Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Größe: px
Ab Seite anzeigen:

Download "Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014"

Transkript

1 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 ( ) 1) Von der DNA-Sequenz zum Protein Sie können diese Aufgabe auch interaktiv auf folgender Webseite lösen: Gehen Sie zu dem Punkt Problem a) Es ist Ihre Aufgabe, ein Gen zu sequenzieren, von dem noch keine Aminosäuresequenz bekannt ist. Sie sequenzieren nach der Sanger-Methode. Das folgende Bild zeigt das Autoradiogramm eines Ihrer ersten Sequenzgele. Lesen Sie die gesamte Sequenz und schreiben Sie Ihr Ergebnis in die entsprechenden Zeilen der Tabellen des folgenden Aufgabenblatts. 1

2 b) Schreiben Sie nun darunter den komplementären Strang. Beschriften Sie alle 5 - und 3 -Enden. c) Nehmen Sie an, dass der DNA-Strang in der 2. Zeile den Matrizenstrang darstellt. Übersetzen Sie diesen in RNA. Schreiben Sie die RNA-Sequenz in die dritte Zeile. Vergessen Sie nicht, die 5 - und 3 -Enden zu beschriften. 2

3 d) Benutzen Sie die Codesonne aus der 5. Übungsstunde und übersetzen Sie die ersten 20 Nukleotide der RNA. Welche der folgenden Aminosäuresequenzen finden Sie? (Einbuchstabencode siehe unten!) (1) T A D V E L (2) L L M L N Stop (3) C Stop C Stop I R (4) alle oben genannten (5) keine der oben genannten e) Bedenken Sie, dass Sie nicht wissen, welcher Strang der Matrizenstrang Ihres Gens ist. Sie müssten somit auch auf dem Gegenstrang nach möglichen offenen Leserahmen suchen. Welche der folgenden RNA-Sequenzen könnten theoretisch auch gebildet werden? (1) 5 UUAACGCGUGCCUCUGGUCU 3 (2) 5 TTAACGCGTGCCTCTGGTCT 3 (3) 5 UGACGACUACAACUUAAUCU 3 f) Im Folgenden ist das Ergebnis Ihrer Suche nach offenen Leserahmen auf beiden DNA-Strängen dargestellt. Leserahmen 1: T A D V E L Leserahmen 2: L L M L N Stop Leserahmen 3: C Stop C Stop I R Leserahmen 4: L T R A S G L Leserahmen 5: Stop R V P L V Stop Leserahmen 6: N A C L W S I Welche/n Leserahmen würden Sie mit dem Ziel, Ihr gesuchtes Gen zu identifizieren, weiter untersuchen? Einbuchstabencode der Aminosäuren: 3

4 2)Transkription und Translation A) Sie haben die nachfolgende DNA vorliegen, welche die Sequenz eines eukaryotischen Gens enthält. Die Transkription beginnt mit dem hervorgehobenen A/T Paar an Position 11 und läuft von dort nach rechts. Wie lautet die Sequenz des kodierten Proteins im Einbuchstabencode? Kennzeichnen Sie die Amino- und Carboxyenden. Benutzen Sie die Codesonne aus der 5. Übungsstunde und den o.a. Einbuchstabencode der Aminosäuren. B) Sie haben die nachfolgende DNA vorliegen, welche die Sequenz eines eukaryotischen Gens enthält. Die Transkription beginnt mit dem hervorgehobenen A/T Paar an Position 6 und läuft von dort nach rechts. Das Splicen der mrna erfolgt gemäß der GT- AG Regel. Demnach beginnt das 5 Ende des Introns mit GT und endet am 3 Ende mit AG. (I) Wie lautet die Sequenz des 5 untranslatierten Bereichs der mrna? Kennzeichnen Sie 5 und 3 Enden der mrna. (II) Wie lautet die Sequenz des von der reifen mrna kodierten Proteins im Einbuchstabencode? Kennzeichnen Sie die Amino- und Carboxyenden des Proteins. 4

5 (III) Wie lautet die Sequenz des Proteins im Einbuchstabencode, die nach einer Punktmutation des T/A Paares an Stelle 27 (fett markiert) zu einem C/G Paar gebildet wird? Kennzeichnen Sie die Amino- und Carboxyenden des Proteins. (IV) Um was für einen Typ von Nukleotid-Austausch handelt es sich hierbei? 5

