IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "IV. Übungsaufgaben für die Jahrgangstufe 9 & 10"

Transkript

1 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während der Zellteilung sichtbar sind 36) Wie ist der Elementarfaden eines Chromosoms aufgebaut? 37) Wo im Chromosom ist die Erbinformation gespeichert? Wie konnte man das durch einen Mäuseversuch erkennen? 38) Beschreibe den Aufbau der DNA. 39) Wann erfolgt die Verdopplung des Chromosoms? 40) Beschreibe den Vorgang der DNA-Verdopplung. 41) Wo und wie ist die Erbinformation in der DNA verschlüsselt? 42) Welche Bedeutung haben Eiweiße bei der Ausprägung von Erbmerkmalen? 43) Beschreibe den Vorgang der Transkription. 44) Beschreibe den Vorgang der Translation. 45) Beschrifte folgende Schemazeichnung:

2 46) Ein gerade abgelesener DNA-Abschnitt enthält die Basenfolge ACTAGCTGG. Welche Basenfolge beinhaltet der entsprechende Abschnitt der m-rna? 47) Was ist ein Gen? 48) Welche Aminosäuren enthält das Eiweiß, das durch folgende Basen verschlüsselt ist? GUGACUCAUGGGUAUGCAAAAUAG Verwende die Codesonne! 49) Welche Unterschiede bestehen im Aufbau von DNA und RNA? 50) In welchen Organen unseres Körpers findet sich die größte Menge der Eiweiße? 51) Was ist eine Mutation? 52) Nenne vier Typen von Mutationen. 53a) Welche Veränderung liegt bei einer Polyploidie vor? Und welche zellulären Veränderungen bringt das in der Regel mit sich? b) Nenne ein Beispiel, wo eine Polyploidie genutzt wird! 54) Wie bezeichnet man die Mutation einer Trisomie? Welche Folgen haben Trisomien in der Regel? 55) Welche Veränderungen liegen bei Chromosomenmutationen vor? 56) Wie bezeichnet man eine Mutation, bei der einzelne Basen der DNA verändert sind?

3 Lösungen der Übungsaufgaben für die Jahrgangsstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Chromosomen speichern die Erbinformation. 35) 36) Der Elementarfaden besteht aus DNA (=Desoxyribonucleinsäure), der umhüllt ist von Eiweiß. 37) Die Erbinformation ist in der DNA gespeichert. - Man hat Mäusen zwei verschiedene Stämme einer Bakterienart (Pneumokokken) eingespritzt. Ein Bakterienstamm A verfügte über eine schützende Kapsel und tötete die Mäuse. Dem anderen Stamm B fehlte diese Kapsel. Die Mäuse überlebten. Abgetötete Bakterien vom Stamm A konnten den Mäusen nicht schaden. Spritzte man aber den Mäusen abgetötete Bakterien des Stammes A und gleichzeitig lebende Bakterien des Stammes B ein, starben die Mäuse. Dieses geschah auch, wenn man den Mäusen lebende Bakterien vom Stamm B und Erbmaterial von Bakterien des Stammes A einspritzte, das zuvor mit Eiweiß abbauenden Enzymen behandelt worden war. War das Erbmaterial mit DNA abbauenden Enzymen behandelt, überlebten die Mäuse. In den toten Mäusen fanden sich Bakterien mit einer Kapsel. - Die kapsellosen Bakterien müssen also aus dem Erbmaterial der umkapselten Bakterien die Information gewonnen haben, wie man eine Kapsel aufbaut. Dieses war aber nur möglich, wenn nicht zuvor die DNA der Chromosomen sondern allenfalls das umhüllende Eiweiß zerstört worden war. Die DNA muss also die Erbinformation enthalten.

