Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen /

Größe: px
Ab Seite anzeigen:

Download "Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de"

Transkript

1 Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen /

2 DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin, Cytosin, Guanin und Thymin Basenpaarungen (Wasserstoffbrücken) C G A = T forward Strand ( ) reverse Strand ( ) 2

3 Veränderungen im Genom: Genommutation Veränderung der Zahl der Chromosomen 3

4 Veränderungen im Genom: Chromosomenmutation Strukturelle Variationen: Deletion Duplikation, Copy Number Variation Inversion Translokation, Insertion 4

5 Veränderungen im Genom: Genmutation Punktmutationen: Substitution, Single Nucleotide Polymorphism (SNP) Rastermutation: Deletion oder Insertion einer Base, d.h. Verschiebung des Leserasters Transition: C T (Pyrimidin) A G (Purin) Transversion: C G A T 5

6 Leseraster / Reading Frame kodierende Regionen im Genom können in Proteine übersetzt werden Transkription: DNA mrna Translation: mrna Protein entsprechend dem Triplett- Code werden jeweils 3 Basen in 1 Aminosäure übersetzt ein Stopp-Codon beendet die Übersetzung Offenes Leseraster: Region zwischen einem Startund einem Stopp-Codon 6

7 Punktmutationen ACGTCGCGAGATCGCTCGCTAGATAGATAGCTCGC Transversion ACGTCGCGTGATCGCTCGCTAGATAGATAGCTCGC Transition ACGTCGCGTGATCGCTCGCTAGATATATAGCTCGC Deletion AC_TCGCGTGATCGCTCGCTAGATATATAGCTCGC Insertion ACTCGCGTGATCGCTCTGCTAGATATATAGCTCGC Zeit 7

8 Folgen für die Zelle Punktmutation in kodierender Region: synonyme -, stille Mutation: Triplett kodiert für dieselbe Aminosäure nicht-synonyme -, sinnverändernde Mutation: Triplett kodiert für eine andere Aminosäure oder ist ein Stopp-Codon Rastermutation in kodierender Region: ab der Mutationsposition Einfügen anderer Aminosäuren bzw. Stopp-Codons in nicht-kodierenden Regionen: können regulatorische Bereiche betroffen sein 8

9 Folgen für das Individuum keine, z.b. bei stiller Mutation in kodierender Region katastrophale, z.b. wenn ein wichtiges Protein nicht mehr gebildet werden kann, d.h. das Individuum ist nicht lebensfähig positive, d.h. das Individuum hat mehr Nachkommen negative, d.h. das Individuum hat weniger Nachkommen 9

10 Zeit C G A C T G C T A G C DNA verändert sich über die Zeit wir sehen nur den heutigen Stand wir können weder in die Vergangenheit noch in die Zukunft schauen wir sehen nur erfolgreiche Veränderungen DNA hat kein Gedächtnis, d.h. eine Veränderung hat keinen Effekt auf spätere Veränderungen 10

11 Verwandtschaft / Homologie Ein Merkmal zweier oder mehrerer Taxa ist homolog, wenn es sich von demselben (oder einem entsprechenden) Merkmal ihres nächsten gemeinsamen Vorfahren ableitet. (Ernst Mayr, 1997) Speziation (Artbildung): aus einer Spezies werden zwei Spezies Duplikation (z.b. durch ungleiches Crossing over): aus einem Gen werden zwei zunächst identische Gene im Genom 11

12 Verwandtschaftsbäume zeigen Duplikationen und Speziationen 12

13 Genbäume sind geeignet, um Verwandtschaftsbeziehungen verschiedener Gene aufzuklären zeigen an den Verzweigungen Duplikationen 13

14 Speziesbäume sind geeignet, um Verwandtschaftsbeziehungen verschiedener Spezies aufzuklären zeigen an den Verzweigungen Speziationen 14

15 Outgroup wird benötigt, um eine Wurzel in den Baum einzufügen eine Wurzel ist nötig, um den Verlauf der Zeit bestimmen zu können A B Welcher gewurzelte Baum ist der richtige? C D Ungewurzelter Baum 15

16 Sequenzen, Bäume und sehr viel Zeit Deletion oder Insertion (Ausschnitt) Punktmutation Hämoglobin alpha Zeit Hämoglobin beta 16

17 Hämoglobin eisenhaltiger roter Blutfarbstoff in den roten Blutkörperchen (Erythrozyten) der Wirbeltiere transportiert (in erster Linie) Sauerstoff besteht aus 4 Untereinheiten (Heterotetramer: 2 * alpha, 2 * beta Hämoglobin) pro Untereinheit eine Hämgruppe mit zentralem Eisen weitere Informationen zum Aufbau und zur Funktionsweise unter: 17

