Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen /

Größe: px
Ab Seite anzeigen:

Download "Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de"

Transkript

1 Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen /

2 DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin, Cytosin, Guanin und Thymin Basenpaarungen (Wasserstoffbrücken) C G A = T forward Strand ( ) reverse Strand ( ) 2

3 Veränderungen im Genom: Genommutation Veränderung der Zahl der Chromosomen 3

4 Veränderungen im Genom: Chromosomenmutation Strukturelle Variationen: Deletion Duplikation, Copy Number Variation Inversion Translokation, Insertion 4

5 Veränderungen im Genom: Genmutation Punktmutationen: Substitution, Single Nucleotide Polymorphism (SNP) Rastermutation: Deletion oder Insertion einer Base, d.h. Verschiebung des Leserasters Transition: C T (Pyrimidin) A G (Purin) Transversion: C G A T 5

6 Leseraster / Reading Frame kodierende Regionen im Genom können in Proteine übersetzt werden Transkription: DNA mrna Translation: mrna Protein entsprechend dem Triplett- Code werden jeweils 3 Basen in 1 Aminosäure übersetzt ein Stopp-Codon beendet die Übersetzung Offenes Leseraster: Region zwischen einem Startund einem Stopp-Codon 6

7 Punktmutationen ACGTCGCGAGATCGCTCGCTAGATAGATAGCTCGC Transversion ACGTCGCGTGATCGCTCGCTAGATAGATAGCTCGC Transition ACGTCGCGTGATCGCTCGCTAGATATATAGCTCGC Deletion AC_TCGCGTGATCGCTCGCTAGATATATAGCTCGC Insertion ACTCGCGTGATCGCTCTGCTAGATATATAGCTCGC Zeit 7

8 Folgen für die Zelle Punktmutation in kodierender Region: synonyme -, stille Mutation: Triplett kodiert für dieselbe Aminosäure nicht-synonyme -, sinnverändernde Mutation: Triplett kodiert für eine andere Aminosäure oder ist ein Stopp-Codon Rastermutation in kodierender Region: ab der Mutationsposition Einfügen anderer Aminosäuren bzw. Stopp-Codons in nicht-kodierenden Regionen: können regulatorische Bereiche betroffen sein 8

9 Folgen für das Individuum keine, z.b. bei stiller Mutation in kodierender Region katastrophale, z.b. wenn ein wichtiges Protein nicht mehr gebildet werden kann, d.h. das Individuum ist nicht lebensfähig positive, d.h. das Individuum hat mehr Nachkommen negative, d.h. das Individuum hat weniger Nachkommen 9

10 Zeit C G A C T G C T A G C DNA verändert sich über die Zeit wir sehen nur den heutigen Stand wir können weder in die Vergangenheit noch in die Zukunft schauen wir sehen nur erfolgreiche Veränderungen DNA hat kein Gedächtnis, d.h. eine Veränderung hat keinen Effekt auf spätere Veränderungen 10

11 Verwandtschaft / Homologie Ein Merkmal zweier oder mehrerer Taxa ist homolog, wenn es sich von demselben (oder einem entsprechenden) Merkmal ihres nächsten gemeinsamen Vorfahren ableitet. (Ernst Mayr, 1997) Speziation (Artbildung): aus einer Spezies werden zwei Spezies Duplikation (z.b. durch ungleiches Crossing over): aus einem Gen werden zwei zunächst identische Gene im Genom 11

12 Verwandtschaftsbäume zeigen Duplikationen und Speziationen 12

13 Genbäume sind geeignet, um Verwandtschaftsbeziehungen verschiedener Gene aufzuklären zeigen an den Verzweigungen Duplikationen 13

14 Speziesbäume sind geeignet, um Verwandtschaftsbeziehungen verschiedener Spezies aufzuklären zeigen an den Verzweigungen Speziationen 14

15 Outgroup wird benötigt, um eine Wurzel in den Baum einzufügen eine Wurzel ist nötig, um den Verlauf der Zeit bestimmen zu können A B Welcher gewurzelte Baum ist der richtige? C D Ungewurzelter Baum 15

16 Sequenzen, Bäume und sehr viel Zeit Deletion oder Insertion (Ausschnitt) Punktmutation Hämoglobin alpha Zeit Hämoglobin beta 16

17 Hämoglobin eisenhaltiger roter Blutfarbstoff in den roten Blutkörperchen (Erythrozyten) der Wirbeltiere transportiert (in erster Linie) Sauerstoff besteht aus 4 Untereinheiten (Heterotetramer: 2 * alpha, 2 * beta Hämoglobin) pro Untereinheit eine Hämgruppe mit zentralem Eisen weitere Informationen zum Aufbau und zur Funktionsweise unter: 17

