Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Größe: px
Ab Seite anzeigen:

Download "Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014"


1 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 ( ) 1) Von der DNA-Sequenz zum Protein Sie können diese Aufgabe auch interaktiv auf folgender Webseite lösen: Gehen Sie zu dem Punkt Problem a) Es ist Ihre Aufgabe, ein Gen zu sequenzieren, von dem noch keine Aminosäuresequenz bekannt ist. Sie sequenzieren nach der Sanger-Methode. Das folgende Bild zeigt das Autoradiogramm eines Ihrer ersten Sequenzgele. Lesen Sie die gesamte Sequenz und schreiben Sie Ihr Ergebnis in die entsprechenden Zeilen der Tabellen des folgenden Aufgabenblatts. 1

2 b) Schreiben Sie nun darunter den komplementären Strang. Beschriften Sie alle 5 - und 3 -Enden. c) Nehmen Sie an, dass der DNA-Strang in der 2. Zeile den Matrizenstrang darstellt. Übersetzen Sie diesen in RNA. Schreiben Sie die RNA-Sequenz in die dritte Zeile. Vergessen Sie nicht, die 5 - und 3 -Enden zu beschriften. 2

3 d) Benutzen Sie die Codesonne aus der 5. Übungsstunde und übersetzen Sie die ersten 20 Nukleotide der RNA. Welche der folgenden Aminosäuresequenzen finden Sie? (Einbuchstabencode siehe unten!) (1) T A D V E L (2) L L M L N Stop (3) C Stop C Stop I R (4) alle oben genannten (5) keine der oben genannten e) Bedenken Sie, dass Sie nicht wissen, welcher Strang der Matrizenstrang Ihres Gens ist. Sie müssten somit auch auf dem Gegenstrang nach möglichen offenen Leserahmen suchen. Welche der folgenden RNA-Sequenzen könnten theoretisch auch gebildet werden? (1) 5 UUAACGCGUGCCUCUGGUCU 3 (2) 5 TTAACGCGTGCCTCTGGTCT 3 (3) 5 UGACGACUACAACUUAAUCU 3 f) Im Folgenden ist das Ergebnis Ihrer Suche nach offenen Leserahmen auf beiden DNA-Strängen dargestellt. Leserahmen 1: T A D V E L Leserahmen 2: L L M L N Stop Leserahmen 3: C Stop C Stop I R Leserahmen 4: L T R A S G L Leserahmen 5: Stop R V P L V Stop Leserahmen 6: N A C L W S I Welche/n Leserahmen würden Sie mit dem Ziel, Ihr gesuchtes Gen zu identifizieren, weiter untersuchen? Einbuchstabencode der Aminosäuren: 3

4 2)Transkription und Translation A) Sie haben die nachfolgende DNA vorliegen, welche die Sequenz eines eukaryotischen Gens enthält. Die Transkription beginnt mit dem hervorgehobenen A/T Paar an Position 11 und läuft von dort nach rechts. Wie lautet die Sequenz des kodierten Proteins im Einbuchstabencode? Kennzeichnen Sie die Amino- und Carboxyenden. Benutzen Sie die Codesonne aus der 5. Übungsstunde und den o.a. Einbuchstabencode der Aminosäuren. B) Sie haben die nachfolgende DNA vorliegen, welche die Sequenz eines eukaryotischen Gens enthält. Die Transkription beginnt mit dem hervorgehobenen A/T Paar an Position 6 und läuft von dort nach rechts. Das Splicen der mrna erfolgt gemäß der GT- AG Regel. Demnach beginnt das 5 Ende des Introns mit GT und endet am 3 Ende mit AG. (I) Wie lautet die Sequenz des 5 untranslatierten Bereichs der mrna? Kennzeichnen Sie 5 und 3 Enden der mrna. (II) Wie lautet die Sequenz des von der reifen mrna kodierten Proteins im Einbuchstabencode? Kennzeichnen Sie die Amino- und Carboxyenden des Proteins. 4

5 (III) Wie lautet die Sequenz des Proteins im Einbuchstabencode, die nach einer Punktmutation des T/A Paares an Stelle 27 (fett markiert) zu einem C/G Paar gebildet wird? Kennzeichnen Sie die Amino- und Carboxyenden des Proteins. (IV) Um was für einen Typ von Nukleotid-Austausch handelt es sich hierbei? 5

