Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath"

Transkript

1 Grundlagen Genetik Dipl.- Psych. Silja Bellingrath

2 Infos zur Klausur Dauer: 11/2 Stunden (maximal) Keine Noten, nur bestanden versus nicht bestanden Inhalt: Grundlage sind die Folien zum Seminar; geprüft werden alle Themen, außer Immunologie Raum: HS 5 Mittwoch :15-17:45 Format: entspricht der Vordiplomsklausur 1. Teil: Multiple Choice (25 Fragen) 2. Teil: offene Fragen (3 Fragen; 6 stehen zur Auswahl) Scheine können ca. 4 Wochen nach der Klausur im Biopsychologie-Institut (Johanniterufer 15) abgeholt werden! Di-Nachmittags (14-18Uhr) oder Mi-Vormittag (9:30-12:30) bei Bellingrath oder Pütz!

3 Gliederung Teaching resources for genetics - interessante Webseiten Wiederholung Begriffe der Genetik Human Genome Project Genetische Variabilität o Anzahl und Art von genetischer Variabilität o Konsequenzen von genetischer Variabilität o - Exkurs:Regulation der Genexpression - Methoden der Verhaltensgenetik

4 Teaching resources for genetics Links: DNA Interactive Genetic Interest Group Informationen zum Human Genome Project The Human Genome (Wellcome Trust) Weitere Links finden Sie hier

5 Begriffe der Genetik Chromosomen Frauen haben 23 Chromosomen, von denen jedes zweimal vorkommt. diploider Chromosomensatz = 46 Chromosomen in jeder Körperzelle Eines dieser homologen Chromosomen stammt von mütterlicher, eines von väterlicher Seite.

6 Begriffe der Genetik Chromosomen Bei den Männern ist eines der Chromosomenpaare ist nicht gleich (XY) Geschlechtschromosomen: Gonosomen Alle anderen Chromosomen: Autosomen In Gameten (Keimzellen: Ovum, Spermium) kommt nur ein einfacher, haploider Chromosomensatz vor Der Geschlechtsvorgang besteht aus einer Verschmelzung von zwei Gameten und wird Gametogamie genannt. Das Verschmelzungsprodukt nennt man Zygote.

7 Begriffe der Genetik Chromosomen bestehen aus verschiedenen Proteinen und aus einer sehr langen Sequenz von Desoxyribonukleinsäure (DNS) englisch: DNA DNA DNA besteht aus Nukleotiden 3 Bestandteile der Nukleotide: Zuckermoleküle (Desoxyribose), Phosphatgruppen und stickstoffhaltige Basen 4 Nukleinbasen der DNA: Adenin (A), Guanin (G), Cytosin (C), Thymin (T) DNA-Moleküle liegen in Doppelsträngen vor, die Basen jedes Nukleotids sind über Wasserstoffbrücken nach einer festen Regel miteinander verbunden Basenpaarung: A-T und G-C bilden jeweils komplementäre Basenpaare

8 Begriffe der Genetik Ferner ist die DNA verdrillt: Doppelhelix 10 Basenpaare pro Wendelgang Das Strukturmodell der DNA stammt von Watson und Crick (1953) Nobelpreis für Physiologie und Medizin 1962

9 Begriffe der Genetik Gene: Gene befinden sich auf Chromosomen. Sie haben dort einen festen Platz: Genlocus heterozygot: ein Mensch hat auf beiden homologen Chromosomen am betreffenden Genlocus zwei unterschiedliche Allele eines Gens homozygot: zwei gleiche Allele des betreffenden Gens Ein Gen ist ein Abschnitt der DNA-Doppelhelix, der ein spezifisches Polypeptid codiert und somit die funktionellen Proteine einer Zelle herstellt. Proteine übernehmen im Körper eine ganz spezifische Funktion, die auch als Merkmal bezeichnet werden kann. Gene werden auch als Erbanlage bezeichnet, da die in ihnen enthaltene Erbinformation durch Reproduktion an die Nachkommen weitergegeben werden.

10 Wie kommt nun die Information der DNA aus der Zelle und wird in Proteine umgesetzt? Proteinbiosynthese: Begriffe der Genetik 1. Schritt Transkription: ein Gen auf der DNA wird abgelesen und in ein mrna-molekül transkribiert. 2. Schritt Translation: die Übersetzung der Basensequenz der mrna in die Aminosäuresequenz des Proteins, an den Ribosomen

11 Begriffe der Genetik Einschub: RNA Vom Aufbau her ist die RNA (Ribonukleinsäure) der DNA ähnlich. RNA-Moleküle sind im Gegensatz zur doppelsträngigen DNA in der Regel einzelsträngig. unterschiedliche Funktionen von RNA-Molekülen: Übertragen genetischer Information Übersetzung dieser Information in Proteine Regulation der Genexpression katalytische Funktionen ähnlich einem Enzym Uracil ist eine der 4 Nukleinbasen der RNA. In der Basenpaarung tritt sie an die Stelle des Thymin.