18 Sauerstofftransport im Blut Hämgruppe Erythrozyt Hämoglobin 18

19 Sauerstoffbindung am Eisenatom der Hämgruppe Hämgruppe ohne Sauerstoff Hämgruppe mit Sauerstoff 19

20 Sauerstoffbindung am Eisenatom der Hämgruppe 20

21 Biologische Datenbanken Proteinsequenzen: Uniprot-Datenbank oder DNA-Sequenzen: EMBL-Datenbank oder Proteinstrukturen: PDB-Datenbank Komplette Genome: ENSEMBL-Datenbank 21

22 Software ClustalW bzw. ClustalX zum Vergleich von Sequenzen und Erstellen von Bäumen (Download) oder Online unter NJPlot zur Visualisierung von Bäumen (Download) Rasmol zur Visualisierung von Proteinstrukturen (Download) 22

23 Aufgabe (1) 1. Hämoglobin-alpha-Proteinsequenzen verschiedener Spezies aus der UniProtKB-Datenbank (http://srs.ebi.ac.uk)* herunterladen und in einer Textdatei abspeichern (nur komplette Sequenzen, d.h. Länge mindestens 140) 2. eine (komplette) Hämoglobin-beta-Proteinsequenz herunterladen (Outgroup zum Wurzeln des Baumes) und in einer Textdatei abspeichern 3. mit Hilfe eines Editors eine dritte Textdatei mit allen Sequenzen aus 1. und 2. erstellen 4. die Textdatei so editieren, dass jeweils hinter dem > -Zeichen der Name der Spezies steht (dabei Leerzeichen durch _ ersetzen!), gefolgt von einem Leerzeichen 5. Von welchen Spezies stammen die Sequenzen? *Suche nach hemoglobin & alpha bzw. hemoglobin & beta in Description und >= 140 in Sequence length 23

24 Aufgabe (2) 1. mit dem Programm ClustalW auf der Webseite mit den Sequenzen ein Multiples Sequenzalignment erstellen, d.h. alle Sequenzen mit allen vergleichen (d.h. Sequenzdatei hochladen) 2. Alignment mit JalView (Online) ansehen 3. Können Sie Punktmutationen / Insertionen / Deletionen identifizieren? 4. Alignment (aln-datei) herunterladen und in einer Textdatei abspeichern 24

25 Aufgabe (3) 1. aus dem Alignment einen Verwandtschaftsbaum erstellen (d.h. Alignmentdatei hochladen und TREE TYPE nj) 2. Baum im Newick-Format (ph-datei) herunterladen und in einer Textdatei abspeichern 3. Visualisierungsprogramm NJPlot herunter (http://pbil.univlyon1.fr/software/njplot.html ) 4. NJPlot mit der Baumdatei aufrufen 5. Baum so anzeigen, dass die Outgroup ganz unten durch eine Kante vom Rest des Baums getrennt zu sehen ist Speziesbaum 6. Stimmen die angezeigten Verwandtschaftsverhältnisse? (siehe z.b. Tree of Life 7. Finden Sie Fische, Amphibien, Reptilien, Vögel, Säugetiere und Primaten im Baum? 25

26 Aufgabe (4) 1. verschiedene Hämoglobin-Proteinsequenzen des Menschen aus der UniProtKB-Datenbank (http://srs.ebi.ac.uk)* herunterladen und in einer Textdatei abspeichern (nur komplette Sequenzen) 2. die menschliche Myoglobin-Proteinsequenz herunterladen (Outgroup zum Wurzeln des Baumes) und in einer Textdatei abspeichern 3. eine dritte Textdatei mit allen Sequenzen aus 1. und 2. erstellen 4. die Textdatei so editieren, dass jeweils hinter dem > -Zeichen der Name der Spezies steht (dabei Leerzeichen durch _ ersetzen!), gefolgt von einem Leerzeichen 5. Welche Hämoglobine gibt es? *Suche nach hemoglobin in Description, homo sapiens in Species, >= 140 und <= 150 in Sequence length 26

27 Aufgabe (5) 1. mit dem Programm ClustalW auf der Webseite mit den Sequenzen ein Multiples Sequenzalignment erstellen, d.h. alle Sequenzen mit allen vergleichen (d.h. Sequenzdatei hochladen) 2. Alignment mit JalView (Online) ansehen 3. Können Sie Punktmutationen / Insertionen / Deletionen identifizieren? 4. Alignment (aln-datei) herunterladen und in einer Textdatei abspeichern 27

