Genomische Selektion in der Pflanzenzüchtung

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Genomische Selektion in der Pflanzenzüchtung"

Transkript

1 Genomische Selektion in der Pflanzenzüchtung Chris-CarolinCarolin Schön 30. März 2012

2 Hybridzüchtung Population 1 Population 2 Kreuzungen Linieni Prüfung 1 Umwelt Kreuzungen Linen Linien Prüfung 5 Umwelten Linen 50 Linien Prüfung 50 Linen >10 Umwelten Hybrid Komponenten Hybriden Hybrid Komponenten Überarbeitet nach Schmidt, 2004 Plant Breeding 2

3 Beobachtungsanbau Photo: KWS, W. Schmidt, M.Ouzunova Plant breeding 3

4 Leistungsprüfung Viele Gene mit kleinen Effekten Photo: W. Schmidt Plant Breeding 4

5 Genomik in einer Minute Plant Breeding 5

6 Overview on public maize Genomische genomics resources Resourcen Status maize genome sequencing: B73 Accessioned Golden Path V2: 2.1 Gb sequence available (of 2.3 Gb) genes identified De novo sequencing of 4 EU flint/dent founder lines (in progress) Resequencing of 27 US NAM founder lines in gene rich regions: 2.9Mio unique SNPs Resequencing of Mo17: 1Mio SNP compared to B73 Resequencing of 26 EU NAM founder lines (in progress) > 2 Mio ESTs Various ongoing projects Maps: Physical Map IBM Map LHRF Map NAM-Map Science Nov 19; 2009 Tools: BAC-Libraries 50K Community Chip Plant Breeding 6

7 DNA Polymorphismen SNP1 SNP2 Ind.1: ACATGGATCCAGGCATGGCTTAG TGGAACAACACACC Ind.2: ACATGGATCCAGACATGGCTTAG TGGAACAACATACC Ind.3: ACATGGATCCAGACATGGCTTAG TGGAACAACATACC Ind.4: ACATGGATCCAGGCATGGCTTAG TGGAACAACATACC SNP funktional oder zufällig Ind.5: ACATGGATCCAGACATGGCTTAG TGGAACAACATACCTGGAACAACATACC Mais: 1 SNP pro 50 Basenpaaren ~ 2.6 x 10 9 Basenpaare/Genom Plant Breeding 7

8 Kopplungsungleichgewicht A C A C A C A C A T A C A T A C G C G T G C G T G T G T G T G T Plant breeding 8

9 Genomische Selektion Reference population Selection candidates Unterschiede PZ - TZ Genotypes and phenotypes Prediction equation Genomic breeding value = w 1 x 1 + w 2 x 2 + w 3 x Marker genotypes Selected genotypes Estimated breeding values Homozygotie Testkreuzungen Familien und GPU Struktur Wiederholte Messungen Migration G x E Dominanz 9

10 Genomische Selektion SNP Marker Ind1 GBV Ind 2 GBV Genetischer Wert eines Individuums id wird aus seinem DNA Profil vorhergesagt Plant Breeding 10

11 Rekurrente Selektion Zyklus 1 Population Linien 200 Linien 50 Linien Elitelinien R i ˆ (, ) M M g r g g R i h P g Zyklus Linien 200 Linien 50 Linien Elitelinien 11

12 Genauigkeit der Vorhersage 732 SNPs 1377 DHs Ertrag Trockensubstanz 12

13 Vorhersage der Testkreuzungsleistung Ertrag 13

14 Erste experimentelle Ergebnisse aus der Maiszüchtung sind ermutigend. Technische Universität München 14

15 Genomische Selektion Harris, New Zealand,

16 Was können wir von der genomischen Selektion erwarten? Literatur bei Fremd- und Selbstbefruchtern empfiehlt den Einsatz genomischer Zuchtwerte für die Selektion. In naher Zukunft wird es bei einer Reihe von Fruchtarten belastbare experimentelle Ergebnisse über mehrere Rekombinationszyklen, Tester und Jahre geben. Die zukünftig verfügbare Datengrundlage wird die Analyse der genetischen Struktur von selektierten Populationen erlauben. Bei Einsatz genomischer Selektion müssen Zuchtschemata grundlegend überarbeitet werden. Plant Breeding 16

17 Pflanzenforschung am WZW Interdisziplinäres Zentrum für genom-basierte Tier- und Pflanzenzüchtung Plant Breeding 17

18 Partner Wissenschaftliche Exzellenz & Technologische Kompetenz U Göttingen Tierzüchtung U Hohenheim Pflanzenzüchtung Bioinformatik Züchtungsinformatik U Kiel Tierzüchtung FLI Mariensee Nutztiergenetik TUM Pflanzenzüchtung Tierzüchtung Genetik Populationsgenetik Bioinformatik Medizin HMGU Bioinformatik Humangenetik LfL Tierzüchtung Industrie KWS SAAT AG Lohmann Tierzucht Anwendungsbezug g 18

19 Datenintegration und Methodenentwicklung Breeders Phenotypes T1 Sequenzen 30 lines Trait Geneics 14 lines, amplicons T2 Genotyping SNP array Genotypes T3 Bioinformatik Metabolites T4 Biomarker Metabolites Geno-/Phenotypes Genotypes Metabolites A1 Statistical Methods A2 Genomic Selection A3 Genomic Prediction A4 Population Genomics 19

