Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen"

Transkript

1 Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen

2 Humangenom Größe 150 m Nukleotide 3000 x 1000 x 1000 Bücher Seiten Buchstaben

3 Watson, J.D., and F.H.C.Crick. Molecular Structure of Nucleic Acids: A Structure for Deoxynucleic Acids. Nature 171: Abschluss des Internationalen Humangenom Projektes James Watson & Francis Crick mit DNA Modell, 1953

4 cubus hugo multimediale installation, IMB Jena, Tage 24 Chromosomen 50 Basen/Sek am Tag 3000 Base/Sek in der Nacht 1.66% vs % Frank Hellwig Steffen Fischer Dresden Michael Utting Jena

5 AAAACTGCGACTGCGCGGCGTGAGCTCGCTGAGACTTCCTGGACCCCGCACCAGGCTGTGGGGTTTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCTTCACCCTC TGCTCTGGGTAAAGTTCATTGGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCC ATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGT CCTTTATGTAAGAATGATATAACCAAAAGGAGCCTACAAGAAAGTACGAGATTTAGTCAACTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACA GGTTTGGAGTATGCAAACAGCTATAATTTTGCAAAAAAGGAAAATAACTCTCCTGAACATCTAAAAGATGAAGTTTCTATCATCCAAAGTATGGGCTACAGAAACCGT GCCAAAAGACTTCTACAGAGTGAACCCGAAAATCCTTCCTTGCAGGAAACCAGTCTCAGTGTCCAACTCTCTAACCTTGGAACTGTGAGAACTCTGAGGACAAAGCAG CGGATACAACCTCAAAAGACGTCTGTCTACATTGAATTGGGATCTGATTCTTCTGAAGATACCGTTAATAAGGCAACTTATTGCAGTGTGGGAGATCAAGAATTGTTA CAAATCACCCCTCAAGGAACCAGGGATGAAATCAGTTTGGATTCTGCAAAAAAGGCTGCTTGTGAATTTTCTGAGACGGATGTAACAAATACTGAACATCATCAACCC AGTAATAATGATTTGAACACCACTGAGAAGCGTGCAGCTGAGAGGCATCCAGAAAAGTATCAGGGTAGTTCTGTTTCAAACTTGCATGTGGAGCCATGTGGCACAAAT ACTCATGCCAGCTCATTACAGCATGAGAACAGCAGTTTATTACTCACTAAAGACAGAATGAATGTAGAAAAGGCTGAATTCTGTAATAAAAGCAAACAGCCTGGCTTA GCAAGGAGCCAACATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAAAGGTAGATCTGAATGCTGATCCCCTGTGTGAG AGAAAAGAATGGAATAAGCAGAAACTGCCATGCTCAGAGAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGAAAGTTAATGAGTGG TTTTCCAGAAGTGATGAACTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAATGCCAAAGTAGCTGATGTATTGGACGTTCTAAATGAGGTAGATGAA TATTCTGGTTCTTCAGAGAAAATAGACTTACTGGCCAGTGATCCTCATGAGGCTTTAATATGTAAAAGTGAAAGAGTTCACTCCAAATCAGTAGAGAGTAATATTGAA GACAAAATATTTGGGAAAACCTATCGGAAGAAGGCAAGCCTCCCCAACTTAAGCCATGTAACTGAAAATCTAATTATAGGAGCATTTGTTACTGAGCCACAGATAATA CAAGAGCGTCCCCTCACAAATAAATTAAAGCGTAAAAGGAGACCTACATCAGGCCTTCATCCTGAGGATTTTATCAAGAAAGCAGATTTGGCAGTTCAAAAGACTCCT GAAATGATAAATCAGGGAACTAACCAAACGGAGCAGAATGGTCAAGTGATGAATATTACTAATAGTGGTCATGAGAATAAAACAAAAGGTGATTCTATTCAGAATGAG AAAAATCCTAACCCAATAGAATCACTCGAAAAAGAATCTGCTTTCAAAACGAAAGCTGAACCTATAAGCAGCAGTATAAGCAATATGGAACTCGAATTAAATATCCAC AATTCAAAAGCACCTAAAAAGAATAGGCTGAGGAGGAAGTCTTCTACCAGGCATATTCATGCGCTTGAACTAGTAGTCAGTAGAAATCTAAGCCCACCTAATTGTACT GAATTGCAAATTGATAGTTGTTCTAGCAGTGAAGAGATAAAGAAAAAAAAGTACAACCAAATGCCAGTCAGGCACAGCAGAAACCTACAACTCATGGAAGGTAAAGAA CCTGCAACTGGAGCCAAGAAGAGTAACAAGCCAAATGAACAGACAAGTAAAAGACATGACAGCGATACTTTCCCAGAGCTGAAGTTAACAAATGCACCTGGTTCTTTT ACTAAGTGTTCAAATACCAGTGAACTTAAAGAATTTGTCAATCCTAGCCTTCCAAGAGAAGAAAAAGAAGAGAAACTAGAAACAGTTAAAGTGTCTAATAATGCTGAA GACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGTTTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCTGGTACTGATTATGGCACTCAGGAA AGTATCTCGTTACTGGAAGTTAGCACTCTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAGCATTTGAAAACCCCAAGGGACTAATTCATGGT TGTTCCAAAGATAATAGAAATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGCGGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATG CTCAGTATTTGCAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCAAATCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTG GGTCCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAAGAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGTTAATATCA CTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTGATAATGCCAAATGTAGTATCAAAGGAGGCTCTAGGTTTTGTCTATCATCTCAGTTCAGAGGCAACG AAACTGGACTCATTACTCCAAATAAACATGGACTTTTACAAAACCCATATCGTATACCACCACTTTTTCCCATCAAGTCATTTGTTAAAACTAAATGTAAGAAAAATC TGCTAGAGGAAAACTTTGAGGAACATTCAATGTCACCTGAAAGAGAAATGGGAAATGAGAACATTCCAAGTACAGTGAGCACAATTAGCCGTAATAACATTAGAGAAA ATGTTTTTAAAGAAGCCAGCTCAAGCAATATTAATGAAGTAGGTTCCAGTACTAATGAAGTGGGCTCCAGTATTAATGAAATAGGTTCCAGTGATGAAAACATTCAAG CAGAACTAGGTAGAAACAGAGGGCCAAAATTGAATGCTATGCTTAGATTAGGGGTTTTGCAACCTGAGGTCTATAAACAAAGTCTTCCTGGAAGTAATTGTAAGCATC CTGAAATAAAAAAGCAAGAATATGAAGAAGTAGTTCAGACTGTTAATACAGATTTCTCTCCATATCTGATTTCAGATAACTTAGAACAGCCTATGGGAAGTAGTCATG CATCTCAGGTTTGTTCTGAGACACCTGATGACCTGTTAGATGATGGTGAAATAAAGGAAGATACTAGTTTTGCTGAAAATGACATTAAGGAAAGTTCTGCTGTTTTTA GCAAAAGCGTCCAGAAAGGAGAGCTTAGCAGGAGTCCTAGCCCTTTCACCCATACACATTTGGCTCAGGGTTACCGAAGAGGGGCCAAGAAATTAGAGTCCTCAGAAG AGAACTTATCTAGTGAGGATGAAGAGCTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACCG AGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTA GTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCA AACAAATGAGGCATCAGTCTGAAAGCCAGGGAGTTGGTCTGAGTGACAAGGAATTGGTTTCAGATGATGAAGAAAGAGGAACGGGCTTGGAAGAAAATAATCAAGAAG Brustkrebsgen BRCA1