28 Aufgabe (6) 1. aus dem Alignment einen Verwandtschaftsbaum erstellen (d.h. Alignmentdatei hochladen und TREE TYPE nj) 2. Baum im Newick-Format (ph-datei) herunterladen und in einer Textdatei abspeichern 3. NJPlot mit der Baumdatei aufrufen 4. Baum so anzeigen, dass die Outgroup ganz unten durch eine Kante vom Rest des Baums getrennt zu sehen ist Genbaum 5. Können Sie feststellen, in welcher Reihenfolge Duplikationen im Genom stattgefunden haben? 28

29 Aufgabe (7) 1. im menschlichen Genom die verschiedenen Hämoglobine lokalisieren (http://www.ensembl.org/homo_sapiens/info/index) 2. Auf welchen Chromosomen in welchen Regionen liegen sie? 3. Kann man einen Zusammenhang zwischen den Duplikationen im Baum und der Lokalisation im Genom feststellen? 29

30 Aufgabe (8) 1. Proteinstruktur von Hämoglobin (2HHB)* aus der PDB- Datenbank herunterladen ( Download Files PDB File (Text)) und in einer Textdatei abspeichern 2. Rasmol mit der PDB-Datei aufrufen 3. Hämoglobin geeignet visualisieren * 30

31 Prof. Dr. Antje Krause Studiengang Bioinformatik Fachhochschule Bingen Berlinstr Bingen am Rhein Tel: 06721/

Homologie und Sequenzähnlichkeit. Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Homologie und Sequenzähnlichkeit. Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Homologie und Sequenzähnlichkeit Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Homologie Verwandtschaft aufgrund gleicher Abstammung basiert auf Speziation (Artbildung): aus einer

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Einblicke in das menschliche Genom aus Sicht der Bioinformatik Prof. Dr. Antje Krause FH Bingen a.krause@fh-bingen.de Kurzer Ausflug in die Genetik DNA (Desoxyribonukleinsäure)

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl Übung II Einführung, Teil 1 Arbeiten mit Ensembl Ensembl Genome Browser (Bereitstellung von Vielzeller Genomen) Projekt wurde 1999 initiiert Projektpartner EMBL European Bioinformatics Institute (EBI)

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen

MOL.504 Analyse von DNA- und Proteinsequenzen MOL.504 Analyse von DNA- und Proteinsequenzen Kurs 1 Monika Oberer, Karl Gruber MOL.504 Modul-Übersicht Einführung, Datenbanken BLAST-Suche, Sequenzalignment Proteinstrukturen Virtuelles Klonieren Abschlusstest

Mehr

Was ist Bioinformatik?

Was ist Bioinformatik? 9. Kurstag: Bioinformatik Der Begriff "Bioinformatik" wurde 1989 erstmals von D.R. Masys im JOURNAL OF RESEARCH OF THE NATIONAL INSTITUTE OF STANDARDS AND TECHNOLOGY erwähnt. Was ist Bioinformatik? Die

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

Veränderung der Zahl der Chromosomensätze (Polyploidisierung)

Veränderung der Zahl der Chromosomensätze (Polyploidisierung) Mutationen - Genommutationen - Chromosomenmutationen - Genmutationen (Punktmutationen) - Erkennbarkeit und Auswirkungen von Punktmutationen - neutrale Mutationen - Missense -Mutationen - Nonsense -Mutationen

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

Einblicke in das menschliche Erbgut (Genom) am Computer

Einblicke in das menschliche Erbgut (Genom) am Computer Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Binger Nacht der Wissenschaft - 16.04.2010 Das menschliche Genom ist entschlüsselt

Mehr

DATENQUALITÄT IN GENOMDATENBANKEN

DATENQUALITÄT IN GENOMDATENBANKEN DATENQUALITÄT IN GENOMDATENBANKEN Alexander Fehr 28. Januar 2004 Gliederung Motivation Biologische Grundkonzepte Genomdaten Datenproduktion und Fehler Data Cleansing 2 Motivation (1) Genomdatenbanken enthalten

Mehr

Informationsvisualisierung

Informationsvisualisierung Informationsvisualisierung Thema: 7. Visualisierung Biologischer Daten Dozent: Dr. Dirk Zeckzer zeckzer@informatik.uni-leipzig.de Sprechstunde: nach Vereinbarung Umfang: 2 Prüfungsfach: Modul Fortgeschrittene