6 3) Wiederholung Ordnen Sie die unten aufgelisteten Begriffe als Kürzel den folgenden Definitionen und Aussagen zu: 6

7 Liste der zuzuordnenden Begriffe: 7

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund Die Suche nach Genen in Bakteriengenomen BWInf-Workshop 22.-23. März 2011 Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund 1 Bioinformatik was ist das? Aufgabe: Analyse (molekular)biologischer

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt 5 mrna Nukleotid 3 N-Terminus Protein C-Terminus Aminosäure Es besteht

Mehr

1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3

1. Nachschreibeklausur zur Vorlesung Genetik im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3 1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A Modul: Studiengang: Matrikel-Nr.: Versuch: 1 2 3 Vollständiger Name in Druckbuchstaben (Vorname Nachname): Jena, 01.04.2010, 10 12 Uhr; Unterschrift:

Mehr

KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase

Mehr

Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2

Mehr

Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die

Mehr

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer

Mehr

Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

Spleissen Dezember 2009 Elmar Schiebel, ZMBH

Spleissen Dezember 2009 Elmar Schiebel, ZMBH Spleissen Dezember 2009 Elmar Schiebel, ZMBH Bis 1970s: Eine Gen besteht aus einem Stück doppelsträngiger DNA. Dieses einfache Bild wurde 1977 durch die Entdeckung von Richard J. Roberts (Cold Spring Harbor

Mehr

S k u l p t u r e n. B i l d e r. T e x t e. H e l g a S i m m e r l e b i s B a n d 2

S k u l p t u r e n. B i l d e r. T e x t e. H e l g a S i m m e r l e b i s B a n d 2 S k u l p t u r e n B i l d e r T e x t e H e l g a S i m m e r l e 1 9 9 3 b i s 1 9 9 5 B a n d 2 S k u l p t u r e n H e l g a S i m m e r l e B i l d e r H e l g a S i m m e r l e Te x t e H e l g

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während

Mehr

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung

Mehr

Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010

Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010 Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010 Prof. Dr. Sven Rahmann 1 Team Prof. Dr. Sven Rahmann Zeit Mo 10-12; Do 8:30-10 Ort OH14, R104 Alle Informationen

Mehr

4. Genetische Mechanismen bei Bakterien

4. Genetische Mechanismen bei Bakterien 4. Genetische Mechanismen bei Bakterien 4.1 Makromoleküle und genetische Information Aufbau der DNA Phasen des Informationsflusses Vergleich der Informationsübertragung bei Pro- und Eukaryoten 4.2 Struktur

Mehr

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen Aus der Reihe Daniels Genetik-Kompendium Erstellt von Daniel Röthgens Inhalt 1. Einleitung 2. RNA-Viren 3. DNA-Viren 1. Einleitung Im folgenden werden einige für die Genetik bedeutungsvolle Viren vorgestellt.

Mehr

Q1 B1 KW 49. Genregulation

Q1 B1 KW 49. Genregulation Q1 B1 KW 49 Genregulation Transkription Posttranskription elle Modifikation Genregulation bei Eukaryoten Transkriptionsfaktoren (an TATA- Box) oder Silencer (verringert Transkription) und Enhancer (erhöht

Mehr

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine

Mehr

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht

Mehr

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts

Mehr

27 Funktionelle Genomanalysen Sachverzeichnis

27 Funktionelle Genomanalysen Sachverzeichnis Inhaltsverzeichnis 27 Funktionelle Genomanalysen... 543 27.1 Einleitung... 543 27.2 RNA-Interferenz: sirna/shrna-screens 543 Gunter Meister 27.3 Knock-out-Technologie: homologe Rekombination im Genom der

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist.

