IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

Größe: px
Ab Seite anzeigen:

Download "IV. Übungsaufgaben für die Jahrgangstufe 9 & 10"


1 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während der Zellteilung sichtbar sind 36) Wie ist der Elementarfaden eines Chromosoms aufgebaut? 37) Wo im Chromosom ist die Erbinformation gespeichert? Wie konnte man das durch einen Mäuseversuch erkennen? 38) Beschreibe den Aufbau der DNA. 39) Wann erfolgt die Verdopplung des Chromosoms? 40) Beschreibe den Vorgang der DNA-Verdopplung. 41) Wo und wie ist die Erbinformation in der DNA verschlüsselt? 42) Welche Bedeutung haben Eiweiße bei der Ausprägung von Erbmerkmalen? 43) Beschreibe den Vorgang der Transkription. 44) Beschreibe den Vorgang der Translation. 45) Beschrifte folgende Schemazeichnung:

2 46) Ein gerade abgelesener DNA-Abschnitt enthält die Basenfolge ACTAGCTGG. Welche Basenfolge beinhaltet der entsprechende Abschnitt der m-rna? 47) Was ist ein Gen? 48) Welche Aminosäuren enthält das Eiweiß, das durch folgende Basen verschlüsselt ist? GUGACUCAUGGGUAUGCAAAAUAG Verwende die Codesonne! 49) Welche Unterschiede bestehen im Aufbau von DNA und RNA? 50) In welchen Organen unseres Körpers findet sich die größte Menge der Eiweiße? 51) Was ist eine Mutation? 52) Nenne vier Typen von Mutationen. 53a) Welche Veränderung liegt bei einer Polyploidie vor? Und welche zellulären Veränderungen bringt das in der Regel mit sich? b) Nenne ein Beispiel, wo eine Polyploidie genutzt wird! 54) Wie bezeichnet man die Mutation einer Trisomie? Welche Folgen haben Trisomien in der Regel? 55) Welche Veränderungen liegen bei Chromosomenmutationen vor? 56) Wie bezeichnet man eine Mutation, bei der einzelne Basen der DNA verändert sind?

3 Lösungen der Übungsaufgaben für die Jahrgangsstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Chromosomen speichern die Erbinformation. 35) 36) Der Elementarfaden besteht aus DNA (=Desoxyribonucleinsäure), der umhüllt ist von Eiweiß. 37) Die Erbinformation ist in der DNA gespeichert. - Man hat Mäusen zwei verschiedene Stämme einer Bakterienart (Pneumokokken) eingespritzt. Ein Bakterienstamm A verfügte über eine schützende Kapsel und tötete die Mäuse. Dem anderen Stamm B fehlte diese Kapsel. Die Mäuse überlebten. Abgetötete Bakterien vom Stamm A konnten den Mäusen nicht schaden. Spritzte man aber den Mäusen abgetötete Bakterien des Stammes A und gleichzeitig lebende Bakterien des Stammes B ein, starben die Mäuse. Dieses geschah auch, wenn man den Mäusen lebende Bakterien vom Stamm B und Erbmaterial von Bakterien des Stammes A einspritzte, das zuvor mit Eiweiß abbauenden Enzymen behandelt worden war. War das Erbmaterial mit DNA abbauenden Enzymen behandelt, überlebten die Mäuse. In den toten Mäusen fanden sich Bakterien mit einer Kapsel. - Die kapsellosen Bakterien müssen also aus dem Erbmaterial der umkapselten Bakterien die Information gewonnen haben, wie man eine Kapsel aufbaut. Dieses war aber nur möglich, wenn nicht zuvor die DNA der Chromosomen sondern allenfalls das umhüllende Eiweiß zerstört worden war. Die DNA muss also die Erbinformation enthalten.