6 3) Wiederholung Ordnen Sie die unten aufgelisteten Begriffe als Kürzel den folgenden Definitionen und Aussagen zu: 6

7 Liste der zuzuordnenden Begriffe: 7

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 7 (11.07-15.07.) Methoden und Techniken II 1. Sie bekommen


Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat


KV: Translation Michael Altmann

KV: Translation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Translation Michael Altmann Herbstsemester 2008/2009 Übersicht VL Translation 1.) Genexpression 2.) Der genetische Code ist universell 3.) Punktmutationen


Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email:

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,


Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund Die Suche nach Genen in Bakteriengenomen BWInf-Workshop 22.-23. März 2011 Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund 1 Bioinformatik was ist das? Aufgabe: Analyse (molekular)biologischer


Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition


KV: Genexpression und Transkription Michael Altmann

KV: Genexpression und Transkription Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Genexpression und Transkription Michael Altmann Herbstsemester 2008/2009 Übersicht VL Genexpression / Transkription 1.) Was ist ein Gen? 2.) Welche Arten


Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt 5 mrna Nukleotid 3 N-Terminus Protein C-Terminus Aminosäure Es besteht


DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 3. Aus welchen vier Nukleotiden ist RNA aufgebaut? 4. DNA RNA 5. Ein Wissenschaftler


1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3

1. Nachschreibeklausur zur Vorlesung Genetik im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3 1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A Modul: Studiengang: Matrikel-Nr.: Versuch: 1 2 3 Vollständiger Name in Druckbuchstaben (Vorname Nachname): Jena, 01.04.2010, 10 12 Uhr; Unterschrift:


Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)


DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich


KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation


2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)


1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener


Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,


Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.


8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria


RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase


DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die


Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2


Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 4 (20.06. 24.06.) Regulation der Transkription II, Translation


Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32


Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich


Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn


Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse


Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen


Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale


Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer


Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung


1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie:

1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie: 1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie: - 5 UTR (leader) - 3 UTR (trailer) - Terminator - Stopp-Kodon - Initiationskodon - Transkriptionsstartstelle


Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Vorbemerkung für die Erlangung des Testats: Bearbeiten Sie die unten gestellten Aufgaben


Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?


Hämophilie Symposium, März , Reitter Sylvia

Hämophilie Symposium, März , Reitter Sylvia Hämophilie Symposium, März 2010 FVIII-Gen liegt auf Xq28 (langer Arm des X-Chromosoms) x Hämophilie Erbgang I Hämophilie Erbgang II FVIII-Gen besteht aus 26 Exons mit 186 Kilobasenpaaren (kb); Exon 14


Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und


1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli


Gen Protein Aufgaben: Edel LK-Bio BI-3

Gen Protein Aufgaben: Edel LK-Bio BI-3 Proteinbiosynthese Von der DNA zum Protein Dieses Lernprogramm zeigt Ihnen in einem vereinfachten Modell den im Zellinneren ablaufenden Prozess vom Gen auf der DNA zum Protein. Aufgaben: 1 Betrachten Sie


Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010

Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010 Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010 Prof. Dr. Sven Rahmann 1 Team Prof. Dr. Sven Rahmann Zeit Mo 10-12; Do 8:30-10 Ort OH14, R104 Alle Informationen


Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein


S k u l p t u r e n. B i l d e r. T e x t e. H e l g a S i m m e r l e b i s B a n d 2

S k u l p t u r e n. B i l d e r. T e x t e. H e l g a S i m m e r l e b i s B a n d 2 S k u l p t u r e n B i l d e r T e x t e H e l g a S i m m e r l e 1 9 9 3 b i s 1 9 9 5 B a n d 2 S k u l p t u r e n H e l g a S i m m e r l e B i l d e r H e l g a S i m m e r l e Te x t e H e l g


Eukaryotische messenger-rna

Eukaryotische messenger-rna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende u.u. nicht-codierende Bereiche (Introns) Spleißen von prä-mrna Viele Protein-codierende Gene in Eukaryoten sind durch nicht-codierende


Spleissen Dezember 2009 Elmar Schiebel, ZMBH

Spleissen Dezember 2009 Elmar Schiebel, ZMBH Spleissen Dezember 2009 Elmar Schiebel, ZMBH Bis 1970s: Eine Gen besteht aus einem Stück doppelsträngiger DNA. Dieses einfache Bild wurde 1977 durch die Entdeckung von Richard J. Roberts (Cold Spring Harbor


IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während


R a i n e r N i e u w e n h u i z e n K a p e l l e n s t r G r e v e n T e l / F a x / e

R a i n e r N i e u w e n h u i z e n K a p e l l e n s t r G r e v e n T e l / F a x / e R a i n e r N i e u w e n h u i z e n K a p e l l e n s t r. 5 4 8 6 2 8 G r e v e n T e l. 0 2 5 7 1 / 9 5 2 6 1 0 F a x. 0 2 5 7 1 / 9 5 2 6 1 2 e - m a i l r a i n e r. n i e u w e n h u i z e n @ c


F r e i t a g, 3. J u n i

F r e i t a g, 3. J u n i F r e i t a g, 3. J u n i 2 0 1 1 L i n u x w i r d 2 0 J a h r e a l t H o l l a, i c h d a c h t e d i e L i n u x - L e u t e s i n d e i n w e n i g v e r n ü n f t i g, a b e r j e t z t g i b t e


DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von DNA- Replikation PowerPoint-Learning von Andrea Brügger Lernziele dieser Lerneinheit: 1. Sie kennen und verstehen die einzelnen Teilschritte der DNA-Replikation und können diese Teilschritte den entsprechenden


4. Genetische Mechanismen bei Bakterien

4. Genetische Mechanismen bei Bakterien 4. Genetische Mechanismen bei Bakterien 4.1 Makromoleküle und genetische Information Aufbau der DNA Phasen des Informationsflusses Vergleich der Informationsübertragung bei Pro- und Eukaryoten 4.2 Struktur


Q1 B1 KW 49. Genregulation

Q1 B1 KW 49. Genregulation Q1 B1 KW 49 Genregulation Transkription Posttranskription elle Modifikation Genregulation bei Eukaryoten Transkriptionsfaktoren (an TATA- Box) oder Silencer (verringert Transkription) und Enhancer (erhöht


Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen Aus der Reihe Daniels Genetik-Kompendium Erstellt von Daniel Röthgens Inhalt 1. Einleitung 2. RNA-Viren 3. DNA-Viren 1. Einleitung Im folgenden werden einige für die Genetik bedeutungsvolle Viren vorgestellt.



Informationsvisualisierung Informationsvisualisierung Thema: 7. Visualisierung Biologischer Daten Dozent: Dr. Dirk Zeckzer Sprechstunde: nach Vereinbarung Umfang: 2 Prüfungsfach: Modul Fortgeschrittene


Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine


Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen


Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen


27 Funktionelle Genomanalysen Sachverzeichnis

27 Funktionelle Genomanalysen Sachverzeichnis Inhaltsverzeichnis 27 Funktionelle Genomanalysen... 543 27.1 Einleitung... 543 27.2 RNA-Interferenz: sirna/shrna-screens 543 Gunter Meister 27.3 Knock-out-Technologie: homologe Rekombination im Genom der


1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist.

1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist. Die Prüfungsarbeit besteht aus drei zu bearbeitenden Teilen Aufgabe I Aufgabe II A oder II B Aufgabe III A oder III B I Aufgabe I: Humangenetik / klassische Genetik / Molekulargenetik Mukoviszidose Mukoviszidose,


Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16


Bio-Datenbanken. Einführung in die Bioinformatik

Bio-Datenbanken. Einführung in die Bioinformatik Bio-Datenbanken Einführung in die Bioinformatik Bearbeiter: Torsten Glomb Betreuer: Dr. Dieter Sosna Inhalt Einleitung I Proteine I.1 Aminosäuren I.2 Peptidbindung I.3 Primärstuktur: Sequenz der Aminosäuren


Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht


NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts


Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information


Biologie für Mediziner WS 2007/08

Biologie für Mediziner WS 2007/08 Biologie für Mediziner WS 2007/08 Teil Allgemeine Genetik, Prof. Dr. Uwe Homberg 1. Endozytose 2. Lysosomen 3. Zellkern, Chromosomen 4. Struktur und Funktion der DNA, Replikation 5. Zellzyklus und Zellteilung


Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin


Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon


6. DNA -Bakteriengenetik

6. DNA -Bakteriengenetik 6. DNA -Bakteriengenetik Konzepte: Francis Crick DNA Struktur DNA Replikation Gentransfer in Bakterien Bakteriophagen 2. Welcher der folgenden Sätze entspricht der Chargaff-Regel? A) Die Menge von Purinen