6

7 Human-Genom-Projekt Ziele Hochauflösende Kartierung des Genoms Vollständige Sequenzierung aller Chromosomen Identifikation aller Gene Technologie-Entwicklung Analyse von Modellorganismen Untersuchung der ethisch & sozialen Konsequenzen

8 Sequenzierung des Human-Genoms Herausforderungen Größe 25x größer als bis 2000 größtes sequenziertes Genom Gehalt an sich wiederholenden Sequenzen ca.40% erwartet Medizinische Relevanz persönliche und gesellschaftliche Konsequenzen, ethische Brisanz Internationales Interesse 20 Zentren aus 6 Ländern privatwirtschaftliche Konkurrenz seit 1998

9 Sequenzierung des Human-Genoms Internationale Zusammenarbeit

10 Sequenzierung des Human-Genoms Phasen Selbstverpflichtung zur Datenfreigabe Privatwirtschaftliche Konkurrenz Sequenz (Mb) 5000 Rohfassungssequenzen finale Sequenzen 1000 Phasen: Pilot-Phase Produktion Jul 04 Jan 04 Jul 03 Jan 03 Jul 02 Jan 02 Jul 01 Jan 01 Jul 00 Jan 00 Jul 99 Jan 99 Jul 98 Jan 98 Jul 97 Jan 97 Jul 96 Jan 96 0 Fertigstellung Pressekonferenzen: 26. Juni 2000 Abschluß der Produktionsphase 12. Februar April Oktobr 2004 Veröffentlichung der ersten Analyse Veröffentlichung zur Fertigstellung Abschluss der Sequenzierung

11 Sequenzierung des Human-Genoms Publikationen der Rohfassung 2001 Internationales akademisches Konsortium Privates Unternehmen Celera

12 Sequenzierung des Human-Genoms Phasen Selbstverpflichtung zur Datenfreigabe Privatwirtschaftliche Konkurrenz Sequenz (Mb) 5000 Rohfassungssequenzen finale Sequenzen 1000 Phasen: Pilot-Phase Produktion Jul 04 Jan 04 Jul 03 Jan 03 Jul 02 Jan 02 Jul 01 Jan 01 Jul 00 Jan 00 Jul 99 Jan 99 Jul 98 Jan 98 Jul 97 Jan 97 Jul 96 Jan 96 0 Fertigstellung Pressekonferenzen: 26. Juni 2000 Abschluß der Produktionsphase 12. Februar April Oktobr 2004 Veröffentlichung der ersten Analyse Veröffentlichung zur Fertigstellung Abschluss der Sequenzierung

13 Fertigstellen des Human-Genoms Beiträge der nationalen Genomprojekte 62,3% 25,1% 5,5% USA GB Japan 2,7% Frankreich 2,5% Deutschl 1,0% China

14 Sequenzierung des Human-Genoms Human Sequence % Beiträge der beteiligten Zentren 8 X 21 US MIT Japan Keio Sanger UK Baylor US in Vorb. März 2005 Mai 2000 IHGSC (2001), Nature 409: 860

