Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen"

Transkript

1 Dr. rer. nat. Jasmin Wellbrock und Prof. Dr. Walter Fiedler Projektbericht an die Alfred & Angelika Gutermuth Stiftung Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen Hintergrund In der Leukämie-Forschung sind Leukämie-Stammzellen (leukemic stem cells, LSC) in den Fokus der zielgerichteten Therapie-Strategien gerückt, da sie aufgrund ihrer Chemotherapie- Resistenz für die schlechte Prognose der akuten myeloischen Leukämie (AML) verantwortlich gemacht werden. Im Knochenmark stehen die LSCs innerhalb der so genannten Leukämie- Stammzell-Nische in enger Interaktion mit einer Reihe von Stromazellen. Obschon bekannt ist, dass das Milieu innerhalb der Leukämie-Stammzell-Nische nur über einen sehr geringen Sauerstoff-Anteil verfügt, wurde der Großteil der bisherigen In-vitro-Studien über die Wechselwirkung von LSCs und Stromazellen unter normoxischen Bedingungen durchgeführt. Es gibt jedoch erste Hinweise darauf, dass die Sauerstoff-Konzentration Einfluss auf die Interaktion von Leukämie- und Stromazellen nimmt. Ziel der vorliegenden Studie war zu ergründen, welchen Einfluss ein hypoxisches Milieu auf die Biologie von Leukämiezellen ausübt. Durchführung und Ergebnisse der Experimente Analyse der Proliferationskapazität von AML-Zellen und Stromazellen unter Hypoxie Zunächst sollte untersucht werden, ob sich AML-Zellen und Knochenmarkstromazellen unter Hypoxie anders verhalten als unter Normoxie. Als hypoxische Bedingung wurde ein Sauerstoffgehalt von 6% ausgewählt, was einer moderaten Hypoxie im Knochenmark entspricht. Es wurden Proliferationsanalysen über 3 Tage durchgeführt und die Zellzahl anschließend mit einem Zellzählgerät (ViCELL XR der Fa. Beckman Coulter) ausgezählt. Es wurden sieben unterschiedliche AML-Zelllinien untersucht: HL60, Kasumi-1, KG-1, MOLM13, MV4-11, OCI-AML5 und UKE-1. Bei allen Zelllinien zeigte sich ein vermindertes Zellwachstum unter hypoxischen Bedingungen. In Abbildung 1a und b ist dieser Effekt examplarisch für die Zelllinien OCI-AML5 und Kasumi-1 dargestellt. Darüber hinaus wurde die Proliferation von primären AML-Blasten untersucht, die frisch aus dem Knochenmark von AML-Patienten isoliert wurden. Hier zeigte sich interessanterweise ein umgekehrter Effekt, da bei ca. 50% der Proben eine verstärkte Proliferation unter Hypoxie zu verzeichnen war (in Abbildung 1c exemplarisch für eine AML-Probe gezeigt). Ähnlich verhielt es sich mit Knochenmarkstromazellen: sowohl primäre Osteoblasten als auch mesenchymale Stromazellen zeigten ein verstärktes Zellwachstum unter Hypoxie (Abbildung 1d). 1

2 Abbildung 1. Proliferation von AML-Zellen und Stromazellen unter Hypoxie. Abbildung 1. Proliferation von AML-Zellen und Stromazellen unter Hypoxie. Dargestellt ist die Proliferationskapazität von den AML-Zelllinien OCI-AML5 (a) und Kasumi-1 (b), primärer Blasten eines AML-Patienten (c) sowie primärer Osteoblasten (d). Die Zellen wurden für jeweils 3 Tagen unter Normoxie (20% O 2) sowie Hypoxie (6% O 2) kultiviert, bevor die Zellzahl mittels ViCELL XR Counter (für a-c) oder mittels WST-1 Proliferationsreagenz an einem ELISA-Reader bestimmt wurde (d). Cytarabin-Resistenz unter hypoxischen Bedingungen In der Studie haben wir uns intensiv damit auseinandergesetzt, ob Hypoxie als alleiniger Faktor ausreicht, um die Resistenz gegenüber Chemotherapie zu verstärken. Hierzu wurden Proliferationsanalysen sowie Colony-Formation-Assays von AML-Zelllinien und primären AML- Blasten unter Behandlung des Nukleosid-Analogons Cytarabin durchgeführt, welches seit mehreren Jahrzehnten die Standardchemotherapie zur Behandlung der AML darstellt. Zunächst wurden die AML-Zelllinien MOLM13, HL60, Kasumi-1, KG-1, MV4-11, OCI-AML5 und OCI-M1 sowie frisch isolierte Blasten von 8 AML-Patienten für 3 Tage unter normoxischen oder hypoxischen Bedingungen kultiviert, damit die Zellen sich an das Sauerstoffmilieu adaptieren konnten. Anschließend wurden die Zellen in definierter Zellzahl ausplattiert und mit unterschiedlichen Cytarabin-Konzentrationen behandelt, bevor die Zellzahl nach 3 Tagen am ViCELL XR Counter bestimmt wurde. Die Mehrzahl der AML-Zelllinien zeigte unter Hypoxie eine deutlich verstärkte Resistenz gegenüber Cytarabin als unter Normoxie (Abbildung 2). Die HL60-Zellen zeigten hierbei die stärkste Resistenz, da die Cytarabin-induzierte Wachstumshemmung unter Hypoxie bei allen untersuchten Cytarabinkonzentrationen unter Hypoxie deutlich vermindert war (Abbildung 2a). Die Zelllinien Kasumi-1, MOLM13, OCI-AML5 und MV4-11 zeigten ebenfalls eine deutliche Cytarabin-Resistenz unter hypoxischen Bedingungen (Abbildung 2b-e). Lediglich die Zelllinie KG-1 zeigte nur leicht verminderte Unterschiede in der Cytarabin-Resistenz (Abbildung 2f). 2