4 38) Die DNA hat die Form einer um die Längsachse gedrehten Strickleiter. Die Leiterholme bestehen aus dem Zucker Desoxyribose und einem Phosphatmolekül, die sich abwechseln. An den Zuckermolekülen hängen die Leitersprossen, die jeweils aus zwei organischen Basen bestehen. Dabei sind die Basen Adenin und Thymin stets gepaart. Ebenso sind die Basen Cytosin und Guanin gepaart und bilden eine Leitersprosse. 39) Die Chromosomen werden während der Interphase verdoppelt. 40) Der DNA-Faden reißt der Länge nach zwischen den gepaarten Basen auseinander. An die Einzelstränge lagern sich an die Basen komplementäre Basen (also Adenin an Thymin und Guanin an Cytosin). An diesen hängen jeweils ein Zuckerund ein Phosphatmolekül. Solche Bausteine nennt man Nucleotide. Diese schwimmen frei im Zellkern. so entstehen zwei völlig identische Doppelstränge. Aus einem Chromosom sind zwei erbgleiche Chromosomen geworden, die man als Schwesterchromatiden bezeichnet. Sie hängen zunächst noch am Centromer zusammen und werden erst während der eigentlichen Zellteilung getrennt. 41) Die Erbinformation ist in der Abfolge der Basen verschlüsselt. Jeweils drei aufeinanderfolgende Basen verschlüsseln eine Aminosäure. 42) Eiweiße sind oft Enzyme, die als Biokatalysatoren die verschiedensten Stoffwechselvorgänge steuern. 43) - Der DNA-Doppelstrang wird durch ein Enzym der Länge nach getrennt - An die freien Basen eines DNA-Einfachstranges lagern sich die komplementären Nucleotide. ( bestehend aus einer Base, Zucker und Phosphat) an. - Die Nucleotide werden miteinander verbunden so dass ein m-rna-strang entsteht. Dieses ist ein Einfachstrang und enthält den Zucker Ribose und statt Thymin die Base Uracil. - Diese Boten-RNA wird als m-rna bezeichnet (m = messanger). - Sie verlässt den Zellkern durch die Kernpore.

5 44) - Die m-rna wandert im Plasma zum Ribosom (= ort der Eiweißsynthese). - Im Plasma befinden sich t-rna-moleküle, aus denen drei organische Basen herausragen ( ein Basentriplett ). Dieses passt genau auf entsprechende Tripletts der m-rna. - Durch ein bestimmtes Enzym ist an die verschiedenen t-rna-moleküle je eine von 20natürlich vorkommenden Aminosäuren gebund en. - Sobald sich zwei t-rna-moleküle an die m-rna im Ribosom gebunden haben, werden die Aminosäuren aneinander gekoppelt. Durch Vorrücken der m-rna im Ribosom können weitere t-rna-moleküle gebunden und damit weitere Aminosäuren an den so entstehenden Eiweißfaden gebunden werden. - T-RNA-Moleküle, die ihre Aminosäure abgegeben haben, lösen sich vom Ribosom und werden neu beladen. 45) a) Enzym, b) DNA, c)zellkern, d) Kernpore, e) Boten-RNA, f) organische Base, g)ribosom, h) t-rna, i) Eiweißfaden, k) Aminosäure 46) UGAUCGACC 47) Gen = Erbanlage 48) Thr (Threonin), His (Histidin),Gly (GLycin), Tyr (Tyrosin), Ala (Alanin), Lys (Lysin) 49) Bei der DNA handelt es sich um einen Doppelstrang. Die RNA ist ein Einfachstrang, in dem statt des Zuckers Desoxyribose der Zucker Ribose eingebaut ist. Außerdem ist in der RNA die Base Thymin durch die Base Uracil ersetzt. 50) Große Mengen von Eiweißen bauen unsere Muskeln auf. 51) Mutation: Sprunghafte und dauerhafte Veränderung der Erbinformation 52) Polyploidie: Vervielfachung des gesamten Chromosomensatzes führt in der Regel zur Vergrößerung des Zellvolumens bei Weizen und Roggen (Getreide) sind auf diese Weise ertragreichere Sorten gezüchtet worden. 53) Trisomien werden als Heteroplidien bezeichnet. Sie sind meist nachteilig. - Die Krankheit Down-Syndrom ist ein Beispiel. 54) Bei Chromosomenmutation fehlen Teile eines Chromosoms oder an das Chromosom sind zusätzlich Teile eines anderen Chromosoms angewachsen.

6 55) Die Veränderung einzelner Basen, zusätzliche oder fehlende Basen führen zu einer Genmutation. 56) Die weiblichen Keimzellen sind die Eizellen. Sie werden in den Eierstöcken gebildet in der Zeit von der Pubertät bis zu den Wechseljahren. Durchschnittlich reift alle 4 Wochen eine Eizelle. Im Leben reifen somit höchstens Eizellen. Die Frau besitzt insgesamt Eianlagen. Die männlichen Keimzellen sind die Spermien. Sie werden in den Hoden gebildet in der Zeit von der Pubertät bis zum Lebensende. Durchschnittlich reifen 100 Millionen Spermien pro Tag. den.

DNS-Modell Best.-Nr. 2015801

DNS-Modell Best.-Nr. 2015801 DNS-Modell Best.-Nr. 2015801 1. Produktvorstellung Ziel des Produktes Dieses Modell soll das DNS-Molekül visualisieren: es soll die Doppelspirale, Stickstoffbasen mit Wasserstoffbrückenbindung, Zucker-Phosphatskelette

Mehr

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten.