20 Investitionen in Ausbildung neue Technologien sind nur mit gut ausgebildetem Nachwuchs zu implementieren stärkere Verzahnung von pflanzen- und agrar- wissenschaftlichen Studiengängen Verbesserung der Durchlässigkeit zwischen benachbarten bioökonomierelevanten Fächern Vermittlung der Attraktivität des grünen Bereichs Plant Breeding 20

Individuelle Genomsequenzen Aussichten für die Tierzucht

Individuelle Genomsequenzen Aussichten für die Tierzucht Individuelle Genomsequenzen Aussichten für die Tierzucht Ruedi Fries WZW / Lehrstuhl für Tierzucht Agrarw. Symposium - 1 Auswirkungen der Genomischen Revolution auf die Tierzucht (und Pflanzenzucht) Agrarw.

Mehr

Themenblock Moderne Methoden in der. Vortrag: Markergestützte Selektion (MAS)

Themenblock Moderne Methoden in der. Vortrag: Markergestützte Selektion (MAS) Klaus Pillen, Markergestützte Selektion in der Pflanzenzüchtung, Magdeburg, 14.10.2010 1 Dialogreihe Innovationsfeld Pflanze Themenblock Moderne Methoden in der Pflanzenforschung und züchtung Vortrag:

Mehr

Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus?

Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Gliederung Seminar des Ausschusses für Genetik der ZAR, Salzburg, 18.03.2010 Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Versuch einer Begriffserklärung Wie weiß man,

Mehr

Potentiale und Herausforderungen der. genomischen Selektion in der Tierzucht

Potentiale und Herausforderungen der. genomischen Selektion in der Tierzucht Potentiale und Herausforderungen der genomischen Selektion in der Tierzucht Jörn Bennewitz Fachgebiet Tiergenetik & Züchtung Institut für Nutztierwissenschaften der Universität Hohenheim Gliederung Gliederung

Mehr

Vom Klimastress zur Genfunktion

Vom Klimastress zur Genfunktion Bayerische Landesanstalt für Landwirtschaft Vom Klimastress zur Genfunktion - genetische Analysen zur züchterischen Nutzung der genetischen Diversität bei Kulturpflanzen Dr. Günther Schweizer Kongress

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Voraussetzungen für die Genomische Selektion beim Pferd

Voraussetzungen für die Genomische Selektion beim Pferd Agrar- und Ernährungswissenschaftliche Fakultät Institut für Tierzucht und Tierhaltung Voraussetzungen für die Genomische Selektion beim Pferd Prof. Dr. Georg Thaller 32. Jahrestagung zur Pferdegesundheit

Mehr

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen Fotos: M. Rindlisbacher Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen H. Hasler 1, F. Berruex 3, B. Haase 2, C. Flury 1, T. Leeb 2, V. Gerber 4, H. Simianer 5, D. Burger 3, P.A. Poncet

Mehr

Informationstechnologie in der Pflanzenzüchtung. Biocomputing in einem Züchtungsunternehmen. Andreas Menze KWS SAAT AG, Einbeck

Informationstechnologie in der Pflanzenzüchtung. Biocomputing in einem Züchtungsunternehmen. Andreas Menze KWS SAAT AG, Einbeck Informationstechnologie in der Pflanzenzüchtung Biocomputing in einem Züchtungsunternehmen Andreas Menze KWS SAAT AG, Einbeck Biocomputing in einem Züchtungsunternehmen Biocomputing Was ist das? Wozu wird

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Aktuelle Arbeiten zur genomischen Selektion bei Qualitas

Aktuelle Arbeiten zur genomischen Selektion bei Qualitas Aktuelle Arbeiten zur genomischen Selektion bei Qualitas Swissherdbook Birgit Gredler, Beat Bapst, Franz Seefried Qualitas AG SABRE TP Workshop 4. Juni 2013, Zug Übersicht Genomische Selektion in der Routine-ZWS

Mehr

Zukünftige Entwicklungen und Anwendungen der genomischen Selektion (GS)

Zukünftige Entwicklungen und Anwendungen der genomischen Selektion (GS) SV agung vom 29. März 2012, Universität Irchel, Zürich Zukünftige Entwicklungen und nwendungen der genomischen Selektion (GS) Ruedi Fries und Hubert Pausch Lehrstuhl für ierzucht echnische Universität

Mehr

Identifikation von genetischen Kopienzahl-Variationen in Zusammenhang mit der komplexen Lungenkrankheit Sarkoidose

Identifikation von genetischen Kopienzahl-Variationen in Zusammenhang mit der komplexen Lungenkrankheit Sarkoidose Identifikation von genetischen Kopienzahl-Variationen in Zusammenhang mit der komplexen Lungenkrankheit Sarkoidose Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät

Mehr

Genomische Selektion beim Schwein Fährt der Zug schon und wenn ja, wohin?