4 38) Die DNA hat die Form einer um die Längsachse gedrehten Strickleiter. Die Leiterholme bestehen aus dem Zucker Desoxyribose und einem Phosphatmolekül, die sich abwechseln. An den Zuckermolekülen hängen die Leitersprossen, die jeweils aus zwei organischen Basen bestehen. Dabei sind die Basen Adenin und Thymin stets gepaart. Ebenso sind die Basen Cytosin und Guanin gepaart und bilden eine Leitersprosse. 39) Die Chromosomen werden während der Interphase verdoppelt. 40) Der DNA-Faden reißt der Länge nach zwischen den gepaarten Basen auseinander. An die Einzelstränge lagern sich an die Basen komplementäre Basen (also Adenin an Thymin und Guanin an Cytosin). An diesen hängen jeweils ein Zuckerund ein Phosphatmolekül. Solche Bausteine nennt man Nucleotide. Diese schwimmen frei im Zellkern. so entstehen zwei völlig identische Doppelstränge. Aus einem Chromosom sind zwei erbgleiche Chromosomen geworden, die man als Schwesterchromatiden bezeichnet. Sie hängen zunächst noch am Centromer zusammen und werden erst während der eigentlichen Zellteilung getrennt. 41) Die Erbinformation ist in der Abfolge der Basen verschlüsselt. Jeweils drei aufeinanderfolgende Basen verschlüsseln eine Aminosäure. 42) Eiweiße sind oft Enzyme, die als Biokatalysatoren die verschiedensten Stoffwechselvorgänge steuern. 43) - Der DNA-Doppelstrang wird durch ein Enzym der Länge nach getrennt - An die freien Basen eines DNA-Einfachstranges lagern sich die komplementären Nucleotide. ( bestehend aus einer Base, Zucker und Phosphat) an. - Die Nucleotide werden miteinander verbunden so dass ein m-rna-strang entsteht. Dieses ist ein Einfachstrang und enthält den Zucker Ribose und statt Thymin die Base Uracil. - Diese Boten-RNA wird als m-rna bezeichnet (m = messanger). - Sie verlässt den Zellkern durch die Kernpore.

5 44) - Die m-rna wandert im Plasma zum Ribosom (= ort der Eiweißsynthese). - Im Plasma befinden sich t-rna-moleküle, aus denen drei organische Basen herausragen ( ein Basentriplett ). Dieses passt genau auf entsprechende Tripletts der m-rna. - Durch ein bestimmtes Enzym ist an die verschiedenen t-rna-moleküle je eine von 20natürlich vorkommenden Aminosäuren gebund en. - Sobald sich zwei t-rna-moleküle an die m-rna im Ribosom gebunden haben, werden die Aminosäuren aneinander gekoppelt. Durch Vorrücken der m-rna im Ribosom können weitere t-rna-moleküle gebunden und damit weitere Aminosäuren an den so entstehenden Eiweißfaden gebunden werden. - T-RNA-Moleküle, die ihre Aminosäure abgegeben haben, lösen sich vom Ribosom und werden neu beladen. 45) a) Enzym, b) DNA, c)zellkern, d) Kernpore, e) Boten-RNA, f) organische Base, g)ribosom, h) t-rna, i) Eiweißfaden, k) Aminosäure 46) UGAUCGACC 47) Gen = Erbanlage 48) Thr (Threonin), His (Histidin),Gly (GLycin), Tyr (Tyrosin), Ala (Alanin), Lys (Lysin) 49) Bei der DNA handelt es sich um einen Doppelstrang. Die RNA ist ein Einfachstrang, in dem statt des Zuckers Desoxyribose der Zucker Ribose eingebaut ist. Außerdem ist in der RNA die Base Thymin durch die Base Uracil ersetzt. 50) Große Mengen von Eiweißen bauen unsere Muskeln auf. 51) Mutation: Sprunghafte und dauerhafte Veränderung der Erbinformation 52) Polyploidie: Vervielfachung des gesamten Chromosomensatzes führt in der Regel zur Vergrößerung des Zellvolumens bei Weizen und Roggen (Getreide) sind auf diese Weise ertragreichere Sorten gezüchtet worden. 53) Trisomien werden als Heteroplidien bezeichnet. Sie sind meist nachteilig. - Die Krankheit Down-Syndrom ist ein Beispiel. 54) Bei Chromosomenmutation fehlen Teile eines Chromosoms oder an das Chromosom sind zusätzlich Teile eines anderen Chromosoms angewachsen.

6 55) Die Veränderung einzelner Basen, zusätzliche oder fehlende Basen führen zu einer Genmutation. 56) Die weiblichen Keimzellen sind die Eizellen. Sie werden in den Eierstöcken gebildet in der Zeit von der Pubertät bis zu den Wechseljahren. Durchschnittlich reift alle 4 Wochen eine Eizelle. Im Leben reifen somit höchstens Eizellen. Die Frau besitzt insgesamt Eianlagen. Die männlichen Keimzellen sind die Spermien. Sie werden in den Hoden gebildet in der Zeit von der Pubertät bis zum Lebensende. Durchschnittlich reifen 100 Millionen Spermien pro Tag. den.