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Wie bezeichnet man den Strang der DNA- Doppelhelix, der die

Mehr

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit in der Nucleotidsequenz der DNA verschlüsselt (codiert)

Mehr

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik Frage Was sind Fachbegriffe zum Thema Grundbegriffe der Genetik? Antwort - Gene - Genotyp - Phänotyp - Genom - Dexoxyribonucleinsäure - Träger genetischer Information - Nukleotide - Basen - Peptid - Start-Codon

Mehr

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie Grundwissenkarten Gymnasium Vilsbisburg 9. Klasse Biologie Es sind insgesamt 10 Karten für die 9. Klasse erarbeitet. davon : Karten ausschneiden : Es ist auf der linken Blattseite die Vorderseite mit Frage/Aufgabe,

Mehr

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen

Mehr

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS)

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) N U C L E I N S Ä U R E N Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) BAUSTEINE DER NUCLEINSÄUREN Die monomeren Bausteine der Nucleinsäuren

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

Genetik Was ist ein Gen - Der Code des Lebens

Genetik Was ist ein Gen - Der Code des Lebens Genetik Was ist ein Gen - Der Code des Lebens A) Teilungsvorgänge 1. Körperzellen Unser Körper besteht aus ca 3 Billionen Zellen, die alle die gleiche Erbsubstanz haben. Nur wirken die Erbanlagen nicht

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Chromosom enthält DNA besteht aus Nucleotiden bestehen aus Phosphat und Basen sind Adenin, Guanin, Cytosin, Thymin

Chromosom enthält DNA besteht aus Nucleotiden bestehen aus Phosphat und Basen sind Adenin, Guanin, Cytosin, Thymin 2 Molekulargenetik Natura Genetik 2 Molekulargenetik Lösungen zu den Aufgaben Seiten 20 21 2.1 DNA ist das genetische Material 1 Stelle in einem Begriffsnetz den Zusammenhang zwischen folgenden Begriffen

Mehr

Pinschertage der OG Bonn Grundlagen der Zucht

Pinschertage der OG Bonn Grundlagen der Zucht Pinschertage der OG Bonn 31.05. - 01.06.2008 Grundlagen der Zucht von Ralf Wiechmann Der Phänotyp Ist die Gesamtheit der wahrnehmbaren Merkmale eines Organismus. das äußere Erscheinungsbild das Aussehen,

Mehr

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren...

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... Molekulargenetik Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... 2 Beschreiben, wie die DNA aufgebaut ist... 3 Den Ablauf der Replikation erklären und dabei die

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird Molekularbiologie 6c Proteinbiosynthese Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird 1 Übersicht: Vom Gen zum Protein 1. 2. 3. 2 Das Dogma

Mehr

Aufbau, Struktur, Funktion von DNA, RNA und Proteinen

Aufbau, Struktur, Funktion von DNA, RNA und Proteinen Aufbau, Struktur, Funktion von DNA, RNA und Proteinen Mitarbeiterseminar der Medizinischen Fakultät Ruhr-Universität Bochum Andreas Friebe Abteilung für Pharmakologie und Toxikologie Aufbau, Struktur,

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Die gentechnische Produktion von Insulin - Selbstlerneinheit zur kontextorientierten Wiederholung der molekularen Genetik Das komplette

Mehr

KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen

KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen Bild 1 Ausdehnung eines Chromosoms (C) 1. Besteht aus Chromatin. Das ist die DNS + Proteine 2. Chromosomen liegen im Zellkern 3. Menschliche Körperzellen

Mehr

Erwin Graf. Genetik an Stationen DNA. Sekundarstufe uf. e I. Erwin Graf. Downloadauszug aus dem Originaltitel: netik

Erwin Graf. Genetik an Stationen DNA. Sekundarstufe uf. e I. Erwin Graf. Downloadauszug aus dem Originaltitel: netik Erwin Graf Genetik an Stationen DNA Sekundarstufe uf e I Erwin Graf Downloadauszug aus dem Originaltitel: netik Genetik an Stationen DNA Dieser Download ist ein Auszug aus dem Originaltitel Genetik Über

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Der Bauplan des Lebens - unsere Erbanlagen (Klasse 9/10) Materialien im PDF-Format Das komplette Material finden Sie hier: School-Scout.de