Mehr

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während

Mehr

Informationsmaterial Resistenz gegen HIV Recherche und Analyse molekularer Daten

Informationsmaterial Resistenz gegen HIV Recherche und Analyse molekularer Daten 1 Informationsmaterial Resistenz gegen HIV Recherche und Analyse molekularer Daten (inkl. Anleitungen zur Recherche von Sequenzen mit GenBank und zur Analyse mit GeneDoc) In der Computer-basierten Version

Mehr

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund Die Suche nach Genen in Bakteriengenomen BWInf-Workshop 22.-23. März 2011 Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund 1 Bioinformatik was ist das? Aufgabe: Analyse (molekular)biologischer

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen. Modul 2 BLAST-Sequenzsuche und Sequenzvergleiche

MOL.504 Analyse von DNA- und Proteinsequenzen. Modul 2 BLAST-Sequenzsuche und Sequenzvergleiche MOL.504 Analyse von DNA- und Proteinsequenzen Modul 2 BLAST-Sequenzsuche und Sequenzvergleiche Summary Modul 1 - Datenbanken Wo finde ich die DNA Sequenz meines Zielgens? Wie erhalte ich Info aus der DNA-Datenbank

Mehr

Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16

Mehr

Bioinformatik an der FH Bingen

Bioinformatik an der FH Bingen Bioinformatik an der FH Bingen Prof. Dr. Antje Krause 05.11.2010 Wie alles begann... 1955 erste Proteinsequenz (nach 12 Jahren Arbeit) veröffentlicht (Insulin vom Rind) Frederick Sanger MALWTRLRPLLALLALWPPPPA

Mehr

Molekulare Pathologie 1: Mutationen

Molekulare Pathologie 1: Mutationen Molekulare Pathologie 1: Mutationen Peter N. Robinson Institut für medizinische Genetik Charité Universitätsmedizin Berlin 23. Juni 2008 Peter N. Robinson (Charité) Molekulare Pathologie 1 23. Juni 2008

Mehr

KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation

Mehr

Informationstechnologie in der Pflanzenzüchtung. Biocomputing in einem Züchtungsunternehmen. Andreas Menze KWS SAAT AG, Einbeck

Informationstechnologie in der Pflanzenzüchtung. Biocomputing in einem Züchtungsunternehmen. Andreas Menze KWS SAAT AG, Einbeck Informationstechnologie in der Pflanzenzüchtung Biocomputing in einem Züchtungsunternehmen Andreas Menze KWS SAAT AG, Einbeck Biocomputing in einem Züchtungsunternehmen Biocomputing Was ist das? Wozu wird

Mehr

Resistenz gegen HIV (Computer- und Internet-basierte Aufgabe)

Resistenz gegen HIV (Computer- und Internet-basierte Aufgabe) 1 Resistenz gegen HIV (Computer- und Internet-basierte Aufgabe) In den frühen 1990er Jahren zeigten verschiedene Untersuchungen, dass einige Menschen trotz wiederholten Kontaktes mit dem HI-Virus nicht

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik

Modul Biologische Grundlagen Kapitel I.2 Grundbegriffe der Genetik Frage Was sind Fachbegriffe zum Thema Grundbegriffe der Genetik? Antwort - Gene - Genotyp - Phänotyp - Genom - Dexoxyribonucleinsäure - Träger genetischer Information - Nukleotide - Basen - Peptid - Start-Codon

Mehr

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath Grundlagen Genetik Dipl.- Psych. Silja Bellingrath Infos zur Klausur Dauer: 11/2 Stunden (maximal) Keine Noten, nur bestanden versus nicht bestanden Inhalt: Grundlage sind die Folien zum Seminar; geprüft

Mehr

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held ACT/CVS neueste gendiagnostische Verfahren 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held DNA, Gene, Chromosomen DNA besteht aus den Basenpaaren Adenin - Thymin

Mehr

Phylogenetische Analyse

Phylogenetische Analyse Bioinformatik I - Uebung Phylogenetische Analyse Wenn nicht anders angegeben verwende die Standard-Einstellungen der Programme Hintergrund: Die Schwämme (Phylum Porifera) gehören zu den den ältesten lebenden

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 2 (06.06. 10.06.) DNA-Schäden, Mutationen und Reparatur 1.