Genomische Selektion beim Schwein Fährt der Zug schon und wenn ja, wohin? Genomische Selektion beim Schwein Fährt der Zug schon und wenn ja, wohin? Dr. Kay-Uwe Götz Bayerische Landesanstalt für Landwirtschaft Institut für Tierzucht Wer sich neben der Schweinezucht auch für Rinder

Mehr

Die Grundlagen der genomischen Selektion. Jörn Bennewitz. Institut für Tierhaltung und Tierzüchtung Universität Hohenheim

Die Grundlagen der genomischen Selektion. Jörn Bennewitz. Institut für Tierhaltung und Tierzüchtung Universität Hohenheim Die Grundlagen der genomischen Selektion Jörn Bennewitz Institut für Tierhaltung und Tierzüchtung Universität Hohenheim Beitrag zum Rinderworkshop, 17.-18. Februar 2009 in Ülzen Einleitung Der Zuchtfortschritt

Mehr

DNA-Test zur Rassebestimmung bei Windhunden

DNA-Test zur Rassebestimmung bei Windhunden DNA-Test zur Rassebestimmung bei Windhunden Dr. Barbara Wimmer, Eurofins Medigenomix GmbH www.eurofins.com Wer wir sind - Eurofins Scientific Gruppe 150 Labore in 30 Ländern in Europa, USA, Asien & Südamerika

Mehr

Individuelle Genomsequenzierung von Nutztieren auf dem Weg zur genomischen Selektion 2.0

Individuelle Genomsequenzierung von Nutztieren auf dem Weg zur genomischen Selektion 2.0 Züchtungskunde, 83, (4/5) S. 371 381, 2011, ISSN 0044-5401 Verlag Eugen Ulmer, Stuttgart Original Article Individuelle Genomsequenzierung von Nutztieren auf dem Weg zur genomischen Selektion 2.0 R. Fries

Mehr

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung FRAUNHOFER-INSTITUT FÜR GRENZFLÄCHEN- UND BIOVERFAHRENSTECHNIK IGB NEXT-GENERATION SEQUENCING Von der Probenvorbereitung bis zur bioinformatischen Auswertung »Progress in science depends on new techniques,

Mehr

Saatgut und Lebensmittel: Zunehmende Monopolisierung durch Patente und Marktkonzentration.

Saatgut und Lebensmittel: Zunehmende Monopolisierung durch Patente und Marktkonzentration. Saatgut und Lebensmittel: Zunehmende Monopolisierung durch Patente und Marktkonzentration www.no-patents-on-seeds.org Marktkonzentration: Zehn Unternehmen kontrollieren etwa 2/3 des globalen Saatgutmarktes

Mehr

Stellungnahme des Ausschusses für Genetisch-Statistische Methoden der DGfZ zur Fragestellung Genomische Zuchtwertschätzung und Selektion 1

Stellungnahme des Ausschusses für Genetisch-Statistische Methoden der DGfZ zur Fragestellung Genomische Zuchtwertschätzung und Selektion 1 Züchtungskunde, 83, (4/5) S. 241 247, 2011, ISSN 0044-5401 Verlag Eugen Ulmer, Stuttgart Stellungnahme des Ausschusses für Genetisch-Statistische Methoden der DGfZ zur Fragestellung Genomische Zuchtwertschätzung

Mehr

Genomische Selektion. Dr. Fritz Schmitz-Hsu, Senior Geneticist. Delegiertenversammlung. Ostschweizer Holsteinzuchtverband. 12.

Genomische Selektion. Dr. Fritz Schmitz-Hsu, Senior Geneticist. Delegiertenversammlung. Ostschweizer Holsteinzuchtverband. 12. Genomische Selektion Dr. Fritz Schmitz-Hsu, Senior Geneticist Delegiertenversammlung Ostschweizer Holsteinzuchtverband 12. März 2009 Swissgenetics 2009 Zuchtwert bei Geburt eines Kalbes bereits mit einer

Mehr

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl Übung II Einführung, Teil 1 Arbeiten mit Ensembl Ensembl Genome Browser (Bereitstellung von Vielzeller Genomen) Projekt wurde 1999 initiiert Projektpartner EMBL European Bioinformatics Institute (EBI)

Mehr

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

Inhalt des Vortrags. o genetische Grundlagen. o Wie findet man Erbfehler? o Zusammenfassung. Was ist ein Haplotyp?

Inhalt des Vortrags. o genetische Grundlagen. o Wie findet man Erbfehler? o Zusammenfassung. Was ist ein Haplotyp? Inhalt des Vortrags o genetische Grundlagen Was ist ein Haplotyp? o Wie findet man Erbfehler? basierend auf Phänotypen: Zwergwuchs basierend auf Genotypen: Braunvieh Haplotyp II o Zusammenfassung einige

Mehr

Innovation Pflanzenzüchtung

Innovation Pflanzenzüchtung Innovation Pflanzenzüchtung Leistungsvorhersage mittels tiefer genetischer und biologischer Markerinformationen Thomas Altmann 25. Hülsenberger Gespräche 21. Mai 2014 Weltweite Getreideproduktion (bisherige

Mehr

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Karl Heinimann, MD PhD Medizinische Genetik Universitätskinderspital beider Basel karl.heinimann@unibas.ch 14. Internationales Seminar DESO St.

