammenhang mit der komplexen Lungenkrankheit Sarkoidose Identifikation von genetischen Kopienzahl-Variationen in Zusammenhang mit der komplexen Lungenkrankheit Sarkoidose Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät

Mehr

Die Grundlagen der genomischen Selektion. Jörn Bennewitz. Institut für Tierhaltung und Tierzüchtung Universität Hohenheim

Die Grundlagen der genomischen Selektion. Jörn Bennewitz. Institut für Tierhaltung und Tierzüchtung Universität Hohenheim Die Grundlagen der genomischen Selektion Jörn Bennewitz Institut für Tierhaltung und Tierzüchtung Universität Hohenheim Beitrag zum Rinderworkshop, 17.-18. Februar 2009 in Ülzen Einleitung Der Zuchtfortschritt

Mehr

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Karl Heinimann, MD PhD Medizinische Genetik Universitätskinderspital beider Basel karl.heinimann@unibas.ch 14. Internationales Seminar DESO St.

Mehr

Übung 8 vom Linkage Disequilibrium GWAS Single-SNP-Regression

Übung 8 vom Linkage Disequilibrium GWAS Single-SNP-Regression Übung 8 vom 27.11.2015 Linkage Disequilibrium GWAS Single-SNP-Regression Qualitas AG Folien ZL I+II LFW C11 04. Dez. 2015 1 Aufgabe 1: Linkage Disequilibrium (LD) 224 Individuen genotypisiert für 8 SNP-Marker

Mehr

Individuelle Genomsequenzierung von Nutztieren auf dem Weg zur genomischen Selektion 2.0

Individuelle Genomsequenzierung von Nutztieren auf dem Weg zur genomischen Selektion 2.0 Züchtungskunde, 83, (4/5) S. 371 381, 2011, ISSN 0044-5401 Verlag Eugen Ulmer, Stuttgart Original Article Individuelle Genomsequenzierung von Nutztieren auf dem Weg zur genomischen Selektion 2.0 R. Fries

Mehr

Pharmazeutische Biologie WS2011/2012. Das neue Paradigma: Personalisierte Medizin

Pharmazeutische Biologie WS2011/2012. Das neue Paradigma: Personalisierte Medizin 3. Vorlesung Pharmazeutische Biologie WS2011/2012 Das neue Paradigma: Personalisierte Medizin Prof. Theo Dingermann Institut für Pharmazeutische Biologie Biozentrum Max-von Laue-Str. 9 60438 Frankfurt

Mehr

Bioinformatische Suche nach pre-mirnas

Bioinformatische Suche nach pre-mirnas Bioinformatische Suche nach pre-mirnas Vorbereitung: Lesen Sie die Publikationen Meyers et al., 2008, Criteria for Annotation of Plant MicroRNAs und Thieme et al., 2011, SplamiR prediction of spliced mirnas

Mehr

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie:

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie: Foto: Alina Ackermann Unsere Forschungsschwerpunkte Synthetische Biologie: Im Fachgebiet Synthetische Biologie arbeiten Biologen, Chemiker und Ingenieure zusammen, um biologische Systeme zu erzeugen, die

Mehr

Perspektiven der Grünen Gentechnik: Eine realistische Bestandsaufnahme

Perspektiven der Grünen Gentechnik: Eine realistische Bestandsaufnahme Perspektiven der Grünen Gentechnik: Eine realistische Bestandsaufnahme Dr. Jan van Aken Universität Hamburg Forschungsschwerpunkt Biotechnik, Gesellschaft und Umwelt Forschungsgruppe Medizin/Neurobiologie

Mehr

Genomische Selektion beim Schwein Fährt der Zug schon und wenn ja, wohin?

