Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014"

Transkript

1 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 ( ) 1) Von der DNA-Sequenz zum Protein Sie können diese Aufgabe auch interaktiv auf folgender Webseite lösen: Gehen Sie zu dem Punkt Problem a) Es ist Ihre Aufgabe, ein Gen zu sequenzieren, von dem noch keine Aminosäuresequenz bekannt ist. Sie sequenzieren nach der Sanger-Methode. Das folgende Bild zeigt das Autoradiogramm eines Ihrer ersten Sequenzgele. Lesen Sie die gesamte Sequenz und schreiben Sie Ihr Ergebnis in die entsprechenden Zeilen der Tabellen des folgenden Aufgabenblatts. 1

2 b) Schreiben Sie nun darunter den komplementären Strang. Beschriften Sie alle 5 - und 3 -Enden. c) Nehmen Sie an, dass der DNA-Strang in der 2. Zeile den Matrizenstrang darstellt. Übersetzen Sie diesen in RNA. Schreiben Sie die RNA-Sequenz in die dritte Zeile. Vergessen Sie nicht, die 5 - und 3 -Enden zu beschriften. 2

3 d) Benutzen Sie die Codesonne aus der 5. Übungsstunde und übersetzen Sie die ersten 20 Nukleotide der RNA. Welche der folgenden Aminosäuresequenzen finden Sie? (Einbuchstabencode siehe unten!) (1) T A D V E L (2) L L M L N Stop (3) C Stop C Stop I R (4) alle oben genannten (5) keine der oben genannten e) Bedenken Sie, dass Sie nicht wissen, welcher Strang der Matrizenstrang Ihres Gens ist. Sie müssten somit auch auf dem Gegenstrang nach möglichen offenen Leserahmen suchen. Welche der folgenden RNA-Sequenzen könnten theoretisch auch gebildet werden? (1) 5 UUAACGCGUGCCUCUGGUCU 3 (2) 5 TTAACGCGTGCCTCTGGTCT 3 (3) 5 UGACGACUACAACUUAAUCU 3 f) Im Folgenden ist das Ergebnis Ihrer Suche nach offenen Leserahmen auf beiden DNA-Strängen dargestellt. Leserahmen 1: T A D V E L Leserahmen 2: L L M L N Stop Leserahmen 3: C Stop C Stop I R Leserahmen 4: L T R A S G L Leserahmen 5: Stop R V P L V Stop Leserahmen 6: N A C L W S I Welche/n Leserahmen würden Sie mit dem Ziel, Ihr gesuchtes Gen zu identifizieren, weiter untersuchen? Einbuchstabencode der Aminosäuren: 3

4 2)Transkription und Translation A) Sie haben die nachfolgende DNA vorliegen, welche die Sequenz eines eukaryotischen Gens enthält. Die Transkription beginnt mit dem hervorgehobenen A/T Paar an Position 11 und läuft von dort nach rechts. Wie lautet die Sequenz des kodierten Proteins im Einbuchstabencode? Kennzeichnen Sie die Amino- und Carboxyenden. Benutzen Sie die Codesonne aus der 5. Übungsstunde und den o.a. Einbuchstabencode der Aminosäuren. B) Sie haben die nachfolgende DNA vorliegen, welche die Sequenz eines eukaryotischen Gens enthält. Die Transkription beginnt mit dem hervorgehobenen A/T Paar an Position 6 und läuft von dort nach rechts. Das Splicen der mrna erfolgt gemäß der GT- AG Regel. Demnach beginnt das 5 Ende des Introns mit GT und endet am 3 Ende mit AG. (I) Wie lautet die Sequenz des 5 untranslatierten Bereichs der mrna? Kennzeichnen Sie 5 und 3 Enden der mrna. (II) Wie lautet die Sequenz des von der reifen mrna kodierten Proteins im Einbuchstabencode? Kennzeichnen Sie die Amino- und Carboxyenden des Proteins. 4