1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist. Die Prüfungsarbeit besteht aus drei zu bearbeitenden Teilen Aufgabe I Aufgabe II A oder II B Aufgabe III A oder III B I Aufgabe I: Humangenetik / klassische Genetik / Molekulargenetik Mukoviszidose Mukoviszidose,

Mehr

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

6. DNA -Bakteriengenetik

6. DNA -Bakteriengenetik 6. DNA -Bakteriengenetik Konzepte: Francis Crick DNA Struktur DNA Replikation Gentransfer in Bakterien Bakteriophagen 2. Welcher der folgenden Sätze entspricht der Chargaff-Regel? A) Die Menge von Purinen

Mehr

Bio-Datenbanken. Einführung in die Bioinformatik

Bio-Datenbanken. Einführung in die Bioinformatik Bio-Datenbanken Einführung in die Bioinformatik Bearbeiter: Torsten Glomb Betreuer: Dr. Dieter Sosna Inhalt Einleitung I Proteine I.1 Aminosäuren I.2 Peptidbindung I.3 Primärstuktur: Sequenz der Aminosäuren

Mehr

Algorithmen auf Sequenzen 12.04.2010

Algorithmen auf Sequenzen 12.04.2010 Algorithmen auf Sequenzen 12.04.2010 Prof. Dr. Sven Rahmann 1 Team Prof. Dr. Sven Rahmann Dipl.-Inform Tobias Marschall (Skript) Zeit Mo 8:30-10; Übungen Mi 8:30-10 ca. alle 2 Wochen (Plan!) Ort OH14,

Mehr

Vorlesung LV-Nr. 954.104. Molekularbiologie für Agrarwissenschaften. J. Glößl, SS 2007

Vorlesung LV-Nr. 954.104. Molekularbiologie für Agrarwissenschaften. J. Glößl, SS 2007 Vorlesung LV-Nr. 954.104 Molekularbiologie für Agrarwissenschaften J. Glößl, SS 2007 Thematik: Molekularbiologische Methoden Teil 1 Die ppt Folien wurden freundlicherweise von Prof. Florian Rüker aus der

Mehr

Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen

Mehr

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath Grundlagen Genetik Dipl.- Psych. Silja Bellingrath Infos zur Klausur Dauer: 11/2 Stunden (maximal) Keine Noten, nur bestanden versus nicht bestanden Inhalt: Grundlage sind die Folien zum Seminar; geprüft

Mehr

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen

Mehr

Funktion. Transkriptionsfaktor in der Ethylen-Signaltransduktion

Funktion. Transkriptionsfaktor in der Ethylen-Signaltransduktion Modifiziertes Funktion Funktionen Protein des Target Ubiquitinierung Phytochrom Polyubi.: (Ubiquitylierung) AUX/IAA EIN2 Auxin-Signaltransduktion Transkriptionsfaktor in der Ethylen-Signaltransduktion

Mehr

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01.

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. Thema: Eukaryotische Genregulation und RNA- Prozessierung Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. 2013 Worin unterscheiden sich die Gene bzw. die Genprodukte von Eukaryoten

Mehr

Abschlussbericht der Projektgruppe 583

Abschlussbericht der Projektgruppe 583 Abschlussbericht der Projektgruppe 58 VATRAM VAriant Tolerant ReAd Mapper Benjamin Kramer, Jens Quedenfeld Sven Schrinner, Marcel Bargull Kada Benadjemia, Jan Stricker David Losch. März 5 Betreuer: Sven

Mehr

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 1.2.1.1. Molekulare Struktur von NCAM S.

Mehr

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Assoc. Prof. PD Mag. Dr. Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Wien, 2013 Währinger Straße 10, A-1090 Wien helmut.dolznig@meduniwien.ac.at www.meduniwien.ac.at/medizinische-genetik

Mehr

Fragenkatalog Informationssysteme im Gesundheitswesen ISG1 (Bioinformatik)

Fragenkatalog Informationssysteme im Gesundheitswesen ISG1 (Bioinformatik) Fragenkatalog Informationssysteme im Gesundheitswesen ISG1 (Bioinformatik) Dieser Fragenkatalog wurde anhand des Themenkatalogs erstellt. Leider fehlen einige Antworten in Teil 2, 3 und 4. Ich hoffe aber

Mehr

Organisation und Evolution des Genoms

Organisation und Evolution des Genoms Organisation und Evolution des Genoms Organisation und Evolution des Genoms Definition Genom: vollständige DNA-Sequenz eines Organismus I. Einfachstes Genom: Prokaryoten Zwei Gruppen, evolutionär unterschiedlicher

Mehr

Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik

Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik Termine 20.10. 2010 Reichweite der Entwicklungsgenetik 27.10. 2010 Die Festlegung der Körperachsen 03.11. 2010 Neurogenese 10.11.