Chapter 1 : þÿ H ö c h s t e i n s a t z b e t a t h o m e c h a p t e r

Chapter 1 : þÿ H ö c h s t e i n s a t z b e t a t h o m e c h a p t e r Chapter 1 : þÿ H ö c h s t e i n s a t z b e t a t h o m e c h a p t e r þÿ w e r d e n a l s Z a h l u n g s m ö g l i c h k e i t e n v o n B e t - a t - H o m e e b e n f a l l s u n t e r s t ü t z


Vorlesung LV-Nr. 954.104. Molekularbiologie für Agrarwissenschaften. J. Glößl, SS 2007

Vorlesung LV-Nr. 954.104. Molekularbiologie für Agrarwissenschaften. J. Glößl, SS 2007 Vorlesung LV-Nr. 954.104 Molekularbiologie für Agrarwissenschaften J. Glößl, SS 2007 Thematik: Molekularbiologische Methoden Teil 1 Die ppt Folien wurden freundlicherweise von Prof. Florian Rüker aus der


Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath Grundlagen Genetik Dipl.- Psych. Silja Bellingrath Infos zur Klausur Dauer: 11/2 Stunden (maximal) Keine Noten, nur bestanden versus nicht bestanden Inhalt: Grundlage sind die Folien zum Seminar; geprüft


DNA Vom Gen zum Protein

DNA Vom Gen zum Protein 55 11215 Didaktische FWU-DVD DNA Vom Gen zum Protein Biologie Chemie Klasse 9 13 Klasse 10 13 Trailer ansehen Schlagwörter Adenin; Aminosäuren; Biochemie; Biosynthese; Chromosom; Codesonne; Cytosin; Desoxyribonukleinsäure;


Chapter 1 : þÿ b e t a t h o m e t e l c h a p t e r

Chapter 1 : þÿ b e t a t h o m e t e l c h a p t e r Chapter 1 : þÿ b e t a t h o m e t e l c h a p t e r þÿ O n l i n e B a n k ü b e r w e i s u n g, E u r o 6 0 0 0 C a r d, I D e a l, p a y s a f e c a r d, W e b m o n e y.. I a m h a v i n g t h i n


Funktion. Transkriptionsfaktor in der Ethylen-Signaltransduktion

Funktion. Transkriptionsfaktor in der Ethylen-Signaltransduktion Modifiziertes Funktion Funktionen Protein des Target Ubiquitinierung Phytochrom Polyubi.: (Ubiquitylierung) AUX/IAA EIN2 Auxin-Signaltransduktion Transkriptionsfaktor in der Ethylen-Signaltransduktion


Was ist ein genetischer Fingerabdruck?

Was ist ein genetischer Fingerabdruck? Was ist ein genetischer Fingerabdruck? Genetischer Fingerabdruck od. DNA-Fingerprint ist ein molekularbiologisches Verfahren zur individuellen Identifizierung von Lebewesen Der genetische Fingerabdruck


MOL.504 Analyse von DNA- und Proteinsequenzen. Datenbanken & Informationssysteme

MOL.504 Analyse von DNA- und Proteinsequenzen. Datenbanken & Informationssysteme MOL.504 Analyse von DNA- und Proteinsequenzen Datenbanken & Informationssysteme Inhaltsübersicht Informationsysteme National Center for Biotechnology Information (NCBI) The European Bioinformatics Institute


1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 Molekulare Struktur von NCAM S.


Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Assoc. Prof. PD Mag. Dr. Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Wien, 2013 Währinger Straße 10, A-1090 Wien


Chapter 1 : þÿ b e t a t h o m e C o d e A n g e b o t e c h a p t e r

Chapter 1 : þÿ b e t a t h o m e C o d e A n g e b o t e c h a p t e r Chapter 1 : þÿ b e t a t h o m e C o d e A n g e b o t e c h a p t e r þÿ h o m e G u t s c h e i n c o d e A n g e b o t a n z e i g e n a u f V o l l e y b a l l, R u g b y, A m e r i c a n. m a n s


Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01.