DNS-Modell Best.-Nr. 2015801

DNS-Modell Best.-Nr. 2015801 DNS-Modell Best.-Nr. 2015801 1. Produktvorstellung Ziel des Produktes Dieses Modell soll das DNS-Molekül visualisieren: es soll die Doppelspirale, Stickstoffbasen mit Wasserstoffbrückenbindung, Zucker-Phosphatskelette


Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie Grundwissenkarten Gymnasium Vilsbisburg 9. Klasse Biologie Es sind insgesamt 10 Karten für die 9. Klasse erarbeitet. davon : Karten ausschneiden : Es ist auf der linken Blattseite die Vorderseite mit Frage/Aufgabe,


Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik Frage Was sind Fachbegriffe zum Thema Grundbegriffe der Genetik? Antwort - Gene - Genotyp - Phänotyp - Genom - Dexoxyribonucleinsäure - Träger genetischer Information - Nukleotide - Basen - Peptid - Start-Codon


1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener


Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS)

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) N U C L E I N S Ä U R E N Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) BAUSTEINE DER NUCLEINSÄUREN Die monomeren Bausteine der Nucleinsäuren


Genetik Was ist ein Gen - Der Code des Lebens

Genetik Was ist ein Gen - Der Code des Lebens Genetik Was ist ein Gen - Der Code des Lebens A) Teilungsvorgänge 1. Körperzellen Unser Körper besteht aus ca 3 Billionen Zellen, die alle die gleiche Erbsubstanz haben. Nur wirken die Erbanlagen nicht


Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information


Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen


Aufbau, Struktur, Funktion von DNA, RNA und Proteinen

Aufbau, Struktur, Funktion von DNA, RNA und Proteinen Aufbau, Struktur, Funktion von DNA, RNA und Proteinen Mitarbeiterseminar der Medizinischen Fakultät Ruhr-Universität Bochum Andreas Friebe Abteilung für Pharmakologie und Toxikologie Aufbau, Struktur,


KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen

KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen Bild 1 Ausdehnung eines Chromosoms (C) 1. Besteht aus Chromatin. Das ist die DNS + Proteine 2. Chromosomen liegen im Zellkern 3. Menschliche Körperzellen


Erwin Graf. Genetik an Stationen DNA. Sekundarstufe uf. e I. Erwin Graf. Downloadauszug aus dem Originaltitel: netik

Erwin Graf. Genetik an Stationen DNA. Sekundarstufe uf. e I. Erwin Graf. Downloadauszug aus dem Originaltitel: netik Erwin Graf Genetik an Stationen DNA Sekundarstufe uf e I Erwin Graf Downloadauszug aus dem Originaltitel: netik Genetik an Stationen DNA Dieser Download ist ein Auszug aus dem Originaltitel Genetik Über


Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Der Bauplan des Lebens - unsere Erbanlagen (Klasse 9/10) Materialien im PDF-Format Das komplette Material finden Sie hier: School-Scout.de


Aufbau der Nervenzelle. Zentrales Nervensystem

Aufbau der Nervenzelle. Zentrales Nervensystem Aufbau der Nervenzelle 2 A: Zellkörper (Soma): Stoffwechselzentrum B: Axon: Weiterleitung der elektrischen Signale C: Dendrit: Informationsaufnahme D: Hüllzellen: Isolation E: Schnürring: Unterbrechung


Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen

Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen Die Organellen der Zelle sind sozusagen die Organe die verschiedene Funktionen in der Zelle ausführen. Wir unterscheiden Tierische


Grundlagen der Vererbung beim Hund

Grundlagen der Vererbung beim Hund Grundlagen der Vererbung beim Hund Züchterstammtisch: 10. August 2013 Referentin: Diana Ringpfeil Tätigkeit: Tierärztin Mail: Ringpfeil@arcor.de Referent: Kay Rostalski Diana Ringpfeil, Tierärztin, Kay


Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer


Gen Protein Aufgaben: Edel LK-Bio BI-3

Gen Protein Aufgaben: Edel LK-Bio BI-3 Proteinbiosynthese Von der DNA zum Protein Dieses Lernprogramm zeigt Ihnen in einem vereinfachten Modell den im Zellinneren ablaufenden Prozess vom Gen auf der DNA zum Protein. Aufgaben: 1 Betrachten Sie


Aufgabe 1. Bakterien als Untersuchungsgegenstand!