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Transkription bei Pro- und Eukaryoten

Transkription bei Pro- und Eukaryoten Transkription bei Pro- und Eukaryoten Im Rahmen der Transkription liefert ein Strang der DNA die Information für die Synthese eines RNA-Stranges. Die Enzyme, die in Pro- und Eukaryotenzellen für die Transkription

Mehr

Codierung und Repräsentation

Codierung und Repräsentation Codierung und Repräsentation - Biologie - Block 4 Codierung und Repräsentation Folie: 1 Codierung: Genotyp und Phänotypebene Vier Übergänge eines evolutionären Zyklus (nach Lewontin, 1974) T 1 : Die Verteilung

Mehr

Eine neue RNA-Welt. Uralte RNA-Welt Am Anfang der Entstehung des Lebens. Bekannte RNA-Welt Protein-Synthese. Neue RNA-Welt Regulatorische RNA-Moleküle

Eine neue RNA-Welt. Uralte RNA-Welt Am Anfang der Entstehung des Lebens. Bekannte RNA-Welt Protein-Synthese. Neue RNA-Welt Regulatorische RNA-Moleküle RNAs Eine neue RNA-Welt 1. Uralte RNA-Welt Am Anfang der Entstehung des Lebens Bekannte RNA-Welt Protein-Synthese Neue RNA-Welt Regulatorische RNA-Moleküle 2. Eine neue RNA-Welt die Anzahl der nicht-kodierenden

Mehr

Proteinbiosynthese. Prof. Dr. Albert Duschl

Proteinbiosynthese. Prof. Dr. Albert Duschl Proteinbiosynthese Prof. Dr. Albert Duschl DNA/RNA/Protein Im Bereich von Genen sind die beiden Stränge der DNA nicht funktionell äquivalent, weil nur einer der beiden Stränge transkribiert, d.h. in RNA

Mehr

A Anhang zu den 5, 6, 11-14

A Anhang zu den 5, 6, 11-14 Ordnung für die Prüfung im Masterstudiengang naturwissenschaftliche Informatik 25 A Anhang zu den 5, 6, 11-14 Das Studium gliedert sich wie folgt: Zwei bzw. drei Angleichungmodule mit insgesamt 27 LP.

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 011 9. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (.000.000.000 Basenpaare)

Mehr

Arten der Intronen. Spliceosome Struktur des snrnp U1. Spliceosome. Vorlesung 3: Evolution des eukaryotischen Genoms 4/20/11

Arten der Intronen. Spliceosome Struktur des snrnp U1. Spliceosome. Vorlesung 3: Evolution des eukaryotischen Genoms 4/20/11 Vorlesung 3: Evolution des eukaryotischen Genoms Struktur des eukaryotischen Gens Intronen und Exonen Genduplikation--Familien des Gens Eiweißdomänen (Protein domains) Domänen und Exonen: sind sie verwandt?

Mehr

Foto:D.Höwing - im Labor werden die DNA-Abschnitte kopiert

Foto:D.Höwing - im Labor werden die DNA-Abschnitte kopiert Forschung - Genforschung: RZPD - Europas größtes Servicezentrum für funktionelle Genomforschung Das Deutsche Ressourcenzentrum (RZPD) ist Europas größtes Servicezentrum für die funktionelle Genomforschung.

Mehr

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide

Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide O:/Wiley/Reihe_verdammt_klever/Fletcher/3d/c01.3d from 15.08.2013 17:16:38 1 Molekulargenetik 1 In diesem Kapitel geht es um diese Themen: DNA-Struktur Gene Der genetische Code Von der DNA zum Protein

Mehr

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden.

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden. 03 Arbeitsauftrag Arbeitsauftrag Ziel: Anhand des Foliensatzes soll die Bildung und der Aufbau des Proteinhormons Insulin erklärt werden. Danach soll kurz erklärt werden, wie man künstlich Insulin herstellt.