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. Thema: Eukaryotische Genregulation und RNA- Prozessierung Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. 2013 Worin unterscheiden sich die Gene bzw. die Genprodukte von Eukaryoten


Organisation und Evolution des Genoms

Organisation und Evolution des Genoms Organisation und Evolution des Genoms Organisation und Evolution des Genoms Definition Genom: vollständige DNA-Sequenz eines Organismus I. Einfachstes Genom: Prokaryoten Zwei Gruppen, evolutionär unterschiedlicher


Abschlussbericht der Projektgruppe 583

Abschlussbericht der Projektgruppe 583 Abschlussbericht der Projektgruppe 58 VATRAM VAriant Tolerant ReAd Mapper Benjamin Kramer, Jens Quedenfeld Sven Schrinner, Marcel Bargull Kada Benadjemia, Jan Stricker David Losch. März 5 Betreuer: Sven


Versuch von Beadle und Tatum Verändertes Gen -> veränderter Phänotyp

Versuch von Beadle und Tatum Verändertes Gen -> veränderter Phänotyp Versuch von Beadle und Tatum Verändertes Gen -> veränderter Phänotyp Neurospora crassa Ein-Gen-ein-Enzym Hypothese Ein-Gen-ein-Polypeptid-Hypothese Ein-Gen-ein-Genprodukt-Hypothese Purves et al. 12.1 1


Seminar zur Grundvorlesung Genetik

Seminar zur Grundvorlesung Genetik Seminar zur Grundvorlesung Genetik Wann? Gruppe B5: Donnerstags, 11 15-12 00 Wo? Raum 133 Teilnahme obligatorisch, max. 1x abwesend Kontaktdaten Marcel Quint Leibniz-Institut für Pflanzenbiochemie - Nachwuchsgruppe


Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik

Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik Termine 20.10. 2010 Reichweite der Entwicklungsgenetik 27.10. 2010 Die Festlegung der Körperachsen 03.11. 2010 Neurogenese 10.11.


Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...


Genetik für Ahnungslose

Genetik für Ahnungslose Genetik für Ahnungslose Eine Einstiegshilfe für Studierende von Michaela Aubele Mit 50 Abbildungen, 29 Tabellen S. Hirzel Verlag Stuttgart VII Inhalt Vorwort V 1 Die kleinste Einheit des Lebens - die Zelle


Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der


Fragenkatalog Informationssysteme im Gesundheitswesen ISG1 (Bioinformatik)

Fragenkatalog Informationssysteme im Gesundheitswesen ISG1 (Bioinformatik) Fragenkatalog Informationssysteme im Gesundheitswesen ISG1 (Bioinformatik) Dieser Fragenkatalog wurde anhand des Themenkatalogs erstellt. Leider fehlen einige Antworten in Teil 2, 3 und 4. Ich hoffe aber


Nukleinsäuren. 1.Theoretischer Hintergrund... 2. 1.1 Aufbau der DNA... 2. 1.2 Struktur und Replikation der DNA... 3

Nukleinsäuren. 1.Theoretischer Hintergrund... 2. 1.1 Aufbau der DNA... 2. 1.2 Struktur und Replikation der DNA... 3 Inhaltsverzeichnis 1.Theoretischer Hintergrund... 2 1.1 Aufbau der DNA... 2 1.2 Struktur und Replikation der DNA... 3 1.3 Struktur und Aufgaben der verschiedenen RNAs... 6 1.4 Methoden der Molekularbiologie...


Institut für Biochemie und Molekulare Medizin. Lecture 1 Translational components. Michael Altmann FS 2011

Institut für Biochemie und Molekulare Medizin. Lecture 1 Translational components. Michael Altmann FS 2011 Institut für Biochemie und Molekulare Medizin Lecture 1 Translational components Michael Altmann FS 2011 Gene Expression Fliessdiagramm der eukaryotischen Genexpression Die Expression eines Gens kann auf


Chapter 1 : þÿ b e t a t h o m e B o n u s g u t h a b e n z u r ü c k z i e h e n c h a p t e r

Chapter 1 : þÿ b e t a t h o m e B o n u s g u t h a b e n z u r ü c k z i e h e n c h a p t e r Chapter 1 : þÿ b e t a t h o m e B o n u s g u t h a b e n z u r ü c k z i e h e n c h a p t e r þÿ O n l i n e - G a m i n g u n d O n l i n e - S p o r t w e t t e n t ä t i g.. z u m o n e m a r k e


Aufgabe 1. Bakterien als Untersuchungsgegenstand!