Mehr

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie:

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie: Foto: Alina Ackermann Unsere Forschungsschwerpunkte Synthetische Biologie: Im Fachgebiet Synthetische Biologie arbeiten Biologen, Chemiker und Ingenieure zusammen, um biologische Systeme zu erzeugen, die

Mehr

Aktuelle Entwicklungen zur genomischen Selektion. Reinhard Reents. Vereinigte Informationssysteme Tierhaltung w.v. (vit), Verden

Aktuelle Entwicklungen zur genomischen Selektion. Reinhard Reents. Vereinigte Informationssysteme Tierhaltung w.v. (vit), Verden Aktuelle Entwicklungen zur genomischen Selektion Reinhard Reents Vereinigte Informationssysteme Tierhaltung w.v. (vit), Verden Einleitung Die Analyse von molekulargenetischen Daten erfreut sich eines starken

Mehr

Klinik für Hepatologie. Christoph Malenke

Klinik für Hepatologie. Christoph Malenke Dense genotyping of immune-related disease regions identifies nine new risk loci for primary sclerosing cholangitis Nat Genet. 2013 June; 45(6): 670 675 Christoph Malenke Klinik für Hepatologie 2 Gliederung

Mehr

Einblicke in das menschliche Erbgut (Genom) am Computer

Einblicke in das menschliche Erbgut (Genom) am Computer Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Binger Nacht der Wissenschaft - 16.04.2010 Das menschliche Genom ist entschlüsselt

Mehr

Bioinformatics Analysis of Rat Muscle Microarray Gene Expression and Genetics of Pig Exterior Traits

Bioinformatics Analysis of Rat Muscle Microarray Gene Expression and Genetics of Pig Exterior Traits Diss. ETH No. 17921 Bioinformatics Analysis of Rat Muscle Microarray Gene Expression and Genetics of Pig Exterior Traits A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH For

Mehr

QTL$MAPPING$OF$IMPORTANT$AGRICULTURAL$AND$LIFE$HISTORY$TRAITS$ IN$THE$PLANT$PATHOGENIC$FUNGUS!ZYMOSEPTORIA!TRITICI$ $

QTL$MAPPING$OF$IMPORTANT$AGRICULTURAL$AND$LIFE$HISTORY$TRAITS$ IN$THE$PLANT$PATHOGENIC$FUNGUS!ZYMOSEPTORIA!TRITICI$ $ DISS.ETHNO.22827 QTLMAPPINGOFIMPORTANTAGRICULTURALANDLIFEHISTORYTRAITS INTHEPLANTPATHOGENICFUNGUS!ZYMOSEPTORIA!TRITICI Athesissubmittedtoattainthedegreeof DOCTOROFSCIENCESofETHZURICH (Dr.sc.ETHZurich)

Mehr

molekularen Rinderzucht

molekularen Rinderzucht Möglichkeiten der molekularen Rinderzucht Johann Sölkner Gliederung Einleitung Molekulare Marker Suche nach wichtigen Genen Molekulare Zuchtwertschätzung Auswirkung auf Zuchtprogramme Versprechen der Molekulargenetiker

Mehr

Agrocluster CropSense.net. Ulrich Schurr, Forschungszentrum Jülich Halbzeitkonferenz Bioökonomie, 5.6.2014

Agrocluster CropSense.net. Ulrich Schurr, Forschungszentrum Jülich Halbzeitkonferenz Bioökonomie, 5.6.2014 Agrocluster CropSense.net Ulrich Schurr, Forschungszentrum Jülich Halbzeitkonferenz Bioökonomie, 5.6.2014 Herausforderung Phänotypisierung EPSO Whitepaper Plant Phenotyping 2010 Nature Gene*cs Dec. 2010

Mehr

Comparative molecular approaches to identify host determinants mediating adhesion of E. coli F4 strains in pigs

Comparative molecular approaches to identify host determinants mediating adhesion of E. coli F4 strains in pigs Dissertation ETH number 18518 Comparative molecular approaches to identify host determinants mediating adhesion of E. coli F4 strains in pigs A dissertation submitted to ETH Zurich for the degree of Doctor

Mehr

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Christian-Albrechts-Universität zu Kiel Next-Generation Sequencing (NGS) Nach Sanger Sequencing (1977) zweite Generation

Mehr

Was ist Bioinformatik?

Was ist Bioinformatik? 9. Kurstag: Bioinformatik Der Begriff "Bioinformatik" wurde 1989 erstmals von D.R. Masys im JOURNAL OF RESEARCH OF THE NATIONAL INSTITUTE OF STANDARDS AND TECHNOLOGY erwähnt. Was ist Bioinformatik? Die

Mehr

Perspektiven der Grünen Gentechnik: Eine realistische Bestandsaufnahme

Perspektiven der Grünen Gentechnik: Eine realistische Bestandsaufnahme Perspektiven der Grünen Gentechnik: Eine realistische Bestandsaufnahme Dr. Jan van Aken Universität Hamburg Forschungsschwerpunkt Biotechnik, Gesellschaft und Umwelt Forschungsgruppe Medizin/Neurobiologie

Mehr

Vorlesung 2 GRUNDLAGEN

Vorlesung 2 GRUNDLAGEN Vorlesung 2 GRUNDLAGEN Überblick Genetische Faktoren Quantitative Genetik Molekulare Genetik Untersuchungsdesigns 2 Genetische Faktoren Davey-Smith et al., 2007 Genetische Faktoren sind nicht korreliert

Mehr

VERTIEFENDE INFORMATION Personalisierte Medizin: Bessere Diagnosen mit Hilfe der DNA-Analyse?