Mehr

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Florian Frommlet Institut für medizinische Statistik, Medizinische Universität Wien Wien, November 2013 Einführung DNA Molekül Zwei

Mehr

Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale

Mehr

Primärstruktur. Wintersemester 2011/12. Peter Güntert

Primärstruktur. Wintersemester 2011/12. Peter Güntert Primärstruktur Wintersemester 2011/12 Peter Güntert Primärstruktur Beziehung Sequenz Struktur Proteinsequenzen, Sequenzdatenbanken Sequenzvergleich (sequence alignment) Sequenzidentität, Sequenzhomologie

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Vorbemerkung für die Erlangung des Testats: Bearbeiten Sie die unten gestellten Aufgaben

Mehr

Algorithmen auf Sequenzen 12.04.2010

Algorithmen auf Sequenzen 12.04.2010 Algorithmen auf Sequenzen 12.04.2010 Prof. Dr. Sven Rahmann 1 Team Prof. Dr. Sven Rahmann Dipl.-Inform Tobias Marschall (Skript) Zeit Mo 8:30-10; Übungen Mi 8:30-10 ca. alle 2 Wochen (Plan!) Ort OH14,

Mehr

Einführung Nukleinsäuren

Einführung Nukleinsäuren Einführung Nukleinsäuren Dr. Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Einführung 1. Semester, WiSe 2007/2008 Historischer Überblick Literatur Bilder aus: Taschenatlas

Mehr

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS)

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) N U C L E I N S Ä U R E N Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) BAUSTEINE DER NUCLEINSÄUREN Die monomeren Bausteine der Nucleinsäuren

Mehr

Individuelle Genomsequenzen Aussichten für die Tierzucht

Individuelle Genomsequenzen Aussichten für die Tierzucht Individuelle Genomsequenzen Aussichten für die Tierzucht Ruedi Fries WZW / Lehrstuhl für Tierzucht Agrarw. Symposium - 1 Auswirkungen der Genomischen Revolution auf die Tierzucht (und Pflanzenzucht) Agrarw.

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen 9.1 Welche Funktionen haben Sinneszellen und Sinnesorgan? Sinneszellen nehmen die Reize auf und wandeln die Information in elektrische Signale um. Die Sinnesorgane dienen unter anderem dazu. Beispiel Auge

Mehr

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Vererbung Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Klassische Genetik Äußeres Erscheinungsbild: Phänotypus setzt sich aus einer Reihe von Merkmalen (Phänen))

Mehr

Vorlesungsthemen Mikrobiologie

Vorlesungsthemen Mikrobiologie Vorlesungsthemen Mikrobiologie 1. Einführung in die Mikrobiologie B. Bukau 2. Zellaufbau von Prokaryoten B. Bukau 3. Bakterielles Wachstum und Differenzierung B. Bukau 4. Bakterielle Genetik und Evolution

Mehr

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine

Mehr

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht

Mehr

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien 36 4. ERGEBNISSE 4.1. Immunglobulin Gentranskripte in Hodgkinzelllinien Mit Hilfe der RT PCR untersuchten wir die Expression umgelagerter Ig Gene in den Hodgkinzelllinien L1236, L428, L591 und KM-H2 sowie

Mehr

Organisation und Evolution des Genoms

Organisation und Evolution des Genoms Organisation und Evolution des Genoms Organisation und Evolution des Genoms Definition Genom: vollständige DNA-Sequenz eines Organismus I. Einfachstes Genom: Prokaryoten Zwei Gruppen, evolutionär unterschiedlicher

Mehr

molekularen Rinderzucht

molekularen Rinderzucht Möglichkeiten der molekularen Rinderzucht Johann Sölkner Gliederung Einleitung Molekulare Marker Suche nach wichtigen Genen Molekulare Zuchtwertschätzung Auswirkung auf Zuchtprogramme Versprechen der Molekulargenetiker

Mehr

...-Arg-Met-Phe-Ala-Asn-His-Lys-Ser-Val-Gly-...

...-Arg-Met-Phe-Ala-Asn-His-Lys-Ser-Val-Gly-... 1. Im Enzym Xase, das aus einer Polypeptidkette aus 300 Aminosäuren besteht, findet sich in der Region der Aminosäuren 40-50 die folgende Aminosäurensequenz:...-Arg-Met-Phe-Ala-Asn-His-Lys-Ser-Val-Gly-...