5 (III) Wie lautet die Sequenz des Proteins im Einbuchstabencode, die nach einer Punktmutation des T/A Paares an Stelle 27 (fett markiert) zu einem C/G Paar gebildet wird? Kennzeichnen Sie die Amino- und Carboxyenden des Proteins. (IV) Um was für einen Typ von Nukleotid-Austausch handelt es sich hierbei? 5

6 3) Wiederholung Ordnen Sie die unten aufgelisteten Begriffe als Kürzel den folgenden Definitionen und Aussagen zu: 6

7 Liste der zuzuordnenden Begriffe: 7

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 7 (11.07-15.07.) Methoden und Techniken II 1. Sie bekommen

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund Die Suche nach Genen in Bakteriengenomen BWInf-Workshop 22.-23. März 2011 Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund 1 Bioinformatik was ist das? Aufgabe: Analyse (molekular)biologischer

Mehr

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat

Mehr

KV: Translation Michael Altmann

KV: Translation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Translation Michael Altmann Herbstsemester 2008/2009 Übersicht VL Translation 1.) Genexpression 2.) Der genetische Code ist universell 3.) Punktmutationen

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird Molekularbiologie 6c Proteinbiosynthese Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird 1 Übersicht: Vom Gen zum Protein 1. 2. 3. 2 Das Dogma

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 3. Aus welchen vier Nukleotiden ist RNA aufgebaut? 4. DNA RNA 5. Ein Wissenschaftler

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 2 (06.06. 10.06.) DNA-Schäden, Mutationen und Reparatur 1.

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

KV: Genexpression und Transkription Michael Altmann

KV: Genexpression und Transkription Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Genexpression und Transkription Michael Altmann Herbstsemester 2008/2009 Übersicht VL Genexpression / Transkription 1.) Was ist ein Gen? 2.) Welche Arten

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt 5 mrna Nukleotid 3 N-Terminus Protein C-Terminus Aminosäure Es besteht

Mehr

RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3

1. Nachschreibeklausur zur Vorlesung Genetik im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3 1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A Modul: Studiengang: Matrikel-Nr.: Versuch: 1 2 3 Vollständiger Name in Druckbuchstaben (Vorname Nachname): Jena, 01.04.2010, 10 12 Uhr; Unterschrift:

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Transkription Teil 2. - Transkription bei Eukaryoten -

Transkription Teil 2. - Transkription bei Eukaryoten - Transkription Teil 2 - Transkription bei Eukaryoten - Inhalte: Unterschiede in der Transkription von Pro- und Eukaryoten Die RNA-Polymerasen der Eukaryoten Cis- und trans-aktive Elemente Promotoren Transkriptionsfaktoren

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 4 (20.06. 24.06.) Regulation der Transkription II, Translation

Mehr

Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

Inhalt Genexpression Microarrays E-Northern

Inhalt Genexpression Microarrays E-Northern Inhalt Genexpression Microarrays E-Northern Genexpression Übersicht Definition Proteinbiosynthese Ablauf Transkription Translation Transport Expressionskontrolle Genexpression: Definition Realisierung

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die

Mehr

Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung

Mehr

Thematik der molekularen Zellbiologie Studienjahr 2004/05. I. Semester

Thematik der molekularen Zellbiologie Studienjahr 2004/05. I. Semester Thematik der molekularen Zellbiologie Studienjahr 2004/05 (Abkürzungen: V. = 45 Min. Vorlesung, S. = 45 Min. Seminar, ds. = doppeltes, 2 x 45 Min. Seminar, Ü. = 90 Min. Übung) I. Semester 1. Woche: d 1.

Mehr

Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2

Mehr

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten.