Mehr

Grundlagen der Vererbung beim Hund

Grundlagen der Vererbung beim Hund Grundlagen der Vererbung beim Hund Züchterstammtisch: 10. August 2013 Referentin: Diana Ringpfeil Tätigkeit: Tierärztin Mail: Ringpfeil@arcor.de Referent: Kay Rostalski Diana Ringpfeil, Tierärztin, Kay

Mehr

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Einführung in die Grundlagen der Genetik Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Molekularbiologische Grundlagen Die Zelle ist die grundlegende, strukturelle und funktionelle

Mehr

Aufbau der Nervenzelle. Zentrales Nervensystem

Aufbau der Nervenzelle. Zentrales Nervensystem Aufbau der Nervenzelle 2 A: Zellkörper (Soma): Stoffwechselzentrum B: Axon: Weiterleitung der elektrischen Signale C: Dendrit: Informationsaufnahme D: Hüllzellen: Isolation E: Schnürring: Unterbrechung

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer

Mehr

Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen

Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen Die Organellen der Zelle sind sozusagen die Organe die verschiedene Funktionen in der Zelle ausführen. Wir unterscheiden Tierische

Mehr

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen 9.1 Welche Funktionen haben Sinneszellen und Sinnesorgan? Sinneszellen nehmen die Reize auf und wandeln die Information in elektrische Signale um. Die Sinnesorgane dienen unter anderem dazu. Beispiel Auge

Mehr

Gen Protein Aufgaben: Edel LK-Bio BI-3

Gen Protein Aufgaben: Edel LK-Bio BI-3 Proteinbiosynthese Von der DNA zum Protein Dieses Lernprogramm zeigt Ihnen in einem vereinfachten Modell den im Zellinneren ablaufenden Prozess vom Gen auf der DNA zum Protein. Aufgaben: 1 Betrachten Sie

Mehr

Proteinbiosynthese: Transkripion:

Proteinbiosynthese: Transkripion: Proteinbiosynthese: - Basensequenz der DNA wird in die Basensequenz der RNA übersetzt (Transkription) - Übersetzen der mrna in die spezifische Aminosäuresequenz (Translation) - Bei Eukaryoten sind Transkription

Mehr

Aufgabe 1. Bakterien als Untersuchungsgegenstand!

Aufgabe 1. Bakterien als Untersuchungsgegenstand! Genetik I Aufgabe 1. Bakterien als Untersuchungsgegenstand 1. Beschriften Sie die Abbildung zu den Bakterien. 2. Nennen Sie Vorteile, die Bakterien wie Escherichia coli so wertvoll für die genetische Forschung

Mehr

T 5 FF 16 Arbeitsblatt 4

T 5 FF 16 Arbeitsblatt 4 T 5 FF 16 Arbeitsblatt 4 Zell bestandteile als Teile eines Staates Ordne die folgenden Begriffe aus der Staatskunde den Beschreibungen zu : produktive Fläche Transportsystem Grenze Brachland / Speicher

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

Einführung Nukleinsäuren

Einführung Nukleinsäuren Einführung Nukleinsäuren Dr. Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Einführung 1. Semester, WiSe 2007/2008 Historischer Überblick Literatur Bilder aus: Taschenatlas

Mehr

Einleitung. Replikation

Einleitung. Replikation (C) 2014 - SchulLV 1 von 9 Einleitung Der Action-Film von gestern Abend war wieder ziemlich spannend. Mal wieder hat es der Superheld geschafft, alle Zeichen richtig zu deuten, diverse Geheimcodes zu knacken

Mehr

DOWNLOAD. Vertretungsstunde Biologie /10. Klasse: Genetik und Vererbung. Corinna Grün, Cathrin Spellner. Downloadauszug aus dem Originaltitel:

DOWNLOAD. Vertretungsstunde Biologie /10. Klasse: Genetik und Vererbung. Corinna Grün, Cathrin Spellner. Downloadauszug aus dem Originaltitel: DOWNLOAD Corinna Grün, Cathrin Spellner Vertretungsstunde Biologie 17 9./10. Klasse: Genetik und Vererbung Downloadauszug aus dem Originaltitel: Chromosomen als Träger der Erbanlagen Aufbau eines Chromosoms

Mehr

Der molekulare Bauplan des Lebens; biologische Nano- und Mikrobausteine von Lebewesen. RNA und DNA als sich selbst replizierende Informationsspeicher

Der molekulare Bauplan des Lebens; biologische Nano- und Mikrobausteine von Lebewesen. RNA und DNA als sich selbst replizierende Informationsspeicher Der molekulare Bauplan des Lebens; biologische Nano- und Mikrobausteine von Lebewesen RNA und DNA als sich selbst replizierende Informationsspeicher Quelle: Biochemie, J.M. Berg, J.L. Tymoczko, L. Stryer,