18 Sauerstofftransport im Blut Hämgruppe Erythrozyt Hämoglobin 18

19 Sauerstoffbindung am Eisenatom der Hämgruppe Hämgruppe ohne Sauerstoff Hämgruppe mit Sauerstoff 19

20 Sauerstoffbindung am Eisenatom der Hämgruppe 20

21 Biologische Datenbanken Proteinsequenzen: Uniprot-Datenbank oder DNA-Sequenzen: EMBL-Datenbank oder Proteinstrukturen: PDB-Datenbank Komplette Genome: ENSEMBL-Datenbank 21

22 Software ClustalW bzw. ClustalX zum Vergleich von Sequenzen und Erstellen von Bäumen (Download) oder Online unter NJPlot zur Visualisierung von Bäumen (Download) Rasmol zur Visualisierung von Proteinstrukturen (Download) 22

23 Aufgabe (1) 1. Hämoglobin-alpha-Proteinsequenzen verschiedener Spezies aus der UniProtKB-Datenbank (http://srs.ebi.ac.uk)* herunterladen und in einer Textdatei abspeichern (nur komplette Sequenzen, d.h. Länge mindestens 140) 2. eine (komplette) Hämoglobin-beta-Proteinsequenz herunterladen (Outgroup zum Wurzeln des Baumes) und in einer Textdatei abspeichern 3. mit Hilfe eines Editors eine dritte Textdatei mit allen Sequenzen aus 1. und 2. erstellen 4. die Textdatei so editieren, dass jeweils hinter dem > -Zeichen der Name der Spezies steht (dabei Leerzeichen durch _ ersetzen!), gefolgt von einem Leerzeichen 5. Von welchen Spezies stammen die Sequenzen? *Suche nach hemoglobin & alpha bzw. hemoglobin & beta in Description und >= 140 in Sequence length 23

24 Aufgabe (2) 1. mit dem Programm ClustalW auf der Webseite mit den Sequenzen ein Multiples Sequenzalignment erstellen, d.h. alle Sequenzen mit allen vergleichen (d.h. Sequenzdatei hochladen) 2. Alignment mit JalView (Online) ansehen 3. Können Sie Punktmutationen / Insertionen / Deletionen identifizieren? 4. Alignment (aln-datei) herunterladen und in einer Textdatei abspeichern 24

25 Aufgabe (3) 1. aus dem Alignment einen Verwandtschaftsbaum erstellen (d.h. Alignmentdatei hochladen und TREE TYPE nj) 2. Baum im Newick-Format (ph-datei) herunterladen und in einer Textdatei abspeichern 3. Visualisierungsprogramm NJPlot herunter (http://pbil.univlyon1.fr/software/njplot.html ) 4. NJPlot mit der Baumdatei aufrufen 5. Baum so anzeigen, dass die Outgroup ganz unten durch eine Kante vom Rest des Baums getrennt zu sehen ist Speziesbaum 6. Stimmen die angezeigten Verwandtschaftsverhältnisse? (siehe z.b. Tree of Life 7. Finden Sie Fische, Amphibien, Reptilien, Vögel, Säugetiere und Primaten im Baum? 25

26 Aufgabe (4) 1. verschiedene Hämoglobin-Proteinsequenzen des Menschen aus der UniProtKB-Datenbank (http://srs.ebi.ac.uk)* herunterladen und in einer Textdatei abspeichern (nur komplette Sequenzen) 2. die menschliche Myoglobin-Proteinsequenz herunterladen (Outgroup zum Wurzeln des Baumes) und in einer Textdatei abspeichern 3. eine dritte Textdatei mit allen Sequenzen aus 1. und 2. erstellen 4. die Textdatei so editieren, dass jeweils hinter dem > -Zeichen der Name der Spezies steht (dabei Leerzeichen durch _ ersetzen!), gefolgt von einem Leerzeichen 5. Welche Hämoglobine gibt es? *Suche nach hemoglobin in Description, homo sapiens in Species, >= 140 und <= 150 in Sequence length 26

27 Aufgabe (5) 1. mit dem Programm ClustalW auf der Webseite mit den Sequenzen ein Multiples Sequenzalignment erstellen, d.h. alle Sequenzen mit allen vergleichen (d.h. Sequenzdatei hochladen) 2. Alignment mit JalView (Online) ansehen 3. Können Sie Punktmutationen / Insertionen / Deletionen identifizieren? 4. Alignment (aln-datei) herunterladen und in einer Textdatei abspeichern 27