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Wie bezeichnet man den Strang der DNA- Doppelhelix, der die

Mehr

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit in der Nucleotidsequenz der DNA verschlüsselt (codiert)

Mehr

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

Spleissen Dezember 2009 Elmar Schiebel, ZMBH

Spleissen Dezember 2009 Elmar Schiebel, ZMBH Spleissen Dezember 2009 Elmar Schiebel, ZMBH Bis 1970s: Eine Gen besteht aus einem Stück doppelsträngiger DNA. Dieses einfache Bild wurde 1977 durch die Entdeckung von Richard J. Roberts (Cold Spring Harbor

Mehr

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer

Mehr

Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale

Mehr

1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie:

1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie: 1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie: - 5 UTR (leader) - 3 UTR (trailer) - Terminator - Stopp-Kodon - Initiationskodon - Transkriptionsstartstelle

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Vorbemerkung für die Erlangung des Testats: Bearbeiten Sie die unten gestellten Aufgaben

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Hämophilie Symposium, März , Reitter Sylvia

Hämophilie Symposium, März , Reitter Sylvia Hämophilie Symposium, März 2010 FVIII-Gen liegt auf Xq28 (langer Arm des X-Chromosoms) x Hämophilie Erbgang I Hämophilie Erbgang II FVIII-Gen besteht aus 26 Exons mit 186 Kilobasenpaaren (kb); Exon 14

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name Starzinski-Powitz, 6 Fragen, 53 Punkte Name Frage 1 8 Punkte Nennen Sie 2 Möglichkeiten, wie der Verlust von Heterozygotie bei Tumorsuppressorgenen (Z.B. dem Retinoblastomgen) zum klompletten Funktionsverlust

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Schreibe ein Programm, das den AT Gehalt diese DNA Sequenz berechnet. Hinweis: A-Gehalt plus T-Gehalt bezogen auf die gesamte Sequenz.

Schreibe ein Programm, das den AT Gehalt diese DNA Sequenz berechnet. Hinweis: A-Gehalt plus T-Gehalt bezogen auf die gesamte Sequenz. 1 Einführung Keine Übungen 2 Python - Zeichenketten - "Strings" (1. Tag) 2.1 AT Gehalt berechnen Berechne aus der folgenden DNA Sequenz den AT-Gehalt. GAGATTTCTTTATTACAATCACTGTGTTTGTTAAAATACCTGCNTCACTTGGTTGTTCTTCAATAACACCAACTTA

Mehr

Gen Protein Aufgaben: Edel LK-Bio BI-3

Gen Protein Aufgaben: Edel LK-Bio BI-3 Proteinbiosynthese Von der DNA zum Protein Dieses Lernprogramm zeigt Ihnen in einem vereinfachten Modell den im Zellinneren ablaufenden Prozess vom Gen auf der DNA zum Protein. Aufgaben: 1 Betrachten Sie

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010

Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010 Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010 Prof. Dr. Sven Rahmann 1 Team Prof. Dr. Sven Rahmann Zeit Mo 10-12; Do 8:30-10 Ort OH14, R104 Alle Informationen

Mehr

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen

Mehr

Vertiefendes Seminar zur Vorlesung Biochemie I

Vertiefendes Seminar zur Vorlesung Biochemie I Vertiefendes Seminar zur Vorlesung Biochemie I 30.01.2015 Klausurvorbereitung: Gerhild van Echten-Deckert Rekombinante DNA Fon. +49-228-732703 Homepage: http://www.limes.uni-bonn.de Klärung einiger Begriffe:

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

S k u l p t u r e n. B i l d e r. T e x t e. H e l g a S i m m e r l e b i s B a n d 2

S k u l p t u r e n. B i l d e r. T e x t e. H e l g a S i m m e r l e b i s B a n d 2 S k u l p t u r e n B i l d e r T e x t e H e l g a S i m m e r l e 1 9 9 3 b i s 1 9 9 5 B a n d 2 S k u l p t u r e n H e l g a S i m m e r l e B i l d e r H e l g a S i m m e r l e Te x t e H e l g

Mehr

Q1 B1 KW 49. Genregulation

Q1 B1 KW 49. Genregulation Q1 B1 KW 49 Genregulation Transkription Posttranskription elle Modifikation Genregulation bei Eukaryoten Transkriptionsfaktoren (an TATA- Box) oder Silencer (verringert Transkription) und Enhancer (erhöht