VERTIEFENDE INFORMATION Personalisierte Medizin: Bessere Diagnosen mit Hilfe der DNA-Analyse? - 1 - Personalisierte Medizin ist der Überbegriff für die Strategie, Medikamente und Therapien zu entwickeln, die besser auf den einzelnen Patienten zugeschnitten sind. Dabei sollen routinemäßige Gentests

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 011 9. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (.000.000.000 Basenpaare)

Mehr

Tier- und Pflanzenzüchtung

Tier- und Pflanzenzüchtung ier- und Pflanzenzüchtung hispita Spelzmais (Mittelamerika) Serrano Zahnmais (US) Baby White Rice Popcorn (US) Blanco erciopelo elbe Beere (Zierform, Deutschland) Kein Korn gleicht dem anderen: Mehrere

Mehr

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie:

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie: Foto: Andreas Arnold Unsere Forschungsschwerpunkte Synthetische Biologie: Im Fachgebiet Synthetische Biologie arbeiten Biologen, Chemiker und Ingenieure zusammen, um biologische Systeme zu erzeugen, die

Mehr

Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren

Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren Institut für Medizinische Genetik Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren Prof. Dr. med. Anita Rauch Seite 1 Häufigkeit von Intelligenzminderung (ID) IQ

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Genomische Zuchtwerte für die kongenitale sensorineurale Taubheit beim Dalmatiner

Genomische Zuchtwerte für die kongenitale sensorineurale Taubheit beim Dalmatiner Genomische Zuchtwerte für die kongenitale sensorineurale Taubheit beim Dalmatiner Prof. Dr. Ottmar Distl Institut für Tierzucht und Vererbungsforschung Stiftung Tierärztliche Hochschule Hannover Bünteweg

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Einblicke in das menschliche Genom aus Sicht der Bioinformatik Prof. Dr. Antje Krause FH Bingen a.krause@fh-bingen.de Kurzer Ausflug in die Genetik DNA (Desoxyribonukleinsäure)

Mehr

PR Statistische Genetik und Bioinformatik

PR Statistische Genetik und Bioinformatik PR Statistische Genetik und Bioinformatik Johanna Bertl Institut für Statistik und OR, Universität Wien Oskar-Morgenstern-Platz 1/6.344, 1090 Wien, Tel.: 01-4277-38617 johanna.bertl@univie.ac.at, homepage.univie.ac.at/johanna.bertl

Mehr

Gestaltung der Zukunft von Genomik in der Tierzucht

Gestaltung der Zukunft von Genomik in der Tierzucht Züchtungskunde, 83, (1) S. 27 33, 2011, ISSN 0044-5401 Verlag Eugen Ulmer, Stuttgart Gestaltung der Zukunft von Genomik in der Tierzucht A. Eggen 1 Zusammenfassung Die Entwicklung der genomischen Technologien

Mehr

Die Universität stellt sich vor

Die Universität stellt sich vor Die Universität stellt sich vor Prof. Dr. Till Tantau. Juni Überblick Die Universität zu Lübeck Exzellente Forschung...... führt zu exzellenter Lehre Die Universität in Zahlen Studierende. Professoren

Mehr

Read Mapping Projektmanagement im So3warebereich SeqAn

Read Mapping Projektmanagement im So3warebereich SeqAn Read Mapping Projektmanagement im So3warebereich SeqAn David Weese April 2010 Inhalt Einführung Reads erzeugen read simulator SWP Teilprojekte Projektplan EINFÜHRUNG 2 nd /Next GeneraGon Sequencing Technologien:

Mehr

DAS METABOLOM: ERNÄHRUNGSSTATUS, METABOLISMUS, METABOLITEN

DAS METABOLOM: ERNÄHRUNGSSTATUS, METABOLISMUS, METABOLITEN DAS METABOLOM: ERNÄHRUNGSSTATUS, METABOLISMUS, METABOLITEN Das Metabolom Extrinsiche Faktoren Ernährung (Nährstoffe und nicht nutritive Lebensmittelinhaltsstoffe) Arzneimittel Physische Aktivität Darmflora

Mehr

Transcriptomics: Analysis of Microarrays

Transcriptomics: Analysis of Microarrays Transcriptomics: Analysis of Microarrays Dion Whitehead dion@uni-muenster.de Division of Bioinformatics, Westfälische Wilhelms Universität Münster Microarrays Vorlesungsüberblick : 1. Überblick von Microarray

Mehr

Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG

Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin Die richtige Therapie für den richtigen Patienten Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin: Was ist denn das? Februar 2011 Personalisierte Medizin:

Mehr

Next Generation Sequencing für die Primärdiagnostik. Focus: Resistenztestung

Next Generation Sequencing für die Primärdiagnostik. Focus: Resistenztestung Next Generation Sequencing für die Primärdiagnostik Focus: Resistenztestung Stefan Niemann Molekulare Mykobakteriologie Forschungszentrum Borstel TTU-TB Deutsches Zentrum für Infektionsforschung Outline