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Bioinformatik: Schnittstelle zwischen Informatik und Life-Science

Bioinformatik: Schnittstelle zwischen Informatik und Life-Science Bioinformatik: Schnittstelle zwischen Informatik und Life-Science Andreas Zendler (PD Dr.rer.nat.Dr.phil.) GI / GChACM 12. ovember 2001 Inhaltsübersicht I. Einführung II. Bioinformatik III. Industrial

Mehr

Evolution, Genetik und Erfahrung

Evolution, Genetik und Erfahrung Chromosomen, Fortpflanzung und Genkopplung Entscheidende Entdeckung: Gene sind auf Chromosomen lokalisiert! 1 CHROMOSOM fadenförmige Strukturen im Kern der Zellen (wikipedia) Chromosomen in Körperzellen

Mehr

Stammbaum der Photorezeptoren

Stammbaum der Photorezeptoren Das Farbensehen der Vögel, Arbeitsmaterial 2 - Evolution des Farbensehens Stammbaum der Photorezeptoren AB 2-1 Arbeitsaufträge: 1. Vervollständigen Sie den Stammbaum der Photorezeptoren, indem Sie folgende

Mehr

Skript zum Kurz-Referat: Was sind Gene, was können sie? Was ist Umwelt?

Skript zum Kurz-Referat: Was sind Gene, was können sie? Was ist Umwelt? Prof. Dr. Klaus-Jürgen Tillmann/ Michael Lenz WS 2001/02 Fakultät für Pädagogik (AG 4) der Universität Bielefeld Seminar: Anlage und Umwelt: Der pädagogische Streit seit den 50er Jahren 2. Sitzung: Grundbegriffe

Mehr

Übung II. Einführung. Teil 1 Arbeiten mit Sequenzen recombinante DNA

Übung II. Einführung. Teil 1 Arbeiten mit Sequenzen recombinante DNA Übung II Einführung Teil 1 Arbeiten mit Sequenzen recombinante DNA Recombinante DNA Technologie Protein Synthese In vitro Expression Libraries Gene Transfer in Tieren und Pflanzen Recombinante DNA Technologie

Mehr

DNS-Modell Best.-Nr. 2015801

DNS-Modell Best.-Nr. 2015801 DNS-Modell Best.-Nr. 2015801 1. Produktvorstellung Ziel des Produktes Dieses Modell soll das DNS-Molekül visualisieren: es soll die Doppelspirale, Stickstoffbasen mit Wasserstoffbrückenbindung, Zucker-Phosphatskelette

Mehr

Python im Bioinformatiker-Alltag

Python im Bioinformatiker-Alltag Python im Bioinformatiker-Alltag Marcel Martin Bioinformatik für Hochdurchsatztechnologien, TU Dortmund 6. Oktober 2011 1 von 27 Worum gehts? Bioinformatik Löst Probleme in Biologie oder Medizin Teilbereich

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Übung Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli

Übung Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli 1. Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli 2. Wieviele DNA-Stränge finden sich in einem Bivalent (= ein in der Metaphase der ersten meiotischen Teilung vorliegendes

Mehr

DNA: Aufbau, Struktur und Replikation

DNA: Aufbau, Struktur und Replikation DNA: Aufbau, Struktur und Replikation Biochemie Die DNA als Träger der Erbinformation Im Genom sind sämtliche Informationen in Form von DNA gespeichert. Die Information des Genoms ist statisch, d. h. in

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen. Übungsaufgaben BLAST-Sequenzsuche und -vergleiche

MOL.504 Analyse von DNA- und Proteinsequenzen. Übungsaufgaben BLAST-Sequenzsuche und -vergleiche MOL.504 Analyse von DNA- und Proteinsequenzen Übungsaufgaben BLAST-Sequenzsuche und -vergleiche Ü6a blastn und blastx Verwenden Sie die in Übung 3 (Datenbanken) gefundene yqjm-sequenz aus Bacillus subtilis

Mehr

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14 Evolution II Molekulare Variabilität Bachelorkurs Evolutionsbiolgie II WS 2013/14 Molekulare Variabilität 1) rten der molekularen Variabilität und ihre Entstehung (rten der Mutation) 2) Wie kann man molekulare

Mehr

KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen

KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen KATA LOGO Biologie - Genetik - Vom Chromosom zum Gen Bild 1 Ausdehnung eines Chromosoms (C) 1. Besteht aus Chromatin. Das ist die DNS + Proteine 2. Chromosomen liegen im Zellkern 3. Menschliche Körperzellen

Mehr

27 Funktionelle Genomanalysen Sachverzeichnis

27 Funktionelle Genomanalysen Sachverzeichnis Inhaltsverzeichnis 27 Funktionelle Genomanalysen... 543 27.1 Einleitung... 543 27.2 RNA-Interferenz: sirna/shrna-screens 543 Gunter Meister 27.3 Knock-out-Technologie: homologe Rekombination im Genom der