Mehr

Eukaryotische messenger-rna

Eukaryotische messenger-rna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende u.u. nicht-codierende Bereiche (Introns) Spleißen von prä-mrna Viele Protein-codierende Gene in Eukaryoten sind durch nicht-codierende

Mehr

6. DNA -Bakteriengenetik

6. DNA -Bakteriengenetik 6. DNA -Bakteriengenetik Konzepte: Francis Crick DNA Struktur DNA Replikation Gentransfer in Bakterien Bakteriophagen 2. Welcher der folgenden Sätze entspricht der Chargaff-Regel? A) Die Menge von Purinen

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

Formale Methoden in der Informatik Wiederholung klassische Logik Konkrete Datentypen (algebraische Strukturen) Abstrakte Datentypen

Formale Methoden in der Informatik Wiederholung klassische Logik Konkrete Datentypen (algebraische Strukturen) Abstrakte Datentypen Was bisher geschah Formale Methoden in der Informatik Wiederholung klassische Logik Konkrete Datentypen (algebraische Strukturen) Abstrakte Datentypen Syntax: Signatur Semantik: Axiome (FOL-Formeln, meist

Mehr

R a i n e r N i e u w e n h u i z e n K a p e l l e n s t r G r e v e n T e l / F a x / e

R a i n e r N i e u w e n h u i z e n K a p e l l e n s t r G r e v e n T e l / F a x / e R a i n e r N i e u w e n h u i z e n K a p e l l e n s t r. 5 4 8 6 2 8 G r e v e n T e l. 0 2 5 7 1 / 9 5 2 6 1 0 F a x. 0 2 5 7 1 / 9 5 2 6 1 2 e - m a i l r a i n e r. n i e u w e n h u i z e n @ c

Mehr

F r e i t a g, 3. J u n i

F r e i t a g, 3. J u n i F r e i t a g, 3. J u n i 2 0 1 1 L i n u x w i r d 2 0 J a h r e a l t H o l l a, i c h d a c h t e d i e L i n u x - L e u t e s i n d e i n w e n i g v e r n ü n f t i g, a b e r j e t z t g i b t e

Mehr

L 3. L a 3. P a. L a m 3. P a l. L a m a 3. P a l m. P a l m e. P o 4. P o p 4. L a. P o p o 4. L a m. Agnes Klawatsch

L 3. L a 3. P a. L a m 3. P a l. L a m a 3. P a l m. P a l m e. P o 4. P o p 4. L a. P o p o 4. L a m. Agnes Klawatsch 1 L 3 P 1 L a 3 P a 1 L a m 3 P a l 1 L a m a 3 P a l m 2 P 3 P a l m e 2 P o 4 L 2 P o p 4 L a 2 P o p o 4 L a m 4 L a m p 6 N a 4 L a m p e 6 N a m 5 5 A A m 6 6 N a m e N a m e n 5 A m p 7 M 5 A m p

Mehr

DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet

Mehr

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen Aus der Reihe Daniels Genetik-Kompendium Erstellt von Daniel Röthgens Inhalt 1. Einleitung 2. RNA-Viren 3. DNA-Viren 1. Einleitung Im folgenden werden einige für die Genetik bedeutungsvolle Viren vorgestellt.

Mehr

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von DNA- Replikation PowerPoint-Learning von Andrea Brügger Lernziele dieser Lerneinheit: 1. Sie kennen und verstehen die einzelnen Teilschritte der DNA-Replikation und können diese Teilschritte den entsprechenden

Mehr

1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist.