28 Aufgabe (6) 1. aus dem Alignment einen Verwandtschaftsbaum erstellen (d.h. Alignmentdatei hochladen und TREE TYPE nj) 2. Baum im Newick-Format (ph-datei) herunterladen und in einer Textdatei abspeichern 3. NJPlot mit der Baumdatei aufrufen 4. Baum so anzeigen, dass die Outgroup ganz unten durch eine Kante vom Rest des Baums getrennt zu sehen ist Genbaum 5. Können Sie feststellen, in welcher Reihenfolge Duplikationen im Genom stattgefunden haben? 28

29 Aufgabe (7) 1. im menschlichen Genom die verschiedenen Hämoglobine lokalisieren (http://www.ensembl.org/homo_sapiens/info/index) 2. Auf welchen Chromosomen in welchen Regionen liegen sie? 3. Kann man einen Zusammenhang zwischen den Duplikationen im Baum und der Lokalisation im Genom feststellen? 29

30 Aufgabe (8) 1. Proteinstruktur von Hämoglobin (2HHB)* aus der PDB- Datenbank herunterladen ( Download Files PDB File (Text)) und in einer Textdatei abspeichern 2. Rasmol mit der PDB-Datei aufrufen 3. Hämoglobin geeignet visualisieren * 30

31 Prof. Dr. Antje Krause Studiengang Bioinformatik Fachhochschule Bingen Berlinstr Bingen am Rhein Tel: 06721/

Homologie und Sequenzähnlichkeit. Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Homologie und Sequenzähnlichkeit. Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Homologie und Sequenzähnlichkeit Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Homologie Verwandtschaft aufgrund gleicher Abstammung basiert auf Speziation (Artbildung): aus einer

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Einblicke in das menschliche Genom aus Sicht der Bioinformatik Prof. Dr. Antje Krause FH Bingen a.krause@fh-bingen.de Kurzer Ausflug in die Genetik DNA (Desoxyribonukleinsäure)

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl Übung II Einführung, Teil 1 Arbeiten mit Ensembl Ensembl Genome Browser (Bereitstellung von Vielzeller Genomen) Projekt wurde 1999 initiiert Projektpartner EMBL European Bioinformatics Institute (EBI)

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen

MOL.504 Analyse von DNA- und Proteinsequenzen MOL.504 Analyse von DNA- und Proteinsequenzen Kurs 1 Monika Oberer, Karl Gruber MOL.504 Modul-Übersicht Einführung, Datenbanken BLAST-Suche, Sequenzalignment Proteinstrukturen Virtuelles Klonieren Abschlusstest

Mehr

Was ist Bioinformatik?

Was ist Bioinformatik? 9. Kurstag: Bioinformatik Der Begriff "Bioinformatik" wurde 1989 erstmals von D.R. Masys im JOURNAL OF RESEARCH OF THE NATIONAL INSTITUTE OF STANDARDS AND TECHNOLOGY erwähnt. Was ist Bioinformatik? Die

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

Veränderung der Zahl der Chromosomensätze (Polyploidisierung)

Veränderung der Zahl der Chromosomensätze (Polyploidisierung) Mutationen - Genommutationen - Chromosomenmutationen - Genmutationen (Punktmutationen) - Erkennbarkeit und Auswirkungen von Punktmutationen - neutrale Mutationen - Missense -Mutationen - Nonsense -Mutationen

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

DATENQUALITÄT IN GENOMDATENBANKEN

DATENQUALITÄT IN GENOMDATENBANKEN DATENQUALITÄT IN GENOMDATENBANKEN Alexander Fehr 28. Januar 2004 Gliederung Motivation Biologische Grundkonzepte Genomdaten Datenproduktion und Fehler Data Cleansing 2 Motivation (1) Genomdatenbanken enthalten

Mehr

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während

Mehr

Informationsmaterial Resistenz gegen HIV Recherche und Analyse molekularer Daten

Informationsmaterial Resistenz gegen HIV Recherche und Analyse molekularer Daten 1 Informationsmaterial Resistenz gegen HIV Recherche und Analyse molekularer Daten (inkl. Anleitungen zur Recherche von Sequenzen mit GenBank und zur Analyse mit GeneDoc) In der Computer-basierten Version

Mehr

Einblicke in das menschliche Erbgut (Genom) am Computer

Einblicke in das menschliche Erbgut (Genom) am Computer Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Binger Nacht der Wissenschaft - 16.04.2010 Das menschliche Genom ist entschlüsselt

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen. Modul 2 BLAST-Sequenzsuche und Sequenzvergleiche

MOL.504 Analyse von DNA- und Proteinsequenzen. Modul 2 BLAST-Sequenzsuche und Sequenzvergleiche MOL.504 Analyse von DNA- und Proteinsequenzen Modul 2 BLAST-Sequenzsuche und Sequenzvergleiche Summary Modul 1 - Datenbanken Wo finde ich die DNA Sequenz meines Zielgens? Wie erhalte ich Info aus der DNA-Datenbank