Aufgabe 1. Bakterien als Untersuchungsgegenstand! Genetik I Aufgabe 1. Bakterien als Untersuchungsgegenstand 1. Beschriften Sie die Abbildung zu den Bakterien. 2. Nennen Sie Vorteile, die Bakterien wie Escherichia coli so wertvoll für die genetische Forschung


..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen 9.1 Welche Funktionen haben Sinneszellen und Sinnesorgan? Sinneszellen nehmen die Reize auf und wandeln die Information in elektrische Signale um. Die Sinnesorgane dienen unter anderem dazu. Beispiel Auge


Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion


Einleitung. Replikation

Einleitung. Replikation (C) 2014 - SchulLV 1 von 9 Einleitung Der Action-Film von gestern Abend war wieder ziemlich spannend. Mal wieder hat es der Superheld geschafft, alle Zeichen richtig zu deuten, diverse Geheimcodes zu knacken


Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale


Einführung Nukleinsäuren

Einführung Nukleinsäuren Einführung Nukleinsäuren Dr. Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Einführung 1. Semester, WiSe 2007/2008 Historischer Überblick Literatur Bilder aus: Taschenatlas


Abschlussbericht der Projektgruppe 583

Abschlussbericht der Projektgruppe 583 Abschlussbericht der Projektgruppe 58 VATRAM VAriant Tolerant ReAd Mapper Benjamin Kramer, Jens Quedenfeld Sven Schrinner, Marcel Bargull Kada Benadjemia, Jan Stricker David Losch. März 5 Betreuer: Sven


Evolution, Genetik und Erfahrung

Evolution, Genetik und Erfahrung Chromosomen, Fortpflanzung und Genkopplung Entscheidende Entdeckung: Gene sind auf Chromosomen lokalisiert! 1 CHROMOSOM fadenförmige Strukturen im Kern der Zellen (wikipedia) Chromosomen in Körperzellen


DOWNLOAD. Vertretungsstunde Biologie /10. Klasse: Genetik und Vererbung. Corinna Grün, Cathrin Spellner. Downloadauszug aus dem Originaltitel:

DOWNLOAD. Vertretungsstunde Biologie /10. Klasse: Genetik und Vererbung. Corinna Grün, Cathrin Spellner. Downloadauszug aus dem Originaltitel: DOWNLOAD Corinna Grün, Cathrin Spellner Vertretungsstunde Biologie 17 9./10. Klasse: Genetik und Vererbung Downloadauszug aus dem Originaltitel: Chromosomen als Träger der Erbanlagen Aufbau eines Chromosoms


Eine kleine Einführung in die Genetik

Eine kleine Einführung in die Genetik Eine kleine Einführung in die Genetik Genetik = Die Lehre von der Vererbung 1.) Die Geschichte der Genetik Johann Gregor Mendel wurde am 22. Juli 1822 in Heinzendorf geboren, nach seinem Abitur tritt er


Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,


Gene, Umwelt & Verhalten II: Molekulare Genetik

Gene, Umwelt & Verhalten II: Molekulare Genetik Gene, Umwelt & Verhalten II: Molekulare Genetik 1. Struktur und Funktion der DNA 2. Die Vervielfältigung der genetischen Information 2.1 Replikation innerhalb des Zellzyklus 2.2 Entstehung von Keimzellen


Robert Koch-Gymnasium Deggendorf GRUNDWISSENKARTEN. Biologie. 9. Jahrgangsstufe

Robert Koch-Gymnasium Deggendorf GRUNDWISSENKARTEN. Biologie. 9. Jahrgangsstufe Robert Koch-Gymnasium Deggendorf GRUNDWISSENKARTEN Biologie 9. Jahrgangsstufe Es sind insgesamt 25 Karten für die 9. Jahrgangsstufe erarbeitet, die als ständiges Grundwissen für alle Jahrgangsstufen gelten!


DNA Vom Gen zum Protein

DNA Vom Gen zum Protein 55 11215 Didaktische FWU-DVD DNA Vom Gen zum Protein Biologie Chemie Klasse 9 13 Klasse 10 13 Trailer ansehen Schlagwörter Adenin; Aminosäuren; Biochemie; Biosynthese; Chromosom; Codesonne; Cytosin; Desoxyribonukleinsäure;


5. Endoplasmatisches Reticulum und Golgi-Apparat

5. Endoplasmatisches Reticulum und Golgi-Apparat 5. Endoplasmatisches Reticulum und Golgi-Apparat Institut für medizinische Physik und Biophysik Ramona Wesselmann Endoplasmatisches Reticulum Umfangreiches Membransystem endoplasmatisch im Cytoplasma reticulum


Einstieg: Fortpflanzung

Einstieg: Fortpflanzung Einstieg: Fortpflanzung Wozu ist Sex gut? - Nachkommen werden gezeugt --> Erhalt der Spezies. - Es entstehen Nachkommen mit Merkmalen (z.b. Aussehen), die denen von Vater und Mutter ähneln. Beide Eltern


Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein


Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)


Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen


Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon


Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Gentechnik: Dem genetischen Fingerabdruck auf der Spur Das komplette Material finden Sie hier: School-Scout.de 8.-11. Schuljahr Dipl.-Bio.


Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und


Genetik. Genetik. Erbanlagen als Risikofaktoren für Erkrankungen. (01) 260 53-0 Fax: (01) 260 53-500 mail@labors.at www.labors.at

Genetik. Genetik. Erbanlagen als Risikofaktoren für Erkrankungen. (01) 260 53-0 Fax: (01) 260 53-500 mail@labors.at www.labors.at Genetik Genetik Erbanlagen als Risikofaktoren für Erkrankungen (01) 260 53-0 Fax: (01) 260 53-500 mail@labors.at www.labors.at Sehr geehrte Leserin! Sehr geehrter Leser! Modernste labormedizinische Methoden


Grundwissen Biologie Jahrgangsstufe 11 Fachschaft Biologie. Zelle und Enzymatik

Grundwissen Biologie Jahrgangsstufe 11 Fachschaft Biologie. Zelle und Enzymatik Grundwissen Biologie Jahrgangsstufe 11 Fachschaft Biologie Q11 Zelle und Enzymatik Biomembranen Bestehen aus einer Lipiddoppelschicht, in die Proteine eingelagert sind. Biomembranen sind selektiv permeabel.


Warum sehen Kinder ihre Eltern ähnlich?

Warum sehen Kinder ihre Eltern ähnlich? Warum sehen Kinder ihre Eltern ähnlich? Du siehst aber deiner Mutter ähnlich! Sieh mal, er hat die Haare wie sein Vater! Du hast wirklich die Augen wie Mama und Oma! Diese oder ähnliche Sätze hat sicherlich


Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Die klassische Genetik: T.H. Morgan und seine Experimente mit Drosophila melanogaster Das komplette Material finden Sie hier: Download


Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden.

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden. 03 Arbeitsauftrag Arbeitsauftrag Ziel: Anhand des Foliensatzes soll die Bildung und der Aufbau des Proteinhormons Insulin erklärt werden. Danach soll kurz erklärt werden, wie man künstlich Insulin herstellt.


Anabole Prozesse in der Zelle

Anabole Prozesse in der Zelle Anabole Prozesse in der Zelle DNA Vermehrung RNA Synthese Protein Synthese Protein Verteilung in der Zelle Ziel: Zellteilung (Wachstum) und Differenzierung (Aufgabenteilung im Organismus). 2016 Struktur


Die Chromosomen sind im Zellkern immer paarweise vorhanden. In der menschlichen Zelle befinden sich 23 Chromosomenpaare. Diese bilden den diploiden

Die Chromosomen sind im Zellkern immer paarweise vorhanden. In der menschlichen Zelle befinden sich 23 Chromosomenpaare. Diese bilden den diploiden Die Chromosomen Die Chromosomen sind Träger der Erbinformation. Unter dem Mikroskop erscheinen sie in verschiedenen Formen. Einmal als gekrümmte oder gedrungene Stäbchen, in deren Mitte sich eine Ein-schnürung


MOLEKULARGENETIK. Die Bestandteile liegen in folgenden Mengenverhältnissen vor:

MOLEKULARGENETIK. Die Bestandteile liegen in folgenden Mengenverhältnissen vor: MOLEKULARGENETIK BAU UND FUNKTOIN DER NUKLEINSÄUREN Bau von DNS und RNS Den räumlichen Bau der Desoxyribonukleinsäure (=DNS, DNA) entschlüsselten die beiden britischen Forscher James Watson und Francis


t-rna Ribosom (adapted from the handouts of Prof. Beck-Sickinger, Universität Leipzig)

t-rna Ribosom (adapted from the handouts of Prof. Beck-Sickinger, Universität Leipzig) ukleinsäuren speichern die Erbinformation. Das menschliche Genom ist in jeder Zelle aus 3900 Millionen Basenpaare (Mbp) aufgebaut und hat eine Gesamtlänge von 99 cm. t-ra Ribosom (adapted from the handouts


DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich


Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine


Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16


Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Vorbemerkung für die Erlangung des Testats: Bearbeiten Sie die unten gestellten Aufgaben


Chemie für Biologen. Vorlesung im. WS 2004/05 V2, Mi 10-12, S04 T01 A02. Paul Rademacher Institut für Organische Chemie der Universität Duisburg-Essen

Chemie für Biologen. Vorlesung im. WS 2004/05 V2, Mi 10-12, S04 T01 A02. Paul Rademacher Institut für Organische Chemie der Universität Duisburg-Essen Chemie für Biologen Vorlesung im WS 004/05 V, Mi 0-, S04 T0 A0 Paul Rademacher Institut für rganische Chemie der Universität Duisburg-Essen (Teil 3: 9.0.005) MILESS: Chemie für Biologen 36 D-Aldosen C


VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4 S 4 M 2 Studien an eineiigen Zwillingen Was ist für die Unterschiede bei eineiigen Zwillingen verantwortlich? Aufgaben 1. Fassen Sie die Informationen des Textes zusammen. 2. Wie sind die im Text beschriebenen


Seminar Biomedical Informatics

Seminar Biomedical Informatics Martin Dugas und Xiaoyi Jiang Institut für Informatik Sommersemester 2017 Organisation Vorlage: Englischsprachige Publikation Vortrag: ca. 30min + 15min Diskussion, Hand-out, Blockseminar Anfang Juni Seminararbeit:


Bauplan für ein Leben

Bauplan für ein Leben Foto: van den Heuvel Unser Genom Bauplan Jochen Graw Die Krankheit Mukoviszidose macht deutlich, wie sehr unsere Gesundheit von einem fehlerfreien Erbgut abhängt. Der Verlust von drei der drei Milliarden


Nervensystem Gib eine Übersicht zu den Bestandteilen des menschlichen Nervensystems an!

Nervensystem Gib eine Übersicht zu den Bestandteilen des menschlichen Nervensystems an! Gib eine Übersicht zu den Bestandteilen des menschlichen s an! Zentrales (ZNS): Gehirn und Rückenmark Peripheres (PNS): Somatisches NS (= willkürlich) Vegetatives NS (= unwillkürlich), gebildet von den


Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können


2. Nur zwei Nanometer Durchmesser, aber zwei Meter lang

2. Nur zwei Nanometer Durchmesser, aber zwei Meter lang Gentechnik Der Bauplan jedes Menschen ist in seinen Genen verborgen. Gene bestimmen mit über unsere Haar- und Augenfarbe und sie entscheiden mit darüber, ob wir ein grosses Risiko haben, an Krankheiten


Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.


Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte

Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte Frage 1: 10 Punkte a) Die Bildung der Gameten bei Diplonten und bei Haplonten erfolgt im Verlaufe von Kernteilungen. Ergänzen Sie die angefangenen Sätze (2


DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von DNA- Replikation PowerPoint-Learning von Andrea Brügger Lernziele dieser Lerneinheit: 1. Sie kennen und verstehen die einzelnen Teilschritte der DNA-Replikation und können diese Teilschritte den entsprechenden


8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria


BIOWISSENSCHAFTEN. Die Biowissenschaften. Biochemie. Molekularbiologie. Mikrobiologie. Botanik, Zoologie. Genetik. Biotechnologie.

BIOWISSENSCHAFTEN. Die Biowissenschaften. Biochemie. Molekularbiologie. Mikrobiologie. Botanik, Zoologie. Genetik. Biotechnologie. Die Biowissenschaften Mikrobiologie Biotechnologie Biochemie Genetik Molekularbiologie Botanik, Zoologie weitere Disziplinen Physiologie Zellbiologie Zentrum f. Angew. Genetik BIOWISSENSCHAFTEN Genetik


Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse


2. Stofwechsel. 2.8 Proteinbiosynthese

2. Stofwechsel. 2.8 Proteinbiosynthese 2. Stofwechsel 2.8 Proteinbiosynthese Die Proteinbiosynthese ist ein biochemischer Prozess. Von einem Abschnitt der Desoxynucleinsäure (DNA, A für engl. acid) werden nach Transkription und Translation


Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2


17. Biomoleküle : Nucleinsäuren

17. Biomoleküle : Nucleinsäuren Friday, February 2, 2001 Allgemeine Chemie B II Page: 1 Inhalt Index 17. Biomoleküle : Nucleinsäuren Die gesamte Erbinformation ist in den Desoxyribonucleinsäuren (DNA) enthalten. Die Übersetzung dieser


DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 3. Aus welchen vier Nukleotiden ist RNA aufgebaut? 4. DNA RNA 5. Ein Wissenschaftler


Wie werden Keimzellen gebildet?

Wie werden Keimzellen gebildet? Wie werden Keimzellen gebildet? Keimzellen (Samenzellen und Eizelle) werden über eine neue Kernteilungsform erzeugt: die MEIOSE ( Reifeteilung I und II) Eizelle mit Zellkern Samenzellen mit Erbmaterial


Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.


-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel).

-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel). Mendelsche Regeln 1 + 2 (1) Merkmale wie die Blütenfarbe können dominant-rezessiv oder intermediär vererbt werden. Bei einem intermediären Erbgang wird die Merkmalsausprägung von beiden Allelen (z. B.