Mehr

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Vererbung Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Klassische Genetik Äußeres Erscheinungsbild: Phänotypus setzt sich aus einer Reihe von Merkmalen (Phänen))

Mehr

Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem

Mehr

Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale

Mehr

11 Nukleinsäuren Die DNA: Der Speicher der Erbinformation

11 Nukleinsäuren Die DNA: Der Speicher der Erbinformation 11 Nukleinsäuren Übersicht: 11.1 Die DNA: Speicher der Erbinformation 11.2 Der Aufbau und die Komponenten der DNA 11.3 Doppelstrang und Doppelhelix 11.4 Der genetische Code 11.5 Die Biosynthese der DNA

Mehr

Evolution, Genetik und Erfahrung

Evolution, Genetik und Erfahrung Chromosomen, Fortpflanzung und Genkopplung Entscheidende Entdeckung: Gene sind auf Chromosomen lokalisiert! 1 CHROMOSOM fadenförmige Strukturen im Kern der Zellen (wikipedia) Chromosomen in Körperzellen

Mehr

Glossar Bio- Gentechnologie

Glossar Bio- Gentechnologie Glossar Bio- Gentechnologie Aminosäuren Organische Verbindungen, die als charakteristisches Merkmal sowohl eine Aminogruppe als auch eine Carboxylgruppe besitzen. Die 20 sogenannten "natürlichen" Aminosäuren

Mehr

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden.

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden. 03 Arbeitsauftrag Arbeitsauftrag Ziel: Anhand des Foliensatzes soll die Bildung und der Aufbau des Proteinhormons Insulin erklärt werden. Danach soll kurz erklärt werden, wie man künstlich Insulin herstellt.

Mehr

Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.

Mehr

Gendefekte und Gentherapie bei Mukoviszidose Klausuraufgaben Reihe 3 Verlauf Material S 1

Gendefekte und Gentherapie bei Mukoviszidose Klausuraufgaben Reihe 3 Verlauf Material S 1 S 1 Gendefekte und Gentherapie Klausurarbeit Name: Datum: I Aufgabenteil Aufgabe 1 a) Lesen Sie sich die Informationen über die Ursache der Krankheit Mukoviszidose im Teil I des Materialteils genau durch.

Mehr

Einstieg: Fortpflanzung

Einstieg: Fortpflanzung Einstieg: Fortpflanzung Wozu ist Sex gut? - Nachkommen werden gezeugt --> Erhalt der Spezies. - Es entstehen Nachkommen mit Merkmalen (z.b. Aussehen), die denen von Vater und Mutter ähneln. Beide Eltern

Mehr

Eine kleine Einführung in die Genetik

Eine kleine Einführung in die Genetik Eine kleine Einführung in die Genetik Genetik = Die Lehre von der Vererbung 1.) Die Geschichte der Genetik Johann Gregor Mendel wurde am 22. Juli 1822 in Heinzendorf geboren, nach seinem Abitur tritt er

Mehr

Anabole Prozesse in der Zelle

Anabole Prozesse in der Zelle Anabole Prozesse in der Zelle DNA Vermehrung RNA Synthese Protein Synthese Protein Verteilung in der Zelle Ziel: Zellteilung (Wachstum) und Differenzierung (Aufgabenteilung im Organismus). 2016 Struktur

Mehr

Abschlussbericht der Projektgruppe 583

Abschlussbericht der Projektgruppe 583 Abschlussbericht der Projektgruppe 58 VATRAM VAriant Tolerant ReAd Mapper Benjamin Kramer, Jens Quedenfeld Sven Schrinner, Marcel Bargull Kada Benadjemia, Jan Stricker David Losch. März 5 Betreuer: Sven

Mehr

Zusammenfassung Biologie Molekulargenetik

Zusammenfassung Biologie Molekulargenetik die Versuche von Griffith und Avery beschreiben und interpretieren können Gemeinsamkeit der Proteine und Nukleinsäuren: langkettige, unverzweigte Moleküle Bakterium: Streptococcus pneumoniae (S-Zellen

Mehr

Gene, Umwelt & Verhalten II: Molekulare Genetik

Gene, Umwelt & Verhalten II: Molekulare Genetik Gene, Umwelt & Verhalten II: Molekulare Genetik 1. Struktur und Funktion der DNA 2. Die Vervielfältigung der genetischen Information 2.1 Replikation innerhalb des Zellzyklus 2.2 Entstehung von Keimzellen