Mehr

Eine molekulare Lösung des Hamiltonkreisproblems mit DNA

Eine molekulare Lösung des Hamiltonkreisproblems mit DNA Eine molekulare Lösung des Hamiltonkreisproblems mit DNA Seminar Molecular Computing Bild: http://creatia2013.files.wordpress.com/2013/03/dna.gif Andreas Fehn 11. Juli 2013 Gliederung 1. Problemstellung

Mehr

Chapter 1 : þÿ b e t a t h o m e k o n t a k t E - M a i l c h a p t e r

Chapter 1 : þÿ b e t a t h o m e k o n t a k t E - M a i l c h a p t e r Chapter 1 : þÿ b e t a t h o m e k o n t a k t E - M a i l c h a p t e r þÿ M a x i m a l e E i n s t e i g e r k ö n n e n s i c h d a s k l e i n e P o k e r - A B C i n d e r k o s t e n l o s z u r

Mehr

Was ist Bioinformatik?

Was ist Bioinformatik? 9. Kurstag: Bioinformatik Der Begriff "Bioinformatik" wurde 1989 erstmals von D.R. Masys im JOURNAL OF RESEARCH OF THE NATIONAL INSTITUTE OF STANDARDS AND TECHNOLOGY erwähnt. Was ist Bioinformatik? Die

Mehr

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen. Datenbanken & Informationssysteme

MOL.504 Analyse von DNA- und Proteinsequenzen. Datenbanken & Informationssysteme MOL.504 Analyse von DNA- und Proteinsequenzen Datenbanken & Informationssysteme Inhaltsübersicht Informationsysteme National Center for Biotechnology Information (NCBI) The European Bioinformatics Institute

Mehr

SCHULER WEBSITE - EINKAUF DOKUMENTE EINSTELLEN & AKTUALISIEREN

SCHULER WEBSITE - EINKAUF DOKUMENTE EINSTELLEN & AKTUALISIEREN SCHULER WEBSITE - EINKAUF DOKUMENTE EINSTELLEN & AKTUALISIEREN 1 STARTMASKE CMS FIONA ANMELDUNG Link: http://cmssrv02.schuler.de:8080/default/nps/login User: seiler PW: start1234 (bitte Passwort nach erster

Mehr

SOP: Erstellung Map im Programm Gene Construction Kit (GCK) Troubleshooting GCK Programm

SOP: Erstellung Map im Programm Gene Construction Kit (GCK) Troubleshooting GCK Programm SOP: Erstellung Map im Programm Gene Construction Kit (GCK) Troubleshooting GCK Programm Datum: 22.09.11 Im GCK kann man Voreinstellung des Layoutes vornehmen, d.h. alle neu angelegten Sequenzen werden

Mehr

VII. Inhalt. Vorwort...

VII. Inhalt. Vorwort... VII Vorwort... V 1 Physikalische und chemische Grundlagen... 1 1.1 Reaktionskinetik... 1 1.2 Reaktionsgeschwindigkeit... 1 1.3 Reaktionsordnung... 2 1.4 Energie... 3 1.4.1 Reaktionsenergie... 3 1.4.2 Enthalpie......

Mehr

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen.

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. Kapitel 9 Genetische Variation Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. 9a Genetische Variation

Mehr

Nukleinsäuren. 1.Theoretischer Hintergrund... 2. 1.1 Aufbau der DNA... 2. 1.2 Struktur und Replikation der DNA... 3

Nukleinsäuren. 1.Theoretischer Hintergrund... 2. 1.1 Aufbau der DNA... 2. 1.2 Struktur und Replikation der DNA... 3 Inhaltsverzeichnis 1.Theoretischer Hintergrund... 2 1.1 Aufbau der DNA... 2 1.2 Struktur und Replikation der DNA... 3 1.3 Struktur und Aufgaben der verschiedenen RNAs... 6 1.4 Methoden der Molekularbiologie...