15 Analyse des Humangenoms Ergebnisse & Besonderheiten Protein-Gene ungleichmäßige Genverteilung Pflanze , Wurm , Fliege % des Genoms sind "genlose Wüste komplexe Transkription 50% repetitive Elemente von 60% aller Gene werden mehrere mrnas transkribiert springende und sich selbst vermehrende Sequenzen, Mikrosatelliten komplexe Proteinarchitektur extrem hohe Genauigkeit mehr funktionelle Domänen pro Protein als bei niederen Organismen %, d.h. < als 1 Fehler auf Basen

16 Genome von Modellorganismen Vergleichende Genomanalyse Ratte Hund Rind Huhn Zebrafisch Schimpanse

17 Genetische Variabilität Einzel-Nukleotid-Polymorphismus (SNP) ATTCGACGTATTG ATTCGATGTATTG SNP 6 Mio SNPs genomweit 1/500 bp 2 Individuen unterscheiden sich in ~ SNPs 1/ bp ca. 5%, d.h SNPs haben einen Phänotyp, ein Teil davon klinische Relevanz

18 Gene und Krankheit monogene - polygene - multifaktorielle Erkrankungen Relatives Erkrankungsrisiko für Geschwister ( s) 850 Mukoviszidose We used to think our fate was in our stars. Now we know, in large measure, our fate is in our genes James Watson, chronisch-entzündliche Darmerkrankungen multiple Sklerose 20 Schizophrenie 10 Psoriasis Diabetes Typ I 5 Asthma 2,5 Bluthochdruck

19 Krankheitsgene Aufklärungsrate Anzahl identifizierter Krankheitsgene

20 Prinzip der positionalen Klonierung Identifikation von Krankeitsgenenen WWW Kopplungsanalyse Physische Kartierung in betroffenen Familien der Region Identifikation aller Gene Mutationsanalyse von Kandidatengenen in Betroffenen und Kontrollen

21 DNA-Microarray-(Chip)Technologie Genotypisierung & Expressionsanalyse Genomische DNA Hybridisierung mrna cdna-synthese reverse Transkription Vervielfältigung (PCR) Markierung cdna Fragmente Analyse Vervielfältigung (PCR) Markierung Fragmente

22 DNA-Microarray-(Chip)Technologie Genexpression in Diagnostik & Therapie Patientenprobe sonde sonde sonde sonde sonde sonde Patientenmuster 06 sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde sonde 51 gesund Krankheit A Krankheit B Krankheit C Mustervergleich Diagnose Identifizierung von Zielgenen für Therapie, Verlaufskontrolle

23 Pharmakogenetik Problem Therapieerfolg Therapie, ohne Erfolg keine Therapie Nebenwirkungen oder andere Form

24 Pharmakogenetik Mechanismen variabler Arzneimittelwirkungen spricht an spricht nicht an Gen im Wirkmechanismus des Arzneimittels Transport Rezeptor spricht nicht an oder toxische Nebenwirkungen Gen im Arzneimittelmetabolismus

25 Pharmakogenetik Zytochrom P450 AmpliChip von Roche CYP2D6 Bestimmung der Allele von 2 Zytochrom P450 Genen MR Debrisoquine/4-Hydroxydebrisoquine erforderliche Dosis Nortriptylin (mg/tag) Berechnung der individuellen optimalen Arzneimitteldosis

26 Individualisierte Medizin Ziel & Risiken Pharmaka für Subpopulationen (Genotypen) optimale Dosis - geringe Nebenwirkungen Einengung der Pharmamärkte Benachteiligung von Trägern seltener Genotypen

27 Individualisierte Medizin A,B,0 Blutgruppen Arg Gly-Leu-Gly A-Spezifität Gly Ser-Met-Ala B-Spezifität A,B,0 - drei Haplotypen des Glykosyltransferase-Gens

28 Genetische Tests Ziele und Konsequenzen Diagnostik und Prognose von Krankheiten Pharmazeutisches Reaktionsprofil Genetischer Fingerabdruck monogen polygen Genmutation= Prädisposition Ursache Erkrankungsrisiko prädiktiv bedingt prädiktiv Gene für Metabolisierung & Wirkung von Pharmaka nicht prädiktiv für Erkrankung Mikrosatelliten Vaterschaft, Forensik keine personenbezogenen Daten Diagnostik, Therapie individualisierte Lebensplanung, Prävention medizinische und ethische KonsequenzenTherapie Recht auf Nichtwissen & Schutz personenbezogener Daten Identitätsnachweis

29 Ausblick Grundlagenforschung Funktionsanalyse aller Gene Identifizierung von Krankheitsgenen Vergleichende Genomik zwischen Spezies Sequenzierung von weiteren Modell-Genomen zwischen Populationen Variabilität - Internationales Projekt HGDiversityP zwischen Individuen Variabilität - Internationales Projekt HapMap zwischen Zellen/Geweben Bedeutung der 5. Base mc für Differenzierung & Krankheiten-Human Epigenom Project Technologieentwicklung Sequenzierung & Typisierung

30 Was bleibt zu tun? Gesellschaftlicher Rahmen & Konsens Recht auf Nichtwissen Recht auf Nichtinformiertheit Recht auf Wissen, dessen Datenschutz und Finanzierung Verhinderung genetischer Fremdbestimmung Arbeitskreis "Medizin, Ethik und Gesellschaft", Jena

31 Nationales Genomforschungsnetz

32 Ausblick Nature 21. Oktober 2004

33

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

Das internationale Human-Genom Projekt. Stand Ergebnisse Perspektiven

Das internationale Human-Genom Projekt. Stand Ergebnisse Perspektiven Das internationale Human-Genom Projekt Stand Ergebnisse Perspektiven 2003 1953 April, 25 th, 1953 Watson, J.D., and F.H.C.Crick. 1953. Molecular Structure of Nucleic Acids: A Structure for Deoxynucleic