Genomische Selektion beim Schwein Fährt der Zug schon und wenn ja, wohin? Genomische Selektion beim Schwein Fährt der Zug schon und wenn ja, wohin? Dr. Kay-Uwe Götz Bayerische Landesanstalt für Landwirtschaft Institut für Tierzucht Wer sich neben der Schweinezucht auch für Rinder

Mehr

Saatgut und Lebensmittel: Zunehmende Monopolisierung durch Patente und Marktkonzentration.

Saatgut und Lebensmittel: Zunehmende Monopolisierung durch Patente und Marktkonzentration. Saatgut und Lebensmittel: Zunehmende Monopolisierung durch Patente und Marktkonzentration www.no-patents-on-seeds.org Marktkonzentration: Zehn Unternehmen kontrollieren etwa 2/3 des globalen Saatgutmarktes

Mehr

Patente auf Tiere (und Saatgut) und die Folgen

Patente auf Tiere (und Saatgut) und die Folgen Patente auf Tiere (und Saatgut) und die Folgen 28.4.2010 Dr. Christoph Then, Testbiotech e.v. München www.testbiotech.org christoph.then@testbiotech.org Was macht Testbiotech e.v.? Testbiotech e.v., Institut

Mehr

Genomische Selektion. Dr. Fritz Schmitz-Hsu, Senior Geneticist. Delegiertenversammlung. Ostschweizer Holsteinzuchtverband. 12.

Genomische Selektion. Dr. Fritz Schmitz-Hsu, Senior Geneticist. Delegiertenversammlung. Ostschweizer Holsteinzuchtverband. 12. Genomische Selektion Dr. Fritz Schmitz-Hsu, Senior Geneticist Delegiertenversammlung Ostschweizer Holsteinzuchtverband 12. März 2009 Swissgenetics 2009 Zuchtwert bei Geburt eines Kalbes bereits mit einer

Mehr

Evolution und Algorithmen

Evolution und Algorithmen Kapitel 6 Spezialvorlesung Modul 10-202-2206 (Fortgeschrittene Methoden in der Bioinformatik) Jana Hertel Professur für Bioinformatik Institut für Informatik Universität Leipzig Machine learning in bioinformatics

Mehr

Zukunftsperspektiven in der Zuchtwertschätzung

Zukunftsperspektiven in der Zuchtwertschätzung Zukunftsperspektiven in der Zuchtwertschätzung Dr. Stefan Rieder / Weiterbildungsveranstaltung des VSP / 8. November 2008 Fragen Was heisst genomischer Zuchtwert? Was heisst genomische Selektion? Wie kann

Mehr

Agrocluster CropSense.net. Ulrich Schurr, Forschungszentrum Jülich Halbzeitkonferenz Bioökonomie, 5.6.2014

Agrocluster CropSense.net. Ulrich Schurr, Forschungszentrum Jülich Halbzeitkonferenz Bioökonomie, 5.6.2014 Agrocluster CropSense.net Ulrich Schurr, Forschungszentrum Jülich Halbzeitkonferenz Bioökonomie, 5.6.2014 Herausforderung Phänotypisierung EPSO Whitepaper Plant Phenotyping 2010 Nature Gene*cs Dec. 2010

Mehr

Software Entwicklung in der Wissenschaft

Software Entwicklung in der Wissenschaft Software Entwicklung in der Wissenschaft Ein Dialog zwischen Theorie und Praxis einiger Softwaretechnikelemente anhand eines Interviews Webadresse, E-Mail oder sonstige Referenz Seite 1/30 07.10.2015 Gliederung

Mehr

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl Übung II Einführung, Teil 1 Arbeiten mit Ensembl Ensembl Genome Browser (Bereitstellung von Vielzeller Genomen) Projekt wurde 1999 initiiert Projektpartner EMBL European Bioinformatics Institute (EBI)

Mehr

PR Statistische Genetik und Bioinformatik

PR Statistische Genetik und Bioinformatik PR Statistische Genetik und Bioinformatik Johanna Bertl Institut für Statistik und OR, Universität Wien Oskar-Morgenstern-Platz 1/6.344, 1090 Wien, Tel.: 01-4277-38617 johanna.bertl@univie.ac.at, homepage.univie.ac.at/johanna.bertl