12 Begriffe der Genetik Transkription:

13 Transkription: Begriffe der Genetik 1. Das Enzym RNA-Polymerase setzt sich an den Promoter 2. die DNA-Doppelhelix wird durch Lösen der Wasserstoffbrücken in zwei DNA-Einzelstränge aufgetrennt 3. Am codogenen Strang der DNA lagern sich durch Basenpaarung komplementäre Ribonukleotide an 4. Die RNA-Polymerase kann aufgrund ihres Aufbaus nur eine Seite (Richtung) des DNA-Stranges "ablesen", diese ist die 3'-5'-Richtung Dadurch ist die Bildungsrichtung des RNA-Stranges in die entgegengesetzte Richtung festgelegt, also 5'-3'-Richtung. Einfach gesagt, das 5'-Ende der RNA wird zuerst synthetisiert 5. Die Öffnung der DNA-Doppelhelix erfolgt nur in einem kurzen Bereich (Transkriptionsblase). Der bereits synthetisierte Teil der mrna hängt aus dieser Öffnung heraus und zwar mit dem 5'-Ende der mrna voran 5. Am Terminator wird die Transkription beendet. Danach wird das mrna- Transkript entlassen und die Polymerase löst sich von der DNA

14 Begriffe der Genetik Translation:

15 Translation: Begriffe der Genetik Die aus der DNA entstandene mrna enthält die genetische Information für den Aufbau eines Proteins. Dabei codieren jeweils drei aneinanderfolgende Nukleotide der mrna (Codons oder Basentripletts) eine bestimmte Aminosäure aus denen das Protein sequentiell aufgebaut wird Genetischer Code 1. Als Aminosäuren- Transporter dient die trna: Ihr Anticodon dockt an je genau einem der Codons auf der mrna an. 2. Das Ribosom bringt die 1. mrna und 2. eine freie trna, die eine Aminosäure aufgenommen hat, so zusammen, dass sich an ein bestimmtes Codon auf der mrna ein komplementäres Anti-Codon der trna anlagert. 3. Das Ribosom, das diesen Prozess katalysiert wandert immer um ein Codon auf der mrna weiter, so lange, bis die Information der mrna vollständig abgearbeitet ist (Stop-Codon).

16 Wiederholung: Begriffe der Genetik Gene bestehen aus Desoxyribonuklein-säure (DNA), einem fadenartigen, doppel-helikal angeordneten Makromolekül Die in der DNA enkodierte Information ist in der Sequenz von Nukleotiden gespeichert Ein Chromosom besteht aus einem (sehr langen) DNA Molekül Der Mensch besitzt 23 Chromosomenpaare, diese konstituieren das Genom Gene sind funktionale Einheiten chromosomaler DNA

17 Die meisten Gene enkodieren Polypeptide und stellen somit die funktionellen Proteine einer Zelle her. Die biologischen Eigenschaften einer Zelle werden hauptsächlich durch die aktiven Proteine bestimmt, die in dieser Zelle exprimiert werden. Proteine bestimmen: - Einen Großteil der zellulären Architektur - Die enzymatische Aktivität der Zelle - Die Interaktion mit der zellulären Umgebung - Sowie eine Reihe weiterer physiologischer Eigenschaften

18 Da die Eigenschaften von Zellen die Eigenschaften eines Organismus bestimmen, gibt es einen direkten Zusammenhang zwischen Genen und der Struktur und Funktion eines Organismus.

19 ...ein paar Zahlen Basenpaare pro Zelle (haploid / diploid) (2,84 Mrd) (5,68 Mrd.) Eine menschliche Zelle enthält 2,244 m DNA (Verpackt in einem Zellkern von mm Durchmesser) Der menschliche Körper besteht aus ca Zellen der Körper enthält insgesamt ca. 2,244 x m DNA 2,244 x m DNA = m

20 Human Genome Project: 1990 initiiert Februar 2001 wurde ein erstes rough draft vom International Human Genome Sequencing Consortium (IHGSC) und von Celera präsentiert 90% des Genoms sequenziert, Gene Rohfassung wies Lücken auf Oktober 2004 Finishing the euchromatic sequence of the human genome Nature 431, (2004) Über 99% des Humangenoms entziffert nur noch 341 Unterbrechungen 2,85 Milliarden Nucleotide neue Schätzung: Gene

21 Das Human Genome Projekt lieferte nicht nur die Information über die genaue Sequenz unseres Genoms, sondern auch Informationen über Unterschiede zwischen den Genomen einzelner Individuen 1. Wieviel Variation / Unterschiede gibt es? 2. Was bringt uns diese Information? 3. Welche Art von genetischer Variabilität gibt es? 4. Welche funktionellen Konsequenzen ergeben sich aus genetischer Variabilität?

22 1. Wieviel Variation / Unterschiede gibt es? Die Unterschiede zwischen den Genomen von verschiedenen Menschen werden u.a. bestimmt durch einzelne Basendifferenzen (Single Nucleotide Polymorphism, SNP) SNPs sind die häufigste Form von DNA Variation im humanen Genom Es gibt insgesamt etwa 10 Millionen Positionen, die zwischen Individuen variieren (Chakravarti 2001, Hinds et al. 2005)

23 ...und ohne Polymorphismen?