Mehr

Sequenzanalyse des Humangenoms. Stand & Perspektiven

Sequenzanalyse des Humangenoms. Stand & Perspektiven Sequenzanalyse des Humangenoms Stand & Perspektiven Genetische Eukaryonten-Autobahn Zahl & Zustand der Fahrstreifen Yeast Human S. cerevisiae H. sapiens Worm C. elegans Fly Fish D. melanogaster F. rubripes

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

Einblicke in das menschliche Erbgut (Genom) am Computer

Einblicke in das menschliche Erbgut (Genom) am Computer Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Binger Nacht der Wissenschaft - 16.04.2010 Das menschliche Genom ist entschlüsselt

Mehr

DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet

Mehr

SNPs, Indels, VNTRs. Gründe für ein Interesse an der genetischen Diversität

SNPs, Indels, VNTRs. Gründe für ein Interesse an der genetischen Diversität Genetische Diversität: SNPs, Indels, VNTRs Gründe für ein Interesse an der genetischen Diversität Aufklärung der Geschichte von Populationen (Migrationen, demographische Ereignisse) Forensik / Aussagen

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32

Mehr

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Individuelle Genomsequenzen Aussichten für die Tierzucht

Individuelle Genomsequenzen Aussichten für die Tierzucht Individuelle Genomsequenzen Aussichten für die Tierzucht Ruedi Fries WZW / Lehrstuhl für Tierzucht Agrarw. Symposium - 1 Auswirkungen der Genomischen Revolution auf die Tierzucht (und Pflanzenzucht) Agrarw.

Mehr

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien III. Interdisziplinärer Kongress JUNGE NATURWISSENSCHAFT

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 011 9. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (.000.000.000 Basenpaare)

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Zentronukleäre Myopathien von der Diagnose zur Therapie

Zentronukleäre Myopathien von der Diagnose zur Therapie MTM Familientreffen Göttingen, 5./6. Juni 2014 Zentronukleäre Myopathien von der Diagnose zur Therapie Dr. Johann Böhm IGBMC, Strasbourg Ein paar Worte über Strasbourg.and über das IGBMC Ein paar Worte

Mehr

Chancen und Grenzen einer individualisierten Arzneimitteltherapie

Chancen und Grenzen einer individualisierten Arzneimitteltherapie einer individualisierten Arzneimitteltherapie Gießen 2006 Prof. Dr. Manfred Schubert-Zsilavecz Johann Wolfgang Goethe-Universität Frankfurt am Main Arzneimittelinnovationen Grundlage für die Erfolge in

Mehr

Anlage zur Akkreditierungsurkunde D PL 13372 01 00

Anlage zur Akkreditierungsurkunde D PL 13372 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13372 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 22.05.2014 bis 25.03.2017 Ausstellungsdatum: 22.05.2014 Urkundeninhaber:

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

Pharmazeutische Biologie WS2011/2012. Das neue Paradigma: Personalisierte Medizin

Pharmazeutische Biologie WS2011/2012. Das neue Paradigma: Personalisierte Medizin 3. Vorlesung Pharmazeutische Biologie WS2011/2012 Das neue Paradigma: Personalisierte Medizin Prof. Theo Dingermann Institut für Pharmazeutische Biologie Biozentrum Max-von Laue-Str. 9 60438 Frankfurt

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Einblicke in das menschliche Genom aus Sicht der Bioinformatik Prof. Dr. Antje Krause FH Bingen a.krause@fh-bingen.de Kurzer Ausflug in die Genetik DNA (Desoxyribonukleinsäure)

Mehr

Genomik und Bioinformatik für komplexe Krankheiten

Genomik und Bioinformatik für komplexe Krankheiten Genomik und Bioinformatik für komplexe Krankheiten Univ.-Prof. DI Dr. Zlatko Trajanoski Institut für Elektro- und Biomedizinische Technik und Christian-Doppler-Labor für Genomik und Bioinformatik Technische

Mehr

Die Gene Buch des Lebens

Die Gene Buch des Lebens Die Gene Buch des Lebens Tagung der Evangelischen Akademie Tutzing 30. 6. 2. 7. 2006 in Thurnau Was kann die Humangenetik zur Aufklärung multifaktorieller Krankheiten beitragen? Peter Propping Institut

Mehr

Wer bin ich? Was sagen mir meine Gene?

Wer bin ich? Was sagen mir meine Gene? Wer bin ich? Was sagen mir meine Gene? Prof. Theo Dingermann Institut für Pharmazeutische Biologie Biozentrum Max-von Laue-Str. 9 60438 Frankfurt am Main Dingermann@em.uni-frankfurt.de 02/03/11 Sind die

Mehr

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen Fotos: M. Rindlisbacher Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen H. Hasler 1, F. Berruex 3, B. Haase 2, C. Flury 1, T. Leeb 2, V. Gerber 4, H. Simianer 5, D. Burger 3, P.A. Poncet

Mehr

Vom Klimastress zur Genfunktion

Vom Klimastress zur Genfunktion Bayerische Landesanstalt für Landwirtschaft Vom Klimastress zur Genfunktion - genetische Analysen zur züchterischen Nutzung der genetischen Diversität bei Kulturpflanzen Dr. Günther Schweizer Kongress

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 26.06.2015 bis 25.03.2017 Ausstellungsdatum: 26.06.2015 Urkundeninhaber:

Mehr

Pressekonferenz 17.5.2004. Auf dem Weg zum «massgeschneiderten Medikament»?