Mehr

Stellungnahme des Ausschusses für Genetisch-Statistische Methoden der DGfZ zur Fragestellung Genomische Zuchtwertschätzung und Selektion 1

Stellungnahme des Ausschusses für Genetisch-Statistische Methoden der DGfZ zur Fragestellung Genomische Zuchtwertschätzung und Selektion 1 Züchtungskunde, 83, (4/5) S. 241 247, 2011, ISSN 0044-5401 Verlag Eugen Ulmer, Stuttgart Stellungnahme des Ausschusses für Genetisch-Statistische Methoden der DGfZ zur Fragestellung Genomische Zuchtwertschätzung

Mehr

QTL$MAPPING$OF$IMPORTANT$AGRICULTURAL$AND$LIFE$HISTORY$TRAITS$ IN$THE$PLANT$PATHOGENIC$FUNGUS!ZYMOSEPTORIA!TRITICI$ $

QTL$MAPPING$OF$IMPORTANT$AGRICULTURAL$AND$LIFE$HISTORY$TRAITS$ IN$THE$PLANT$PATHOGENIC$FUNGUS!ZYMOSEPTORIA!TRITICI$ $ DISS.ETHNO.22827 QTLMAPPINGOFIMPORTANTAGRICULTURALANDLIFEHISTORYTRAITS INTHEPLANTPATHOGENICFUNGUS!ZYMOSEPTORIA!TRITICI Athesissubmittedtoattainthedegreeof DOCTOROFSCIENCESofETHZURICH (Dr.sc.ETHZurich)

Mehr

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Christian-Albrechts-Universität zu Kiel Next-Generation Sequencing (NGS) Nach Sanger Sequencing (1977) zweite Generation

Mehr

DATENQUALITÄT IN GENOMDATENBANKEN

DATENQUALITÄT IN GENOMDATENBANKEN DATENQUALITÄT IN GENOMDATENBANKEN Alexander Fehr 28. Januar 2004 Gliederung Motivation Biologische Grundkonzepte Genomdaten Datenproduktion und Fehler Data Cleansing 2 Motivation (1) Genomdatenbanken enthalten

Mehr

Klinik für Hepatologie. Christoph Malenke

Klinik für Hepatologie. Christoph Malenke Dense genotyping of immune-related disease regions identifies nine new risk loci for primary sclerosing cholangitis Nat Genet. 2013 June; 45(6): 670 675 Christoph Malenke Klinik für Hepatologie 2 Gliederung

Mehr

Bioinformatik I (Einführung)

Bioinformatik I (Einführung) Kay Diederichs, Sommersemester 2015 Bioinformatik I (Einführung) Algorithmen Sequenzen Strukturen PDFs unter http://strucbio.biologie.unikonstanz.de/~dikay/bioinformatik/ Klausur: Fr 17.7. 10:00-11:00

Mehr

Inhalt des Vortrags. o genetische Grundlagen. o Wie findet man Erbfehler? o Zusammenfassung. Was ist ein Haplotyp?

Inhalt des Vortrags. o genetische Grundlagen. o Wie findet man Erbfehler? o Zusammenfassung. Was ist ein Haplotyp? Inhalt des Vortrags o genetische Grundlagen Was ist ein Haplotyp? o Wie findet man Erbfehler? basierend auf Phänotypen: Zwergwuchs basierend auf Genotypen: Braunvieh Haplotyp II o Zusammenfassung einige

Mehr

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie:

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie: Foto: Andreas Arnold Unsere Forschungsschwerpunkte Synthetische Biologie: Im Fachgebiet Synthetische Biologie arbeiten Biologen, Chemiker und Ingenieure zusammen, um biologische Systeme zu erzeugen, die