Mehr

Codierung und Repräsentation. - Biologie -

Codierung und Repräsentation. - Biologie - Codierung und Repräsentation - Biologie - Codierung: Genotyp und Phänotypebene Vier Übergänge eines evolutionären Zyklus (nach Lewontin, 1974) T 1 : Die Verteilung der Genotypen G 1 wird auf die Verteilung

Mehr

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene Übung 11 Genregulation bei Prokaryoten Konzepte: Entwicklungs /gewebespezifische Genexpression Coexpression funktional überlappender Gene Positive Genregulation Negative Genregulation cis /trans Regulation

Mehr

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Es sollten mithilfe des Yeast-Two-Hybrid-Systems Proteine identifiziert werden, die mit der zytoplasmatischen Domäne von CEACAM1-4L aus

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

Transgene Organismen

Transgene Organismen Transgene Organismen Themenübersicht 1) Einführung 2) Komplementäre DNA (cdna) 3) Vektoren 4) Einschleusung von Genen in Eukaryontenzellen 5) Ausmaß der Genexpression 6) Genausschaltung (Gen-Knockout)

Mehr

RUHR-UNIVERSITÄT BOCHUM

RUHR-UNIVERSITÄT BOCHUM RUHR-UNIVERSITÄT BOCHUM Fakultät für Chemie Titel der Lehreinheit (LE) Modulpraktika Biochemie im Schwerpunkt Molekulare Biologie und Biotechnologie der Pflanzen und Mikroorganismen Molekularbiologie von

Mehr

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

Chapter 1 : þÿ b e t a t h o m e k e i n e A n z a h l u n g c h a p t e r

Chapter 1 : þÿ b e t a t h o m e k e i n e A n z a h l u n g c h a p t e r Chapter 1 : þÿ b e t a t h o m e k e i n e A n z a h l u n g c h a p t e r þÿ o f f i n a n c i a l s p r e a d i n g b e t t i n g a n d C F D s a t I n t e r T r a d e r D i r e c t, & n b s p ;. 9.

Mehr

Modul 10B: Übungen zur Bioinformatik. Teil 1 DNA-Sequenzanalyse und Gensuche

Modul 10B: Übungen zur Bioinformatik. Teil 1 DNA-Sequenzanalyse und Gensuche Modul 10B: Übungen zur Bioinformatik Teil 1 DNA-Sequenzanalyse und Gensuche 13.08.-17.08.2012 AG Hankeln Institut für Molekulargenetik J. J. Becherweg 30a 55128 Mainz 1. OLD SCHOOL: mit Fred Sanger zur

Mehr

Algorithmische Bioinformatik

Algorithmische Bioinformatik Algorithmische Bioinformatik Gene Finding mit Markov-Modellen Ulf Leser Wissensmanagement in der Bioinformatik Ziel der Vorlesung Einstieg in statistische Verfahren Problemstellung Statistisches Patternmatching

Mehr

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl. Molekulare Mechanismen der Signaltransduktion 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.com/modul-mms bisheriges Modell auxin auxin AXR1 auxin response AXR1 potentieller

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

Transcriptomics: Analysis of Microarrays

Transcriptomics: Analysis of Microarrays Transcriptomics: Analysis of Microarrays Dion Whitehead dion@uni-muenster.de Division of Bioinformatics, Westfälische Wilhelms Universität Münster Microarrays Vorlesungsüberblick : 1. Überblick von Microarray

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

PCR basierte- Detektionstechniken

PCR basierte- Detektionstechniken PCR basierte- Detektionstechniken Warum überhaupt? Forensische Analysen: Vaterschaftstests, Kriminalistik Mikrobielle Gemeinschaften: Biofilme, medizinische Mikrobiologie 2 Warum überhaupt? minimale Mengen

Mehr

Trennungsverfahren Techniken (in der Biologie)

Trennungsverfahren Techniken (in der Biologie) Trennungsverfahren Techniken (in der Biologie)? Biomoleküle können getrennt werden aufgrund ihrer - chemischen Eigenschaften: Ladung, Löslichkeit, Wechselwirkung mit spezifischen Reagenzen, Molmasse -

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

Mechanismen funktioneller Varianten: die Liste wächst

Mechanismen funktioneller Varianten: die Liste wächst Mechanismen funktioneller Varianten: die Liste wächst Martin Hersberger Abteilung für Klinische Chemie und Biochemie Universitäts-Kinderspital Zürich Genetische Varianten gestern Funktionelle Varianten

Mehr