24 Oooops!

25 2. Was bringt uns diese Information? Untersuchung genetischer Variation erlaubt die Abschätzung des Einflusses einzelner DNA Polymorphismen auf inter-individuelle Variabilität in der Anfälligkeit für bzw. Protektion gegen eine Vielzahl von (komplexen) Erkrankungen...der Ansprechbarkeit auf Medikamente (Stichwort personalisierte Medizin) Birgt die Möglichkeit, den Anteil einzelner Gene bei der Entstehung von Krankheiten mit komplexer und multigener Basis zu entschlüsseln...promises to provide unprecedented opportunities to explore the genetic basis of individual differences in complex behaviors and vulnerability to neuropsychiatric illness (Hariri, Br Med Bull 2003)

26 Monogene versus komplexe Erkrankungen Monogene Erkrankungen Schwerwiegendes Krankheitsbild Früher Erkrankungsbeginn Selten Mendelsches Vererbungsmuster Beispiele: Cystische Fibrose, Progressive Muskeldystrophie... Ursache: Mutationen Ein Gen eine Krankheit komplexe Erkrankungen mit multigener Basis Mildes Krankheitsbild Später Erkrankungsbeginn Weit verbreitet Komplexes Vererbungsmuster Beispiele: Diabetes, Depression, Schizophrenie, Krebs, CVD... Ursachen: Interaktion von genetischer Ausstattung mit Umweltvariablen (multiplikative Effekte)

27 3. Welche Art von genetischer Variabilität gibt es? Polymorphismus: Kommen in einer Population multiple funktionelle Allele vor, die alternative Aktivitäten darstellen und nicht den Verlust oder Gewinn einer Funktion, spricht man von genetischem Polymorphismus. Häufigkeit von mehr als 1% in der Population SNPs: Single Nucleotide Polymorphisms Repeats: Repetetive DNA-Segmente Strukturelle Variation

28 Single Nucleotide Polymorphisms SNPs ( Snips ): sind Variationen, bei denen ein Basenpaar durch ein anderes ersetzt wird 22/23 5 1A 1B 1C α 9β 3 ACTCGGTAGGAGAGGCTGGAATGCGCGTGCGACCTGGTCT ACTCGGTAGGAAAAGCTGGAATGCGCGTGCGACCTGGTCT

29 Polymorphismus: Kommen in einer Population multiple funktionelle Allele vor, die alternative Aktivitäten darstellen und nicht den Verlust oder Gewinn einer Funktion, spricht man von genetischem Polymorphismus. Häufigkeit von mehr als 1% in der Population SNPs: Single Nucleotide Polymorphisms Repeats: Repetetive DNA-Segmente Strukturelle Variation

30 Repeats Microsatellites: zwei bis vier Basenpaare lang (Di-/ Tri-/ Tetranucleotid repeats) Minisatellites: auch variable number of tandem repeats (VNTR), bestehen aus einer variablen Anzahl repetetiver Elemente

31 Polymorphismus: Kommen in einer Population multiple funktionelle Allele vor, die alternative Aktivitäten darstellen und nicht den Verlust oder Gewinn einer Funktion, spricht man von genetischem Polymorphismus. Häufigkeit von mehr als 1% in der Population SNPs: Single Nucleotide Polymorphisms Repeats: Repetetive DNA-Segmente Strukturelle Variation

32 Strukturelle Variation Variationen, die größere DNA Abschnitte betreffen DNA-Abschnitt geht verloren Ein DNA-Abschnitt wird eingebaut Die Abfolge eines DNA- Abschnitts kehrt sich um DNA-Abschnitte wiederholen sich

33 4. Welche funktionellen Konsequenzen ergeben sich aus genetischer Variabilität? Exkurs: Genstruktur / Mechanismen der Genregulation Genstruktur: Gene gliedern sich in folgende hauptsächliche Regionen: 5 3` Regulatorische Region: Empfängt und reagiert auf Signale aus dem Genom selbst oder aus der Umwelt

34 4. Welche funktionellen Konsequenzen ergeben sich aus genetischer Variabilität? Exkurs: Genstruktur / Mechanismen der Genregulation Genstruktur: Gene gliedern sich in folgende hauptsächliche Regionen: 5 3` Exons: DNA Segmente, die in mrna umgeschrieben werden. Konstituieren die eigentliche kodierende Region

35 4. Welche funktionellen Konsequenzen ergeben sich aus genetischer Variabilität? Exkurs: Genstruktur / Mechanismen der Genregulation Genstruktur: Gene gliedern sich in folgende hauptsächliche Regionen: 5 3` Zwischen Genen befindet sich DNA, deren Funktion größtenteils unbekannt ist. Nur 1,2% des Genoms bestehen aus Exons! Introns: DNA Segmente unbekannter Funktion, eingestreut zwischen den Exons. Enthalten keine Information für das funktionelle Genprodukt. Werden transkribiert aus dem primären Transkript herausgespleisst

36 RNA Prozessierung 5 3` Transkription Primäre mrna Transkripte (mehrere Zwischenstufen) Transkription Funktionale mrna (Introns herausgespleißt) Translation Polypeptidkette

37 Grundlegende Mechanismen der Genregulation : Nochmals eine Definition: Ein Gen ist eine Region chromosomaler DNA, die zur richtigen Zeit und am richtigen Ort in funktionale mrna umgeschrieben werden kann. Regulatorische Region: DNA Segment mit einer spezifischen Nukleotidsequenz empfängt Signale aus dem Genom selbst oder aus der Umwelt Jede Zelle besitzt die gesamte genetische Information, die im Genom enkodiert ist.