Mehr

Anabole Prozesse in der Zelle

Anabole Prozesse in der Zelle Anabole Prozesse in der Zelle DNA Vermehrung RNA Synthese Protein Synthese Protein Verteilung in der Zelle Ziel: Zellteilung (Wachstum) und Differenzierung (Aufgabenteilung im Organismus). 2016 Struktur

Mehr

Seminar Biomedical Informatics

Seminar Biomedical Informatics Martin Dugas und Xiaoyi Jiang Institut für Informatik Sommersemester 2017 Organisation Vorlage: Englischsprachige Publikation Vortrag: ca. 30min + 15min Diskussion, Hand-out, Blockseminar Anfang Juni Seminararbeit:

Mehr

Prof. Dr. Antje Krause. akrause@fh-bingen.de. 05.11.08 Prof. Dr. Antje Krause

Prof. Dr. Antje Krause. akrause@fh-bingen.de. 05.11.08 Prof. Dr. Antje Krause Bioinformatiki ik an der FH Bingen Prof. Dr. Antje Krause FH Bingen akrause@fh-bingen.de 1 Was ist Bioinformatik? interdisziplinäres Fach Nutzung von Methoden der Informatik (und der Mathematik) zur Analyse

Mehr

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

BIOINFORMATIK UEBUNGEN MOLZEB SS2014

BIOINFORMATIK UEBUNGEN MOLZEB SS2014 BIOINFORMATIK UEBUNGEN MOLZEB SS2014 Dietmar Rieder icbi.at/courses/bioinformatics_lfu.html Organisatorisches Termine Übungsziele Kennlernen biologischer Datenbanken (NCBI, ) Arbeiten mit Protein und DNA/RNA

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: Einführung Übung Bitte bereiten Sie folgende Probleme vor der Übung am Mittwoch. Die Klausur

Mehr

Evolution und Entwicklung

Evolution und Entwicklung Evolution und Entwicklung Wie aus einzelnen Zellen die Menschen wurden: Phylogenese Klassische Genetik: Mendel Moderne Genetik: Watson & Crick Wie aus einer einzigen Zelle ein Mensch wird: Ontogenese Vererbung

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 011 9. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (.000.000.000 Basenpaare)

Mehr

16.3 Unterrichtsmaterialien

16.3 Unterrichtsmaterialien 16.3 Unterrichtsmterilien Vness D.l. Pfeiffer, Christine Glöggler, Stephnie Hhn und Sven Gembll Mteril 1: Alignieren von Nukleotidsequenzen für die Verwndtschftsnlyse Für eine Verwndtschftsnlyse vergleicht

Mehr

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

Sequenzen-Alignierung in der Bioinformatik

Sequenzen-Alignierung in der Bioinformatik Sequenzen-Alignierung in der Bioinformatik VO Algorithm Engineering Professor Dr. Petra Mutzel Lehrstuhl für Algorithm Engineering, LS 22. VO 23..26 Literatur für diese VO Volker Heun: Skriptum zur Vorlesung

Mehr

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher

Mehr

Die molekulare BDV. Inhalt

Die molekulare BDV. Inhalt Die molekulare BDV Biochemie Inhalt BDV = Biologische Datenverabeitung Informationen in lebenden Systemen Die Entschlüsselung des genetischen Codes Der genetische Code ist degeneriert 1 Die Weitergabe

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Der Bauplan des Lebens - unsere Erbanlagen (Klasse 9/10) Materialien im PDF-Format Das komplette Material finden Sie hier: School-Scout.de

Mehr

Biochemie Tutorium 10. Mutationen

Biochemie Tutorium 10. Mutationen Biochemie Tutorium 10 Mutationen IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2 Molekulare

Mehr

Abschlussbericht der Projektgruppe 583

Abschlussbericht der Projektgruppe 583 Abschlussbericht der Projektgruppe 58 VATRAM VAriant Tolerant ReAd Mapper Benjamin Kramer, Jens Quedenfeld Sven Schrinner, Marcel Bargull Kada Benadjemia, Jan Stricker David Losch. März 5 Betreuer: Sven

Mehr

Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus?

Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Gliederung Seminar des Ausschusses für Genetik der ZAR, Salzburg, 18.03.2010 Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Versuch einer Begriffserklärung Wie weiß man,

Mehr

Arten der Intronen. Spliceosome Struktur des snrnp U1. Spliceosome. Vorlesung 3: Evolution des eukaryotischen Genoms 4/20/11

Arten der Intronen. Spliceosome Struktur des snrnp U1. Spliceosome. Vorlesung 3: Evolution des eukaryotischen Genoms 4/20/11 Vorlesung 3: Evolution des eukaryotischen Genoms Struktur des eukaryotischen Gens Intronen und Exonen Genduplikation--Familien des Gens Eiweißdomänen (Protein domains) Domänen und Exonen: sind sie verwandt?