Mehr

Biowissenschaftlich recherchieren

Biowissenschaftlich recherchieren Biowissenschaftlich recherchieren Uber den Einsatz von Datenbanken und anderen Ressourcen der Bioinformatik Nicola Gaedeke Birkhauser Basel Boston Berlin Inhaltsverzeichnis Vorwort xi 1 Die Informationssucheim

Mehr

Bioinformatische Suche nach pre-mirnas

Bioinformatische Suche nach pre-mirnas Bioinformatische Suche nach pre-mirnas Vorbereitung: Lesen Sie die Publikationen Meyers et al., 2008, Criteria for Annotation of Plant MicroRNAs und Thieme et al., 2011, SplamiR prediction of spliced mirnas

Mehr

Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer. www.genomaustria.at

Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer. www.genomaustria.at Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer www.genomaustria.at Warum sind wir heute hier? Wir sind heute hier, um über das Thema Erbgut Sequenzierung

Mehr

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Florian Frommlet Institut für medizinische Statistik, Medizinische Universität Wien Wien, November 2013 Einführung DNA Molekül Zwei

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

Bioinformatik I (Einführung)

Bioinformatik I (Einführung) Kay Diederichs, Sommersemester 2015 Bioinformatik I (Einführung) Algorithmen Sequenzen Strukturen PDFs unter http://strucbio.biologie.unikonstanz.de/~dikay/bioinformatik/ Klausur: Fr 17.7. 10:00-11:00

Mehr

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema Gentechnologie Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Die Genklonierung in Bakterien Vektor-DNA Spender-DNA Restriktionsenzym Rekombinante

Mehr

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held ACT/CVS neueste gendiagnostische Verfahren 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held DNA, Gene, Chromosomen DNA besteht aus den Basenpaaren Adenin - Thymin

Mehr

Bioinformatik Statistik und Analyse mit R 22.05.2009-1 -

Bioinformatik Statistik und Analyse mit R 22.05.2009-1 - Bioinformatik Statistik und Analyse mit R 22.05.2009-1 - Definition: Bioinformatik Die Bioinformatik http://de.wikipedia.org/wiki/bioinformatik (englisch bioinformatics, auch computational biology) ist

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

Grundlegende Experimente der Molekulargenetik

Grundlegende Experimente der Molekulargenetik Übung 12 Wiederholung/Zusatzübung Inhalte: Mendelscher Erbgang Grundlegende Experimente der Molekulargenetik Transposons Methoden 1. Sie haben drei runde, gelbe Erbsen (A, B und C). Aus jeder der drei

Mehr

Software Entwicklung in der Wissenschaft

Software Entwicklung in der Wissenschaft Software Entwicklung in der Wissenschaft Ein Dialog zwischen Theorie und Praxis einiger Softwaretechnikelemente anhand eines Interviews Webadresse, E-Mail oder sonstige Referenz Seite 1/30 07.10.2015 Gliederung

Mehr

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory Sequenzierung Norbert Arnold Neue Sequenziertechnologien (seit 2005) Next Generation Sequenzierung (NGS, Erste Generation) Unterschiedliche Plattformen mit unterschiedlichen Strategien Roche 454 (basierend

Mehr

Die Entschlüsselung des menschlichen Genoms Erkenntnisse und Perspektiven

Die Entschlüsselung des menschlichen Genoms Erkenntnisse und Perspektiven Die Entschlüsselung des menschlichen Genoms Erkenntnisse und Perspektiven Prof. Dr. habil. Egon Amann 31. Oktober 2012 Profilmodul: Grundlagen und Anwendungen der Genom- und Proteomforschung WS 2012/13

Mehr

Moderne Evolutionsforschung in Wien: Entwicklungen und Herausforderungen

Moderne Evolutionsforschung in Wien: Entwicklungen und Herausforderungen Univ.-Prof. Dr. Joachim Hermisson Moderne Evolutionsforschung in Wien: Entwicklungen und Herausforderungen 150 Jahre nach Charles Darwins "Origin of Species" führen neue DNA- Sequenzierungstechnologien

Mehr

Grüne Gentechnik. Parlamentarischer Abend der Deutschen Forschungsgemeinschaft am 22. März 2010 in Berlin

Grüne Gentechnik. Parlamentarischer Abend der Deutschen Forschungsgemeinschaft am 22. März 2010 in Berlin Grüne Gentechnik Parlamentarischer Abend der Deutschen Forschungsgemeinschaft am 22. März 2010 in Berlin Was bringt die Grüne Gentechnik in der Pflanzenzüchtung? Christian Jung, Universität Kiel Die Entwicklung

Mehr

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien III. Interdisziplinärer Kongress JUNGE NATURWISSENSCHAFT

Mehr

Saatguthandelstag am 22./23. Mai 2014

Saatguthandelstag am 22./23. Mai 2014 Saatguthandelstag am 22./23. Mai 2014 Innovationen in der Pflanzenzüchtung von Mendel bis zur Gentechnik und darüber hinaus Prof. Dr. Thomas Miedaner Innovationen in der Pflanzenzüchtung Von Mendel bis

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

Genomische Selektion

Genomische Selektion Inhaltsverzeichnis 1 Einleitung 1 2 Grundlagen genomische Selektion 1 2.1 Was versteht man unter genomischer Selektion?........ 1 2.2 SNP-Marker........................... 1 2.3 Vom Marker zum Gen.....................