Mehr

Vererbung und Epilepsie

Vererbung und Epilepsie epi-info Vererbung und Epilepsie www.diakonie-kork.de 1 Was versteht man unter Vererbung, und welche Hauptformen gibt es? Vererbung ist die Weitergabe von Merkmalen von Eltern an ihre Kinder. Dies erfolgt

Mehr

Robert Koch-Gymnasium Deggendorf GRUNDWISSENKARTEN. Biologie. 9. Jahrgangsstufe

Robert Koch-Gymnasium Deggendorf GRUNDWISSENKARTEN. Biologie. 9. Jahrgangsstufe Robert Koch-Gymnasium Deggendorf GRUNDWISSENKARTEN Biologie 9. Jahrgangsstufe Es sind insgesamt 25 Karten für die 9. Jahrgangsstufe erarbeitet, die als ständiges Grundwissen für alle Jahrgangsstufen gelten!

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Gentechnik: Dem genetischen Fingerabdruck auf der Spur Das komplette Material finden Sie hier: School-Scout.de 8.-11. Schuljahr Dipl.-Bio.

Mehr

5. Endoplasmatisches Reticulum und Golgi-Apparat

5. Endoplasmatisches Reticulum und Golgi-Apparat 5. Endoplasmatisches Reticulum und Golgi-Apparat Institut für medizinische Physik und Biophysik Ramona Wesselmann Endoplasmatisches Reticulum Umfangreiches Membransystem endoplasmatisch im Cytoplasma reticulum

Mehr

DNA Vom Gen zum Protein

DNA Vom Gen zum Protein 55 11215 Didaktische FWU-DVD DNA Vom Gen zum Protein Biologie Chemie Klasse 9 13 Klasse 10 13 Trailer ansehen Schlagwörter Adenin; Aminosäuren; Biochemie; Biosynthese; Chromosom; Codesonne; Cytosin; Desoxyribonukleinsäure;

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 2 (06.06. 10.06.) DNA-Schäden, Mutationen und Reparatur 1.

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

AUFGABENSAMMLUNG Lösungen. Variabilität von Antikörpern 1

AUFGABENSAMMLUNG Lösungen. Variabilität von Antikörpern 1 Variabilität von Antikörpern 1 Rezeptoren bzw. Antikörper eines noch undifferenzierten B-Lymphocyten: a) Schreiben Sie die Anzahl der variablen Exons je Chromosom auf. b) Berechnen Sie die mögliche Anzahl

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

Chemie für Biologen. Vorlesung im. WS 2004/05 V2, Mi 10-12, S04 T01 A02. Paul Rademacher Institut für Organische Chemie der Universität Duisburg-Essen

Chemie für Biologen. Vorlesung im. WS 2004/05 V2, Mi 10-12, S04 T01 A02. Paul Rademacher Institut für Organische Chemie der Universität Duisburg-Essen Chemie für Biologen Vorlesung im WS 004/05 V, Mi 0-, S04 T0 A0 Paul Rademacher Institut für rganische Chemie der Universität Duisburg-Essen (Teil 3: 9.0.005) MILESS: Chemie für Biologen 36 D-Aldosen C

Mehr

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema Gentechnologie Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Die Genklonierung in Bakterien Vektor-DNA Spender-DNA Restriktionsenzym Rekombinante

Mehr

Genetik. Genetik. Erbanlagen als Risikofaktoren für Erkrankungen. (01) 260 53-0 Fax: (01) 260 53-500 mail@labors.at www.labors.at

Genetik. Genetik. Erbanlagen als Risikofaktoren für Erkrankungen. (01) 260 53-0 Fax: (01) 260 53-500 mail@labors.at www.labors.at Genetik Genetik Erbanlagen als Risikofaktoren für Erkrankungen (01) 260 53-0 Fax: (01) 260 53-500 mail@labors.at www.labors.at Sehr geehrte Leserin! Sehr geehrter Leser! Modernste labormedizinische Methoden

Mehr

Transkription Teil 2. - Transkription bei Eukaryoten -

Transkription Teil 2. - Transkription bei Eukaryoten - Transkription Teil 2 - Transkription bei Eukaryoten - Inhalte: Unterschiede in der Transkription von Pro- und Eukaryoten Die RNA-Polymerasen der Eukaryoten Cis- und trans-aktive Elemente Promotoren Transkriptionsfaktoren

Mehr

Entstehung und Evolution v Entstehung und Ev o olution v n Leben Manuela Gober 30.J uni 2011