BEISPIELFRAGEN zum ÜBEN...ähnliche Fragen könnten zum Test kommen

BEISPIELFRAGEN zum ÜBEN...ähnliche Fragen könnten zum Test kommen BIOLOGIETEST Sommersemester 3. Klasse Teststoff: Meiose Intersexualität Transsexualität Pubertät und Hormone Menstruationszyklus Embryonalentwicklung Plazenta BEISPIELFRAGEN zum ÜBEN...ähnliche Fragen


Biologie für Mediziner WS 2007/08

Biologie für Mediziner WS 2007/08 Biologie für Mediziner WS 2007/08 Teil Allgemeine Genetik, Prof. Dr. Uwe Homberg 1. Endozytose 2. Lysosomen 3. Zellkern, Chromosomen 4. Struktur und Funktion der DNA, Replikation 5. Zellzyklus und Zellteilung


Molekularbiologische Grundlagen

Molekularbiologische Grundlagen Molekularbiologische Grundlagen Ulf Leser, Sommersemester 2008 Silke Trißl Überblick Biologie Organismen Aufbau von Zellen Prokaryoten und Eukaryoten Genom und DNA Transkription DNA RNA Protein Proteine


2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)


Abiturprüfung Biologie, Leistungskurs

Abiturprüfung Biologie, Leistungskurs Seite 1 von 5 Abiturprüfung 2008 Biologie, Leistungskurs Aufgabenstellung: Thema: Das MERRF-Syndrom II.1 Begründen Sie, warum x-chromosomale Vererbung des MERRF-Krankheitsbildes, wie in Material C dargestellt,


Biochemie Vorlesung Die ersten 100 Seiten

Biochemie Vorlesung Die ersten 100 Seiten Biochemie Vorlesung 11-15 Die ersten 100 Seiten 1. Unterschiede der Zellen Eukaryoten- Prokaryoten Eukaryoten: - Keine Zellwand - Intrazelluläre Membransysteme - Kernhülle mit 2 Membranen und Kernporen


Studienkolleg der Technischen Universität Berlin. Biologie-Prüfung. für BewerberInnen mit Beruflicher Qualifikation nach 11 BerlHG

Studienkolleg der Technischen Universität Berlin. Biologie-Prüfung. für BewerberInnen mit Beruflicher Qualifikation nach 11 BerlHG Studienkolleg der Technischen Universität Berlin Biologie-Prüfung für BewerberInnen mit Beruflicher Qualifikation nach 11 BerlHG Teil 1 Markieren Sie bitte die richtige Antwort. (pro richtiger Antwort


Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz Luitgardis Seigner Schaderregernachweis mit der Polymerase-Kettenreaktion (PCR) Schaderregernachweis mit der Polymerase- Kettenreaktion


Biologie für Mediziner

Biologie für Mediziner Biologie für Mediziner - Zellbiologie 1 - Prof. Dr. Reiner Peters Institut für Medizinische Physik und Biophysik/CeNTech Robert-Koch-Strasse 31 Tel. 0251-835 6933, petersr@uni-muenster.de Dr. Martin Kahms


Übertragung von Erbgut von einem Individuum auf ein anderes mehr nicht. Gleichgültig, ob nun Insekten miteinander kopulieren, Würmer, Vögel oder

Übertragung von Erbgut von einem Individuum auf ein anderes mehr nicht. Gleichgültig, ob nun Insekten miteinander kopulieren, Würmer, Vögel oder Übertragung von Erbgut von einem Individuum auf ein anderes mehr nicht. Gleichgültig, ob nun Insekten miteinander kopulieren, Würmer, Vögel oder Menschen. Alles andere ist nur Beiwerk: die Lust und die


Zellstrukturen und ihre Funktionen Zellkern (inkl. Chromosomen)

Zellstrukturen und ihre Funktionen Zellkern (inkl. Chromosomen) Zellstrukturen und ihre Funktionen Zellkern (inkl. Chromosomen) Nukleus aufgebaut aus Kernmembran = Kontinuum aus rauem Endoplasmatischem Reticulum, Kernplasma, Chromatin, Nucleolen 3 verschiedene Zustände


Die molekulare BDV. Inhalt

Die molekulare BDV. Inhalt Die molekulare BDV Biochemie Inhalt BDV = Biologische Datenverabeitung Informationen in lebenden Systemen Die Entschlüsselung des genetischen Codes Der genetische Code ist degeneriert 1 Die Weitergabe


Lernziele - Genetik. Grundlagenfach Biologie. Das Auge (S )

Lernziele - Genetik. Grundlagenfach Biologie. Das Auge (S ) Das Auge (S. 273-276) 1. Der Aufbau des Auges ist dir bekannt, du kannst die Aufgaben der einzelnen Strukturen beschreiben. Hornhaut Aderhaut Lederhaut mechanischer Schutz versorgt das Auge mit Nährstoffen