Aufgabe 1. Bakterien als Untersuchungsgegenstand! Genetik I Aufgabe 1. Bakterien als Untersuchungsgegenstand 1. Beschriften Sie die Abbildung zu den Bakterien. 2. Nennen Sie Vorteile, die Bakterien wie Escherichia coli so wertvoll für die genetische Forschung


Vorlesungsthemen Mikrobiologie

Vorlesungsthemen Mikrobiologie Vorlesungsthemen Mikrobiologie 1. Einführung in die Mikrobiologie B. Bukau 2. Zellaufbau von Prokaryoten B. Bukau 3. Bakterielles Wachstum und Differenzierung B. Bukau 4. Bakterielle Genetik und Evolution


Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt


Codierung und Repräsentation

Codierung und Repräsentation Codierung und Repräsentation - Biologie - Block 4 Codierung und Repräsentation Folie: 1 Codierung: Genotyp und Phänotypebene Vier Übergänge eines evolutionären Zyklus (nach Lewontin, 1974) T 1 : Die Verteilung


Eine neue RNA-Welt. Uralte RNA-Welt Am Anfang der Entstehung des Lebens. Bekannte RNA-Welt Protein-Synthese. Neue RNA-Welt Regulatorische RNA-Moleküle

Eine neue RNA-Welt. Uralte RNA-Welt Am Anfang der Entstehung des Lebens. Bekannte RNA-Welt Protein-Synthese. Neue RNA-Welt Regulatorische RNA-Moleküle RNAs Eine neue RNA-Welt 1. Uralte RNA-Welt Am Anfang der Entstehung des Lebens Bekannte RNA-Welt Protein-Synthese Neue RNA-Welt Regulatorische RNA-Moleküle 2. Eine neue RNA-Welt die Anzahl der nicht-kodierenden


Transkription bei Pro- und Eukaryoten

Transkription bei Pro- und Eukaryoten Transkription bei Pro- und Eukaryoten Im Rahmen der Transkription liefert ein Strang der DNA die Information für die Synthese eines RNA-Stranges. Die Enzyme, die in Pro- und Eukaryotenzellen für die Transkription


A Anhang zu den 5, 6, 11-14

A Anhang zu den 5, 6, 11-14 Ordnung für die Prüfung im Masterstudiengang naturwissenschaftliche Informatik 25 A Anhang zu den 5, 6, 11-14 Das Studium gliedert sich wie folgt: Zwei bzw. drei Angleichungmodule mit insgesamt 27 LP.


Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik Frage Was sind Fachbegriffe zum Thema Grundbegriffe der Genetik? Antwort - Gene - Genotyp - Phänotyp - Genom - Dexoxyribonucleinsäure - Träger genetischer Information - Nukleotide - Basen - Peptid - Start-Codon


Algorithmen auf Sequenzen 12.04.2010

Algorithmen auf Sequenzen 12.04.2010 Algorithmen auf Sequenzen 12.04.2010 Prof. Dr. Sven Rahmann 1 Team Prof. Dr. Sven Rahmann Dipl.-Inform Tobias Marschall (Skript) Zeit Mo 8:30-10; Übungen Mi 8:30-10 ca. alle 2 Wochen (Plan!) Ort OH14,


Chapter 1 : þÿ b e t a t h o m e 5 e u r o g u t s c h e i n c h a p t e r

Chapter 1 : þÿ b e t a t h o m e 5 e u r o g u t s c h e i n c h a p t e r Chapter 1 : þÿ b e t a t h o m e 5 e u r o g u t s c h e i n c h a p t e r þÿ n e t & n b s p ;. b e l o w. a n a c c o u n t, o r d i n a r i l y y o u w o u l d g o a b o u t i n s t a l l i n g t h


Proteinbiosynthese. Prof. Dr. Albert Duschl

Proteinbiosynthese. Prof. Dr. Albert Duschl Proteinbiosynthese Prof. Dr. Albert Duschl DNA/RNA/Protein Im Bereich von Genen sind die beiden Stränge der DNA nicht funktionell äquivalent, weil nur einer der beiden Stränge transkribiert, d.h. in RNA


Einleitung. Replikation

Einleitung. Replikation (C) 2014 - SchulLV 1 von 9 Einleitung Der Action-Film von gestern Abend war wieder ziemlich spannend. Mal wieder hat es der Superheld geschafft, alle Zeichen richtig zu deuten, diverse Geheimcodes zu knacken