Entstehung und Evolution v Entstehung und Ev o olution v n Leben Manuela Gober 30.J uni 2011 Entstehung und Evolution von Leben Manuela Gober 30. Juni 2011 DIE PRAEBIOTISCHE ERDE Mögliche Atmosphärenzusammensetzung nach Urey und Miller: H 2, CH 4, NH 3 und H 2 O Oberflächentemperatur: ~ 100 C

Mehr

Grundwissen Biologie Jahrgangsstufe 11 Fachschaft Biologie. Zelle und Enzymatik

Grundwissen Biologie Jahrgangsstufe 11 Fachschaft Biologie. Zelle und Enzymatik Grundwissen Biologie Jahrgangsstufe 11 Fachschaft Biologie Q11 Zelle und Enzymatik Biomembranen Bestehen aus einer Lipiddoppelschicht, in die Proteine eingelagert sind. Biomembranen sind selektiv permeabel.

Mehr

Warum sehen Kinder ihre Eltern ähnlich?

Warum sehen Kinder ihre Eltern ähnlich? Warum sehen Kinder ihre Eltern ähnlich? Du siehst aber deiner Mutter ähnlich! Sieh mal, er hat die Haare wie sein Vater! Du hast wirklich die Augen wie Mama und Oma! Diese oder ähnliche Sätze hat sicherlich

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Die klassische Genetik: T.H. Morgan und seine Experimente mit Drosophila melanogaster Das komplette Material finden Sie hier: Download

Mehr

Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Wobei jeweils eine AS von 3 Basen codiert wird..

Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Wobei jeweils eine AS von 3 Basen codiert wird.. Proteinbiosynthese Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Alle Proteine, sind über die DNA codiert Wobei jeweils eine AS von 3 Basen codiert wird.. GENETISCHER CODE

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von DNA- Replikation PowerPoint-Learning von Andrea Brügger Lernziele dieser Lerneinheit: 1. Sie kennen und verstehen die einzelnen Teilschritte der DNA-Replikation und können diese Teilschritte den entsprechenden

Mehr

FRAG DIE TRAUBE. Das 1x1 der modernen Pflanzenforschung. Teil 1 Grundlagen der Molekularbiologie

FRAG DIE TRAUBE. Das 1x1 der modernen Pflanzenforschung. Teil 1 Grundlagen der Molekularbiologie FRAG DIE TRAUBE Das 1x1 der modernen Pflanzenforschung Teil 1 Grundlagen der Molekularbiologie Inhalt Grundlagen Teil 1 FRAG DIE TRAUBE Warum interessieren sich Forscher für pflanzliches Erbgut? Weiter

Mehr

Learn4Med. Ein Gen steuert die Haarfarbe einer Katze. Es gibt ein Allel (also eine Version) für ein schwarzes Fell und ein Allel für rote Haare.

Learn4Med. Ein Gen steuert die Haarfarbe einer Katze. Es gibt ein Allel (also eine Version) für ein schwarzes Fell und ein Allel für rote Haare. 1. Mendelsche Regeln Bei Mendel ist ein Gen als Teil des Erbmaterials definiert, der für die Ausbildung eines bestimmten Merkmals verantwortlich ist. Gibt es für dieses Gen verschiedene Ausprägungen, nennt

Mehr

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz Luitgardis Seigner Schaderregernachweis mit der Polymerase-Kettenreaktion (PCR) Schaderregernachweis mit der Polymerase- Kettenreaktion

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Vorbemerkung für die Erlangung des Testats: Bearbeiten Sie die unten gestellten Aufgaben

Mehr

Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16

Mehr

INHALT Geschichte des Klonens Klonen in der Natur Vorgehensweise des Klonens Reproduktives Klonen Therapeutisches Klonen Dolly Prometea Pro & Contra

INHALT Geschichte des Klonens Klonen in der Natur Vorgehensweise des Klonens Reproduktives Klonen Therapeutisches Klonen Dolly Prometea Pro & Contra KLONEN INHALT Geschichte des Klonens Klonen in der Natur Vorgehensweise des Klonens Reproduktives Klonen Therapeutisches Klonen Dolly Prometea Pro & Contra Ethikdiskussion Bedeutung der Gentechnik im Weltvergleich

Mehr

Die Chromosomen sind im Zellkern immer paarweise vorhanden. In der menschlichen Zelle befinden sich 23 Chromosomenpaare. Diese bilden den diploiden

Die Chromosomen sind im Zellkern immer paarweise vorhanden. In der menschlichen Zelle befinden sich 23 Chromosomenpaare. Diese bilden den diploiden Die Chromosomen Die Chromosomen sind Träger der Erbinformation. Unter dem Mikroskop erscheinen sie in verschiedenen Formen. Einmal als gekrümmte oder gedrungene Stäbchen, in deren Mitte sich eine Ein-schnürung