Pressekonferenz 17.5.2004. Auf dem Weg zum «massgeschneiderten Medikament»? Pressekonferenz 17.5.2004 Auf dem Weg zum «massgeschneiderten Medikament»? Dr. Klaus Peter Rippe Andreas Bachmann Dr. Nicole Probst-Hensch Marion Völger Auf dem Weg zum massgeschneiderten Medikament? Das

Mehr

Ethische und rechtliche Aspekte der Totalsequenzierung von menschlichen Genomen das EURAT-Projekt im Marsilius-Kolleg

Ethische und rechtliche Aspekte der Totalsequenzierung von menschlichen Genomen das EURAT-Projekt im Marsilius-Kolleg marsilius kolleg Universität Heidelberg Zukunft seit 1386 Ethische und rechtliche Aspekte der Totalsequenzierung von menschlichen Genomen das EURAT-Projekt im Marsilius-Kolleg Stefan Wiemann, Gösta Gantner,

Mehr

Assoziationsstudien. Prof. DI Dr. Andrea Berghold Institut für Med. Informatik, Statistik und Dokumentation

Assoziationsstudien. Prof. DI Dr. Andrea Berghold Institut für Med. Informatik, Statistik und Dokumentation Assoziationsstudien Prof. DI Dr. Andrea Berghold Institut für Med. Informatik, Statistik und Dokumentation Inhalt Ziele von Assoziationsstudien Design von Assoziationsstudien Statistische Analysemethoden

Mehr

Zweigbibliofhek Medizin

Zweigbibliofhek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliofhek Medizin

Mehr

Genomanalyse Vorlesung Masterstudiengang 2011 Jena FLI. Klaus Huse Leibniz-Institut für Altersforschung Fritz-Lipmann-Institut Jena

Genomanalyse Vorlesung Masterstudiengang 2011 Jena FLI. Klaus Huse Leibniz-Institut für Altersforschung Fritz-Lipmann-Institut Jena Vorlesung Masterstudiengang 2011 Jena 9.11.2011 FLI Klaus Huse Leibniz-Institut für Altersforschung Fritz-Lipmann-Institut Jena Genom Begriffsbestimmung Gen (Johannsen, 1909) - Erbfaktor, der eine einzelne

Mehr

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Christian-Albrechts-Universität zu Kiel Next-Generation Sequencing (NGS) Nach Sanger Sequencing (1977) zweite Generation

Mehr

VERTIEFENDE INFORMATION Personalisierte Medizin: Bessere Diagnosen mit Hilfe der DNA-Analyse?

VERTIEFENDE INFORMATION Personalisierte Medizin: Bessere Diagnosen mit Hilfe der DNA-Analyse? - 1 - Personalisierte Medizin ist der Überbegriff für die Strategie, Medikamente und Therapien zu entwickeln, die besser auf den einzelnen Patienten zugeschnitten sind. Dabei sollen routinemäßige Gentests

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7. Einführung 19

Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7. Einführung 19 Inhaltsverzeichnis Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7 Einführung 19 Über dieses Buch 19 Konventionen in diesem Buch 19 Was Sie nicht lesen müssen 20 Törichte Annahmen über

Mehr

Molekulare Grundlagen der Humangenetik

Molekulare Grundlagen der Humangenetik Molekulare Grundlagen der Humangenetik Aufbau und Funktion des Genoms... Grundlagen... Eukaryontengenom... Variabilität des Genoms... Transkription und Translation der genetischen Information... DNAundRNA...

Mehr

Bioinformatik an der FH Bingen

Bioinformatik an der FH Bingen Bioinformatik an der FH Bingen Prof. Dr. Antje Krause 05.11.2010 Wie alles begann... 1955 erste Proteinsequenz (nach 12 Jahren Arbeit) veröffentlicht (Insulin vom Rind) Frederick Sanger MALWTRLRPLLALLALWPPPPA

Mehr

Informationstechnologie in der Pflanzenzüchtung. Biocomputing in einem Züchtungsunternehmen. Andreas Menze KWS SAAT AG, Einbeck

Informationstechnologie in der Pflanzenzüchtung. Biocomputing in einem Züchtungsunternehmen. Andreas Menze KWS SAAT AG, Einbeck Informationstechnologie in der Pflanzenzüchtung Biocomputing in einem Züchtungsunternehmen Andreas Menze KWS SAAT AG, Einbeck Biocomputing in einem Züchtungsunternehmen Biocomputing Was ist das? Wozu wird

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16

Mehr

Voraussetzungen für die Genomische Selektion beim Pferd

Voraussetzungen für die Genomische Selektion beim Pferd Agrar- und Ernährungswissenschaftliche Fakultät Institut für Tierzucht und Tierhaltung Voraussetzungen für die Genomische Selektion beim Pferd Prof. Dr. Georg Thaller 32. Jahrestagung zur Pferdegesundheit

Mehr

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held ACT/CVS neueste gendiagnostische Verfahren 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held DNA, Gene, Chromosomen DNA besteht aus den Basenpaaren Adenin - Thymin

Mehr

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61 Tier-Biotechnologie Inhaltsverzeichnis Vorwort. 9 Mitarbeiter. 10 Einführung in die Tier-Biotechnologie. 11 Teil I: Zellkultur- und Bioverfahrenstechniken. 23 1 Kultivierung tierischer Zellen. 25 1.1 Voraussetzungen

Mehr

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats Das humane Genom satellites and single repeats protein coding & non-protein coding mobile (transposable) DNA elements Alle Genome sind individuell, selbst jene eineiiger Zwillinge! 1 Variationen im humanen

Mehr

Roche Personalisierte Medizin Die Behandlungen auf die Patienten zuschneiden. April 2012

Roche Personalisierte Medizin Die Behandlungen auf die Patienten zuschneiden. April 2012 Roche Personalisierte Medizin Die Behandlungen auf die Patienten zuschneiden April 2012 Gesundheitswesen Personalisierte Medizin bei Roche Vorteile für Patienten, Ärzte und Kostenträger Einzigartige Positionierung

Mehr

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin - Status und Zukunft PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin

Mehr

Workshop des WissGrid Fachberater-Teams

Workshop des WissGrid Fachberater-Teams Workshop des WissGrid Fachberater-Teams Virtuelle Forschungsumgebungen aufbauen - mit D-Grid - Communities mit datenlastigen Aufgaben 19. Januar 2011, Göttingen Benjamin Löhnhardt Vortragsinhalte Einleitung

Mehr

Trio-Analyse (Exome-Seq)

Trio-Analyse (Exome-Seq) WS2017/2018 MSc Modul 7A Genomforschung und Sequenzanalyse - Einführung in Methoden der Bioinformatik- AG Hankeln Trio-Analyse (Exome-Seq) Mutationen mit Krankheitsrelevanz im Humangenom More than 3800

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

WARUM FRAUEN GESÜNDER LEBEN & MÄNNER FRÜHER STERBEN. Inhalt

WARUM FRAUEN GESÜNDER LEBEN & MÄNNER FRÜHER STERBEN. Inhalt Inhalt 15 Zwei Gesundheitskulturen Männer sind anders, Frauen auch 16 Der Begriff Gender Medicine 18 Biologische Gegebenheiten 19 Frauen leben länger 21 Warum Frauen länger leben 22 Gesund oder krank?

Mehr

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher

Mehr

ethische Probleme im Kontext der Humangenetik

ethische Probleme im Kontext der Humangenetik ethische Probleme im Kontext der Humangenetik ethische Probleme im Kontext der Humangenetik / Lernziele molekulargenetische Diagnostik pränatale Diagnostik / Interruptio Elternalter Human-Genetik A C Genetik

Mehr

Labortests für Ihre Gesundheit. Therapie nach Maß 26

Labortests für Ihre Gesundheit. Therapie nach Maß 26 Labortests für Ihre Gesundheit Therapie nach Maß 26 01IPF Labortests für Ihre Gesundheit Therapie nach Maß Die individuelle Dosis finden Jeder Mensch ist einzigartig. Keiner gleicht dem anderen nicht nur

Mehr

Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG

Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin Die richtige Therapie für den richtigen Patienten Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin: Was ist denn das? Februar 2011 Personalisierte Medizin:

Mehr

Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens

Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens Wolfgang Hulla KFJ-Sital / SMZ-Süd, Wien Grundlagen Historischer Ausgangspunkt Anwendungen und klinische Relevanz Methodik Auswertung

Mehr

Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen

Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen Master-Kolloquium Kombinierte Analyse von DNA-Methylierung und Transkriptions-Profilen in verschiedenen Immunzellen Lorette Weidel Agenda Hintergrund Aufgabenstellung Material & Methoden Ergebnisse Diskussion

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010

G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Institut für f r Biochemische Verfahren und Analysen (IBVA) Genomik?! Tobias Schäfer Institut für f r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Inhalt Methoden der Gensequenzierung Nutzen genetischer

Mehr

Datenschutz und Recht auf Nichtwissen. Neue ethische Herausforderungen im Rahmen der individualisierten Medizin?

Datenschutz und Recht auf Nichtwissen. Neue ethische Herausforderungen im Rahmen der individualisierten Medizin? Datenschutz und Recht auf Nichtwissen. Neue ethische Herausforderungen im Rahmen der individualisierten Medizin? PD Dr. J. Boldt Institut für Ethik und Geschichte der Medizin Universität Freiburg Wozu

Mehr

Pflegewissenschaftliche Aspekte bei Familien mit chronisch kranken Kindern

Pflegewissenschaftliche Aspekte bei Familien mit chronisch kranken Kindern Pflegewissenschaftliche Aspekte bei Familien mit chronisch kranken Kindern Bernadette Bächle-Helde Pflegeexpertin Kinderkrankenschwester Diplompflegepädagogin (FH) Pflegewissenschaftlerin MScN Überblick

Mehr

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath Grundlagen Genetik Dipl.- Psych. Silja Bellingrath Infos zur Klausur Dauer: 11/2 Stunden (maximal) Keine Noten, nur bestanden versus nicht bestanden Inhalt: Grundlage sind die Folien zum Seminar; geprüft

Mehr

Von der Blaupause zur Therapie Molekulare Medizin als Herausforderung

Von der Blaupause zur Therapie Molekulare Medizin als Herausforderung Von der Blaupause zur Therapie Molekulare Medizin als Herausforderung 18.02.15 Thomas D. Szucs Hippokrates (466-377 v. Chr.) Es ist wichtiger zu wissen, welche Person eine Krankheit hat, als zu wissen,