38 Grundlegende Mechanismen der Genregulation : ABER Nur eine kleine Anzahl von Genen wird abgelesen! Selektive Aktivierung bzw. Repression von Genen muss zwei Kriterien erfüllen 1.Transkription von spezifischen Genen oder Gruppen von Genen muss reversibel an- und abschaltbar sein 2.Auf spezifische Signale aus der Umwelt bzw. des physiologischen Kontextes muss reagiert werden können Letztendlich werden diese Signale in regulatorische Proteine übersetzt binden an der regulatorischen Region des Gens initiieren Transkription

39 Zwei Arten von DNA-Protein Interaktion müssen stattfinden: a) Die eine determiniert WO die Transkription beginnt b) Die andere OB Transkription stattfindet Ad a) Promoter und RNA Polymerase: Bindet RNA Polymerase an den Promoter, so wird die Transkription ein paar Basenpaare stromaufwärts initiiert. Jedes Gen muss einen Promoter haben, sonst kann es nicht transkribiert werden Ad b) Aktivatoren / Repressoren: DNA Segmente in der Nähe des Promoters fungieren als Bindungsstellen für regulatorische Proteine

40 a) Promoter und RNA Polymerase: Bindet RNA Polymerase an den Promoter, so wird die Transkription ein paar Basenpaare stromaufwärts initiiert. Jedes Gen muss einen Promoter haben, sonst kann es nicht transkribiert werden. AP-1 Transkriptionsfaktor Bindungsstellen für Transkriptionsfaktoren AP-1 Koaktivatoren RNA Polymerase Transkriptionsinitiation Promoter Regulatorische Region Kodierende Region

41 b) Aktivatoren / Repressoren DNA Segmente in der Nähe des Promoters fungieren als Bindungsstellen für regulatorische Proteine AP-1 Transkriptionsfaktor Bindungsstellen für Transkriptionsfaktoren AP-1 Koaktivatoren RNA Polymerase Transkriptionsinitiation Promoter Regulatorische Region Kodierende Region

42 und noch etwas genauer:

43 4. Welche funktionellen Konsequenzen ergeben sich aus genetischer Variabilität? Die funktionellen Konsequenzen von genetischen Varianten sind abhängig von ihrer Lokalisation. Beobachtet werden Varianten in: Nicht kodierenden Regionen zwischen Genen: Konsequenzen nicht bekannt Introns: Konsequenzen unklar Kodierenden Regionen: Veränderungen des Genprodukts durch Aminosäuretausch somit Veränderung der Proteinstruktur Regulatorischen Regionen: Veränderung der Menge des exprimierten Gens oder des zeitlich-örtlichen Expressionsmusters

44

45 Mögliche Folgen von DNA Polymorphismen in kodierenden Regionen: Met Arg Ser Glu Arg Leu Asp Ala Stop ATG CGG TCG GAG AGG CTG GAC GCG TGA Met Arg Ser Glu Arg Leu Asp Ala Stop ATG CGG TCG GAA AGG CTG GAC GCG TGA Met ATG CGG TCG GAG AGC CTG GAC GCG TGA Met Arg Arg Ser Stop Glu Glu Ser Leu Asp Ala Stop Arg Leu Asp Ala Stop ATG CGG TAG GAG AGG CTG GAC GCG TGA Met Arg Ser Glu ATG CGG TCG GAG AGG ACT G GA C GC G TG A Ser Thr Gly Arg Val

46 Mögliche Folgen von DNA Polymorphismen in kodierenden Regionen: Synonymer Austausch: ein Basenaustausch führt zu keinem Aminosäuretausch, da beide Kodons für die gleiche AS kodieren Nicht-Synbonymer Austausch (missense): ein Kodon für eine Aminosäure wird durch ein Kodon für eine andere Aminosäure ersetzt Aminosäuretausch im Genprodukt nonsense: führt ein Stopkodon ein beendet Transkription frameshift / insertion / deletion: Reading Frame wird verändert Aminosäuresequenz weist keinerlei Ähnlichkeit mit der eigentlichen Aminosäuresequenz auf

47 Beispiel: Auswirkung von Punktmutationen in der Promoterregion Konsequenzen von Punktmutationen im Promoter des β-globin Gens. Punktmutationen der nahezu gesamten Promoterregion und ihre Auswirkungen auf die Transkriptionsrate

48 Methoden der Verhaltensgenetik: Zwillingsstudien Adoptionsstudien Familienstudien Linkageanalysen Assoziationsstudien Designs ohne (Molekular)-Genetik Designs mit (Molekular)-Genetik

49 Assoziationsstudie 1. Kandidatengen(e) aussuchen 2. auf Varianten prüfen (ausreichende Prävalenz?) Gruppe A (Variante A) Gruppe B (Variante B) 3. Einfluss ja / nein