Mehr

Teil Osiewacz, 8 Fragen, 55 Punkte)

Teil Osiewacz, 8 Fragen, 55 Punkte) Teil Osiewacz, 8 Fragen, 55 Punkte) Frage 1: 8 Punkte Die Kernteilungsspindel ist aus verschiedenen Fasern aufgebaut. a) Welche Fasern sind das? (3 Punkte) b) Welche dieser Fasern setzen in der Metaphaseplatte

Mehr

t-rna Ribosom (adapted from the handouts of Prof. Beck-Sickinger, Universität Leipzig)

t-rna Ribosom (adapted from the handouts of Prof. Beck-Sickinger, Universität Leipzig) ukleinsäuren speichern die Erbinformation. Das menschliche Genom ist in jeder Zelle aus 3900 Millionen Basenpaare (Mbp) aufgebaut und hat eine Gesamtlänge von 99 cm. t-ra Ribosom (adapted from the handouts

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Q1 B1 KW 49. Genregulation

Q1 B1 KW 49. Genregulation Q1 B1 KW 49 Genregulation Transkription Posttranskription elle Modifikation Genregulation bei Eukaryoten Transkriptionsfaktoren (an TATA- Box) oder Silencer (verringert Transkription) und Enhancer (erhöht

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

MOLEKULARGENETIK. Die Bestandteile liegen in folgenden Mengenverhältnissen vor:

MOLEKULARGENETIK. Die Bestandteile liegen in folgenden Mengenverhältnissen vor: MOLEKULARGENETIK BAU UND FUNKTOIN DER NUKLEINSÄUREN Bau von DNS und RNS Den räumlichen Bau der Desoxyribonukleinsäure (=DNS, DNA) entschlüsselten die beiden britischen Forscher James Watson und Francis

Mehr

Die Zelle 3. Teilung und Vererbung

Die Zelle 3. Teilung und Vererbung Die Zelle 3. Teilung und Vererbung Film und Beitrag: Anita Bach Inhalt Der Zellzyklus ist ein komplexer Prozess. Eine Gruppe Schüler will mehr darüber wissen und begibt sich auf die Suche. Unter dem Mikroskop

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

Bauplan für ein Leben

Bauplan für ein Leben Foto: van den Heuvel Unser Genom Bauplan Jochen Graw Die Krankheit Mukoviszidose macht deutlich, wie sehr unsere Gesundheit von einem fehlerfreien Erbgut abhängt. Der Verlust von drei der drei Milliarden

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4 S 4 M 2 Studien an eineiigen Zwillingen Was ist für die Unterschiede bei eineiigen Zwillingen verantwortlich? Aufgaben 1. Fassen Sie die Informationen des Textes zusammen. 2. Wie sind die im Text beschriebenen

Mehr

Struktur und Eigenschaften der DNA in Pro und Eukaryonten

Struktur und Eigenschaften der DNA in Pro und Eukaryonten Struktur und Eigenschaften der DNA in Pro und Eukaryonten Bausteine von Nukleinsäuren: Nukleotide bestehen aus 3 Komponenten: C5-Zucker (RNA: D-Ribose, DNA: 2-Deoxy-D-ribose) Purin- und Pyrimidin-Basen

Mehr

Übungsblatt zu Säuren und Basen

Übungsblatt zu Säuren und Basen 1 Übungsblatt zu Säuren und Basen 1. In einer wässrigen Lösung misst die Konzentration der Oxoniumionen (H 3 O + ) 10 5 M. a) Wie gross ist der ph Wert? b) Ist die Konzentration der OH Ionen grösser oder

Mehr

-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel).

-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel). Mendelsche Regeln 1 + 2 (1) Merkmale wie die Blütenfarbe können dominant-rezessiv oder intermediär vererbt werden. Bei einem intermediären Erbgang wird die Merkmalsausprägung von beiden Allelen (z. B.

Mehr

Seminar Biomedical Informatics

Seminar Biomedical Informatics Martin Dugas und Xiaoyi Jiang Institut für Informatik Sommersemester 2017 Organisation Vorlage: Englischsprachige Publikation Vortrag: ca. 30min + 15min Diskussion, Hand-out, Blockseminar Anfang Juni Seminararbeit:

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte

Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte Teil Osiewacz, 5 Seiten, 5 Fragen, 50 Punkte Frage 1: 10 Punkte a) Die Bildung der Gameten bei Diplonten und bei Haplonten erfolgt im Verlaufe von Kernteilungen. Ergänzen Sie die angefangenen Sätze (2

Mehr