Mehr

Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem

Mehr

Humane Genetische Diversität. Peter Ahnert ahnert@uni-leipzig.de

Humane Genetische Diversität. Peter Ahnert ahnert@uni-leipzig.de Humane Genetische Diversität Peter Ahnert ahnert@uni-leipzig.de Verschiedene Genome Gliederung Das menschliche Genom Definition Gen Variabilität im Genom Genetisch Bedingte Erkrankungen Das Humangenomprojekt

Mehr

Vicky Schuckel & Nick Dunken WS 2015/2016. Bipolare Störung - Symptome, Ursachen und Behandlung

Vicky Schuckel & Nick Dunken WS 2015/2016. Bipolare Störung - Symptome, Ursachen und Behandlung Bipolare Störung - Symptome, Ursachen und Behandlung Inhaltsverzeichnis - Einleitung - Verlauf - Symptome - Formen - Ursachen - Diagnose - Therapie - Berühmte Beispiele Einleitung - Affektive Störungen

Mehr

Risiko-adaptierte Prävention am Beispiel des Mammakarzinoms

Risiko-adaptierte Prävention am Beispiel des Mammakarzinoms Schwerpunkt Familiärer Brustund Eierstockkrebs Risiko-adaptierte Prävention am Beispiel des Mammakarzinoms 26.09.2009 Monika Graeser Rationale für eine risiko-adaptierte Prävention Neuere Untersuchungen

Mehr

Pharmakogenetik: Stand und Perspektiven

Pharmakogenetik: Stand und Perspektiven SUB Hamburg B/107681 Pharmakogenetik: Stand und Perspektiven Aktualisierte Synopse sieben europäischer Studien Gutachten im Auftrag des Deutschen Bundestages vorgelegt dem Büro für Technikfolgen-Abschätzung

Mehr

C SB. Genomics Herausforderungen und Chancen. Genomics. Genomic data. Prinzipien dominieren über Detail-Fluten. in 10 Minuten!

C SB. Genomics Herausforderungen und Chancen. Genomics. Genomic data. Prinzipien dominieren über Detail-Fluten. in 10 Minuten! Genomics Herausforderungen und Chancen Prinzipien dominieren über Detail-Fluten Genomics in 10 Minuten! biol. Prin cip les Genomic data Dr.Thomas WERNER Scientific & Business Consulting +49 89 81889252

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory Sequenzierung Norbert Arnold Neue Sequenziertechnologien (seit 2005) Next Generation Sequenzierung (NGS, Erste Generation) Unterschiedliche Plattformen mit unterschiedlichen Strategien Roche 454 (basierend

Mehr

Gentechnologie und Neurobiologie: Das Ende der Versicherbarkeit? Vom Gen zum Versicherungsantrag. Priv. Doz. Dr. Stephan Becher Berlin 10.11.

Gentechnologie und Neurobiologie: Das Ende der Versicherbarkeit? Vom Gen zum Versicherungsantrag. Priv. Doz. Dr. Stephan Becher Berlin 10.11. Gentechnologie und Neurobiologie: Das Ende der Versicherbarkeit? Vom Gen zum Versicherungsantrag Priv. Doz. Dr. Stephan Becher Berlin 10.11.2014 Vom Gen zum Versicherungsantrag 1 Einführung 2 Begriffe

Mehr

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name Starzinski-Powitz, 6 Fragen, 53 Punkte Name Frage 1 8 Punkte Nennen Sie 2 Möglichkeiten, wie der Verlust von Heterozygotie bei Tumorsuppressorgenen (Z.B. dem Retinoblastomgen) zum klompletten Funktionsverlust

Mehr

Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus

Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus Seminar Molekulare Diagnostik 2011 30. November 2011, Wien AnDiaTec Kernkompetenz Entwicklung und Produktion

Mehr

Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012

Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012 Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012 Hämoglobin Hämoglobin Gene h"p://amc- app1.amc.sara.nl/eduwiki/images/d/d8/hb-

Mehr

Next Generation Sequencing für die Primärdiagnostik. Focus: Resistenztestung

Next Generation Sequencing für die Primärdiagnostik. Focus: Resistenztestung Next Generation Sequencing für die Primärdiagnostik Focus: Resistenztestung Stefan Niemann Molekulare Mykobakteriologie Forschungszentrum Borstel TTU-TB Deutsches Zentrum für Infektionsforschung Outline

Mehr

Nutriomic - komplexe Analyse der Interaktion zwischen Ernährungsumwelt und biologischer Individualität

Nutriomic - komplexe Analyse der Interaktion zwischen Ernährungsumwelt und biologischer Individualität Nutriomic - komplexe Analyse der Interaktion zwischen Ernährungsumwelt und biologischer Individualität Frank Döring Biogenese, Technogenese Lebensmittel Ernährungsumwelt Mensch (...om) Gesundheit/ Krankheit

Mehr

Fachkraft für Molekulare Medizin (TÜV).

Fachkraft für Molekulare Medizin (TÜV). Berufsbegleitende Weiterbildung Fachkraft für Molekulare Medizin (TÜV). Informationen TÜV-Abschluss - optimal vorbereitet für die Praxis. Die Erforschung und Heilung von Krankheitsursachen vollzieht sich

Mehr

Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: "Hip or Hype"

Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: Hip or Hype Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: "Hip or Hype" 3. Nationales Biobankensymposium 2014 Berlin, 04.12.2014 Prof. Dr. rer. nat Edgar Dahl RWTH zentralisierte Biomaterialbank

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien Branford, CT, USA, 29. Januar 2009 Forscher nutzen das 454 Sequencing System bei der Identifizierung Herpesähnlicher Viren in Zusammenhang mit Korallensterben Mit metagenomischen

Mehr

Inhalt des Vortrags. o genetische Grundlagen. o Wie findet man Erbfehler? o Zusammenfassung. Was ist ein Haplotyp?