Mehr

Resistenz gegen HIV (Computer- und Internet-basierte Aufgabe)

Resistenz gegen HIV (Computer- und Internet-basierte Aufgabe) 1 Resistenz gegen HIV (Computer- und Internet-basierte Aufgabe) In den frühen 1990er Jahren zeigten verschiedene Untersuchungen, dass einige Menschen trotz wiederholten Kontaktes mit dem HI-Virus nicht

Mehr

Algorithmen auf Sequenzen 12.04.2010

Algorithmen auf Sequenzen 12.04.2010 Algorithmen auf Sequenzen 12.04.2010 Prof. Dr. Sven Rahmann 1 Team Prof. Dr. Sven Rahmann Dipl.-Inform Tobias Marschall (Skript) Zeit Mo 8:30-10; Übungen Mi 8:30-10 ca. alle 2 Wochen (Plan!) Ort OH14,

Mehr

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund Die Suche nach Genen in Bakteriengenomen BWInf-Workshop 22.-23. März 2011 Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund 1 Bioinformatik was ist das? Aufgabe: Analyse (molekular)biologischer

Mehr

KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation

Mehr

Bioinformatik an der FH Bingen

Bioinformatik an der FH Bingen Bioinformatik an der FH Bingen Prof. Dr. Antje Krause 05.11.2010 Wie alles begann... 1955 erste Proteinsequenz (nach 12 Jahren Arbeit) veröffentlicht (Insulin vom Rind) Frederick Sanger MALWTRLRPLLALLALWPPPPA

Mehr

Informationstechnologie in der Pflanzenzüchtung. Biocomputing in einem Züchtungsunternehmen. Andreas Menze KWS SAAT AG, Einbeck

Informationstechnologie in der Pflanzenzüchtung. Biocomputing in einem Züchtungsunternehmen. Andreas Menze KWS SAAT AG, Einbeck Informationstechnologie in der Pflanzenzüchtung Biocomputing in einem Züchtungsunternehmen Andreas Menze KWS SAAT AG, Einbeck Biocomputing in einem Züchtungsunternehmen Biocomputing Was ist das? Wozu wird

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath Grundlagen Genetik Dipl.- Psych. Silja Bellingrath Infos zur Klausur Dauer: 11/2 Stunden (maximal) Keine Noten, nur bestanden versus nicht bestanden Inhalt: Grundlage sind die Folien zum Seminar; geprüft

Mehr

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held ACT/CVS neueste gendiagnostische Verfahren 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held DNA, Gene, Chromosomen DNA besteht aus den Basenpaaren Adenin - Thymin

Mehr

Molekulare Pathologie 1: Mutationen

Molekulare Pathologie 1: Mutationen Molekulare Pathologie 1: Mutationen Peter N. Robinson Institut für medizinische Genetik Charité Universitätsmedizin Berlin 23. Juni 2008 Peter N. Robinson (Charité) Molekulare Pathologie 1 23. Juni 2008

Mehr

Phylogenetische Analyse

Phylogenetische Analyse Bioinformatik I - Uebung Phylogenetische Analyse Wenn nicht anders angegeben verwende die Standard-Einstellungen der Programme Hintergrund: Die Schwämme (Phylum Porifera) gehören zu den den ältesten lebenden

Mehr

Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale

Mehr

Einführung Nukleinsäuren

Einführung Nukleinsäuren Einführung Nukleinsäuren Dr. Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Einführung 1. Semester, WiSe 2007/2008 Historischer Überblick Literatur Bilder aus: Taschenatlas

Mehr

Individuelle Genomsequenzen Aussichten für die Tierzucht

Individuelle Genomsequenzen Aussichten für die Tierzucht Individuelle Genomsequenzen Aussichten für die Tierzucht Ruedi Fries WZW / Lehrstuhl für Tierzucht Agrarw. Symposium - 1 Auswirkungen der Genomischen Revolution auf die Tierzucht (und Pflanzenzucht) Agrarw.

Mehr

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen

..den Sinneszellen. zu schützen. optimal zuzuführen. die Qualität des Reizes festzustellen die Quantität des Reizes festzustellen 9.1 Welche Funktionen haben Sinneszellen und Sinnesorgan? Sinneszellen nehmen die Reize auf und wandeln die Information in elektrische Signale um. Die Sinnesorgane dienen unter anderem dazu. Beispiel Auge

Mehr

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik

Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Statistische Analyse von hochdimensionalen Daten in der Bioinformatik Florian Frommlet Institut für medizinische Statistik, Medizinische Universität Wien Wien, November 2013 Einführung DNA Molekül Zwei

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht

Mehr

Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen

Mehr

Organisation und Evolution des Genoms

Organisation und Evolution des Genoms Organisation und Evolution des Genoms Organisation und Evolution des Genoms Definition Genom: vollständige DNA-Sequenz eines Organismus I. Einfachstes Genom: Prokaryoten Zwei Gruppen, evolutionär unterschiedlicher

Mehr

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine

Mehr

DNS-Modell Best.-Nr. 2015801

DNS-Modell Best.-Nr. 2015801 DNS-Modell Best.-Nr. 2015801 1. Produktvorstellung Ziel des Produktes Dieses Modell soll das DNS-Molekül visualisieren: es soll die Doppelspirale, Stickstoffbasen mit Wasserstoffbrückenbindung, Zucker-Phosphatskelette

Mehr

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: Einführung Übung Bitte bereiten Sie folgende Probleme vor der Übung am Mittwoch. Die Klausur

Mehr

Übung II. Einführung. Teil 1 Arbeiten mit Sequenzen recombinante DNA

Übung II. Einführung. Teil 1 Arbeiten mit Sequenzen recombinante DNA Übung II Einführung Teil 1 Arbeiten mit Sequenzen recombinante DNA Recombinante DNA Technologie Protein Synthese In vitro Expression Libraries Gene Transfer in Tieren und Pflanzen Recombinante DNA Technologie

Mehr

Stammbaum der Photorezeptoren

Stammbaum der Photorezeptoren Das Farbensehen der Vögel, Arbeitsmaterial 2 - Evolution des Farbensehens Stammbaum der Photorezeptoren AB 2-1 Arbeitsaufträge: 1. Vervollständigen Sie den Stammbaum der Photorezeptoren, indem Sie folgende

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien 36 4. ERGEBNISSE 4.1. Immunglobulin Gentranskripte in Hodgkinzelllinien Mit Hilfe der RT PCR untersuchten wir die Expression umgelagerter Ig Gene in den Hodgkinzelllinien L1236, L428, L591 und KM-H2 sowie

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 011 9. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (.000.000.000 Basenpaare)

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen. Übungsaufgaben BLAST-Sequenzsuche und -vergleiche

MOL.504 Analyse von DNA- und Proteinsequenzen. Übungsaufgaben BLAST-Sequenzsuche und -vergleiche MOL.504 Analyse von DNA- und Proteinsequenzen Übungsaufgaben BLAST-Sequenzsuche und -vergleiche Ü6a blastn und blastx Verwenden Sie die in Übung 3 (Datenbanken) gefundene yqjm-sequenz aus Bacillus subtilis

Mehr

BIOINFORMATIK UEBUNGEN MOLZEB SS2014

BIOINFORMATIK UEBUNGEN MOLZEB SS2014 BIOINFORMATIK UEBUNGEN MOLZEB SS2014 Dietmar Rieder icbi.at/courses/bioinformatics_lfu.html Organisatorisches Termine Übungsziele Kennlernen biologischer Datenbanken (NCBI, ) Arbeiten mit Protein und DNA/RNA

Mehr

Anabole Prozesse in der Zelle

Anabole Prozesse in der Zelle Anabole Prozesse in der Zelle DNA Vermehrung RNA Synthese Protein Synthese Protein Verteilung in der Zelle Ziel: Zellteilung (Wachstum) und Differenzierung (Aufgabenteilung im Organismus). 2016 Struktur

Mehr

Python im Bioinformatiker-Alltag

Python im Bioinformatiker-Alltag Python im Bioinformatiker-Alltag Marcel Martin Bioinformatik für Hochdurchsatztechnologien, TU Dortmund 6. Oktober 2011 1 von 27 Worum gehts? Bioinformatik Löst Probleme in Biologie oder Medizin Teilbereich

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

Evolution, Genetik und Erfahrung

Evolution, Genetik und Erfahrung Chromosomen, Fortpflanzung und Genkopplung Entscheidende Entdeckung: Gene sind auf Chromosomen lokalisiert! 1 CHROMOSOM fadenförmige Strukturen im Kern der Zellen (wikipedia) Chromosomen in Körperzellen

Mehr

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen

Mehr

27 Funktionelle Genomanalysen Sachverzeichnis

27 Funktionelle Genomanalysen Sachverzeichnis Inhaltsverzeichnis 27 Funktionelle Genomanalysen... 543 27.1 Einleitung... 543 27.2 RNA-Interferenz: sirna/shrna-screens 543 Gunter Meister 27.3 Knock-out-Technologie: homologe Rekombination im Genom der

Mehr

Prof. Dr. Antje Krause. akrause@fh-bingen.de. 05.11.08 Prof. Dr. Antje Krause

Prof. Dr. Antje Krause. akrause@fh-bingen.de. 05.11.08 Prof. Dr. Antje Krause Bioinformatiki ik an der FH Bingen Prof. Dr. Antje Krause FH Bingen akrause@fh-bingen.de 1 Was ist Bioinformatik? interdisziplinäres Fach Nutzung von Methoden der Informatik (und der Mathematik) zur Analyse

Mehr

Übung Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli

Übung Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli 1. Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli 2. Wieviele DNA-Stränge finden sich in einem Bivalent (= ein in der Metaphase der ersten meiotischen Teilung vorliegendes

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Arten der Intronen. Spliceosome Struktur des snrnp U1. Spliceosome. Vorlesung 3: Evolution des eukaryotischen Genoms 4/20/11

Arten der Intronen. Spliceosome Struktur des snrnp U1. Spliceosome. Vorlesung 3: Evolution des eukaryotischen Genoms 4/20/11 Vorlesung 3: Evolution des eukaryotischen Genoms Struktur des eukaryotischen Gens Intronen und Exonen Genduplikation--Familien des Gens Eiweißdomänen (Protein domains) Domänen und Exonen: sind sie verwandt?

Mehr

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14 Evolution II Molekulare Variabilität Bachelorkurs Evolutionsbiolgie II WS 2013/14 Molekulare Variabilität 1) rten der molekularen Variabilität und ihre Entstehung (rten der Mutation) 2) Wie kann man molekulare

Mehr

Die Universität stellt sich vor

Die Universität stellt sich vor Die Universität stellt sich vor Prof. Dr. Till Tantau. Juni Überblick Die Universität zu Lübeck Exzellente Forschung...... führt zu exzellenter Lehre Die Universität in Zahlen Studierende. Professoren

Mehr

Die molekulare BDV. Inhalt

Die molekulare BDV. Inhalt Die molekulare BDV Biochemie Inhalt BDV = Biologische Datenverabeitung Informationen in lebenden Systemen Die Entschlüsselung des genetischen Codes Der genetische Code ist degeneriert 1 Die Weitergabe

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Sequenzen-Alignierung in der Bioinformatik

Sequenzen-Alignierung in der Bioinformatik Sequenzen-Alignierung in der Bioinformatik VO Algorithm Engineering Professor Dr. Petra Mutzel Lehrstuhl für Algorithm Engineering, LS 22. VO 23..26 Literatur für diese VO Volker Heun: Skriptum zur Vorlesung

Mehr

16.3 Unterrichtsmaterialien

16.3 Unterrichtsmaterialien 16.3 Unterrichtsmterilien Vness D.l. Pfeiffer, Christine Glöggler, Stephnie Hhn und Sven Gembll Mteril 1: Alignieren von Nukleotidsequenzen für die Verwndtschftsnlyse Für eine Verwndtschftsnlyse vergleicht

Mehr

Aufbau, Struktur, Funktion von DNA, RNA und Proteinen

Aufbau, Struktur, Funktion von DNA, RNA und Proteinen Aufbau, Struktur, Funktion von DNA, RNA und Proteinen Mitarbeiterseminar der Medizinischen Fakultät Ruhr-Universität Bochum Andreas Friebe Abteilung für Pharmakologie und Toxikologie Aufbau, Struktur,

Mehr

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Prof. Dr. med. Brigitte Schlegelberger 670513011/15 Olaparib Zulassung in Europa: Rezidiv eines Platin-sensitiven Ovarialkarzinoms

Mehr

Abschlussbericht der Projektgruppe 583

Abschlussbericht der Projektgruppe 583 Abschlussbericht der Projektgruppe 58 VATRAM VAriant Tolerant ReAd Mapper Benjamin Kramer, Jens Quedenfeld Sven Schrinner, Marcel Bargull Kada Benadjemia, Jan Stricker David Losch. März 5 Betreuer: Sven

Mehr

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher

Mehr

1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3

1. Nachschreibeklausur zur Vorlesung Genetik im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3 1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A Modul: Studiengang: Matrikel-Nr.: Versuch: 1 2 3 Vollständiger Name in Druckbuchstaben (Vorname Nachname): Jena, 01.04.2010, 10 12 Uhr; Unterschrift:

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen. Übungsaufgaben Datenbanken und Informationssysteme

MOL.504 Analyse von DNA- und Proteinsequenzen. Übungsaufgaben Datenbanken und Informationssysteme MOL.504 Analyse von DNA- und Proteinsequenzen Übungsaufgaben Datenbanken und Informationssysteme Ü1 Tutorial für NCBI NCBI Nucleotide: Suche nach cellobiose dehydrogenase fungi Ü1 Tutorial für NCBI NCBI

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats Das humane Genom satellites and single repeats protein coding & non-protein coding mobile (transposable) DNA elements Alle Genome sind individuell, selbst jene eineiiger Zwillinge! 1 Variationen im humanen

Mehr

-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel).

-Generation sehen alle gleich aus (Uniformitätsregel). In der F 2. -Generation treten unterschiedliche Phänotypen auf (Spaltungsregel). Mendelsche Regeln 1 + 2 (1) Merkmale wie die Blütenfarbe können dominant-rezessiv oder intermediär vererbt werden. Bei einem intermediären Erbgang wird die Merkmalsausprägung von beiden Allelen (z. B.

Mehr

Nachlese zu den Referaten

Nachlese zu den Referaten Nachlese zu den Referaten Referate Die Themen Phylogenie Aminosäurematrizen für die Eukaryontenphylogenie Ansätze für die Prokaryontenphylogenie Vergleichende Sequenzierung Spezieswahl zur Informationsoptimierung

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Gentechnik: Dem genetischen Fingerabdruck auf der Spur Das komplette Material finden Sie hier: School-Scout.de 8.-11. Schuljahr Dipl.-Bio.

Mehr

Modul 8: Bioinformatik A. Von der DNA zum Protein Proteinsynthese in silicio

Modul 8: Bioinformatik A. Von der DNA zum Protein Proteinsynthese in silicio Modul 8: Bioinformatik A. Von der DNA zum Protein Proteinsynthese in silicio Ein Wissenschaftler erhält nach einer Sequenzierung folgenden Ausschnitt aus einer DNA-Sequenz: 5 ctaccatcaa tccggtaggt tttccggctg

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen. Datenbanken & Informationssysteme

MOL.504 Analyse von DNA- und Proteinsequenzen. Datenbanken & Informationssysteme MOL.504 Analyse von DNA- und Proteinsequenzen Datenbanken & Informationssysteme Inhaltsübersicht Informationsysteme National Center for Biotechnology Information (NCBI) The European Bioinformatics Institute

Mehr

Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus?

Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Gliederung Seminar des Ausschusses für Genetik der ZAR, Salzburg, 18.03.2010 Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Versuch einer Begriffserklärung Wie weiß man,

Mehr

Vorlesung 2 GRUNDLAGEN

Vorlesung 2 GRUNDLAGEN Vorlesung 2 GRUNDLAGEN Überblick Genetische Faktoren Quantitative Genetik Molekulare Genetik Untersuchungsdesigns 2 Genetische Faktoren Davey-Smith et al., 2007 Genetische Faktoren sind nicht korreliert

Mehr

Genetische Ahnenforschung

Genetische Ahnenforschung Arbeitsgemeinschaft Genealogie Thüringen e.v. Genetische Ahnenforschung Autor: Dirk Schweitzer, Ph.D. dirkdna@yahoo.com 2009-08-24 1.) Welche Informationen können untersucht werden? männliche oder weibliche

Mehr

Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32

Mehr

Mechanismen funktioneller Varianten: die Liste wächst

Mechanismen funktioneller Varianten: die Liste wächst Mechanismen funktioneller Varianten: die Liste wächst Martin Hersberger Abteilung für Klinische Chemie und Biochemie Universitäts-Kinderspital Zürich Genetische Varianten gestern Funktionelle Varianten

Mehr

Winterschool Obergurgl. Molekulare Typisierung CF-relevanter Erreger

Winterschool Obergurgl. Molekulare Typisierung CF-relevanter Erreger Winterschool Obergurgl Molekulare Typisierung CF-relevanter Erreger Barbara C. Kahl Institut für Medizinische Mikrobiologie Universitätsklinikum Münster Warum Typisierung? Individueller Patient Persistierende

Mehr

Spleissen Dezember 2009 Elmar Schiebel, ZMBH

Spleissen Dezember 2009 Elmar Schiebel, ZMBH Spleissen Dezember 2009 Elmar Schiebel, ZMBH Bis 1970s: Eine Gen besteht aus einem Stück doppelsträngiger DNA. Dieses einfache Bild wurde 1977 durch die Entdeckung von Richard J. Roberts (Cold Spring Harbor

Mehr

Genetik. Genetik. Erbanlagen als Risikofaktoren für Erkrankungen. (01) 260 53-0 Fax: (01) 260 53-500 mail@labors.at www.labors.at

Genetik. Genetik. Erbanlagen als Risikofaktoren für Erkrankungen. (01) 260 53-0 Fax: (01) 260 53-500 mail@labors.at www.labors.at Genetik Genetik Erbanlagen als Risikofaktoren für Erkrankungen (01) 260 53-0 Fax: (01) 260 53-500 mail@labors.at www.labors.at Sehr geehrte Leserin! Sehr geehrter Leser! Modernste labormedizinische Methoden

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen Fotos: M. Rindlisbacher Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen H. Hasler 1, F. Berruex 3, B. Haase 2, C. Flury 1, T. Leeb 2, V. Gerber 4, H. Simianer 5, D. Burger 3, P.A. Poncet

Mehr

TreeTOPS. Ein Phylogenetik-Icebreaker Spiel. Lehrer- Handbuch. ELLS Europäisches Lernlabor für die Lebenswissenschaften

TreeTOPS. Ein Phylogenetik-Icebreaker Spiel. Lehrer- Handbuch. ELLS Europäisches Lernlabor für die Lebenswissenschaften TreeTOPS Ein Phylogenetik-Icebreaker Spiel Lehrer- Handbuch ELLS Europäisches Lernlabor für die Lebenswissenschaften 1 Übergeordnetes Ziel Das übergeordnete Ziel des Spieles ist es, die Spieler in das

Mehr

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen.

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. Kapitel 9 Genetische Variation Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. 9a Genetische Variation

Mehr

9. Mutationen. Konzepte: Vorwärts-/Rückwärts-Mutationen. Somatische Zellen oder Keimzellen. Loss-of-function/gain-of-function.

9. Mutationen. Konzepte: Vorwärts-/Rückwärts-Mutationen. Somatische Zellen oder Keimzellen. Loss-of-function/gain-of-function. 9. Mutationen Konzepte: Vorwärts-/Rückwärts-Mutationen Somatische Zellen oder Keimzellen Loss-of-function/gain-of-function Mutagenese 1. Loss-of-function -Mutationen treten häufiger auf als gain-of-function

Mehr

Phylogenetik. Vorlesung Einführung in die Angewandte Bioinformatik Prof. Dr. Sven Rahmann. Webseite zur Vorlesung

Phylogenetik. Vorlesung Einführung in die Angewandte Bioinformatik Prof. Dr. Sven Rahmann. Webseite zur Vorlesung Phylogenetik Vorlesung Einführung in die Angewandte Bioinformatik Prof. Dr. Sven Rahmann Webseite zur Vorlesung http://bioinfo.wikidot.com/ Sprechstunde Mo 16-17 in OH14, R214 Sven.Rahmann -at- tu-dortmund.de

Mehr

Welche drei Faktoren bestimmen nach Auffassung der modernen biopsychologischen. Verhalten?

Welche drei Faktoren bestimmen nach Auffassung der modernen biopsychologischen. Verhalten? Welche drei Faktoren bestimmen nach Auffassung der modernen biopsychologischen Forschung das Verhalten? 1 Was versteht man unter Phrenologie? 2 Was versteht man unter Präadapation? 3 Wie gelangte Homo

Mehr

Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:

Frage 1 A: Wieviele Codone des Universellen genetisches Codes kodieren: Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren: Aminosäuren Translationsstart Translationsstop? B: Welche biochemische Reaktion wird von Aminoazyl-tRNA-Synthetasen katalysiert?

Mehr

Neuer Gentest für erbliche Augenerkrankung

Neuer Gentest für erbliche Augenerkrankung Gesellschaft zur Förderung Kynologischer Forschung Abschlussbericht Neuer Gentest für erbliche Augenerkrankung aus der gkf-info 34 Dezember 2011 Info 33 Dezember 2011 Grußwort Abschlussbericht Neuer Gentest

Mehr

Biowissenschaftlich recherchieren

Biowissenschaftlich recherchieren Biowissenschaftlich recherchieren Uber den Einsatz von Datenbanken und anderen Ressourcen der Bioinformatik Nicola Gaedeke Birkhauser Basel Boston Berlin Inhaltsverzeichnis Vorwort xi 1 Die Informationssucheim

Mehr

Zentronukleäre Myopathien von der Diagnose zur Therapie

Zentronukleäre Myopathien von der Diagnose zur Therapie MTM Familientreffen Göttingen, 5./6. Juni 2014 Zentronukleäre Myopathien von der Diagnose zur Therapie Dr. Johann Böhm IGBMC, Strasbourg Ein paar Worte über Strasbourg.and über das IGBMC Ein paar Worte

Mehr

Programmiersprachen in der Bioinformatik

Programmiersprachen in der Bioinformatik Programmiersprachen in der Bioinformatik Bioinformatik In der Biologie immer größere Datenmengen (z.b. Genome, Proteinsequenzen) Sequenzanalyse, Strukturvorhersage Informationen in Datenbanken abrufbar

Mehr

Algorithms for Regression and Classification

Algorithms for Regression and Classification Fakultät für Informatik Effiziente Algorithmen und Komplexitätstheorie Algorithms for Regression and Classification Robust Regression and Genetic Association Studies Robin Nunkesser Fakultät für Informatik

Mehr