1. Stammbaum einer Familie, in der Mukoviszidose aufgetreten ist. Die Prüfungsarbeit besteht aus drei zu bearbeitenden Teilen Aufgabe I Aufgabe II A oder II B Aufgabe III A oder III B I Aufgabe I: Humangenetik / klassische Genetik / Molekulargenetik Mukoviszidose Mukoviszidose,

Mehr

27 Funktionelle Genomanalysen Sachverzeichnis

27 Funktionelle Genomanalysen Sachverzeichnis Inhaltsverzeichnis 27 Funktionelle Genomanalysen... 543 27.1 Einleitung... 543 27.2 RNA-Interferenz: sirna/shrna-screens 543 Gunter Meister 27.3 Knock-out-Technologie: homologe Rekombination im Genom der

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen. Datenbanken & Informationssysteme

MOL.504 Analyse von DNA- und Proteinsequenzen. Datenbanken & Informationssysteme MOL.504 Analyse von DNA- und Proteinsequenzen Datenbanken & Informationssysteme Inhaltsübersicht Informationsysteme National Center for Biotechnology Information (NCBI) The European Bioinformatics Institute

Mehr

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht

Mehr

4. Genetische Mechanismen bei Bakterien

4. Genetische Mechanismen bei Bakterien 4. Genetische Mechanismen bei Bakterien 4.1 Makromoleküle und genetische Information Aufbau der DNA Phasen des Informationsflusses Vergleich der Informationsübertragung bei Pro- und Eukaryoten 4.2 Struktur

Mehr

Promotor kodierende Sequenz Terminator

Promotor kodierende Sequenz Terminator 5.2 Genexpression Sequenz in eine RNA-Sequenz. Die Enzyme, die diese Reaktion katalysieren, sind die DNA-abhängigen RNA-Polymerasen. Sie bestehen aus mehreren Untereinheiten, die von den Pro- bis zu den

Mehr

Genaktivierung und Genexpression

Genaktivierung und Genexpression Genaktivierung und Genexpression Unter Genexpression versteht man ganz allgemein die Ausprägung des Genotyps zum Phänotyp einer Zelle oder eines ganzen Organismus. Genotyp: Gesamtheit der Informationen

Mehr

Fotogalerie mit PWGallery in Joomla (3.4.0) erstellen

Fotogalerie mit PWGallery in Joomla (3.4.0) erstellen Fotogalerie mit PWGallery in Joomla (3.4.0) erstellen Als ersten Schritt müssen wir alle Fotos die in die Galerie sollen hochladen. Wir gehen davon aus, dass das Plugin PWGallery bereits installiert und

Mehr

Was ist ein genetischer Fingerabdruck?

Was ist ein genetischer Fingerabdruck? Was ist ein genetischer Fingerabdruck? Genetischer Fingerabdruck od. DNA-Fingerprint ist ein molekularbiologisches Verfahren zur individuellen Identifizierung von Lebewesen Der genetische Fingerabdruck

Mehr

Posttranskriptionale RNA-Prozessierung

Posttranskriptionale RNA-Prozessierung Posttranskriptionale RNA-Prozessierung Spaltung + Modifikation G Q Spleissen + Editing U UUU Prozessierung einer prä-trna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende

Mehr

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.)

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.) Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen Die verschiedenen Ribosomen-Komplexe können im Elektronenmikroskop beobachtet werden Durch Röntgenkristallographie wurden

Mehr

Übungen zu Einführung in die Informatik: Programmierung und Software-Entwicklung: Lösungsvorschlag

Übungen zu Einführung in die Informatik: Programmierung und Software-Entwicklung: Lösungsvorschlag Ludwig-Maximilians-Universität München WS 2015/16 Institut für Informatik Übungsblatt 13 Prof. Dr. R. Hennicker, A. Klarl Übungen zu Einführung in die Informatik: Programmierung und Software-Entwicklung:

Mehr

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz 1. Nennen Sie die verschiedenen RNA-Typen, die bei der Translation wichtig sind. Erklären Sie die Funktion der verschiedenen RNA-Typen. Skizzieren Sie die Struktur der verschiedenen RNA-Typen und bezeichnen

Mehr

Transkription und Translation sind in Eukaryoten räumlich und zeitlich getrennt. Abb. aus Stryer (5th Ed.)