50 Zusammenfassung: Das menschliche Genom ist nahezu entschlüsselt Es gibt eine Vielzahl von interindividuellen Unterschieden bzgl. der genetischen Ausstattung Die Kenntnis dieser Variabilität ist für die bio-medizinische und neurowissenschaftliche Forschung von enormen Wert und...eröffnet die bisher nicht da gewesene Möglichkeit, die genetische Basis von individuellen Unterschieden im komplexen Verhalten und der Anfälligkeit für (neuropsychiatrische) Krankheiten zu ergründen Ausblick auf die nächste Stunde: Beispiele von für die (Bio-)Psychologie relevanten genetischen Studien (Varianten in Neurotransmittersystemen und deren Einfluss auf Persönlichkeit / psychische Krankheit)

51

52 Einschub: Sequenzhomologie

53 Einschub: Sequenzhomologie Homologie der DNA-Sequenz mit anderen Spezies: 60% Huhn 88% Nagern >98% Schimpansen...Was macht uns zum Menschen? 35 Millionen Veränderungen der Basenabfolge 5 Millionen Insertionen / Deletionen Viele chromosomale Veränderungen...the question of what genetic changes make us human is far more complex [than the mere comparison of sequence] Li & Saunders (2005). The chimpanzee and us. Nature 437 (7055):50-51.

54 ...Was macht(e) uns zum Menschen? 3 Hypothesen Proteinevolution: Eher unwahrscheinlich (in Einzelfällen wichtig, z.b. FOXP2) Weniger ist mehr : Adaptiver Verlust von Genen Sehr wahrscheinlich Veränderung der Genregulation: Sehr wahrscheinlich: Gilad et al. (2006) Expression profiling in primates reveals a rapid evolution of human transcription factors. Biopsychologie Vertiefung WS Nature 07/08 440:

55 ...zurück zum Menschen Das Human Genome Projekt lieferte nicht nur die Information über die genaue Sequenz unseres Genoms, sondern auch Informationen über Unterschiede zwischen den Genomen einzelner Individuen 1. Wieviel Variation / Unterschiede gibt es? 2. Was bringt uns diese Information? 3. Welche Art von genetischer Variabilität gibt es? 4. Welche funktionellen Konsequenzen ergeben sich aus genetischer Variabilität?

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten.

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Wie bezeichnet man den Strang der DNA- Doppelhelix, der die

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während

Mehr

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit in der Nucleotidsequenz der DNA verschlüsselt (codiert)

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

DNS-Modell Best.-Nr. 2015801

DNS-Modell Best.-Nr. 2015801 DNS-Modell Best.-Nr. 2015801 1. Produktvorstellung Ziel des Produktes Dieses Modell soll das DNS-Molekül visualisieren: es soll die Doppelspirale, Stickstoffbasen mit Wasserstoffbrückenbindung, Zucker-Phosphatskelette

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren...

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... Molekulargenetik Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... 2 Beschreiben, wie die DNA aufgebaut ist... 3 Den Ablauf der Replikation erklären und dabei die

Mehr

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen

Mehr

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird Molekularbiologie 6c Proteinbiosynthese Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird 1 Übersicht: Vom Gen zum Protein 1. 2. 3. 2 Das Dogma

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer

Mehr

Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16

Mehr

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik Frage Was sind Fachbegriffe zum Thema Grundbegriffe der Genetik? Antwort - Gene - Genotyp - Phänotyp - Genom - Dexoxyribonucleinsäure - Träger genetischer Information - Nukleotide - Basen - Peptid - Start-Codon

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Proteinbiosynthese: Transkripion:

Proteinbiosynthese: Transkripion: Proteinbiosynthese: - Basensequenz der DNA wird in die Basensequenz der RNA übersetzt (Transkription) - Übersetzen der mrna in die spezifische Aminosäuresequenz (Translation) - Bei Eukaryoten sind Transkription

Mehr

RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Einblicke in das menschliche Erbgut (Genom) am Computer

Einblicke in das menschliche Erbgut (Genom) am Computer Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Binger Nacht der Wissenschaft - 16.04.2010 Das menschliche Genom ist entschlüsselt

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die

Mehr

Biochemie (für Bioinformatiker) WS 2010/2011, 1. Klausur (50 Punkte)

Biochemie (für Bioinformatiker) WS 2010/2011, 1. Klausur (50 Punkte) Datum: 06.12.2010 Name: Matrikel-Nr.: Vorname: Studiengang: Bioinformatik Biochemie (für Bioinformatiker) WS 2010/2011, 1. Klausur (50 Punkte) Modulnr.: FMI-BI0027 iermit bestätige ich meine Prüfungstauglichkeit.

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

Gene, Umwelt & Verhalten II: Molekulare Genetik

Gene, Umwelt & Verhalten II: Molekulare Genetik Gene, Umwelt & Verhalten II: Molekulare Genetik 1. Struktur und Funktion der DNA 2. Die Vervielfältigung der genetischen Information 2.1 Replikation innerhalb des Zellzyklus 2.2 Entstehung von Keimzellen

Mehr

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS)

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) N U C L E I N S Ä U R E N Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) BAUSTEINE DER NUCLEINSÄUREN Die monomeren Bausteine der Nucleinsäuren

Mehr

Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine

Mehr

DATENQUALITÄT IN GENOMDATENBANKEN

DATENQUALITÄT IN GENOMDATENBANKEN DATENQUALITÄT IN GENOMDATENBANKEN Alexander Fehr 28. Januar 2004 Gliederung Motivation Biologische Grundkonzepte Genomdaten Datenproduktion und Fehler Data Cleansing 2 Motivation (1) Genomdatenbanken enthalten

Mehr

Einleitung. Replikation

Einleitung. Replikation (C) 2014 - SchulLV 1 von 9 Einleitung Der Action-Film von gestern Abend war wieder ziemlich spannend. Mal wieder hat es der Superheld geschafft, alle Zeichen richtig zu deuten, diverse Geheimcodes zu knacken

Mehr

Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2

Mehr

1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3

1. Nachschreibeklausur zur Vorlesung Genetik im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3 1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A Modul: Studiengang: Matrikel-Nr.: Versuch: 1 2 3 Vollständiger Name in Druckbuchstaben (Vorname Nachname): Jena, 01.04.2010, 10 12 Uhr; Unterschrift:

Mehr

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht

Mehr

Evolution und Entwicklung

Evolution und Entwicklung Evolution und Entwicklung Wie aus einzelnen Zellen die Menschen wurden: Phylogenese Klassische Genetik: Mendel Moderne Genetik: Watson & Crick Wie aus einer einzigen Zelle ein Mensch wird: Ontogenese Vererbung

Mehr

Einstieg: Fortpflanzung

Einstieg: Fortpflanzung Einstieg: Fortpflanzung Wozu ist Sex gut? - Nachkommen werden gezeugt --> Erhalt der Spezies. - Es entstehen Nachkommen mit Merkmalen (z.b. Aussehen), die denen von Vater und Mutter ähneln. Beide Eltern

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

Inhalt Genexpression Microarrays E-Northern

Inhalt Genexpression Microarrays E-Northern Inhalt Genexpression Microarrays E-Northern Genexpression Übersicht Definition Proteinbiosynthese Ablauf Transkription Translation Transport Expressionskontrolle Genexpression: Definition Realisierung

Mehr

Grundlegende Experimente der Molekulargenetik

Grundlegende Experimente der Molekulargenetik Übung 12 Wiederholung/Zusatzübung Inhalte: Mendelscher Erbgang Grundlegende Experimente der Molekulargenetik Transposons Methoden 1. Sie haben drei runde, gelbe Erbsen (A, B und C). Aus jeder der drei

Mehr

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4 S 4 M 2 Studien an eineiigen Zwillingen Was ist für die Unterschiede bei eineiigen Zwillingen verantwortlich? Aufgaben 1. Fassen Sie die Informationen des Textes zusammen. 2. Wie sind die im Text beschriebenen

Mehr

Vererbung und Epilepsie

Vererbung und Epilepsie epi-info Vererbung und Epilepsie www.diakonie-kork.de 1 Was versteht man unter Vererbung, und welche Hauptformen gibt es? Vererbung ist die Weitergabe von Merkmalen von Eltern an ihre Kinder. Dies erfolgt

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.

Mehr

Chemie für Biologen. Vorlesung im. WS 2004/05 V2, Mi 10-12, S04 T01 A02. Paul Rademacher Institut für Organische Chemie der Universität Duisburg-Essen

Chemie für Biologen. Vorlesung im. WS 2004/05 V2, Mi 10-12, S04 T01 A02. Paul Rademacher Institut für Organische Chemie der Universität Duisburg-Essen Chemie für Biologen Vorlesung im WS 004/05 V, Mi 0-, S04 T0 A0 Paul Rademacher Institut für rganische Chemie der Universität Duisburg-Essen (Teil 3: 9.0.005) MILESS: Chemie für Biologen 36 D-Aldosen C

Mehr

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts

Mehr

Genaktivierung und Genexpression

Genaktivierung und Genexpression Genaktivierung und Genexpression Unter Genexpression versteht man ganz allgemein die Ausprägung des Genotyps zum Phänotyp einer Zelle oder eines ganzen Organismus. Genotyp: Gesamtheit der Informationen

Mehr

Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:

Frage 1 A: Wieviele Codone des Universellen genetisches Codes kodieren: Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren: Aminosäuren Translationsstart Translationsstop? B: Welche biochemische Reaktion wird von Aminoazyl-tRNA-Synthetasen katalysiert?

Mehr

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Gene, Umwelt & Verhalten I: Formal- und Quantitative Genetik

Gene, Umwelt & Verhalten I: Formal- und Quantitative Genetik Gene, Umwelt & Verhalten I: Formal- und Quantitative Genetik 1. Einleitung und Grundbegriffe 2. Grundlegendes zu den Trägern der Erbinformation 2.1. Chromosomen 2.2. DNA und Gen 2.3. Die Vervielfältigung,

Mehr

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Florian Frommlet Institut für medizinische Statistik, Medizinische Universität Wien Wien, November 2013 Einführung DNA Molekül Zwei

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 4 (20.06. 24.06.) Regulation der Transkription II, Translation

Mehr

Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Wobei jeweils eine AS von 3 Basen codiert wird..

Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Wobei jeweils eine AS von 3 Basen codiert wird.. Proteinbiosynthese Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Alle Proteine, sind über die DNA codiert Wobei jeweils eine AS von 3 Basen codiert wird.. GENETISCHER CODE

Mehr

Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich

Mehr

Institut für Biochemie und Molekulare Medizin. Lecture 1 Translational components. Michael Altmann FS 2011

Institut für Biochemie und Molekulare Medizin. Lecture 1 Translational components. Michael Altmann FS 2011 Institut für Biochemie und Molekulare Medizin Lecture 1 Translational components Michael Altmann FS 2011 Gene Expression Fliessdiagramm der eukaryotischen Genexpression Die Expression eines Gens kann auf

Mehr

5. Selbstreplikation wie funktioniert Replikation bei natürlichen Organismen?

5. Selbstreplikation wie funktioniert Replikation bei natürlichen Organismen? 5. Selbstreplikation wie funktioniert Replikation bei natürlichen Organismen? Grundlagen der Genetik Grundvorstellung: Bauplan des Organismus gespeichert in DNA-Molekülen, diese werden repliziert DNA als

Mehr

C SB. Genomics Herausforderungen und Chancen. Genomics. Genomic data. Prinzipien dominieren über Detail-Fluten. in 10 Minuten!

C SB. Genomics Herausforderungen und Chancen. Genomics. Genomic data. Prinzipien dominieren über Detail-Fluten. in 10 Minuten! Genomics Herausforderungen und Chancen Prinzipien dominieren über Detail-Fluten Genomics in 10 Minuten! biol. Prin cip les Genomic data Dr.Thomas WERNER Scientific & Business Consulting +49 89 81889252

Mehr

Chromosom enthält DNA besteht aus Nucleotiden bestehen aus Phosphat und Basen sind Adenin, Guanin, Cytosin, Thymin

Chromosom enthält DNA besteht aus Nucleotiden bestehen aus Phosphat und Basen sind Adenin, Guanin, Cytosin, Thymin 2 Molekulargenetik Natura Genetik 2 Molekulargenetik Lösungen zu den Aufgaben Seiten 20 21 2.1 DNA ist das genetische Material 1 Stelle in einem Begriffsnetz den Zusammenhang zwischen folgenden Begriffen

Mehr

KV: Translation Michael Altmann

KV: Translation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Translation Michael Altmann Herbstsemester 2008/2009 Übersicht VL Translation 1.) Genexpression 2.) Der genetische Code ist universell 3.) Punktmutationen

Mehr

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Einführung in die Grundlagen der Genetik Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Molekularbiologische Grundlagen Die Zelle ist die grundlegende, strukturelle und funktionelle

Mehr

Gendefekte und Gentherapie bei Mukoviszidose Klausuraufgaben Reihe 3 Verlauf Material S 1

Gendefekte und Gentherapie bei Mukoviszidose Klausuraufgaben Reihe 3 Verlauf Material S 1 S 1 Gendefekte und Gentherapie Klausurarbeit Name: Datum: I Aufgabenteil Aufgabe 1 a) Lesen Sie sich die Informationen über die Ursache der Krankheit Mukoviszidose im Teil I des Materialteils genau durch.

Mehr

Der molekulare Bauplan des Lebens; biologische Nano- und Mikrobausteine von Lebewesen. RNA und DNA als sich selbst replizierende Informationsspeicher

Der molekulare Bauplan des Lebens; biologische Nano- und Mikrobausteine von Lebewesen. RNA und DNA als sich selbst replizierende Informationsspeicher Der molekulare Bauplan des Lebens; biologische Nano- und Mikrobausteine von Lebewesen RNA und DNA als sich selbst replizierende Informationsspeicher Quelle: Biochemie, J.M. Berg, J.L. Tymoczko, L. Stryer,

Mehr

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat

Mehr

Vorwärts /Rückwärts Mutationen. Somatische Zellen oder Keimzellen. Loss of function/gain of function. Mutagenese

Vorwärts /Rückwärts Mutationen. Somatische Zellen oder Keimzellen. Loss of function/gain of function. Mutagenese 9. Mutationen Konzepte: Vorwärts /Rückwärts Mutationen Somatische Zellen oder Keimzellen Loss of function/gain of function Mutagenese 1. Loss of function Mutationen treten häufiger auf als gain of function

Mehr

Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32

Mehr

Genetik Was ist ein Gen - Der Code des Lebens

Genetik Was ist ein Gen - Der Code des Lebens Genetik Was ist ein Gen - Der Code des Lebens A) Teilungsvorgänge 1. Körperzellen Unser Körper besteht aus ca 3 Billionen Zellen, die alle die gleiche Erbsubstanz haben. Nur wirken die Erbanlagen nicht

Mehr

KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen

KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen Bild 1 Ausdehnung eines Chromosoms (C) 1. Besteht aus Chromatin. Das ist die DNS + Proteine 2. Chromosomen liegen im Zellkern 3. Menschliche Körperzellen

Mehr

Pharmazeutische Biologie WS2011/2012. Das neue Paradigma: Personalisierte Medizin

Pharmazeutische Biologie WS2011/2012. Das neue Paradigma: Personalisierte Medizin 3. Vorlesung Pharmazeutische Biologie WS2011/2012 Das neue Paradigma: Personalisierte Medizin Prof. Theo Dingermann Institut für Pharmazeutische Biologie Biozentrum Max-von Laue-Str. 9 60438 Frankfurt

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene Übung 11 Genregulation bei Prokaryoten Konzepte: Entwicklungs /gewebespezifische Genexpression Coexpression funktional überlappender Gene Positive Genregulation Negative Genregulation cis /trans Regulation

Mehr

Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen

Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen Humangenom Größe 150 m 3.000.000.000 Nukleotide 3000 x 1000 x 1000 Bücher Seiten Buchstaben 1953 2003 Watson, J.D., and F.H.C.Crick.

Mehr

AUFGABENSAMMLUNG Lösungen. Variabilität von Antikörpern 1

AUFGABENSAMMLUNG Lösungen. Variabilität von Antikörpern 1 Variabilität von Antikörpern 1 Rezeptoren bzw. Antikörper eines noch undifferenzierten B-Lymphocyten: a) Schreiben Sie die Anzahl der variablen Exons je Chromosom auf. b) Berechnen Sie die mögliche Anzahl

Mehr

Genexpressionsregulation

Genexpressionsregulation Genexpressionsregulation Genexpressionsregulation Different tissue types 1 2 3 4 5 6 7 8 Taken from Caron et al., 2001 Verschiedene Ebenen der Genexpressionsregulation Epigenetic mechanisms Transkriptionskontrolle

Mehr

BCDS - Biochemische Datenbanken und Software

BCDS - Biochemische Datenbanken und Software BCDS - Biochemische Datenbanken und Software Seminarinhalte Bioinformatische Genom- und Proteomanalyse Literaturrecherche und Zitation Naturwissenschaftliche Software Termine 25. Mai, 1. Juni, 8. Juni,

Mehr

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Vererbung Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Klassische Genetik Äußeres Erscheinungsbild: Phänotypus setzt sich aus einer Reihe von Merkmalen (Phänen))

Mehr

Transkription Teil 2. - Transkription bei Eukaryoten -

Transkription Teil 2. - Transkription bei Eukaryoten - Transkription Teil 2 - Transkription bei Eukaryoten - Inhalte: Unterschiede in der Transkription von Pro- und Eukaryoten Die RNA-Polymerasen der Eukaryoten Cis- und trans-aktive Elemente Promotoren Transkriptionsfaktoren

Mehr

KV: Genexpression und Transkription Michael Altmann

KV: Genexpression und Transkription Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Genexpression und Transkription Michael Altmann Herbstsemester 2008/2009 Übersicht VL Genexpression / Transkription 1.) Was ist ein Gen? 2.) Welche Arten

Mehr

Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem

Mehr

Neuer Gentest für erbliche Augenerkrankung

Neuer Gentest für erbliche Augenerkrankung Gesellschaft zur Förderung Kynologischer Forschung Abschlussbericht Neuer Gentest für erbliche Augenerkrankung aus der gkf-info 34 Dezember 2011 Info 33 Dezember 2011 Grußwort Abschlussbericht Neuer Gentest

Mehr

Genannotation bei Prokaryoten

Genannotation bei Prokaryoten Genannotation bei Prokaryoten Maike Tech Abt. Bioinformatik Institut für Mikrobiologie und Genetik (IMG) Universität Göttingen 28. November 2005 Genetik von Pro- und Eukaryoten Eukaryoten Prokaryoten Zellkern

Mehr

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz 1. Nennen Sie die verschiedenen RNA-Typen, die bei der Translation wichtig sind. Erklären Sie die Funktion der verschiedenen RNA-Typen. Skizzieren Sie die Struktur der verschiedenen RNA-Typen und bezeichnen

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen.

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. Kapitel 9 Genetische Variation Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. 9a Genetische Variation

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 3. Aus welchen vier Nukleotiden ist RNA aufgebaut? 4. DNA RNA 5. Ein Wissenschaftler

Mehr

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin

Mehr

Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide

Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide O:/Wiley/Reihe_verdammt_klever/Fletcher/3d/c01.3d from 15.08.2013 17:16:38 1 Molekulargenetik 1 In diesem Kapitel geht es um diese Themen: DNA-Struktur Gene Der genetische Code Von der DNA zum Protein

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen

MOL.504 Analyse von DNA- und Proteinsequenzen MOL.504 Analyse von DNA- und Proteinsequenzen Kurs 1 Monika Oberer, Karl Gruber MOL.504 Modul-Übersicht Einführung, Datenbanken BLAST-Suche, Sequenzalignment Proteinstrukturen Virtuelles Klonieren Abschlusstest

Mehr

Informationsgehalt von DNA

Informationsgehalt von DNA Informationsgehalt von DNA Topics Genes code, gene organisation, signals, gene detection Genomes genome organisation, nucleotide patterns, junk DNA DNA als Informationsträger DNA Building Blocks Desoxyribose

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Vorbemerkung für die Erlangung des Testats: Bearbeiten Sie die unten gestellten Aufgaben

Mehr