Mehr

Ethische Fragestellungen zur Personalisierten Medizin

Ethische Fragestellungen zur Personalisierten Medizin Ethische Fragestellungen zur Personalisierten Medizin Softskills Seminar Ethik 05.02.2013 Ethik in der Personalisierten Medizin Personalisierte Medizin Ihre Anwendungsgebiete Fallbeispiele Wohin mit der

Mehr

Beitrag der Züchtung zur nachhaltigen Intensivierung

Beitrag der Züchtung zur nachhaltigen Intensivierung Beitrag der Züchtung zur nachhaltigen Intensivierung Frank Ordon www.jki.bund.de http://royalsociety.org/uploadedfiles/royal_society_content/policy/publications/2009/4294967719.pdf Entwicklung der Maisanbaufläche

Mehr

Bioinformatik an der FH Bingen

Bioinformatik an der FH Bingen Bioinformatik an der FH Bingen Prof. Dr. Antje Krause 05.11.2010 Wie alles begann... 1955 erste Proteinsequenz (nach 12 Jahren Arbeit) veröffentlicht (Insulin vom Rind) Frederick Sanger MALWTRLRPLLALLALWPPPPA

Mehr

DATENQUALITÄT IN GENOMDATENBANKEN

DATENQUALITÄT IN GENOMDATENBANKEN DATENQUALITÄT IN GENOMDATENBANKEN Alexander Fehr 28. Januar 2004 Gliederung Motivation Biologische Grundkonzepte Genomdaten Datenproduktion und Fehler Data Cleansing 2 Motivation (1) Genomdatenbanken enthalten

Mehr

62. Tagung. 22.-23. November 2011. Von markergestützter Selektion zu genomischer Selektion in der Pflanzenzüchtung. Wheat stress und Robust Wheat

62. Tagung. 22.-23. November 2011. Von markergestützter Selektion zu genomischer Selektion in der Pflanzenzüchtung. Wheat stress und Robust Wheat Vereinigung der Pflanzenzüchter und Saatgutkaufleute Österreichs 62. Tagung 22.-23. November 2011 Von markergestützter Selektion zu genomischer Selektion in der Pflanzenzüchtung Wheat stress und Robust

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 01 8. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (~.000.000.000 Basenpaare)

Mehr

Einfluss der genetischen Architektur auf die empirische Genauigkeit der genomischen Zuchtwertschätzung

Einfluss der genetischen Architektur auf die empirische Genauigkeit der genomischen Zuchtwertschätzung Einfluss der genetischen Architektur auf die empirische Genauigkeit der genomischen Zuchtwertschätzung M. Kramer 1, F. Biscarini 1, B. Bapst 2, C. Stricker 3, H. Simianer 1 1 Department für Nutztierwissenschaften,

Mehr

Validierung praxisrelevanter Marker für die Züchtung klimaangepasster und gesunder Gerstensorten

Validierung praxisrelevanter Marker für die Züchtung klimaangepasster und gesunder Gerstensorten Projektverbund Strategien zur Anpassung von Kulturpflanzen an den Klimawandel Validierung praxisrelevanter Marker für die Züchtung klimaangepasster und gesunder Gerstensorten Dr. Markus Herz Bayerische

Mehr

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Bioinformatik

Mehr

VL Algorithmische BioInformatik (19710) WS2013/2014 Woche 16 - Mittwoch. Annkatrin Bressin Freie Universität Berlin

VL Algorithmische BioInformatik (19710) WS2013/2014 Woche 16 - Mittwoch. Annkatrin Bressin Freie Universität Berlin VL Algorithmische BioInformatik (19710) WS2013/2014 Woche 16 - Mittwoch Annkatrin Bressin Freie Universität Berlin Vorlesungsthemen Part 1: Background Basics (4) 1. The Nucleic Acid World 2. Protein Structure

Mehr

Swiss Low Input Genetics (SLIG):

Swiss Low Input Genetics (SLIG): Swiss Low Input Genetics (SLIG): Breeding functional dairy cows for low-input production systems using whole genome sequence data SABRE Treffen 04. Juni 2013 Übersicht Das Projekt Sequenzierung Ziel Umfang

Mehr

Nutrigenomics der Schlüssel zur personalisierten Ernährung?