3 Abbildung 2. Hypoxie-vermittelte Cytarabin-Resistenz. Abbildung 2. Hypoxie-vermittelte Cytarabin-Resistenz. AML-Zelllinien (a-f) oder primäre AML-Blasten (g) wurden mit verschiedenen Cytarabin-Konzentrationen behandelt und für 3 Tage unter normoxischen (20% O 2) oder hypoxischen (6% O 2) Bedingungen kultiviert. Die Anzahl vitaler Zellen wurde mittels ViCLL XR Counter bestimmt. Die Normalisiergung erfolgte zur unbehandelten Kontrolle (im Diagramm mit K gekennzeichnet). Die dunklen Balken zeigen die normoxischen, die hellen Balken die hypoxischen Bedingungen. * p<0,05 und p<0,001 im Welch-T-Test. Neben den AML-Zelllinien wurden primäre Blasten von 8 AML-Patienten mit unterschiedlichen Cytarabinkonzentrationen behandelt. Das Ansprechen auf Cytarabin variierte bei den einzelnen AML-Patienten sehr stark. Bei einer Konzentration von 500 nm Cytarabin zeigte sich bei einigen Patienten eine Verminderung der Zellzahl auf unter 20% im Vergleich zur unbehandelten Kontrolle, während die Zellen anderer AML-Patienten überhaupt nicht auf Cytarabin ansprachen. Die Proben, die überhaupt kein Ansprechen zeigten, wurden 3

4 aus der weiteren Analyse ausgeschlossen. Von den 6 verbleibenden primären AML-Proben zeigten 5 eine verstärkte Cytarabin-Resistenz unter Hypoxie im Vergleich zur Normoxie. In Abbildung 2g ist exemplarisch der Assay für eine primäre AML-Probe gezeigt. Die Beobachtung der erhöhten Cytarabin-Resistenz unter Hypoxie konnte im Colony- Formation-Assay bestätigt werden. Die Zelllinien Kasumi-1, MOLM13 sowie HL60 wurden nach einer dreitägigen Vorinkubation unter Normoxie oder Hypoxie in semi-solidem Medium ausplattiert und mit unterschiedlichen Cytarabinkonzentrationen behandelt. Nach 7 Tagen wurde die Anzahl der Kolonien mithilfe eines Umkehrmikroskops ausgezählt. Es zeigte sich, dass alle 3 Zelllinien unter Hypoxie eine verstärkte Resistenz gegenüber Cytarabin besaßen als unter Normoxie (Abbildung 3). Abbildung 3. Hypoxie-vermittelte Cytarabin-Resistenz im Colony-Formation-Assay. Abbildung 3. Hypoxie-vermittelte Cytarabin- Resistenz im Colony-Formation-Assay. Das Ansprechen auf Cytarabin unter normoxischen vs. hypoxischen Bedingungen der AML-Zelllinien HL60 (a), Kasumi-1 (b) und MOLM13 (c) wurde anhand des Kolonienwachstums über 7 Tage ermittelt. Die Normalisierung erfolgte gegen die unbehandelte Kontrolle (im Diagramm mit K gekennzeichnet). Die dunklen Balken zeigen die normoxischen, die hellen Balken die hypoxischen Bedingungen. * p<0,05 und p<0,001 im Welch-T-Test. Unsere Daten zeigen eindrücklich, dass Hypoxie als alleiniger Faktor eine verstärkte Resistenz gegenüber Cytarabin in den AML-Zellen induzieren kann. In weiteren Versuchen konnten wir nachweisen, dass diese verstärkte Resistenz auf eine hypoxie-vermittelte Herunterregulierung des Enzyms Deoxycytidinkinase (DCK) zurückzuführen ist. Das Enzym DCK überführt Cytarabin im Körper in seine aktive Form und ist daher für die Wirkung der Chemotherapie unerlässlich. Wir untersuchten die Expression von DCK nach dreitägiger Kultur unter hypoxischen versus normoxischen Bedingungen mittels quantitativer PCR. Die Kultivierung unter Hypoxie induzierte eine deutliche Verminderung der DCK-Expression in den 6 untersuchten Zelllinien sowie primären AML-Blasten (Abbildung 4a). Weiterhin untersuchten wir, ob die 4

5 DCK-Herunterregulation durch den Transkriptionsfaktor Hypoxia-inducible factor 1 α (HIF-1α), welcher als starker Regulator der Anpassung von Zellen an Hypoxie gilt, vermittelt wird. Hierzu wurden die Zelllinien HL60, KG-1 und MV4-11 über 3 Tage mit dem spezifischen HIF-1α- Inhibitor BAY behandelt und erneut die DCK-Expression ermittelt. Die Behandlung mit BAY verhinderte die Herunterregulierung von DCK unter Hypoxie (Abbildung 4b), was die direkte Verbindung zwischen HIF-1α und der DCK-Expression aufzeigte. Die Daten über die verstärkte DCK-vermittelte Cytarabin-Resistenz unter Hypoxie wurden kürzlich beim European Journal of Haematology akzeptiert und werden in einer der nächsten Ausgaben erscheinen. Abbildung 4. Verminderte Deoxycytidinkinase-Expression unter Hypoxie. Abbildung 4. Verminderte Deoxycytidinkinase-Expression unter Hypoxie. a) Die quantitative PCR- Analyse verschiedener AML-Zelllinien und primärer AML-Blasten (n=6) zeigte, dass die Expression des Cytarabin-aktivierenden Enzyms Deoxycytidinkinase (DCK) unter Hypoxie im Vergleich zur Normoxie vermindert war (Expressionslevel unter Normoxie entsprechen 1, was als dicke schwarze Linie im Diagramm gekennzeichnet ist). b) In HL60-, KG-1- und MV4-11-Zellen, die mit 100 nm BAY behandelt wurden, wurde die Hypoxie-induzierte Herunterregulierung von DCK verhindert (Expressionslevel unter Nomoxie entsprechen 1, als dicke schwarze Linie gekennzeichnet); das Gen Glycerinaldehyd-3-phosphat-Dehydrogenase wurde als Referenzgen zur Normalisierung von a) und b) verwendet. RNA-Sequencing von AML-Zellen und Stromazellen unter Hypoxie Die Daten zur DCK-vermittelten Cytarabinresistenz unter Hypoxie haben uns gezeigt, dass Hypoxie als alleiniges Merkmal die Biologie von Leukämiezellen maßgeblich verändern kann. Auf Grundlage dieser Daten haben wir beschlossen, die Hypoxie-induzierten Veränderungen in den Zellen auf globalerer Ebene zu untersuchen. Hierzu sollte die Technik des RNA- Sequencing verwendet werden. Die Technik gehört zum so genannten Next Generation Sequencing, was es erlaubt, innerhalb kurzer Zeit große DNA-Mengen zu sequenzieren, sodass die komplette genetische Information des Menschen analysiert werden kann. Beim RNA- Sequencing wird die mrna der Zelle in DNA übersetzt, wodurch die Sequenzierung ermöglicht wird. Die erhaltenen Sequenzen spiegeln die Gesamtheit der in der Zellen enthaltenen mrna wider, was Aufschluss über die Gesamtheit der aktiven Transkripte und somit einen Überblick über zelluläre Vorgänge innerhalb der Zelle gibt. Für unsere Untersuchungen wurde die mrna von 8 primären AML-Proben, die jeweils für 3 Tage unter Normoxie oder Hypoxie kultiviert 5

6 worden waren, verwendet. Für die Analyse wurden die Proben miteinander vereint, in cdna umgeschrieben und anschließend sequenziert. Darüber hinaus wurden mesenchymale Stromazellen von 4 Spendern ebenfalls unter normoxischen und hypoxischen Bedingungen kultiviert und die mrna-expression mittels RNA-Sequencing analysiert. Erste Auswertungen der RNA-Sequencing-Daten zeigten, dass eine Reihe von Genen aus unterschiedlichen Signalwegen eine veränderte Expression unter Hypoxie aufwiesen. Bei den AML-Proben waren z.b. einige Gene aus dem Mitochondrienstoffwechsel dysreguliert, während in mesenchymalen Stromazellen vor allem Gene eine veränderte Expression aufwiesen, die mit der Biologie der Extrazellulärmatrix assoziiert werden können. Zusammenfassung und Ausblick Unsere bisherigen Studien konnten zeigen, dass ein verminderter Sauerstoffgehalt allein ausreicht, um die Biologie von AML-Zellen maßgeblich zu verändern. Vor allem unsere Daten über die Hypoxie-induzierte Herunterregulation des Enzyms Deoxycytidinkinase und der daraus resultierenden vestärkten Cytarabin-Resistenz unter hypoxischen Bedingungen, die kürzlich zur Veröffentlichung im European Journal of Haematology zur Veröffentlichung angenommen wurden, tragen zum Verständnis der zellulären Prozesse in der akuten myeloischen Leukämie bei. Darüber hinaus konnten wir mittels RNA-Sequencing eine Reihe von Genen identifizieren, die in AML-Zellen sowie Knochenmarkstromazellen unter Hypoxie eine veränderte Expression aufwiesen. Die Fortführung des Projektes soll sich vor allem auf die Verifizierung der RNA-Sequencing-Daten sowie funktionelle Analysen der identifizierten Gene in AML- und Knochenmarkstromazellen konzentrieren. Publikationen mit Nennung der Alfred & Angelika Gutermuth Stiftung Deoxycytidine kinase is downregulated under hypoxic conditions and confers resistance against cytarabine in acute myeloid leukaemia, Nicole Degwert, Emily Latuske, Gabi Vohwinkel, Hauke Stamm, Marianne Klokow, Carsten Bokemeyer, Walter Fiedler and Jasmin Wellbrock. European Journal of Haematology, im Druck. Unterschriften Hamburg, den (Dr. rer. nat. Jasmin Wellbrock) Ort, Datum, Unterschrift Hamburg, den (Prof. Dr. Walter Fiedler) Ort, Datum, Unterschrift 6

Charakterisierung von Tumor initiierenden Zellen mit randomisierten Phagenpeptidbanken

Charakterisierung von Tumor initiierenden Zellen mit randomisierten Phagenpeptidbanken Charakterisierung von Tumor initiierenden Zellen mit randomisierten Phagenpeptidbanken S. Adebahr 1, M. Henke 1, R. Mertelsmann 2, G. Niedermann 1, M. Trepel 2,3 1 Klinik für Strahlenheilkunde, Universitätsklinikum

Mehr

Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom

Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom Von Navneet Ramesh und Maike Haehle, übersetzt von Sabine Schock Vom 8. Apr 2014 7:41 Uhr; aktualisiert am 8. Apr

Mehr

Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt.

Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. - 22-4 Ergebnisse 4.1 RT-PCR Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. 4.1.1 Struma nodosa Histologie Fas Fas CD 97

Mehr

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien 36 4. ERGEBNISSE 4.1. Immunglobulin Gentranskripte in Hodgkinzelllinien Mit Hilfe der RT PCR untersuchten wir die Expression umgelagerter Ig Gene in den Hodgkinzelllinien L1236, L428, L591 und KM-H2 sowie

Mehr

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Es sollten mithilfe des Yeast-Two-Hybrid-Systems Proteine identifiziert werden, die mit der zytoplasmatischen Domäne von CEACAM1-4L aus

Mehr

4. Diskussion. 4.1. Polymerase-Kettenreaktion

4. Diskussion. 4.1. Polymerase-Kettenreaktion 59 4. Diskussion Bei der Therapie maligner Tumoren stellt die Entwicklung von Kreuzresistenz gegen Zytostatika ein ernstzunehmendes Hindernis dar. Im wesentlich verantwortlich für die so genannte Multidrug

Mehr

F-Praktikum Physik: Photolumineszenz an Halbleiterheterostruktur

F-Praktikum Physik: Photolumineszenz an Halbleiterheterostruktur F-Praktikum Physik: Photolumineszenz an Halbleiterheterostruktur David Riemenschneider & Felix Spanier 31. Januar 2001 1 Inhaltsverzeichnis 1 Einleitung 3 2 Auswertung 3 2.1 Darstellung sämtlicher PL-Spektren................

Mehr

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt

Mehr

Zentronukleäre Myopathien von der Diagnose zur Therapie

Zentronukleäre Myopathien von der Diagnose zur Therapie MTM Familientreffen Göttingen, 5./6. Juni 2014 Zentronukleäre Myopathien von der Diagnose zur Therapie Dr. Johann Böhm IGBMC, Strasbourg Ein paar Worte über Strasbourg.and über das IGBMC Ein paar Worte

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

VORANGEGANGENE MODELLE

VORANGEGANGENE MODELLE VORANGEGANGENE MODELLE UNSER THEMA HEUTE Ziel dieses Papers: - Nähere Charakterisierung der AuxREs - Analyse eines zu den AuxREs gehörenden Transkriptionsfaktors WAS BEREITS BEKANNT WAR: - Auxin moduliert

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose Aus der Medizinischen Universitätsklinik und Poliklinik Abteilung für Pneumologie der Albert-Ludwigs-Universität Freiburg im Breisgau Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen

Mehr

Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC

Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC Wolferner Analytik GmbH Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC 1 Veröffentlichung 15.12.2004, Studie Zusammenfassung: Im Auftrag der ASTRA GmbH, einer Vorgesellschaft der

Mehr

3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34

3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34 Ergebnisse 34 3 Ergebnisse 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC 3.1.1 Nachweis auf RNA-Ebene Zum Nachweis der Transkription des y + -Systems in kutanen Zellen, wurden

Mehr

Stand von letzter Woche

Stand von letzter Woche RUB ECR1 AXR1 Stand von letzter Woche E2 U? E1-like AXR1 Repressor ARF1 Proteasom AuxRE Repressor wird sehr schnell abgebaut notwendig für Auxinantwort evtl. Substrat für SCF Identifikation des SCF-Ubiquitin

Mehr

Tierärztliche Hochschule Hannover

Tierärztliche Hochschule Hannover Tierärztliche Hochschule Hannover Beurteilung der Entwicklungskompetenz boviner Oozyten aus Follikeln mit unterschiedlicher Durchblutung der Follikelwand INAUGURAL-DISSERTATION zur Erlangung des Grades

Mehr

Charakterisierung der mirna-expression im großzellig anaplastischen T-Zell-Lymphom

Charakterisierung der mirna-expression im großzellig anaplastischen T-Zell-Lymphom Charakterisierung der mirna-expression im großzellig anaplastischen T-Zell-Lymphom Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität Tübingen zur Erlangung des

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch Forschungsbericht über das Projekt Einfluss der TLR3-Aktivierung des retinalen Pigmentepithels auf das Verhalten von Makrophagen, gefördert durch die DOG im Rahmen der Forschungsförderung innovativer wissenschaftlicher

Mehr

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3

Mehr

2.8 Grenzflächeneffekte

2.8 Grenzflächeneffekte - 86-2.8 Grenzflächeneffekte 2.8.1 Oberflächenspannung An Grenzflächen treten besondere Effekte auf, welche im Volumen nicht beobachtbar sind. Die molekulare Grundlage dafür sind Kohäsionskräfte, d.h.

Mehr

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1 I... I Abbildungs- und Tabellenverzeichnis... VI Abkürzungsverzeichnis... IX 1 Einleitung... 1 1.1 Untersuchte uro-rektale Fehlbildungen... 1 1.1.1 Blasenekstrophie-Epispadie-Komplex (BEEK)... 1 1.1.1.1

Mehr

Herpes simplex Infektionen bei HIV - infizierten Patienten. Johannes R. Bogner Uni München

Herpes simplex Infektionen bei HIV - infizierten Patienten. Johannes R. Bogner Uni München Herpes simplex Infektionen bei HIV - infizierten Patienten Johannes R. Bogner Uni München 1. Die klinische Präsentation von HSV 1 und HSV 2 Läsionen unterscheidet sich oft von Läsionen bei immunkompetenten

Mehr

DISSERTATION. Genanalyse bei Patienten mit Akuter Intermittierender Porphyrie. Zur Erlangung des akademischen Grades Doctor Medicinae (Dr. med.

DISSERTATION. Genanalyse bei Patienten mit Akuter Intermittierender Porphyrie. Zur Erlangung des akademischen Grades Doctor Medicinae (Dr. med. Aus der Medizinischen Klinik mit Schwerpunkt Onkologie und Hämatologie Charité Campus Mitte Charité Universitätsmedizin Berlin und dem Hämatologisch-Onkologischen Zentrum München DISSERTATION Genanalyse

Mehr

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem

Mehr

Grundlegende Experimente der Molekulargenetik

Grundlegende Experimente der Molekulargenetik Übung 12 Wiederholung/Zusatzübung Inhalte: Mendelscher Erbgang Grundlegende Experimente der Molekulargenetik Transposons Methoden 1. Sie haben drei runde, gelbe Erbsen (A, B und C). Aus jeder der drei

Mehr

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom...

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... Inhaltsverzeichnis Abkürzungsverzeichnis... 7 Inhaltsverzeichnis... 11 Abbildungsverzeichnis... 17 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... 21 1.1.2 Protein-Protein Interaktionen allgemein...

Mehr

in vivo -- Das Magazin der Deutschen Krebshilfe vom 09.11.2010

in vivo -- Das Magazin der Deutschen Krebshilfe vom 09.11.2010 Seite 1/5 in vivo -- Das Magazin der Deutschen Krebshilfe vom 09.11.2010 Expertengespräch zum Thema Retinoblastom Und zu diesem Thema begrüße ich jetzt Professor Norbert Bornfeld, Direktor des Zentrums

Mehr

DOE am Beispiel Laserpointer

DOE am Beispiel Laserpointer DOE am Beispiel Laserpointer Swen Günther Ein wesentliches Ziel im Rahmen der Neuproduktentwicklung ist die aus Kundesicht bestmögliche, d.h. nutzenmaximale Konzeption des Produktes zu bestimmen (vgl.

Mehr

BIS Infobrief November 2014

BIS Infobrief November 2014 Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit BIS Infobrief November 2014 Sehr geehrte Kolleginnen und Kollegen, wir bedanken uns ganz herzlich bei Ihnen für Ihre aktive Teilnahme am

Mehr

Qualitative Sozialforschung: Ein Überblick. Autor: Thomas Brüsemeister Überarbeitung: Patrick Heiser und Judith Bündgens-Kosten

Qualitative Sozialforschung: Ein Überblick. Autor: Thomas Brüsemeister Überarbeitung: Patrick Heiser und Judith Bündgens-Kosten Qualitative Sozialforschung: Ein Überblick Autor: Thomas Brüsemeister Überarbeitung: Patrick Heiser und Judith Bündgens-Kosten 2011 FernUniversität in Hagen. Fakultät für Kultur- und Sozialwissenschaften.

Mehr

Einfache Varianzanalyse für abhängige

Einfache Varianzanalyse für abhängige Einfache Varianzanalyse für abhängige Stichproben Wie beim t-test gibt es auch bei der VA eine Alternative für abhängige Stichproben. Anmerkung: Was man unter abhängigen Stichproben versteht und wie diese

Mehr

Transcriptomics: Analysis of Microarrays

Transcriptomics: Analysis of Microarrays Transcriptomics: Analysis of Microarrays Dion Whitehead dion@uni-muenster.de Division of Bioinformatics, Westfälische Wilhelms Universität Münster Microarrays Vorlesungsüberblick : 1. Überblick von Microarray

Mehr

Markus Demary / Michael Voigtländer

Markus Demary / Michael Voigtländer Forschungsberichte aus dem Institut der deutschen Wirtschaft Köln Nr. 50 Markus Demary / Michael Voigtländer Immobilien 2025 Auswirkungen des demografischen Wandels auf die Wohn- und Büroimmobilienmärkte

Mehr

Mechanismen der Pasteurella multocida Toxin vermittelten Modulation des Osteoimmunsystems

Mechanismen der Pasteurella multocida Toxin vermittelten Modulation des Osteoimmunsystems Mechanismen der Pasteurella multocida Toxin vermittelten Modulation des Osteoimmunsystems Gutachter Prof. Dr. Alexander Dalpke Prof. Dr. Ralf Bartenschlager Inhaltsverzeichnis 1 Zusammenfassung 1 2 Einleitung

Mehr

KISS-Newsletter Dezember 2014

KISS-Newsletter Dezember 2014 KISS-Newsletter Dezember 2014 Sehr geehrte KISS-Teilnehmer, mit diesem KISS-Newsletter möchten wir Ihnen aktuelle Informationen zur Surveillance im KISS zukommen lassen. Achten Sie zudem bitte auch auf

Mehr

Die DOE-Funktionen im Assistenten führen Benutzer durch einen sequenziellen Prozess zum Entwerfen und Analysieren eines oder mehrerer Experimente, in

Die DOE-Funktionen im Assistenten führen Benutzer durch einen sequenziellen Prozess zum Entwerfen und Analysieren eines oder mehrerer Experimente, in Dieses White Paper ist Teil einer Reihe von Veröffentlichungen, welche die Forschungsarbeiten der Minitab-Statistiker erläutern, in deren Rahmen die im Assistenten der Minitab 17 Statistical Software verwendeten

Mehr

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens 6 Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens Von der Gemeinsamen Naturwissenschaftlichen Fakultät der Technischen Universität

Mehr

Information zum Projekt. Mitwirkung von Menschen mit Demenz in ihrem Stadtteil oder Quartier

Information zum Projekt. Mitwirkung von Menschen mit Demenz in ihrem Stadtteil oder Quartier Information zum Projekt Mitwirkung von Menschen mit Demenz in ihrem Stadtteil oder Quartier Sehr geehrte Dame, sehr geehrter Herr Wir führen ein Projekt durch zur Mitwirkung von Menschen mit Demenz in

Mehr

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins ERGEBNISSE 29 4. Ergebnisse 4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd3-igg1-tnf- Fusionsproteins Im vorliegenden Immunzytokin wurden die Domänen CH2/CH3 des humanen Fc-Fragmentes durch

Mehr

Trennungsverfahren Techniken (in der Biologie)

Trennungsverfahren Techniken (in der Biologie) Trennungsverfahren Techniken (in der Biologie)? Biomoleküle können getrennt werden aufgrund ihrer - chemischen Eigenschaften: Ladung, Löslichkeit, Wechselwirkung mit spezifischen Reagenzen, Molmasse -

Mehr

Motive und Barrieren zur Blutspende in der Schweizer Bevölkerung. Bild 28.4 cm x 8 cm

Motive und Barrieren zur Blutspende in der Schweizer Bevölkerung. Bild 28.4 cm x 8 cm Gesundheit Motive und Barrieren zur Blutspende in der Schweizer Bevölkerung Peter Rüesch, Nicole Maeder, Thomas Volken ZHAW Fachstelle Gesundheitswissenschaften Swisstransfusion Jahreskongress 2011, 8.9.

Mehr

Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen

Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen Lorette Weidel Agenda Hintergrund Aufgabenstellung Material & Methoden Ergebnisse Diskussion

Mehr

Aus der Klinik und Poliklinik für Urologie und Kinderurologie der Universität Würzburg Direktor: Universitäts-Professor Dr. med. H.

Aus der Klinik und Poliklinik für Urologie und Kinderurologie der Universität Würzburg Direktor: Universitäts-Professor Dr. med. H. Aus der Klinik und Poliklinik für Urologie und Kinderurologie der Universität Würzburg Direktor: Universitäts-Professor Dr. med. H. Riedmiller MicroRNA-221 reguliert PMEPA1 und moduliert den TGFß-Signalweg

Mehr

Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012

Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012 Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012 Hämoglobin Hämoglobin Gene h"p://amc- app1.amc.sara.nl/eduwiki/images/d/d8/hb-

Mehr

Chronische myeloische Leukämie. Chronische Phase

Chronische myeloische Leukämie. Chronische Phase Chronische myeloische Leukämie Chronische Phase Zytologie Prof. Dr. med. Roland Fuchs Prof. Dr. med. Tim Brümmendorf Medizinische Klinik IV Zytogenetik Molekulargenetik Prof. Dr. med. Detlef Haase Zentrum

Mehr

Insgesamt erfüllten 30 Studien die definierten Einschlusskriterien. Davon konnten 8 Studien in die Nutzenbewertung eingeschlossen werden.

Insgesamt erfüllten 30 Studien die definierten Einschlusskriterien. Davon konnten 8 Studien in die Nutzenbewertung eingeschlossen werden. Kurzfassung Das wurde vom Gemeinsamen Bundesausschuss (G-BA) beauftragt, eine Nutzenbewertung der allogenen Stammzelltransplantation mit nicht verwandtem Spender bei der Indikation Hodgkin- Lymphom (HL)

Mehr

E.H.S. Hausmann, K. Mac, L. Ellerbroek

E.H.S. Hausmann, K. Mac, L. Ellerbroek Ein Bericht über eine gelungene Zusammenarbeit des Genlabors an der Emil- Fischer-Schule mit dem Bundesinstitut für Risikobewertung, Fachgruppe 42: Lebensmittelhygiene und Sicherheitskonzepte in Berlin

Mehr

Häufigkeit und mögliche klinische Relevanz von Koinfektionen mit Borrelien und Anaplasma phagocytophilum.

Häufigkeit und mögliche klinische Relevanz von Koinfektionen mit Borrelien und Anaplasma phagocytophilum. Häufigkeit und mögliche klinische Relevanz von Koinfektionen mit Borrelien und Anaplasma phagocytophilum. Kurzdarstellung Die sichere Diagnose einer Borrelieninfektion stellt die Laboratoriumsmedizin trotz

Mehr

Veröffentlichungen aus dem Technologiezentrum Wasser Band 67 Anaerober CKW-Abbau: Molekularbiologie, Substanzspektrum, Isotopenfraktionierung

Veröffentlichungen aus dem Technologiezentrum Wasser Band 67 Anaerober CKW-Abbau: Molekularbiologie, Substanzspektrum, Isotopenfraktionierung Veröffentlichungen aus dem Technologiezentrum Wasser Band 67 Anaerober CKW-Abbau: Molekularbiologie, Substanzspektrum, Isotopenfraktionierung Inhaltsverzeichnis 1. Einleitung... 1 1.1. Wissenschaftliche

Mehr

Nachweis gentechnisch veränderter Lebensmittel: Ohne Gentechnik oder: Wieviel Gentechnik ist da eigentlich drin? Dr. Lutz Grohmann

Nachweis gentechnisch veränderter Lebensmittel: Ohne Gentechnik oder: Wieviel Gentechnik ist da eigentlich drin? Dr. Lutz Grohmann Nachweis gentechnisch veränderter Lebensmittel: Ohne Gentechnik oder: Wieviel Gentechnik ist da eigentlich drin? Dr. Lutz Grohmann Gliederung 1. Gesetzlicher Rahmen 2. Erbsubstanz und Gentechnik 3. Anwendungen

Mehr

HIV-Infektion und AIDS. Seminar aus funktioneller Pathologie

HIV-Infektion und AIDS. Seminar aus funktioneller Pathologie HIV-Infektion und AIDS Seminar aus funktioneller Pathologie Retroviren des Menschen Lentiviren von Primaten Das Virion des HI-Virus schematisch und elektronenmikroskopisch Virale Gene Bindungssequenzen

Mehr

Posttranskriptionale Veränderungen der Genexpression bei hereditären Erkrankungen

Posttranskriptionale Veränderungen der Genexpression bei hereditären Erkrankungen Posttranskriptionale Veränderungen der Genexpression bei hereditären Erkrankungen Dissertation zur Erlangung des Doktorgrades Dr. rer. nat. des Fachbereichs Biologie, Chemie, Pharmazie der Freien Universität

Mehr

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Bernd Hoffmann, Klaus R. Depner, Horst Schirrmeier & Martin Beer Friedrich-Loeffler-Institut Greifswald-Insel Riems

Mehr

Vergleich verschiedener Visualisierungsinstrumente zur online Landschaftsbildbewertung

Vergleich verschiedener Visualisierungsinstrumente zur online Landschaftsbildbewertung Vergleich verschiedener Visualisierungsinstrumente zur online Landschaftsbildbewertung Verfasser: Roman Hirzel Betreuerin: Dr. Ulrike Wissen Hayek Externe Betreuerin: Prof. Dr. Margit Mönnecke Hochschule

Mehr

Strahleninduzierte Apoptose bei ESRT im Mausmodell

Strahleninduzierte Apoptose bei ESRT im Mausmodell Strahleninduzierte Apoptose bei ESRT im Mausmodell Die Apoptose ist von vielen ineinandergreifenden Mechanismen abhängig, in deren Regulationsmittelpunkt die Caspasen als ausführende Cysteinproteasen stehen.

Mehr

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl. Molekulare Mechanismen der Signaltransduktion 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.com/modul-mms bisheriges Modell auxin auxin AXR1 auxin response AXR1 potentieller

Mehr

Insiderwissen 2013. Hintergrund

Insiderwissen 2013. Hintergrund Insiderwissen 213 XING EVENTS mit der Eventmanagement-Software für Online Eventregistrierung &Ticketing amiando, hat es sich erneut zur Aufgabe gemacht zu analysieren, wie Eventveranstalter ihre Veranstaltungen

Mehr

II. Zum Jugendbegleiter-Programm

II. Zum Jugendbegleiter-Programm II. Zum Jugendbegleiter-Programm A. Zu den Jugendbegleiter/inne/n 1. Einsatz von Jugendbegleiter/inne/n Seit Beginn des Schuljahres 2007/2008 setzen die 501 Modellschulen 7.068 Jugendbegleiter/innen ein.

Mehr

Healthcare. Sehr geehrte Kundin, sehr geehrter Kunde,

Healthcare. Sehr geehrte Kundin, sehr geehrter Kunde, Healthcare Siemens Healthcare Diagnostics AG, Freilagerstrasse 40, CH-8047 Zürich Name Abteilung Robert Schlatter RAQS-EHS Telefon +41( 0) 585 581 066 Telefax +41 (0) 585 581 151 Mobil E-mail robert.schlatter@siemens.com

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

CHECKLISTE zur Beauftragung einer BRCA1/2-Mutationsanalyse bei gesetzlich krankenversicherten Patientinnen

CHECKLISTE zur Beauftragung einer BRCA1/2-Mutationsanalyse bei gesetzlich krankenversicherten Patientinnen Dr. med. Markus Tiemann Dr. med. Christoph Schulte Prof. Dr. med. Katharina Tiemann Fachärzte für Pathologie und Molekularpathologie Institut für Hämatopathologie Postfach 54 06 40 22506 Hamburg CHECKLISTE

Mehr

Hypor Deutschland GmbH [andrea.schuster@hendrix-genetics.com] Gesendet: Mittwoch, 20. August 2008 09:53 An: Betreff:

Hypor Deutschland GmbH [andrea.schuster@hendrix-genetics.com] Gesendet: Mittwoch, 20. August 2008 09:53 An: Betreff: Andrea Schuster Von: Hypor Deutschland GmbH [andrea.schuster@hendrix-genetics.com] Gesendet: Mittwoch, 20. August 2008 09:53 An: Andrea Schuster Betreff: Faktoren, welche die Wurfgröße und das Geburtsgewicht

Mehr

Lasertechnik Praktikum. Nd:YAG Laser

Lasertechnik Praktikum. Nd:YAG Laser Lasertechnik Praktikum Nd:YAG Laser SS 2013 Gruppe B1 Arthur Halama Xiaomei Xu 1. Theorie 2. Messung und Auswertung 2.1 Justierung und Beobachtung des Pulssignals am Oszilloskop 2.2 Einfluss der Verstärkerspannung

Mehr

International werden Ärzte und Forscher immer mehr darauf aufmerksam, dass viele Menschen mit Fragilem-X-Syndrom auch Symptome von Autismus

International werden Ärzte und Forscher immer mehr darauf aufmerksam, dass viele Menschen mit Fragilem-X-Syndrom auch Symptome von Autismus 1 International werden Ärzte und Forscher immer mehr darauf aufmerksam, dass viele Menschen mit Fragilem-X-Syndrom auch Symptome von Autismus aufweisen. Ob ein Kind mit Fragilem-X-Syndrom auch auf Autismus

Mehr

Bericht über die Untersuchung zur Erblichkeit von Herzerkrankungen beim PON

Bericht über die Untersuchung zur Erblichkeit von Herzerkrankungen beim PON 1 Bericht über die Untersuchung zur Erblichkeit von Herzerkrankungen beim PON Einleitung Bei der Rasse PON wurden im APH in der letzten Zeit auffällig viele Herzkrankheiten und Herzveränderungen unterschiedlicher

Mehr

Abb. 1: Strukturformel von L-Arginin; Molekulargewicht 174,20 g/mol; Summenformel C 6 H 15 N 4 O 2. 6

Abb. 1: Strukturformel von L-Arginin; Molekulargewicht 174,20 g/mol; Summenformel C 6 H 15 N 4 O 2. 6 Abbildungen Abb. 1: Strukturformel von L-Arginin; Molekulargewicht 174,20 g/mol; Summenformel C 6 H 15 N 4 O 2. 6 Abb. 2: Biosynthese von Stickstoffmonoxid aus L-Arginin (nach Nathan, 1992). 8 Abb. 3:

Mehr

Lehrgang zur Kaufmann/-frau für Büromanagement

Lehrgang zur Kaufmann/-frau für Büromanagement Lehrgang zur Kaufmann/-frau für Büromanagement Der Kaufmann / Die Kauffrau im Büromanagement ist ein anerkannter Ausbildungsberuf nach dem Berufsbildungsgesetz und vereint die drei Berufe Bürokauffrau/-mann,

Mehr

Wege aus Krise und Hoffnungslosigkeit

Wege aus Krise und Hoffnungslosigkeit Wege aus Krise und Hoffnungslosigkeit Intensivtherapie von Depressionen BADEN-BADEN Behandlungsangebot für Menschen mit Depressionen Merkmale von Depressionen Sie fühlen sich wie gelähmt, unfähig, wertlos,

Mehr

Embodiment: of Sadness and Depression

Embodiment: of Sadness and Depression Embodiment: of Sadness and Depression Seminar Psychopathologische Prozesse: Lea Reusser Einführung Bisherige Forschung Studie 1 Studie 2 Ablauf Zusammenfassung und ImplikaIon 1 Einführung: DefiniIon Embodiment:

Mehr

Abb. 1: J.A. Woollam Co. VASE mit AutoRetarder

Abb. 1: J.A. Woollam Co. VASE mit AutoRetarder Charakterisierung von Glasbeschichtungen mit Spektroskopischer Ellipsometrie Thomas Wagner, L.O.T.-Oriel GmbH & Co KG; Im Tiefen See 58, D-64293 Darmstadt Charles Anderson, Saint-Gobain Recherche, 39,

Mehr

Leistenbruch-Operation

Leistenbruch-Operation Leistenbruch-Operation Patienteninformation Foto: Nikolay Pozdeev, fotolia.de Informationen rund um den Leistenbruch Was ist ein Leistenbruch? Beim Leistenbruch (= Hernie) handelt es sich um eine Lücke

Mehr

Projektskizze: Studie/ Auswertung/ Publikation

Projektskizze: Studie/ Auswertung/ Publikation Projektskizze: Studie/ Auswertung/ Publikation Name: PD Dr. Dr. Robert Bals, CAPNetz C11 Datum: 30. 8. 2007 Institution(en)/Autor(en): Klinikum der Universität Marburg Klinik für Innere Medizin mit Schwerpunkt

Mehr

Forschungszentrum Karlsruhe

Forschungszentrum Karlsruhe Forschungszentrum Karlsruhe in der Helmholtz-Gemelnschaft Wissenschaftliche Berichte FZKA7106 Biochemische Charakterisierung der Isoprensynthase aus der Graupappel (Populus x canescens (Ait.) Sm.) und

Mehr

Diese Broschüre fasst die wichtigsten Informationen zusammen, damit Sie einen Entscheid treffen können.

Diese Broschüre fasst die wichtigsten Informationen zusammen, damit Sie einen Entscheid treffen können. Aufklärung über die Weiterverwendung/Nutzung von biologischem Material und/oder gesundheitsbezogen Daten für die biomedizinische Forschung. (Version V-2.0 vom 16.07.2014, Biobanken) Sehr geehrte Patientin,

Mehr

Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR

Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR Aus dem Institut für Humangenetik der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Genexpressionsanalyse von DNA-Reparaturgenen in primären Fibroblasten von Tumorpatienten mittels Real

Mehr

Maximale Lagertemperaturen

Maximale Lagertemperaturen Maximale Lagertemperaturen Dauerhafte Kühlung unterhalb der Grenze der Umkristallisierungsvorgänge White Paper erstellt am: 30.03.2012 White Paper Seite 1 von 6 Inhalt ASKION GmbH 1. Hintergrund... 2 2.

Mehr

Autismus. autism spectrum disorders

Autismus. autism spectrum disorders Autismus autism spectrum disorders Index Was ist Autismus? Wissenschaftliche Grundlagen Phelan-McDermid-Syndrome (PMDS) Pharmakologische Tests Zusammenfassung Schlussfolgerungen Methoden Elektrophysiologische

Mehr

Nicht kopieren. Der neue Report von: Stefan Ploberger. 1. Ausgabe 2003

Nicht kopieren. Der neue Report von: Stefan Ploberger. 1. Ausgabe 2003 Nicht kopieren Der neue Report von: Stefan Ploberger 1. Ausgabe 2003 Herausgeber: Verlag Ploberger & Partner 2003 by: Stefan Ploberger Verlag Ploberger & Partner, Postfach 11 46, D-82065 Baierbrunn Tel.

Mehr

Untersuchung von Alterungseffekten bei monokristallinen PV-Modulen mit mehr als 15 Betriebsjahren durch Elektrolumineszenz- und Leistungsmessungen

Untersuchung von Alterungseffekten bei monokristallinen PV-Modulen mit mehr als 15 Betriebsjahren durch Elektrolumineszenz- und Leistungsmessungen Untersuchung von Alterungseffekten bei monokristallinen PV-Modulen mit mehr als 15 Betriebsjahren durch Elektrolumineszenz- und Leistungsmessungen Katharina Schulze*, Manfred Groh*, Monika Nieß*, Christian

Mehr

Praktikum Physik. Protokoll zum Versuch 1: Viskosität. Durchgeführt am 26.01.2012. Gruppe X

Praktikum Physik. Protokoll zum Versuch 1: Viskosität. Durchgeführt am 26.01.2012. Gruppe X Praktikum Physik Protokoll zum Versuch 1: Viskosität Durchgeführt am 26.01.2012 Gruppe X Name 1 und Name 2 (abc.xyz@uni-ulm.de) (abc.xyz@uni-ulm.de) Betreuerin: Wir bestätigen hiermit, dass wir das Protokoll

Mehr

4.2 Kokulturen Epithelzellen und Makrophagen

4.2 Kokulturen Epithelzellen und Makrophagen Ergebnisse 4.2 Kokulturen Epithelzellen und Makrophagen Nach der eingehenden Untersuchung der einzelnen Zelllinien wurden die Versuche auf Kokulturen aus den A549-Epithelzellen und den Makrophagenzelllinien

Mehr

Arbeitszeiterfassung mit Fingerabdruck

Arbeitszeiterfassung mit Fingerabdruck Arbeitszeiterfassung mit Fingerabdruck Was ist Biometrie? Unter Biometrie, im Zusammenhang mit einer Personenidentifikation, versteht man die Erkennung von Personen anhand von einzigartigen und unverwechselbaren

Mehr

Örtliche Angebots- und Teilhabeplanung im Landkreis Weilheim-Schongau

Örtliche Angebots- und Teilhabeplanung im Landkreis Weilheim-Schongau Örtliche Angebots- und Teilhabeplanung im Landkreis Weilheim-Schongau Zusammenfassung der Ergebnisse in Leichter Sprache Timo Wissel Albrecht Rohrmann Timo Wissel / Albrecht Rohrmann: Örtliche Angebots-

Mehr

Was ist aus der ersten Generation von Unternehmergesellschaften geworden?

Was ist aus der ersten Generation von Unternehmergesellschaften geworden? Prof. Dr. Walter Bayer / Dipl.-Kfm. Thomas Hoffmann, Jena Was ist aus der ersten Generation von Unternehmergesellschaften geworden? In diesen und den nächsten Tagen begehen die ersten Unternehmergesellschaften

Mehr

Transgene Organismen

Transgene Organismen Transgene Organismen Themenübersicht 1) Einführung 2) Komplementäre DNA (cdna) 3) Vektoren 4) Einschleusung von Genen in Eukaryontenzellen 5) Ausmaß der Genexpression 6) Genausschaltung (Gen-Knockout)

Mehr

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C F1-Praktikum Genetik Protokoll Versuch 2: Nachweis der Funktion von Promotor- und Enhancer-Sequenzen mittels Reportergen-Assay Gruppe 8, Manfred Depner & Susanne Duncker Einführung Um die Funktion von

Mehr

Die immunsuppressive Wirkung von Tumormetaboliten auf humane T-Zellen

Die immunsuppressive Wirkung von Tumormetaboliten auf humane T-Zellen Die immunsuppressive Wirkung von Tumormetaboliten auf humane T-Zellen Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) der Naturwissenschaftlichen Fakultät III - Biologie

Mehr

5 Zusammenfassung. Zusammenfassung 76

5 Zusammenfassung. Zusammenfassung 76 Zusammenfassung 76 5 Zusammenfassung 1. Aminosäuren sind als Bausteine der Proteine essentiell zur Aufrechterhaltung vitaler Prozesse. Eine besondere Rolle im Zellmetabolismus der Haut spielen dabei kationische

Mehr

Kundeninformation Nachfolgeinformation

Kundeninformation Nachfolgeinformation IMMULITE 2000 IMMULITE 2000 XPi Kundeninformation Nachfolgeinformation IMC12-12A.A.OUS Dezember 2015 Grund für die Nachfolgeinformation Im September 2012 hat Siemens Healthcare Diagnostics eine Wichtige

Mehr

Zielgerichtetes amplikonbasiertes Sequenzieren bei Chronisch Lymphatischer Leukämie

Zielgerichtetes amplikonbasiertes Sequenzieren bei Chronisch Lymphatischer Leukämie Zielgerichtetes amplikonbasiertes Sequenzieren bei Chronisch Lymphatischer Leukämie 1. CLL Chronisch Lymphatische Leukämie Anreicherung von langlebigen monoklonalen reifen B-Zellen Häufigste Leukämie in

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 1.2.1.1. Molekulare Struktur von NCAM S.

Mehr

Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005

Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005 Optimality and evolutionary tuning of the expression level of a protein Erez Dekel & Uri Alon Nature Vol 436, July 2005 Wie Zellen Denken Übersicht Hintergrund Mathematische Formulierung (cost-benefit-theory)

Mehr

auf, so erhält man folgendes Schaubild: Temperaturabhängigkeit eines Halbleiterwiderstands

auf, so erhält man folgendes Schaubild: Temperaturabhängigkeit eines Halbleiterwiderstands Auswertung zum Versuch Widerstandskennlinien und ihre Temperaturabhängigkeit Kirstin Hübner (1348630) Armin Burgmeier (1347488) Gruppe 15 2. Juni 2008 1 Temperaturabhängigkeit eines Halbleiterwiderstands

Mehr