Neuer Gentest für erbliche Augenerkrankung

Neuer Gentest für erbliche Augenerkrankung Gesellschaft zur Förderung Kynologischer Forschung Abschlussbericht Neuer Gentest für erbliche Augenerkrankung aus der gkf-info 34 Dezember 2011 Info 33 Dezember 2011 Grußwort Abschlussbericht Neuer Gentest


Eukaryoten und Prokaryoten

Eukaryoten und Prokaryoten Eukaryoten und Prokaryoten Biochemie Inhalt Zellen Prokaryoten, Eukaryoten Unterschiede und Ähnlichkeiten Zellstrukturen Evolution der Zellen Entwicklung von Mitochondrien und Chloroplasten Angriffsmöglichkeiten


Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt: Genetik & Vererbung. Das komplette Material finden Sie hier:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt: Genetik & Vererbung. Das komplette Material finden Sie hier: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: : Genetik & Vererbung Das komplette Material finden Sie hier: Download bei School-Scout.de Inhalt Vorwort Seite 4 Einleitung Seite


Nukleinsäuren. 1.Theoretischer Hintergrund... 2. 1.1 Aufbau der DNA... 2. 1.2 Struktur und Replikation der DNA... 3

Nukleinsäuren. 1.Theoretischer Hintergrund... 2. 1.1 Aufbau der DNA... 2. 1.2 Struktur und Replikation der DNA... 3 Inhaltsverzeichnis 1.Theoretischer Hintergrund... 2 1.1 Aufbau der DNA... 2 1.2 Struktur und Replikation der DNA... 3 1.3 Struktur und Aufgaben der verschiedenen RNAs... 6 1.4 Methoden der Molekularbiologie...


Heterocyclen & Naturstoffe - DNA, RNA

Heterocyclen & Naturstoffe - DNA, RNA 35 Heterocyclen & Naturstoffe - DNA, RNA Heterocyclen besitzen mindestens einen Ring, der außer Kohlenstoff ein weiteres Element enthält. Zur Gruppe der Heterocyclen gehören die organischen Basen, die


Seminar Biochemie. Nukleotide - Nukleinsäuren - Nukleotidstoffwechsel - DNA-Replikation. Dr. Christian Hübbers

Seminar Biochemie. Nukleotide - Nukleinsäuren - Nukleotidstoffwechsel - DNA-Replikation. Dr. Christian Hübbers Seminar Biochemie Nukleotide - Nukleinsäuren - Nukleotidstoffwechsel - DNA-Replikation Dr. Christian Hübbers Lernziele Zusammensetzung der Nukleotide (Basen, Zucker) Purin-und Pyrimidinbiosynthese (prinzipieller


Autotrophe und heterotrophe Organismen

Autotrophe und heterotrophe Organismen Grundlagen der Umwelttechnik 5. Biomoleküle und Grundlagen des Stoffwechsels Vorlesung an der ochschule Augsburg Dr. Siegfried Kreibe Stand 2013 1 Autotrophe und heterotrophe Organismen Autotrophe Organismen:


Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem


NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts


Auswahlverfahren Medizin Prüfungsgebiet Chemie. 6.Termin Organische Chemie Naturstoffe

Auswahlverfahren Medizin Prüfungsgebiet Chemie. 6.Termin Organische Chemie Naturstoffe Auswahlverfahren Medizin Prüfungsgebiet Chemie 6.Termin Organische Chemie Naturstoffe Kursleiter Mag. Wolfgang Mittergradnegger IFS Kurs 2009 Organische Chemie Naturstoffe Fette Kohlenhydrate Proteine


Unterschiede zwischen Prokaryoten und. Eukaryont. Unterschiede prokaryotische eukaryotische Zelle. Zellaufbau Prokaryoten. Zellaufbau Eukaryoten

Unterschiede zwischen Prokaryoten und. Eukaryont. Unterschiede prokaryotische eukaryotische Zelle. Zellaufbau Prokaryoten. Zellaufbau Eukaryoten Unterschiede zwischen Prokaryoten und Prokaryoten lassen sich in 2 Reiche unterteilen: Eubakterien und Archaebakterien werden in 4 Reiche unterteilt: Protozoen (Einzeller), Pilze, Pflanzen und Tiere Unterschiede


Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat


Einführung in die Biochemie Antworten zu den Übungsaufgaben

Einführung in die Biochemie Antworten zu den Übungsaufgaben Einführung in die Biochemie Antworten zu den Übungsaufgaben Dank Die vorliegenden Antworten zu den Übungsaufgaben für das Seminar zum Modul Einführung in die Biochemie wurden im Wintersemester 2014/2015