Mehr

Winterschool Obergurgl. Molekulare Typisierung CF-relevanter Erreger

Winterschool Obergurgl. Molekulare Typisierung CF-relevanter Erreger Winterschool Obergurgl Molekulare Typisierung CF-relevanter Erreger Barbara C. Kahl Institut für Medizinische Mikrobiologie Universitätsklinikum Münster Warum Typisierung? Individueller Patient Persistierende

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Prof. Dr. med. Brigitte Schlegelberger 670513011/15 Olaparib Zulassung in Europa: Rezidiv eines Platin-sensitiven Ovarialkarzinoms

Mehr

Grundlagen der biologischen Evolution

Grundlagen der biologischen Evolution Ausgewählte Grundlagen der biologischen Evolution Grundlagen der biologischen Evolution Chromosome und Gene Genotyp und Phänotyp Evolutionsfaktoren Epigenetik und was wir sonst noch nicht verstanden haben

Mehr

Die Universität stellt sich vor

Die Universität stellt sich vor Die Universität stellt sich vor Prof. Dr. Till Tantau. Juni Überblick Die Universität zu Lübeck Exzellente Forschung...... führt zu exzellenter Lehre Die Universität in Zahlen Studierende. Professoren

Mehr

Genetik Was ist ein Gen - Der Code des Lebens

Genetik Was ist ein Gen - Der Code des Lebens Genetik Was ist ein Gen - Der Code des Lebens A) Teilungsvorgänge 1. Körperzellen Unser Körper besteht aus ca 3 Billionen Zellen, die alle die gleiche Erbsubstanz haben. Nur wirken die Erbanlagen nicht

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Gentechnik: Dem genetischen Fingerabdruck auf der Spur Das komplette Material finden Sie hier: School-Scout.de 8.-11. Schuljahr Dipl.-Bio.

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

Aufgabe 7: Distanzbasierte Phylogenie: Neighbor Joining. Stefan Kröger, Philippe Thomas Wissensmanagement in der Bioinformatik

Aufgabe 7: Distanzbasierte Phylogenie: Neighbor Joining. Stefan Kröger, Philippe Thomas Wissensmanagement in der Bioinformatik Aufgabe 7: Distanzbasierte Phylogenie: Neighbor Joining Stefan Kröger, Philippe Thomas Wissensmanagement in der Bioinformatik Daten Wir verwenden neue Daten Die müssen sie ausnahmsweise selber suchen DNA-Sequenzen

Mehr

Mutationen im Erbgut

Mutationen im Erbgut Jeder Mensch ist anders. Bei manchen ist die Nase lang, andere haben eine Stupsnase, manche haben lange dünne Finger und wiederum andere besitzen eher kurze dicke Finger an ihren Händen. Aber einige Merkmale

Mehr

1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3

1. Nachschreibeklausur zur Vorlesung Genetik im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3 1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A Modul: Studiengang: Matrikel-Nr.: Versuch: 1 2 3 Vollständiger Name in Druckbuchstaben (Vorname Nachname): Jena, 01.04.2010, 10 12 Uhr; Unterschrift:

Mehr

Hämophilie Symposium, März , Reitter Sylvia

Hämophilie Symposium, März , Reitter Sylvia Hämophilie Symposium, März 2010 FVIII-Gen liegt auf Xq28 (langer Arm des X-Chromosoms) x Hämophilie Erbgang I Hämophilie Erbgang II FVIII-Gen besteht aus 26 Exons mit 186 Kilobasenpaaren (kb); Exon 14

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen. Übungsaufgaben Datenbanken und Informationssysteme

MOL.504 Analyse von DNA- und Proteinsequenzen. Übungsaufgaben Datenbanken und Informationssysteme MOL.504 Analyse von DNA- und Proteinsequenzen Übungsaufgaben Datenbanken und Informationssysteme Ü1 Tutorial für NCBI NCBI Nucleotide: Suche nach cellobiose dehydrogenase fungi Ü1 Tutorial für NCBI NCBI

Mehr

-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel).

-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel). Mendelsche Regeln 1 + 2 (1) Merkmale wie die Blütenfarbe können dominant-rezessiv oder intermediär vererbt werden. Bei einem intermediären Erbgang wird die Merkmalsausprägung von beiden Allelen (z. B.

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr