Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen"

Transkript

1 Dr. rer. nat. Jasmin Wellbrock und Prof. Dr. Walter Fiedler Projektbericht an die Alfred & Angelika Gutermuth Stiftung Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen Hintergrund In der Leukämie-Forschung sind Leukämie-Stammzellen (leukemic stem cells, LSC) in den Fokus der zielgerichteten Therapie-Strategien gerückt, da sie aufgrund ihrer Chemotherapie- Resistenz für die schlechte Prognose der akuten myeloischen Leukämie (AML) verantwortlich gemacht werden. Im Knochenmark stehen die LSCs innerhalb der so genannten Leukämie- Stammzell-Nische in enger Interaktion mit einer Reihe von Stromazellen. Obschon bekannt ist, dass das Milieu innerhalb der Leukämie-Stammzell-Nische nur über einen sehr geringen Sauerstoff-Anteil verfügt, wurde der Großteil der bisherigen In-vitro-Studien über die Wechselwirkung von LSCs und Stromazellen unter normoxischen Bedingungen durchgeführt. Es gibt jedoch erste Hinweise darauf, dass die Sauerstoff-Konzentration Einfluss auf die Interaktion von Leukämie- und Stromazellen nimmt. Ziel der vorliegenden Studie war zu ergründen, welchen Einfluss ein hypoxisches Milieu auf die Biologie von Leukämiezellen ausübt. Durchführung und Ergebnisse der Experimente Analyse der Proliferationskapazität von AML-Zellen und Stromazellen unter Hypoxie Zunächst sollte untersucht werden, ob sich AML-Zellen und Knochenmarkstromazellen unter Hypoxie anders verhalten als unter Normoxie. Als hypoxische Bedingung wurde ein Sauerstoffgehalt von 6% ausgewählt, was einer moderaten Hypoxie im Knochenmark entspricht. Es wurden Proliferationsanalysen über 3 Tage durchgeführt und die Zellzahl anschließend mit einem Zellzählgerät (ViCELL XR der Fa. Beckman Coulter) ausgezählt. Es wurden sieben unterschiedliche AML-Zelllinien untersucht: HL60, Kasumi-1, KG-1, MOLM13, MV4-11, OCI-AML5 und UKE-1. Bei allen Zelllinien zeigte sich ein vermindertes Zellwachstum unter hypoxischen Bedingungen. In Abbildung 1a und b ist dieser Effekt examplarisch für die Zelllinien OCI-AML5 und Kasumi-1 dargestellt. Darüber hinaus wurde die Proliferation von primären AML-Blasten untersucht, die frisch aus dem Knochenmark von AML-Patienten isoliert wurden. Hier zeigte sich interessanterweise ein umgekehrter Effekt, da bei ca. 50% der Proben eine verstärkte Proliferation unter Hypoxie zu verzeichnen war (in Abbildung 1c exemplarisch für eine AML-Probe gezeigt). Ähnlich verhielt es sich mit Knochenmarkstromazellen: sowohl primäre Osteoblasten als auch mesenchymale Stromazellen zeigten ein verstärktes Zellwachstum unter Hypoxie (Abbildung 1d). 1

2 Abbildung 1. Proliferation von AML-Zellen und Stromazellen unter Hypoxie. Abbildung 1. Proliferation von AML-Zellen und Stromazellen unter Hypoxie. Dargestellt ist die Proliferationskapazität von den AML-Zelllinien OCI-AML5 (a) und Kasumi-1 (b), primärer Blasten eines AML-Patienten (c) sowie primärer Osteoblasten (d). Die Zellen wurden für jeweils 3 Tagen unter Normoxie (20% O 2) sowie Hypoxie (6% O 2) kultiviert, bevor die Zellzahl mittels ViCELL XR Counter (für a-c) oder mittels WST-1 Proliferationsreagenz an einem ELISA-Reader bestimmt wurde (d). Cytarabin-Resistenz unter hypoxischen Bedingungen In der Studie haben wir uns intensiv damit auseinandergesetzt, ob Hypoxie als alleiniger Faktor ausreicht, um die Resistenz gegenüber Chemotherapie zu verstärken. Hierzu wurden Proliferationsanalysen sowie Colony-Formation-Assays von AML-Zelllinien und primären AML- Blasten unter Behandlung des Nukleosid-Analogons Cytarabin durchgeführt, welches seit mehreren Jahrzehnten die Standardchemotherapie zur Behandlung der AML darstellt. Zunächst wurden die AML-Zelllinien MOLM13, HL60, Kasumi-1, KG-1, MV4-11, OCI-AML5 und OCI-M1 sowie frisch isolierte Blasten von 8 AML-Patienten für 3 Tage unter normoxischen oder hypoxischen Bedingungen kultiviert, damit die Zellen sich an das Sauerstoffmilieu adaptieren konnten. Anschließend wurden die Zellen in definierter Zellzahl ausplattiert und mit unterschiedlichen Cytarabin-Konzentrationen behandelt, bevor die Zellzahl nach 3 Tagen am ViCELL XR Counter bestimmt wurde. Die Mehrzahl der AML-Zelllinien zeigte unter Hypoxie eine deutlich verstärkte Resistenz gegenüber Cytarabin als unter Normoxie (Abbildung 2). Die HL60-Zellen zeigten hierbei die stärkste Resistenz, da die Cytarabin-induzierte Wachstumshemmung unter Hypoxie bei allen untersuchten Cytarabinkonzentrationen unter Hypoxie deutlich vermindert war (Abbildung 2a). Die Zelllinien Kasumi-1, MOLM13, OCI-AML5 und MV4-11 zeigten ebenfalls eine deutliche Cytarabin-Resistenz unter hypoxischen Bedingungen (Abbildung 2b-e). Lediglich die Zelllinie KG-1 zeigte nur leicht verminderte Unterschiede in der Cytarabin-Resistenz (Abbildung 2f). 2