Mehr

molekularen Rinderzucht

molekularen Rinderzucht Möglichkeiten der molekularen Rinderzucht Johann Sölkner Gliederung Einleitung Molekulare Marker Suche nach wichtigen Genen Molekulare Zuchtwertschätzung Auswirkung auf Zuchtprogramme Versprechen der Molekulargenetiker

Mehr

DNA-Test zur Rassebestimmung bei Windhunden

DNA-Test zur Rassebestimmung bei Windhunden DNA-Test zur Rassebestimmung bei Windhunden Dr. Barbara Wimmer, Eurofins Medigenomix GmbH www.eurofins.com Wer wir sind - Eurofins Scientific Gruppe 150 Labore in 30 Ländern in Europa, USA, Asien & Südamerika

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

Grundlegende Experimente der Molekulargenetik

Grundlegende Experimente der Molekulargenetik Übung 12 Wiederholung/Zusatzübung Inhalte: Mendelscher Erbgang Grundlegende Experimente der Molekulargenetik Transposons Methoden 1. Sie haben drei runde, gelbe Erbsen (A, B und C). Aus jeder der drei

Mehr

Aktuelle Entwicklungen zur genomischen Selektion. Reinhard Reents. Vereinigte Informationssysteme Tierhaltung w.v. (vit), Verden

Aktuelle Entwicklungen zur genomischen Selektion. Reinhard Reents. Vereinigte Informationssysteme Tierhaltung w.v. (vit), Verden Aktuelle Entwicklungen zur genomischen Selektion Reinhard Reents Vereinigte Informationssysteme Tierhaltung w.v. (vit), Verden Einleitung Die Analyse von molekulargenetischen Daten erfreut sich eines starken

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Möglichkeiten und Grenzen der Anwendung molekularer Marker in der Zierpflanzenzüchtung

Möglichkeiten und Grenzen der Anwendung molekularer Marker in der Zierpflanzenzüchtung Möglichkeiten und Grenzen der Anwendung molekularer Marker in der Zierpflanzenzüchtung Th. Debener Institut für Pflanzengenetik Molekulare Pflanzenzüchtung Forum zum Informationsaustausch zwischen Forschung

Mehr

Bioinformatik Statistik und Analyse mit R 22.05.2009-1 -

Bioinformatik Statistik und Analyse mit R 22.05.2009-1 - Bioinformatik Statistik und Analyse mit R 22.05.2009-1 - Definition: Bioinformatik Die Bioinformatik http://de.wikipedia.org/wiki/bioinformatik (englisch bioinformatics, auch computational biology) ist

Mehr

Grundlagen Molekulargenetik

Grundlagen Molekulargenetik Grundlagen Molekulargenetik Birgit Gredler-Grandl Qualitas AG Birgit Gredler-Grandl Folien ZL I+II LFW C11 20. Nov. 2015 1 Termine und Inhaltsübersicht 06. Nov. 2015 VCE, BLUP-Zuchtwertschätzung 13. Nov.

Mehr

Transcriptomics: Analysis of Microarrays

Transcriptomics: Analysis of Microarrays Transcriptomics: Analysis of Microarrays Dion Whitehead dion@uni-muenster.de Division of Bioinformatics, Westfälische Wilhelms Universität Münster Microarrays Vorlesungsüberblick : 1. Überblick von Microarray

Mehr

Comparative molecular approaches to identify host determinants mediating adhesion of E. coli F4 strains in pigs

Comparative molecular approaches to identify host determinants mediating adhesion of E. coli F4 strains in pigs Dissertation ETH number 18518 Comparative molecular approaches to identify host determinants mediating adhesion of E. coli F4 strains in pigs A dissertation submitted to ETH Zurich for the degree of Doctor

Mehr

Innovation Pflanzenzüchtung

Innovation Pflanzenzüchtung Innovation Pflanzenzüchtung Leistungsvorhersage mittels tiefer genetischer und biologischer Markerinformationen Thomas Altmann 25. Hülsenberger Gespräche 21. Mai 2014 Weltweite Getreideproduktion (bisherige

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Einblicke in das menschliche Genom aus Sicht der Bioinformatik Prof. Dr. Antje Krause FH Bingen a.krause@fh-bingen.de Kurzer Ausflug in die Genetik DNA (Desoxyribonukleinsäure)

Mehr

Was ist Bioinformatik?

Was ist Bioinformatik? 9. Kurstag: Bioinformatik Der Begriff "Bioinformatik" wurde 1989 erstmals von D.R. Masys im JOURNAL OF RESEARCH OF THE NATIONAL INSTITUTE OF STANDARDS AND TECHNOLOGY erwähnt. Was ist Bioinformatik? Die

Mehr

Agrarwissenschaften. Moderne Landwirtschaft. Hohe Erträge bei niedrigem Personalaufwand. Hoher Mechanisierungsgrad

Agrarwissenschaften. Moderne Landwirtschaft. Hohe Erträge bei niedrigem Personalaufwand. Hoher Mechanisierungsgrad Moderne Landwirtschaft Hohe Erträge bei niedrigem Personalaufwand Hoher Mechanisierungsgrad Hohe Spezialisierung (Monokulturen!) Leistungsfähige Rassen /Sorten Biologische Forschung in den Agrarwissenschaften:

Mehr

Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren

Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren Institut für Medizinische Genetik Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren Prof. Dr. med. Anita Rauch Seite 1 Häufigkeit von Intelligenzminderung (ID) IQ

Mehr

Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer. www.genomaustria.at

Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer. www.genomaustria.at Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer www.genomaustria.at Warum sind wir heute hier? Wir sind heute hier, um über das Thema Erbgut Sequenzierung

Mehr

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema Gentechnologie Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Die Genklonierung in Bakterien Vektor-DNA Spender-DNA Restriktionsenzym Rekombinante

Mehr

Genomanalyse Vorlesung Masterstudiengang 2011 Jena FLI. Klaus Huse Leibniz-Institut für Altersforschung Fritz-Lipmann-Institut Jena

Genomanalyse Vorlesung Masterstudiengang 2011 Jena FLI. Klaus Huse Leibniz-Institut für Altersforschung Fritz-Lipmann-Institut Jena Vorlesung Masterstudiengang 2011 Jena 9.11.2011 FLI Klaus Huse Leibniz-Institut für Altersforschung Fritz-Lipmann-Institut Jena Genom Begriffsbestimmung Gen (Johannsen, 1909) - Erbfaktor, der eine einzelne

Mehr

Bioinformatics Analysis of Rat Muscle Microarray Gene Expression and Genetics of Pig Exterior Traits

Bioinformatics Analysis of Rat Muscle Microarray Gene Expression and Genetics of Pig Exterior Traits Diss. ETH No. 17921 Bioinformatics Analysis of Rat Muscle Microarray Gene Expression and Genetics of Pig Exterior Traits A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH For

Mehr

Bioinformatik: Hype oder Hoffnung?

Bioinformatik: Hype oder Hoffnung? Bioinformatik: Hype oder Hoffnung? Florian Markowetz Max-Planck-Institut für Molekulare Genetik Computational Molecular Biology Berlin Career Nights AKG Bensheim, 28. Januar 2005 1 Florian Markowetz, Bioinformatik:

Mehr

Genomische Zuchtwerte für die kongenitale sensorineurale Taubheit beim Dalmatiner

Genomische Zuchtwerte für die kongenitale sensorineurale Taubheit beim Dalmatiner Genomische Zuchtwerte für die kongenitale sensorineurale Taubheit beim Dalmatiner Prof. Dr. Ottmar Distl Institut für Tierzucht und Vererbungsforschung Stiftung Tierärztliche Hochschule Hannover Bünteweg

Mehr

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held ACT/CVS neueste gendiagnostische Verfahren 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held DNA, Gene, Chromosomen DNA besteht aus den Basenpaaren Adenin - Thymin

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 011 9. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (.000.000.000 Basenpaare)

Mehr

Read Mapping Projektmanagement im So3warebereich SeqAn

Read Mapping Projektmanagement im So3warebereich SeqAn Read Mapping Projektmanagement im So3warebereich SeqAn David Weese April 2010 Inhalt Einführung Reads erzeugen read simulator SWP Teilprojekte Projektplan EINFÜHRUNG 2 nd /Next GeneraGon Sequencing Technologien:

Mehr

Bioinformatik: The Next Generation

Bioinformatik: The Next Generation Bioinformatik: The Next Generation Prof. Dr. Caroline Friedel Lehr- und Forschungseinheit Bioinformatik Was ist Bioinformatik? Prof. Dr. Caroline Friedel, Tag der offenen Tür der LMU 2 Was ist Bioinformatik?

Mehr

Next Generation Sequencing für die Primärdiagnostik. Focus: Resistenztestung

Next Generation Sequencing für die Primärdiagnostik. Focus: Resistenztestung Next Generation Sequencing für die Primärdiagnostik Focus: Resistenztestung Stefan Niemann Molekulare Mykobakteriologie Forschungszentrum Borstel TTU-TB Deutsches Zentrum für Infektionsforschung Outline

Mehr

Zentronukleäre Myopathien von der Diagnose zur Therapie

Zentronukleäre Myopathien von der Diagnose zur Therapie MTM Familientreffen Göttingen, 5./6. Juni 2014 Zentronukleäre Myopathien von der Diagnose zur Therapie Dr. Johann Böhm IGBMC, Strasbourg Ein paar Worte über Strasbourg.and über das IGBMC Ein paar Worte

Mehr

DAS METABOLOM: ERNÄHRUNGSSTATUS, METABOLISMUS, METABOLITEN

DAS METABOLOM: ERNÄHRUNGSSTATUS, METABOLISMUS, METABOLITEN DAS METABOLOM: ERNÄHRUNGSSTATUS, METABOLISMUS, METABOLITEN Das Metabolom Extrinsiche Faktoren Ernährung (Nährstoffe und nicht nutritive Lebensmittelinhaltsstoffe) Arzneimittel Physische Aktivität Darmflora

Mehr

Gestaltung der Zukunft von Genomik in der Tierzucht

Gestaltung der Zukunft von Genomik in der Tierzucht Züchtungskunde, 83, (1) S. 27 33, 2011, ISSN 0044-5401 Verlag Eugen Ulmer, Stuttgart Gestaltung der Zukunft von Genomik in der Tierzucht A. Eggen 1 Zusammenfassung Die Entwicklung der genomischen Technologien

Mehr

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien III. Interdisziplinärer Kongress JUNGE NATURWISSENSCHAFT

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

Ausprägungsfach Bioinformatik im Rahmen des Bachelor-Studiengangs Informatik. CIBIV Center for Integrative Bioinformatics Vienna

Ausprägungsfach Bioinformatik im Rahmen des Bachelor-Studiengangs Informatik. CIBIV Center for Integrative Bioinformatics Vienna Ausprägungsfach Bioinformatik im Rahmen des Bachelor-Studiengangs Informatik Center for Integrative Bioinformatics Vienna (CIBIV) Max F. Perutz Laboratories (MFPL) Vienna, Austria http://www.cibiv.at CIBIV

Mehr

Ethische Fragestellungen zur Personalisierten Medizin

Ethische Fragestellungen zur Personalisierten Medizin Ethische Fragestellungen zur Personalisierten Medizin Softskills Seminar Ethik 05.02.2013 Ethik in der Personalisierten Medizin Personalisierte Medizin Ihre Anwendungsgebiete Fallbeispiele Wohin mit der

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

Genetische Analyse des Freiberger-Pferdes mit genomweiten SNP-Daten. Berner Fachhochschule, Schweizerische Hochschule für Landwirtschaft, Zollikofen 2

Genetische Analyse des Freiberger-Pferdes mit genomweiten SNP-Daten. Berner Fachhochschule, Schweizerische Hochschule für Landwirtschaft, Zollikofen 2 Fotos: M. Rindlisbacher Genetische Analyse des Freiberger-Pferdes mit genomweiten SNP-Daten H. Hasler 1, C. Flury 1, B. Haase 2, D. Burger 3, C.Stricker 4, H. Simianer 5, T. Leeb 2, S. Rieder 1 1 Berner

Mehr

Vorlesung 2 GRUNDLAGEN

Vorlesung 2 GRUNDLAGEN Vorlesung 2 GRUNDLAGEN Überblick Genetische Faktoren Quantitative Genetik Molekulare Genetik Untersuchungsdesigns 2 Genetische Faktoren Davey-Smith et al., 2007 Genetische Faktoren sind nicht korreliert

Mehr

Grants Forschungsförderung

Grants Forschungsförderung Grants Forschungsförderung We appreciate the continuous support for our research projects by the following grant providers (for details see next pages): Wir bedanken uns bei folgenden Forschungsförderern

Mehr

Moderne Evolutionsforschung in Wien: Entwicklungen und Herausforderungen

Moderne Evolutionsforschung in Wien: Entwicklungen und Herausforderungen Univ.-Prof. Dr. Joachim Hermisson Moderne Evolutionsforschung in Wien: Entwicklungen und Herausforderungen 150 Jahre nach Charles Darwins "Origin of Species" führen neue DNA- Sequenzierungstechnologien

Mehr

Ausführungen von Dr. Léon Broers anlässlich der Hauptversammlung der KWS SAAT SE am 14. Dezember 2017

Ausführungen von Dr. Léon Broers anlässlich der Hauptversammlung der KWS SAAT SE am 14. Dezember 2017 Ausführungen von Dr. Léon Broers anlässlich der Hauptversammlung der KWS SAAT SE am 14. Dezember 2017 Sehr geehrte Aktionäre, liebe Gäste, wieder ist ein Jahr vorbei und wir wollen erneut gemeinsam auf

Mehr

Tier- und Pflanzenzüchtung

Tier- und Pflanzenzüchtung ier- und Pflanzenzüchtung hispita Spelzmais (Mittelamerika) Serrano Zahnmais (US) Baby White Rice Popcorn (US) Blanco erciopelo elbe Beere (Zierform, Deutschland) Kein Korn gleicht dem anderen: Mehrere

Mehr

Saatgut-Projekte in Peru. Saatgutsektor stärken Ernährungssicherheit erhöhen

Saatgut-Projekte in Peru. Saatgutsektor stärken Ernährungssicherheit erhöhen Saatgut-Projekte in Peru Saatgutsektor stärken Ernährungssicherheit erhöhen KWS Saatgut-Projekte in Peru Peru ist vielfältig. Tropenklima prägt die östlichen Regenwaldgebiete ( Selva ). Im Westen und den

Mehr

Landwirtschaft: Mehr mit weniger

Landwirtschaft: Mehr mit weniger Landwirtschaft: Mehr mit weniger Stefan Marcinowski Mitglied des Vorstands BASF SE Vorsitzender des Vorstands DIB Ackerland ist limitiert! Mehr Ertrag über verbesserte Effizienz DEUTSCHE INDUSTRIEVEREINIGUNG

Mehr

Einfluss der genetischen Architektur auf die empirische Genauigkeit der genomischen Zuchtwertschätzung

Einfluss der genetischen Architektur auf die empirische Genauigkeit der genomischen Zuchtwertschätzung Einfluss der genetischen Architektur auf die empirische Genauigkeit der genomischen Zuchtwertschätzung M. Kramer 1, F. Biscarini 1, B. Bapst 2, C. Stricker 3, H. Simianer 1 1 Department für Nutztierwissenschaften,

Mehr

Wir fördern das Gute in NRW. www.nrwbank.de/azubiwelt

Wir fördern das Gute in NRW. www.nrwbank.de/azubiwelt Wir fördern das Gute in NRW. www.nrwbank.de/azubiwelt Teamgeist ist eine der guten Eigenschaften in NRW, die es wert sind, gefördert zu werden, und die unsere Auszubildenden im Gepäck haben sollten. So

Mehr

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory Sequenzierung Norbert Arnold Neue Sequenziertechnologien (seit 2005) Next Generation Sequenzierung (NGS, Erste Generation) Unterschiedliche Plattformen mit unterschiedlichen Strategien Roche 454 (basierend

Mehr

CROPGEN Utrecht 2005

CROPGEN Utrecht 2005 CROPGEN Utrecht 2005 XXX Plant Breeding Potential to Improve Energy Crops for the Use in Biogas Wolfgang Friedt Department of Plant Breeding IFZ - Research Centre for Biosystems,, Land Use & Nutrition,

Mehr

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Florian Frommlet Institut für medizinische Statistik, Medizinische Universität Wien Wien, November 2013 Einführung DNA Molekül Zwei

Mehr

DATA-FORECASTER. Erich Steiner steiner@softopt.de SoftOpt www.softopt.de. 7. April 2003

DATA-FORECASTER. Erich Steiner steiner@softopt.de SoftOpt www.softopt.de. 7. April 2003 DATA-FORECASTER Erich Steiner steiner@softopt.de SoftOpt www.softopt.de 7. April 2003 Was ist DATA-FORECASTER? 1 Was ist DATA-FORECASTER? 1 eine Software für Datamining Was ist DATA-FORECASTER? 1 eine

Mehr

KWS Dialogforum. KWS SAAT SE Einbeck 30. November 2015

KWS Dialogforum. KWS SAAT SE Einbeck 30. November 2015 KWS SAAT SE Einbeck 30. November 2015 Geschäftsentwicklung der KWS Gruppe Hagen Duenbostel 2 Unternehmensgrundsätze Vision KWS sät die Zukunft. Unser ertragsstarkes Saatgut und landwirtschaftliches Wissen

Mehr

Neue Strategien bei der Krankheitsresistenzzüchtung der Honigbiene

Neue Strategien bei der Krankheitsresistenzzüchtung der Honigbiene Neue Strategien bei der Krankheitsresistenzzüchtung der Honigbiene Frühjahrstagung 2015 der SVT Zollikofen, 9. April 2015 Bedeutung der Honigbiene Bestäubung Deutschland 2,5 Milliarden (Dreher 1960) Welt

Mehr

Human Capital Management

Human Capital Management Human Capital Management Peter Simeonoff Nikolaus Schmidt Markt- und Technologiefaktoren, die Qualifikation der Mitarbeiter sowie regulatorische Auflagen erfordern die Veränderung von Unternehmen. Herausforderungen

Mehr

Züchtungslehre - Genomische Selektion Peter von Rohr

Züchtungslehre - Genomische Selektion Peter von Rohr Züchtungslehre - Genomische Selektion Peter von Rohr 2016-12-09 Einleitung Zuchtprogramme werden betrieben um die fundamentalen Probleme in der Tierzucht zu lösen. Wir hatten in früheren Kapiteln gesehen,

Mehr

Modellierung biologischer. Christian Maidorfer Thomas Zwifl (Seminar aus Informatik)

Modellierung biologischer. Christian Maidorfer Thomas Zwifl (Seminar aus Informatik) Modellierung biologischer Prozesse Christian Maidorfer Thomas Zwifl (Seminar aus Informatik) Überblick Einführung Arten von Modellen Die stochastische Pi-Maschine Warum Modelle Die Biologie konzentriert

Mehr