Inhalt des Vortrags. o genetische Grundlagen. o Wie findet man Erbfehler? o Zusammenfassung. Was ist ein Haplotyp? Inhalt des Vortrags o genetische Grundlagen Was ist ein Haplotyp? o Wie findet man Erbfehler? basierend auf Phänotypen: Zwergwuchs basierend auf Genotypen: Braunvieh Haplotyp II o Zusammenfassung einige

Mehr

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Karl Heinimann, MD PhD Medizinische Genetik Universitätskinderspital beider Basel karl.heinimann@unibas.ch 14. Internationales Seminar DESO St.

Mehr

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: Einführung Übung Bitte bereiten Sie folgende Probleme vor der Übung am Mittwoch. Die Klausur

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Center for Biotechnology, Bielefeld

Center for Biotechnology, Bielefeld Andreas Albersmeier CeBiTec Bielefeld 3. Life Science Conference Analytik Jena Jena 14.05.2014 Center for Biotechnology, Bielefeld sketchup.google.com Genomik Transkriptomik Proteomics Metabolomics Genom

Mehr

Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren

Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren Stefan-Marcel Loitsch, Christian von Mallinckrodt, Tim Hirche, Thomas OF Wagner Pneumologie und Allergologie, Medizinische Klinik

Mehr

Pharmazeutische Biologie Genetik

Pharmazeutische Biologie Genetik Pharmazeutische Biologie Genetik N230-Raum 306 Tel. (069) 798-29650 dingermann@em.uni-frankfurt.de 4. Erbkrankheiten des Menschen Hardy-Weinberg-Gleichgewicht 4. Erbkrankheiten des Menschen Hardy-Weinberg-Gleichgewicht

Mehr

ethische Probleme im Kontext der Humangenetik

ethische Probleme im Kontext der Humangenetik ethische Probleme im Kontext der Humangenetik 12.12.2014 ethische Probleme im Kontext der Humangenetik / Lernziele molekulargenetische Diagnostik pränatale Diagnostik / Interruptio Elternalter Human-Genetik

Mehr

Gentests Klinisch relevant oder genetisches Horoskop?

Gentests Klinisch relevant oder genetisches Horoskop? Gentests Klinisch relevant oder genetisches Horoskop? Prof. Dr. Sabina Gallati Abteilung für Humangenetik Universitätsklinik für Kinderheilkunde Bedeutung und Aufgaben der Humangenetik Interdisziplinäres

Mehr

Epidemiologische Kohortenstudien

Epidemiologische Kohortenstudien Epidemiologische Kohortenstudien Vergangenheit, Gegenwart und Zukunft Teil 1 Prof. Dr. K.-H. Jöckel Festsymposium"60 Jahre GMDS", 28. Oktober 2015, Köln Bekannte Kohortenstudien I Studie Ziele Umfang (Alter)

Mehr

Genetische Varianten: Aufgaben der Pharmakogenetik. Personalisierte Medizin mit Hilfe der Pharmacogenetik

Genetische Varianten: Aufgaben der Pharmakogenetik. Personalisierte Medizin mit Hilfe der Pharmacogenetik Personalisierte Medizin mit Hilfe der Pharmacogenetik Priv. Doz. Dr. Annette Kaiser Medizinsches Forschungszentrum Institut für Pharmakogenetik Hufelandstrasse 55 45147 Essen Telefon: 0201-723-3468 email:

Mehr

Molekulargenetischer Nachweis und Genotypisierung von HPV

Molekulargenetischer Nachweis und Genotypisierung von HPV Molekulargenetischer Nachweis und Genotypisierung von HPV Dr. Sabine Sussitz-Rack Institut für Labordiagnostik und Mikrobiologie Vorstand: Prim. Prof. DDr. Pranav Sinha Humanes Papillomavirus HPV HPV ist

Mehr

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

Von kardiovaskulären Risikofaktoren zu Demenz. Brennpunkt Demenz, Köln 06.11.2010

Von kardiovaskulären Risikofaktoren zu Demenz. Brennpunkt Demenz, Köln 06.11.2010 Von kardiovaskulären Risikofaktoren zu Demenz Brennpunkt Demenz, Köln 06.11.2010 Stationär Heime / Krankenhaus konsiliarisch tagesklinische Versorgung Gedächtnissprechstunden Memory Clinics Gerontopsychiatrische

Mehr

GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse. Erste Lernphase: Aneignungsphase

GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse. Erste Lernphase: Aneignungsphase Folie GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse Erste Lernphase: Aneignungsphase Erarbeiten Sie in Ihrer Expertengruppe die Inhalte eines der vier Textabschnitte (2.1, 2.2, 3.1, 3.2).

Mehr

Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer. www.genomaustria.at

Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer. www.genomaustria.at Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer www.genomaustria.at Warum sind wir heute hier? Wir sind heute hier, um über das Thema Erbgut Sequenzierung

Mehr

QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten

QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten QIAGEN erwirbt Rechte an genetischen Biomarkern für Hirntumore, Lungen- und andere Krebsarten Hilden (10. Januar 2012) - QIAGEN hat von zwei US-amerikanischen Biotechnologieunternehmen weltweit exklusive

Mehr