3 Abbildung 2. Hypoxie-vermittelte Cytarabin-Resistenz. Abbildung 2. Hypoxie-vermittelte Cytarabin-Resistenz. AML-Zelllinien (a-f) oder primäre AML-Blasten (g) wurden mit verschiedenen Cytarabin-Konzentrationen behandelt und für 3 Tage unter normoxischen (20% O 2) oder hypoxischen (6% O 2) Bedingungen kultiviert. Die Anzahl vitaler Zellen wurde mittels ViCLL XR Counter bestimmt. Die Normalisiergung erfolgte zur unbehandelten Kontrolle (im Diagramm mit K gekennzeichnet). Die dunklen Balken zeigen die normoxischen, die hellen Balken die hypoxischen Bedingungen. * p<0,05 und p<0,001 im Welch-T-Test. Neben den AML-Zelllinien wurden primäre Blasten von 8 AML-Patienten mit unterschiedlichen Cytarabinkonzentrationen behandelt. Das Ansprechen auf Cytarabin variierte bei den einzelnen AML-Patienten sehr stark. Bei einer Konzentration von 500 nm Cytarabin zeigte sich bei einigen Patienten eine Verminderung der Zellzahl auf unter 20% im Vergleich zur unbehandelten Kontrolle, während die Zellen anderer AML-Patienten überhaupt nicht auf Cytarabin ansprachen. Die Proben, die überhaupt kein Ansprechen zeigten, wurden 3

4 aus der weiteren Analyse ausgeschlossen. Von den 6 verbleibenden primären AML-Proben zeigten 5 eine verstärkte Cytarabin-Resistenz unter Hypoxie im Vergleich zur Normoxie. In Abbildung 2g ist exemplarisch der Assay für eine primäre AML-Probe gezeigt. Die Beobachtung der erhöhten Cytarabin-Resistenz unter Hypoxie konnte im Colony- Formation-Assay bestätigt werden. Die Zelllinien Kasumi-1, MOLM13 sowie HL60 wurden nach einer dreitägigen Vorinkubation unter Normoxie oder Hypoxie in semi-solidem Medium ausplattiert und mit unterschiedlichen Cytarabinkonzentrationen behandelt. Nach 7 Tagen wurde die Anzahl der Kolonien mithilfe eines Umkehrmikroskops ausgezählt. Es zeigte sich, dass alle 3 Zelllinien unter Hypoxie eine verstärkte Resistenz gegenüber Cytarabin besaßen als unter Normoxie (Abbildung 3). Abbildung 3. Hypoxie-vermittelte Cytarabin-Resistenz im Colony-Formation-Assay. Abbildung 3. Hypoxie-vermittelte Cytarabin- Resistenz im Colony-Formation-Assay. Das Ansprechen auf Cytarabin unter normoxischen vs. hypoxischen Bedingungen der AML-Zelllinien HL60 (a), Kasumi-1 (b) und MOLM13 (c) wurde anhand des Kolonienwachstums über 7 Tage ermittelt. Die Normalisierung erfolgte gegen die unbehandelte Kontrolle (im Diagramm mit K gekennzeichnet). Die dunklen Balken zeigen die normoxischen, die hellen Balken die hypoxischen Bedingungen. * p<0,05 und p<0,001 im Welch-T-Test. Unsere Daten zeigen eindrücklich, dass Hypoxie als alleiniger Faktor eine verstärkte Resistenz gegenüber Cytarabin in den AML-Zellen induzieren kann. In weiteren Versuchen konnten wir nachweisen, dass diese verstärkte Resistenz auf eine hypoxie-vermittelte Herunterregulierung des Enzyms Deoxycytidinkinase (DCK) zurückzuführen ist. Das Enzym DCK überführt Cytarabin im Körper in seine aktive Form und ist daher für die Wirkung der Chemotherapie unerlässlich. Wir untersuchten die Expression von DCK nach dreitägiger Kultur unter hypoxischen versus normoxischen Bedingungen mittels quantitativer PCR. Die Kultivierung unter Hypoxie induzierte eine deutliche Verminderung der DCK-Expression in den 6 untersuchten Zelllinien sowie primären AML-Blasten (Abbildung 4a). Weiterhin untersuchten wir, ob die 4

5 DCK-Herunterregulation durch den Transkriptionsfaktor Hypoxia-inducible factor 1 α (HIF-1α), welcher als starker Regulator der Anpassung von Zellen an Hypoxie gilt, vermittelt wird. Hierzu wurden die Zelllinien HL60, KG-1 und MV4-11 über 3 Tage mit dem spezifischen HIF-1α- Inhibitor BAY behandelt und erneut die DCK-Expression ermittelt. Die Behandlung mit BAY verhinderte die Herunterregulierung von DCK unter Hypoxie (Abbildung 4b), was die direkte Verbindung zwischen HIF-1α und der DCK-Expression aufzeigte. Die Daten über die verstärkte DCK-vermittelte Cytarabin-Resistenz unter Hypoxie wurden kürzlich beim European Journal of Haematology akzeptiert und werden in einer der nächsten Ausgaben erscheinen. Abbildung 4. Verminderte Deoxycytidinkinase-Expression unter Hypoxie. Abbildung 4. Verminderte Deoxycytidinkinase-Expression unter Hypoxie. a) Die quantitative PCR- Analyse verschiedener AML-Zelllinien und primärer AML-Blasten (n=6) zeigte, dass die Expression des Cytarabin-aktivierenden Enzyms Deoxycytidinkinase (DCK) unter Hypoxie im Vergleich zur Normoxie vermindert war (Expressionslevel unter Normoxie entsprechen 1, was als dicke schwarze Linie im Diagramm gekennzeichnet ist). b) In HL60-, KG-1- und MV4-11-Zellen, die mit 100 nm BAY behandelt wurden, wurde die Hypoxie-induzierte Herunterregulierung von DCK verhindert (Expressionslevel unter Nomoxie entsprechen 1, als dicke schwarze Linie gekennzeichnet); das Gen Glycerinaldehyd-3-phosphat-Dehydrogenase wurde als Referenzgen zur Normalisierung von a) und b) verwendet. RNA-Sequencing von AML-Zellen und Stromazellen unter Hypoxie Die Daten zur DCK-vermittelten Cytarabinresistenz unter Hypoxie haben uns gezeigt, dass Hypoxie als alleiniges Merkmal die Biologie von Leukämiezellen maßgeblich verändern kann. Auf Grundlage dieser Daten haben wir beschlossen, die Hypoxie-induzierten Veränderungen in den Zellen auf globalerer Ebene zu untersuchen. Hierzu sollte die Technik des RNA- Sequencing verwendet werden. Die Technik gehört zum so genannten Next Generation Sequencing, was es erlaubt, innerhalb kurzer Zeit große DNA-Mengen zu sequenzieren, sodass die komplette genetische Information des Menschen analysiert werden kann. Beim RNA- Sequencing wird die mrna der Zelle in DNA übersetzt, wodurch die Sequenzierung ermöglicht wird. Die erhaltenen Sequenzen spiegeln die Gesamtheit der in der Zellen enthaltenen mrna wider, was Aufschluss über die Gesamtheit der aktiven Transkripte und somit einen Überblick über zelluläre Vorgänge innerhalb der Zelle gibt. Für unsere Untersuchungen wurde die mrna von 8 primären AML-Proben, die jeweils für 3 Tage unter Normoxie oder Hypoxie kultiviert 5

6 worden waren, verwendet. Für die Analyse wurden die Proben miteinander vereint, in cdna umgeschrieben und anschließend sequenziert. Darüber hinaus wurden mesenchymale Stromazellen von 4 Spendern ebenfalls unter normoxischen und hypoxischen Bedingungen kultiviert und die mrna-expression mittels RNA-Sequencing analysiert. Erste Auswertungen der RNA-Sequencing-Daten zeigten, dass eine Reihe von Genen aus unterschiedlichen Signalwegen eine veränderte Expression unter Hypoxie aufwiesen. Bei den AML-Proben waren z.b. einige Gene aus dem Mitochondrienstoffwechsel dysreguliert, während in mesenchymalen Stromazellen vor allem Gene eine veränderte Expression aufwiesen, die mit der Biologie der Extrazellulärmatrix assoziiert werden können. Zusammenfassung und Ausblick Unsere bisherigen Studien konnten zeigen, dass ein verminderter Sauerstoffgehalt allein ausreicht, um die Biologie von AML-Zellen maßgeblich zu verändern. Vor allem unsere Daten über die Hypoxie-induzierte Herunterregulation des Enzyms Deoxycytidinkinase und der daraus resultierenden vestärkten Cytarabin-Resistenz unter hypoxischen Bedingungen, die kürzlich zur Veröffentlichung im European Journal of Haematology zur Veröffentlichung angenommen wurden, tragen zum Verständnis der zellulären Prozesse in der akuten myeloischen Leukämie bei. Darüber hinaus konnten wir mittels RNA-Sequencing eine Reihe von Genen identifizieren, die in AML-Zellen sowie Knochenmarkstromazellen unter Hypoxie eine veränderte Expression aufwiesen. Die Fortführung des Projektes soll sich vor allem auf die Verifizierung der RNA-Sequencing-Daten sowie funktionelle Analysen der identifizierten Gene in AML- und Knochenmarkstromazellen konzentrieren. Publikationen mit Nennung der Alfred & Angelika Gutermuth Stiftung Deoxycytidine kinase is downregulated under hypoxic conditions and confers resistance against cytarabine in acute myeloid leukaemia, Nicole Degwert, Emily Latuske, Gabi Vohwinkel, Hauke Stamm, Marianne Klokow, Carsten Bokemeyer, Walter Fiedler and Jasmin Wellbrock. European Journal of Haematology, im Druck. Unterschriften Hamburg, den (Dr. rer. nat. Jasmin Wellbrock) Ort, Datum, Unterschrift Hamburg, den (Prof. Dr. Walter Fiedler) Ort, Datum, Unterschrift 6

Charakterisierung von Tumor initiierenden Zellen mit randomisierten Phagenpeptidbanken

Charakterisierung von Tumor initiierenden Zellen mit randomisierten Phagenpeptidbanken Charakterisierung von Tumor initiierenden Zellen mit randomisierten Phagenpeptidbanken S. Adebahr 1, M. Henke 1, R. Mertelsmann 2, G. Niedermann 1, M. Trepel 2,3 1 Klinik für Strahlenheilkunde, Universitätsklinikum

Mehr

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Es sollten mithilfe des Yeast-Two-Hybrid-Systems Proteine identifiziert werden, die mit der zytoplasmatischen Domäne von CEACAM1-4L aus

Mehr

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt

Mehr

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien 36 4. ERGEBNISSE 4.1. Immunglobulin Gentranskripte in Hodgkinzelllinien Mit Hilfe der RT PCR untersuchten wir die Expression umgelagerter Ig Gene in den Hodgkinzelllinien L1236, L428, L591 und KM-H2 sowie

Mehr

4. Diskussion. 4.1. Polymerase-Kettenreaktion

4. Diskussion. 4.1. Polymerase-Kettenreaktion 59 4. Diskussion Bei der Therapie maligner Tumoren stellt die Entwicklung von Kreuzresistenz gegen Zytostatika ein ernstzunehmendes Hindernis dar. Im wesentlich verantwortlich für die so genannte Multidrug

Mehr

Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom

Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom Minimale Resterkrankung, Hochdurchsatz-Sequenzierung und Prognose beim multiplen Myelom Von Navneet Ramesh und Maike Haehle, übersetzt von Sabine Schock Vom 8. Apr 2014 7:41 Uhr; aktualisiert am 8. Apr

Mehr

Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt.

Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. - 22-4 Ergebnisse 4.1 RT-PCR Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. 4.1.1 Struma nodosa Histologie Fas Fas CD 97

Mehr

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose Aus der Medizinischen Universitätsklinik und Poliklinik Abteilung für Pneumologie der Albert-Ludwigs-Universität Freiburg im Breisgau Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen

Mehr

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese

Mehr

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1 I... I Abbildungs- und Tabellenverzeichnis... VI Abkürzungsverzeichnis... IX 1 Einleitung... 1 1.1 Untersuchte uro-rektale Fehlbildungen... 1 1.1.1 Blasenekstrophie-Epispadie-Komplex (BEEK)... 1 1.1.1.1

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch Forschungsbericht über das Projekt Einfluss der TLR3-Aktivierung des retinalen Pigmentepithels auf das Verhalten von Makrophagen, gefördert durch die DOG im Rahmen der Forschungsförderung innovativer wissenschaftlicher

Mehr

VORANGEGANGENE MODELLE

VORANGEGANGENE MODELLE VORANGEGANGENE MODELLE UNSER THEMA HEUTE Ziel dieses Papers: - Nähere Charakterisierung der AuxREs - Analyse eines zu den AuxREs gehörenden Transkriptionsfaktors WAS BEREITS BEKANNT WAR: - Auxin moduliert

Mehr

3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34

3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34 Ergebnisse 34 3 Ergebnisse 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC 3.1.1 Nachweis auf RNA-Ebene Zum Nachweis der Transkription des y + -Systems in kutanen Zellen, wurden

Mehr

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3

Mehr

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom...

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... Inhaltsverzeichnis Abkürzungsverzeichnis... 7 Inhaltsverzeichnis... 11 Abbildungsverzeichnis... 17 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... 21 1.1.2 Protein-Protein Interaktionen allgemein...

Mehr

Tierärztliche Hochschule Hannover

Tierärztliche Hochschule Hannover Tierärztliche Hochschule Hannover Beurteilung der Entwicklungskompetenz boviner Oozyten aus Follikeln mit unterschiedlicher Durchblutung der Follikelwand INAUGURAL-DISSERTATION zur Erlangung des Grades

Mehr

Stand von letzter Woche

Stand von letzter Woche RUB ECR1 AXR1 Stand von letzter Woche E2 U? E1-like AXR1 Repressor ARF1 Proteasom AuxRE Repressor wird sehr schnell abgebaut notwendig für Auxinantwort evtl. Substrat für SCF Identifikation des SCF-Ubiquitin

Mehr

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens 6 Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens Von der Gemeinsamen Naturwissenschaftlichen Fakultät der Technischen Universität

Mehr

Veröffentlichungen aus dem Technologiezentrum Wasser Band 67 Anaerober CKW-Abbau: Molekularbiologie, Substanzspektrum, Isotopenfraktionierung

Veröffentlichungen aus dem Technologiezentrum Wasser Band 67 Anaerober CKW-Abbau: Molekularbiologie, Substanzspektrum, Isotopenfraktionierung Veröffentlichungen aus dem Technologiezentrum Wasser Band 67 Anaerober CKW-Abbau: Molekularbiologie, Substanzspektrum, Isotopenfraktionierung Inhaltsverzeichnis 1. Einleitung... 1 1.1. Wissenschaftliche

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Zentronukleäre Myopathien von der Diagnose zur Therapie

Zentronukleäre Myopathien von der Diagnose zur Therapie MTM Familientreffen Göttingen, 5./6. Juni 2014 Zentronukleäre Myopathien von der Diagnose zur Therapie Dr. Johann Böhm IGBMC, Strasbourg Ein paar Worte über Strasbourg.and über das IGBMC Ein paar Worte

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

DISSERTATION. Genanalyse bei Patienten mit Akuter Intermittierender Porphyrie. Zur Erlangung des akademischen Grades Doctor Medicinae (Dr. med.

DISSERTATION. Genanalyse bei Patienten mit Akuter Intermittierender Porphyrie. Zur Erlangung des akademischen Grades Doctor Medicinae (Dr. med. Aus der Medizinischen Klinik mit Schwerpunkt Onkologie und Hämatologie Charité Campus Mitte Charité Universitätsmedizin Berlin und dem Hämatologisch-Onkologischen Zentrum München DISSERTATION Genanalyse

Mehr

Autismus. autism spectrum disorders

Autismus. autism spectrum disorders Autismus autism spectrum disorders Index Was ist Autismus? Wissenschaftliche Grundlagen Phelan-McDermid-Syndrome (PMDS) Pharmakologische Tests Zusammenfassung Schlussfolgerungen Methoden Elektrophysiologische

Mehr

Transcriptomics: Analysis of Microarrays

Transcriptomics: Analysis of Microarrays Transcriptomics: Analysis of Microarrays Dion Whitehead dion@uni-muenster.de Division of Bioinformatics, Westfälische Wilhelms Universität Münster Microarrays Vorlesungsüberblick : 1. Überblick von Microarray

Mehr

Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR

Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR Aus dem Institut für Humangenetik der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Genexpressionsanalyse von DNA-Reparaturgenen in primären Fibroblasten von Tumorpatienten mittels Real

Mehr

Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012

Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012 Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012 Hämoglobin Hämoglobin Gene h"p://amc- app1.amc.sara.nl/eduwiki/images/d/d8/hb-

Mehr

Proteomic Pathology Quantitative Massenspektrometrie

Proteomic Pathology Quantitative Massenspektrometrie Proteomic Pathology Die pathologische Forschung analysiert die zellulären Vorgänge, die zur Entstehung und Progression von Krankheiten führen. In diesem Zusammenhang werden Zellen und Gewebe zunehmend

Mehr

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl. Molekulare Mechanismen der Signaltransduktion 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.com/modul-mms bisheriges Modell auxin auxin AXR1 auxin response AXR1 potentieller

Mehr

Inhaltsverzeichnis. 1 Einleitung... 1

Inhaltsverzeichnis. 1 Einleitung... 1 Inhaltsverzeichnis 1 Einleitung... 1 1.1 G-Protein-gekoppelte Rezeptoren... 3 1.1.1 Klassifizierung und Struktur von G-Protein-gekoppelten Rezeptoren... 6 1.1.2 Purinerge Rezeptoren... 12 1.1.3 Pharmazeutische

Mehr

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins ERGEBNISSE 29 4. Ergebnisse 4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd3-igg1-tnf- Fusionsproteins Im vorliegenden Immunzytokin wurden die Domänen CH2/CH3 des humanen Fc-Fragmentes durch

Mehr

Die Entwicklung von B Lymphozyten

Die Entwicklung von B Lymphozyten Die Entwicklung von B Lymphozyten Die Entwicklung von B Lymphozyten Übersicht Gliederung I II III IV Stammzellen im Knochenmark VDJ Rekombination Positive Selektion Negative Selektion I Stammzellen im

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC

Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC Wolferner Analytik GmbH Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC 1 Veröffentlichung 15.12.2004, Studie Zusammenfassung: Im Auftrag der ASTRA GmbH, einer Vorgesellschaft der

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel. Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar

Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel. Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar Rejektion Hartono et al., 2009 Seite 2 Untersuchungsmaterial Nierengewebe

Mehr

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin - Status und Zukunft PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin

Mehr

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 1.2.1.1. Molekulare Struktur von NCAM S.

Mehr

Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1

Mehr

Anlage zur Akkreditierungsurkunde D PL 13372 01 00

Anlage zur Akkreditierungsurkunde D PL 13372 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13372 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 22.05.2014 bis 25.03.2017 Ausstellungsdatum: 22.05.2014 Urkundeninhaber:

Mehr

Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen

Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen Lorette Weidel Agenda Hintergrund Aufgabenstellung Material & Methoden Ergebnisse Diskussion

Mehr

Trennungsverfahren Techniken (in der Biologie)

Trennungsverfahren Techniken (in der Biologie) Trennungsverfahren Techniken (in der Biologie)? Biomoleküle können getrennt werden aufgrund ihrer - chemischen Eigenschaften: Ladung, Löslichkeit, Wechselwirkung mit spezifischen Reagenzen, Molmasse -

Mehr

Forschungszentrum Karlsruhe

Forschungszentrum Karlsruhe Forschungszentrum Karlsruhe in der Helmholtz-Gemelnschaft Wissenschaftliche Berichte FZKA7106 Biochemische Charakterisierung der Isoprensynthase aus der Graupappel (Populus x canescens (Ait.) Sm.) und

Mehr

Was sind MICROARRAYS? Microarrays sind Technologieplattformen zur Messung der Aktivität einer großen Anzahl von Genen.

Was sind MICROARRAYS? Microarrays sind Technologieplattformen zur Messung der Aktivität einer großen Anzahl von Genen. MICROARRAYS Was sind Microarrays? Welche Technologieplattformen gibt es? Beispiel: Rot-Grün Chip Wie wird ein Chip hergestellt (Film)? Welche Fragen kann man mit Chips beantworten? Datenfluß: Experiment-Design

Mehr

Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign

Mehr

5 Zusammenfassung. Zusammenfassung 76

5 Zusammenfassung. Zusammenfassung 76 Zusammenfassung 76 5 Zusammenfassung 1. Aminosäuren sind als Bausteine der Proteine essentiell zur Aufrechterhaltung vitaler Prozesse. Eine besondere Rolle im Zellmetabolismus der Haut spielen dabei kationische

Mehr

Molekulare Mechanismen der Signaltransduktion

Molekulare Mechanismen der Signaltransduktion Molekulare Mechanismen der Signaltransduktion 07 - Identifizierung von ARF1 + Hinweise für Vorträge Folien: http://tinyurl.com/modul-mms http://www.pnas.org/content/111/14/5427/f1.large.jpg neues Modell

Mehr

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien III. Interdisziplinärer Kongress JUNGE NATURWISSENSCHAFT

Mehr

Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005

Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005 Optimality and evolutionary tuning of the expression level of a protein Erez Dekel & Uri Alon Nature Vol 436, July 2005 Wie Zellen Denken Übersicht Hintergrund Mathematische Formulierung (cost-benefit-theory)

Mehr

Chronische myeloische Leukämie. Chronische Phase

Chronische myeloische Leukämie. Chronische Phase Chronische myeloische Leukämie Chronische Phase Zytologie Prof. Dr. med. Roland Fuchs Prof. Dr. med. Tim Brümmendorf Medizinische Klinik IV Zytogenetik Molekulargenetik Prof. Dr. med. Detlef Haase Zentrum

Mehr

Next Generation Sequencing Vorder- und Rückseite des kompletten Genoms

Next Generation Sequencing Vorder- und Rückseite des kompletten Genoms Next Generation Sequencing Vorder- und Rückseite des kompletten Genoms Thomas Karn Klinik für Gynäkologie und Geburtshilfe J.W. Frankfurt Direktor Prof. S. Becker Whole Genome Sequencing Therapeutische

Mehr

Das Ende der Unsterblichkeit? Mitarbeiter des Ludwig Boltzmann Clusters Oncology (LB-CO) entdecken neue Zielstrukturen in Leukämischen Stammzellen

Das Ende der Unsterblichkeit? Mitarbeiter des Ludwig Boltzmann Clusters Oncology (LB-CO) entdecken neue Zielstrukturen in Leukämischen Stammzellen Das Ende der Unsterblichkeit? Mitarbeiter des Ludwig Boltzmann Clusters Oncology (LB-CO) entdecken neue Zielstrukturen in Leukämischen Stammzellen Zusammenfassung: Tumor-Stammzellen zeichnen sich durch

Mehr

Bioinformatik Statistik und Analyse mit R 22.05.2009-1 -

Bioinformatik Statistik und Analyse mit R 22.05.2009-1 - Bioinformatik Statistik und Analyse mit R 22.05.2009-1 - Definition: Bioinformatik Die Bioinformatik http://de.wikipedia.org/wiki/bioinformatik (englisch bioinformatics, auch computational biology) ist

Mehr

Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen

Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen DISSERTATION der Fakultät für Chemie und Pharmazie der Eberhard-Karls-Universität

Mehr

Moderne und zielgerichtete Therapie der akuten Leukämie

Moderne und zielgerichtete Therapie der akuten Leukämie Universitätsklinikum Regensburg Moderne und zielgerichtete Therapie der akuten Leukämie Wolfgang Herr Innere Medizin III (Hämatologie u. internistische Onkologie) Klinik und Poliklinik für Innere Medizin

Mehr

Neue Diagnostik für akute myeloische Leukämie

Neue Diagnostik für akute myeloische Leukämie Neue Diagnostik für akute myeloische Leukämie Neuherberg (9. März 2011) - Wissenschaftler des Helmholtz Zentrums München und der Ludwig-Maximilians-Universität München haben eine Methode entwickelt, mit

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Molekulares Profiling/Individualisierung - Konsequenzen für Standards, Studien und Therapien der Zukunft -

Molekulares Profiling/Individualisierung - Konsequenzen für Standards, Studien und Therapien der Zukunft - PATHOLOGIE LEIPZIG Pathologie Bochum Molekulares Profiling/Individualisierung - Konsequenzen für Standards, Studien und Therapien der Zukunft - Andrea Tannapfel Institut für Pathologie Ruhr-Universität

Mehr

4.2 Kokulturen Epithelzellen und Makrophagen

4.2 Kokulturen Epithelzellen und Makrophagen Ergebnisse 4.2 Kokulturen Epithelzellen und Makrophagen Nach der eingehenden Untersuchung der einzelnen Zelllinien wurden die Versuche auf Kokulturen aus den A549-Epithelzellen und den Makrophagenzelllinien

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Projektskizze: Studie/ Auswertung/ Publikation

Projektskizze: Studie/ Auswertung/ Publikation Projektskizze: Studie/ Auswertung/ Publikation Name: PD Dr. Dr. Robert Bals, CAPNetz C11 Datum: 30. 8. 2007 Institution(en)/Autor(en): Klinikum der Universität Marburg Klinik für Innere Medizin mit Schwerpunkt

Mehr

Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Herpes simplex Infektionen bei HIV - infizierten Patienten. Johannes R. Bogner Uni München

Herpes simplex Infektionen bei HIV - infizierten Patienten. Johannes R. Bogner Uni München Herpes simplex Infektionen bei HIV - infizierten Patienten Johannes R. Bogner Uni München 1. Die klinische Präsentation von HSV 1 und HSV 2 Läsionen unterscheidet sich oft von Läsionen bei immunkompetenten

Mehr

Transgene Organismen

Transgene Organismen Transgene Organismen Themenübersicht 1) Einführung 2) Komplementäre DNA (cdna) 3) Vektoren 4) Einschleusung von Genen in Eukaryontenzellen 5) Ausmaß der Genexpression 6) Genausschaltung (Gen-Knockout)

Mehr

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Florian Frommlet Institut für medizinische Statistik, Medizinische Universität Wien Wien, November 2013 Einführung DNA Molekül Zwei

Mehr

Expression und Funktion. von Neurotransmitterrezeptoren auf Astrozyten im intakten. Hirngewebe der Maus

Expression und Funktion. von Neurotransmitterrezeptoren auf Astrozyten im intakten. Hirngewebe der Maus Expression und Funktion von Neurotransmitterrezeptoren auf Astrozyten im intakten Hirngewebe der Maus Dissertation zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) von Dipl.-Biochem.

Mehr

Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt

Mehr

MODULE für den SCHULKOFFER GENTECHNIK

MODULE für den SCHULKOFFER GENTECHNIK MODULE für den SCHULKOFFER GENTECHNIK Modul 1 - DNA-Bastel-Set Zusammenbau eines Papiermodells in Form einer Doppelhelix sehr einfach, Unterstufe, ohne Koffer möglich Modul 2 - DNA-Isolierung aus Gemüse

Mehr

Ergebnisse 32. Peptid 1- Peptid 2- Peptid 1- Peptid 2- Sepharose Sepharose Sepharose Sepharose 1/I 1/II 2/I 2/II

Ergebnisse 32. Peptid 1- Peptid 2- Peptid 1- Peptid 2- Sepharose Sepharose Sepharose Sepharose 1/I 1/II 2/I 2/II Ergebnisse 32 4 Ergebnisse 4.1 Nachweis des ORF1-Proteins p40 Das erste offene Leseraster (ORF1) eines L1-Retrotransposons kodiert für ein 40 kd Protein (p40-protein). Dieses Protein hat eine Chaperone-Funktion

Mehr

DETECT III DETECT III

DETECT III DETECT III DETECT III Eine prospektive, randomisierte, zweiarmige, multizentrische Phase III Studie zum Vergleich Standardtherapie versusstandardtherapie mit Lapatinib bei metastasierten Patientinnen mit initial

Mehr

Akute Leukämien. Dr. Luzius Schmid Leitender Arzt für Hämatologie, IKCH luzius.schmid@ikch.ch. Weiterbildung Labmed 15.11.2007. L. Schmid 13.11.

Akute Leukämien. Dr. Luzius Schmid Leitender Arzt für Hämatologie, IKCH luzius.schmid@ikch.ch. Weiterbildung Labmed 15.11.2007. L. Schmid 13.11. Akute Leukämien Weiterbildung Labmed 15.11.2007 Dr. Luzius Schmid Leitender Arzt für Hämatologie, IKCH luzius.schmid@ikch.ch Seite 1 15.11.2007 Allgemeines Seite 2 15.11.2007 Hämopoietische Stammund Vorläuferzellen

Mehr

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C F1-Praktikum Genetik Protokoll Versuch 2: Nachweis der Funktion von Promotor- und Enhancer-Sequenzen mittels Reportergen-Assay Gruppe 8, Manfred Depner & Susanne Duncker Einführung Um die Funktion von

Mehr

Erhö hung der Lebensmittelsicherheit bei Gemu se durch den Einsatz eines natu rlichen Extraktes zum Schutz gegen Krankheitserreger

Erhö hung der Lebensmittelsicherheit bei Gemu se durch den Einsatz eines natu rlichen Extraktes zum Schutz gegen Krankheitserreger GUSTAV WILMS OHG Erhö hung der Lebensmittelsicherheit bei Gemu se durch den Einsatz eines natu rlichen Extraktes zum Schutz gegen Krankheitserreger Effectivity screening of a commercial product from Wilms

Mehr

Das Paper von heute. Samuel Grimm & Jan Kemna

Das Paper von heute. Samuel Grimm & Jan Kemna Das Paper von heute Samuel Grimm & Jan Kemna Bisheriges Modell Was bereits bekannt war - TIR1 ist an Auxinantwort (Zellteilung, Elongation, Differenzierung) beteiligt, im selben Signalweg wie AXR1 - TIR1

Mehr

1 Einleitung... 1. 1.4 Glucoserepression...3. 1.8 Zielsetzung... 24. 2 Material und Methoden... 25

1 Einleitung... 1. 1.4 Glucoserepression...3. 1.8 Zielsetzung... 24. 2 Material und Methoden... 25 Inhaltsverzeichnis 1 Einleitung... 1 1.1 Zuckerstoffwechsel von Saccharomyces cerevisiae... 1 1.2 Glucoseinaktivierung... 2 1.3 Glucoseinduzierter gezielter mrna-abbau... 3 1.4 Glucoserepression...3 1.5

Mehr

Grundlegende Experimente der Molekulargenetik

Grundlegende Experimente der Molekulargenetik Übung 12 Wiederholung/Zusatzübung Inhalte: Mendelscher Erbgang Grundlegende Experimente der Molekulargenetik Transposons Methoden 1. Sie haben drei runde, gelbe Erbsen (A, B und C). Aus jeder der drei

Mehr

Molekularbiologische Datenbanken

Molekularbiologische Datenbanken Molekularbiologische Datenbanken Übungen Aufgabe 2 Silke Trißl Ulf Leser Wissensmanagement in der Bioinformatik Microarray oder Expressionsanalyse Gleiche Erbinformation in der Zelle (Genom), aber viele

Mehr

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 26.06.2015 bis 25.03.2017 Ausstellungsdatum: 26.06.2015 Urkundeninhaber:

Mehr

Veranstaltungsort. Konferenzzentrum München Hanns Seidel Stiftung Lazarettstraße München. Lageplan

Veranstaltungsort. Konferenzzentrum München Hanns Seidel Stiftung Lazarettstraße München. Lageplan Absender in Druckschrift / Stempel Ariane Kölsch Beckman Coulter GmbH Europark Fichtenhain B13 47807 Krefeld Veranstaltungsort Konferenzzentrum München Hanns Seidel Stiftung Lazarettstraße 33 80636 München

Mehr

Role of CXCR4 and Gab1 in the development of muscle precursor cells

Role of CXCR4 and Gab1 in the development of muscle precursor cells Role of CXCR4 and Gab1 in the development of muscle precursor cells Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.) eingereicht im Fachbereich Biologie,

Mehr

Krebserkrankungen im Kindes- und Jugendalter C.F.Classen. Vorlesung

Krebserkrankungen im Kindes- und Jugendalter C.F.Classen. Vorlesung Krebserkrankungen im Kindes- und Jugendalter C.F.Classen Vorlesung Krebserkrankungen bei Kindern und Jugendlichen sind etwas Seltenes: Nur etwa eines von tausend Kindern ist betroffen, während es im Erwachsenenalter

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

HIV-Infektion und AIDS. Seminar aus funktioneller Pathologie

HIV-Infektion und AIDS. Seminar aus funktioneller Pathologie HIV-Infektion und AIDS Seminar aus funktioneller Pathologie Retroviren des Menschen Lentiviren von Primaten Das Virion des HI-Virus schematisch und elektronenmikroskopisch Virale Gene Bindungssequenzen

Mehr

22. Onkologisches Symposium Große Fortschritte in der Leukämietherapie

22. Onkologisches Symposium Große Fortschritte in der Leukämietherapie 22. Onkologisches Symposium - 21.01.2017 Große Fortschritte in der Leukämietherapie Prof. Dr. Wolfgang Herr Klinik und Poliklinik für Innere Medizin III - Hämatologie und intern. Onkologie Leukämien (Patienten

Mehr

Nachweis gentechnisch veränderter Lebensmittel: Ohne Gentechnik oder: Wieviel Gentechnik ist da eigentlich drin? Dr. Lutz Grohmann

Nachweis gentechnisch veränderter Lebensmittel: Ohne Gentechnik oder: Wieviel Gentechnik ist da eigentlich drin? Dr. Lutz Grohmann Nachweis gentechnisch veränderter Lebensmittel: Ohne Gentechnik oder: Wieviel Gentechnik ist da eigentlich drin? Dr. Lutz Grohmann Gliederung 1. Gesetzlicher Rahmen 2. Erbsubstanz und Gentechnik 3. Anwendungen

Mehr

1 Einleitung... 1. 2 Material und Methoden... 11. Inhaltsverzeichnis. 1.1 Venturia inaequalis... 3. 1.1.1 Die Biologie des Erregers...

1 Einleitung... 1. 2 Material und Methoden... 11. Inhaltsverzeichnis. 1.1 Venturia inaequalis... 3. 1.1.1 Die Biologie des Erregers... Inhaltsverzeichnis 1 Einleitung... 1 1.1 Venturia inaequalis... 3 1.1.1 Die Biologie des Erregers... 3 1.1.2 Symptome... 4 1.1.3 In vitro-testsysteme für das Pathosystem Malus/V. inaequalis... 6 1.2 Die

Mehr

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik Ruprecht Kuner Abteilung Molekulare Genomanalyse DKFZ Heidelberg Vortragsübersicht Folie 1 1. Was ist ein Biochip / Microarray?

Mehr

Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:

Frage 1 A: Wieviele Codone des Universellen genetisches Codes kodieren: Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren: Aminosäuren Translationsstart Translationsstop? B: Welche biochemische Reaktion wird von Aminoazyl-tRNA-Synthetasen katalysiert?

Mehr

BMP / TGF-ß Receptor. Prof. Dr. Albert Duschl

BMP / TGF-ß Receptor. Prof. Dr. Albert Duschl BMP / TGF-ß Receptor Prof. Dr. Albert Duschl Biologische Regelsysteme Behalten Sie bitte im Gedächtnis, daß biologische Systeme immer wieder vor vergleichbaren Aufgaben stehen, bei denen es darum geht,

Mehr

Drexler G.A. 1, Derer A 1, Dirks W.G. 2, Hable V. 3, Greubel C. 3, Burgdorfer C. 3, Dollinger G. 3, Du G. 4, Friedl A.A. 1

Drexler G.A. 1, Derer A 1, Dirks W.G. 2, Hable V. 3, Greubel C. 3, Burgdorfer C. 3, Dollinger G. 3, Du G. 4, Friedl A.A. 1 Nutzung von bi-cistronischen Vektoren für die Beobachtung der Rekrutierung von Signal- und Reparaturproteinen an DNA-Schäden nach Ionen- Mikrobestrahlung durch Live-Cell Imaging Drexler G.A. 1, Derer A

Mehr

E.H.S. Hausmann, K. Mac, L. Ellerbroek

E.H.S. Hausmann, K. Mac, L. Ellerbroek Ein Bericht über eine gelungene Zusammenarbeit des Genlabors an der Emil- Fischer-Schule mit dem Bundesinstitut für Risikobewertung, Fachgruppe 42: Lebensmittelhygiene und Sicherheitskonzepte in Berlin

Mehr

Chromosomale Veränderungen in der Tumodiagnostik: Bedeutung und neue Anforderungen an die Qualitätssicherung

Chromosomale Veränderungen in der Tumodiagnostik: Bedeutung und neue Anforderungen an die Qualitätssicherung Chromosomale Veränderungen in der Tumodiagnostik: Bedeutung und neue Anforderungen an die Qualitätssicherung Prof. Dr. Beat Schäfer Laborleiter Onkologie Universitäts-Kinderkliniken Zürich Molekulare Diagnostik,

Mehr

F-Praktikum Physik: Photolumineszenz an Halbleiterheterostruktur

F-Praktikum Physik: Photolumineszenz an Halbleiterheterostruktur F-Praktikum Physik: Photolumineszenz an Halbleiterheterostruktur David Riemenschneider & Felix Spanier 31. Januar 2001 1 Inhaltsverzeichnis 1 Einleitung 3 2 Auswertung 3 2.1 Darstellung sämtlicher PL-Spektren................

Mehr

Diss. ETH No. 13704. A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH. for the degree of DOCTOR OF NATURAL SCIENCES

Diss. ETH No. 13704. A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH. for the degree of DOCTOR OF NATURAL SCIENCES Diss. ETH No. 13704 Regulation of Insulin-Iike Growth Factor Type 1 Receptor Expression in A549 non-small Cell Lung Cancer and Saos-2/B-1 0 osteoblastic Osteosarcoma Cells and its Implication in Tumor

Mehr

27 Funktionelle Genomanalysen Sachverzeichnis

27 Funktionelle Genomanalysen Sachverzeichnis Inhaltsverzeichnis 27 Funktionelle Genomanalysen... 543 27.1 Einleitung... 543 27.2 RNA-Interferenz: sirna/shrna-screens 543 Gunter Meister 27.3 Knock-out-Technologie: homologe Rekombination im Genom der

Mehr

Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32

Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32 Inhaltsverzeichnis 1. Einleitung... 9 1.1 Posttranslationale Modifikationen... 10 1.2 N-Glykosylierung... 11 1.3 O-Glykosylierung... 12 1.4 Veränderungen der Glykosylierung bei der Tumorentstehung... 13

Mehr

Untersuchung von DNA Methylierungsprofilen mit Hilfe veröffentlichter Genexpressionsignaturen

Untersuchung von DNA Methylierungsprofilen mit Hilfe veröffentlichter Genexpressionsignaturen Untersuchung von DNA Methylierungsprofilen mit Hilfe veröffentlichter Genexpressionsignaturen Christian Ruckert Universität Münster 7. September 2010 Inhalt 1 Einleitung 2 Daten und Methoden 3 Ergebnisse

Mehr