Transkription und Translation sind in Eukaryoten räumlich und zeitlich getrennt. Abb. aus Stryer (5th Ed.) Transkription und Translation sind in Eukaryoten räumlich und zeitlich getrennt Die Initiation der Translation bei Eukaryoten Der eukaryotische Initiationskomplex erkennt zuerst das 5 -cap der mrna und

Mehr

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren...

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... Molekulargenetik Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... 2 Beschreiben, wie die DNA aufgebaut ist... 3 Den Ablauf der Replikation erklären und dabei die

Mehr

Informationsvisualisierung

Informationsvisualisierung Informationsvisualisierung Thema: 7. Visualisierung Biologischer Daten Dozent: Dr. Dirk Zeckzer zeckzer@informatik.uni-leipzig.de Sprechstunde: nach Vereinbarung Umfang: 2 Prüfungsfach: Modul Fortgeschrittene

Mehr

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts

Mehr

BCDS - Biochemische Datenbanken und Software

BCDS - Biochemische Datenbanken und Software BCDS - Biochemische Datenbanken und Software Seminarinhalte Bioinformatische Genom- und Proteomanalyse Literaturrecherche und Zitation Naturwissenschaftliche Software Termine 25. Mai, 1. Juni, 8. Juni,

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 1.2.1.1. Molekulare Struktur von NCAM S.

Mehr

Tutorial: Gnumeric installieren und Jahres-Kostenübersicht erstellen mit Diagramm

Tutorial: Gnumeric installieren und Jahres-Kostenübersicht erstellen mit Diagramm Gnumeric Mittwoch, 8. Mai 2013 01:05 Tutorial: Gnumeric installieren und Jahres-Kostenübersicht erstellen mit Diagramm In diesem Tutorial will ich Ihnen zeigen, wie man Gnumeric installiert und wie man

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

A Anhang zu den 5, 6, 11-14

A Anhang zu den 5, 6, 11-14 Ordnung für die Prüfung im Masterstudiengang naturwissenschaftliche Informatik 25 A Anhang zu den 5, 6, 11-14 Das Studium gliedert sich wie folgt: Zwei bzw. drei Angleichungmodule mit insgesamt 27 LP.

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Erarbeitung der Proteinbiosynthese in einem Gruppenpuzzle

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Erarbeitung der Proteinbiosynthese in einem Gruppenpuzzle Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Erarbeitung der Proteinbiosynthese in einem Gruppenpuzzle Das komplette finden Sie hier: School-Scout.de Reihe 5 S LEK Glossar Mediothek

Mehr

Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16

Mehr

Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik

Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik Termine 20.10. 2010 Reichweite der Entwicklungsgenetik 27.10. 2010 Die Festlegung der Körperachsen 03.11. 2010 Neurogenese 10.11.

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Informationsgehalt von DNA

Informationsgehalt von DNA Informationsgehalt von DNA Welche Themen werden behandelt? Gene Code, Genorganisation Signale in DNA Detektion von Genen Genome Genomorganisation Nukleotidmuster Junk DNA 2 DNA als Informationsträger 3

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Ideen der Informatik Suchen und Sortieren [Ordnung muss sein ] Kurt Mehlhorn Adrian Neumann viele Folien von Kostas Panagiotou

Ideen der Informatik Suchen und Sortieren [Ordnung muss sein ] Kurt Mehlhorn Adrian Neumann viele Folien von Kostas Panagiotou Ideen der Informatik Suchen und Sortieren [Ordnung muss sein ] Kurt Mehlhorn Adrian Neumann viele Folien von Kostas Panagiotou Suchen Welche Telefonnummer hat Kurt Mehlhorn? Wie schreibt man das Wort Equivalenz?

Mehr

Christian Thoma: Schnelle Regulation durch Translationskontrolle

Christian Thoma: Schnelle Regulation durch Translationskontrolle Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/christian-thoma-schnelleregulation-durch-translationskontrolle/ Christian Thoma: Schnelle Regulation durch Translationskontrolle

Mehr