Nutrigenomics der Schlüssel zur personalisierten Ernährung? Eidgenössisches Departement für Wirtschaft, Bildung und Forschung WBF Agroscope Nutrigenomics der Schlüssel zur personalisierten Ernährung? SMP Symposium 2016 Ernährungstrends Barbara Walther 13. September

Mehr

Möglichkeiten und Grenzen der Genomischen Selektion bei landwirtschaftlichen Nutztieren

Möglichkeiten und Grenzen der Genomischen Selektion bei landwirtschaftlichen Nutztieren Möglichkeiten und Grenzen der Genomischen Selektion bei landwirtschaftlichen Nutztieren Thematik heute: 1. Milchrind 1. Allgemeine Anmerkungen 2. König, Simianer, Willam (2009), J. Dairy Sci.: Economic

Mehr

Meine Gene, meine Gesundheit

Meine Gene, meine Gesundheit AIW-Hauptversammlung, SportSchloss Velen, 4. Mai 2006 Prof. Dr. Dr. Christian De Bruijn IPMG Institut für präventiv-medizinisches Gesundheitsmanagement, Velen Die Molekularmedizin ist die Medizin von Morgen

Mehr

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Prof. Dr. med. Brigitte Schlegelberger 670513011/15 Olaparib Zulassung in Europa: Rezidiv eines Platin-sensitiven Ovarialkarzinoms

Mehr

Übung II. Einführung. Teil 1 Arbeiten mit Sequenzen recombinante DNA

Übung II. Einführung. Teil 1 Arbeiten mit Sequenzen recombinante DNA Übung II Einführung Teil 1 Arbeiten mit Sequenzen recombinante DNA Recombinante DNA Technologie Protein Synthese In vitro Expression Libraries Gene Transfer in Tieren und Pflanzen Recombinante DNA Technologie

Mehr

Wem gehört das Leben? Hofgeismar,

Wem gehört das Leben? Hofgeismar, Wem gehört das Leben? Hofgeismar, 21.10.2010 Dr. Christoph Then, Testbiotech e.v. München www.testbiotech.org christoph.then@testbiotech.org www.testbiotech.org Geschichte des Patentrechtes 1980: Mikroorganismus

Mehr

Software Kurzanleitung

Software Kurzanleitung Software Kurzanleitung Für den Einsatz mit dem IMMUCOR MIA FORA NGS HLA Typing-Kit Nur zur In-vitro-Diagnostik Seite 1 von 18 Dieses Handbuch wurde für den Einsatz mit der Software FORA NGS SR-790-00017

Mehr

Kapitel 3. Populationsgenetik: Gene und ihre Frequenzen

Kapitel 3. Populationsgenetik: Gene und ihre Frequenzen 701-245-00L Pop - & Evol biol - 25 - Kap. 3: Populationsgenetik Kapitel 3 Populationsgenetik: Gene und ihre Frequenzen 3.1 Populationsgenetik Mikroevolutive Prozesse bilden die Grundlage allen Evolutionsgeschehens.

Mehr

Von Hohenheim in die weite Welt der Pflanzenzüchtung. Andreas J. Büchting Hohenheim, 19. November 2012

Von Hohenheim in die weite Welt der Pflanzenzüchtung. Andreas J. Büchting Hohenheim, 19. November 2012 Von Hohenheim in die weite Welt der Pflanzenzüchtung Hohenheim, 19. November 2012 Universität Hohenheim 1967 2 Forschungsfreiheit à la 1968 Ein Auszug aus der illustrierten Studentenzeitschrift Hohenheimer

Mehr

Genomische Selektion in der Hundezucht am Beispiel der Hüftgelenkdysplasie

Genomische Selektion in der Hundezucht am Beispiel der Hüftgelenkdysplasie Genomische Selektion in der Hundezucht am Beispiel der Hüftgelenkdysplasie Prof. Dr. Ottmar Distl Institut für Tierzucht und Vererbungsforschung Stiftung Tierärztliche Hochschule Hannover Bünteweg 17p

Mehr

Zentronukleäre Myopathien von der Diagnose zur Therapie

Zentronukleäre Myopathien von der Diagnose zur Therapie MTM Familientreffen Göttingen, 5./6. Juni 2014 Zentronukleäre Myopathien von der Diagnose zur Therapie Dr. Johann Böhm IGBMC, Strasbourg Ein paar Worte über Strasbourg.and über das IGBMC Ein paar Worte

Mehr

Anwendung und Regulierung der neuen Pflanzenzüchtungstechniken aus deutscher Sicht. Hans-Jörg Buhk Quedlinburg, 18.06.2014

Anwendung und Regulierung der neuen Pflanzenzüchtungstechniken aus deutscher Sicht. Hans-Jörg Buhk Quedlinburg, 18.06.2014 Anwendung und Regulierung der neuen Pflanzenzüchtungstechniken aus deutscher Sicht Hans-Jörg Buhk Quedlinburg, 18.06.2014 New Techniques Working Group Einrichtung: Auf Vorschlag von national zuständigen

Mehr

Was ist Bioinformatik?

Was ist Bioinformatik? Bioinformatik: Vom Genom zum Medikament Was ist Bioinformatik? Biowissenschaften Bioinformatik Informatik Die Bioinformatik entwickelt ein virtuelles Biolabor. Die Bioinformatik entwickelt ein virtuelles

Mehr

Sinnvoller Umgang mit DNA-Tests

Sinnvoller Umgang mit DNA-Tests Sinnvoller Umgang mit DNA-Tests - Eine Zuchtmethode - - Kleine Hundepopulation - Helga Eichelberg Welpenstatistik Eingetragene Welpen 2006 2005 2004 Pinscher 384 237 246 ca. 80 Würfe Zwerge 197 250 251

Mehr