Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:

Größe: px
Ab Seite anzeigen:

Download "Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:"

Transkript

1 Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren: Aminosäuren Translationsstart Translationsstop? B: Welche biochemische Reaktion wird von Aminoazyl-tRNA-Synthetasen katalysiert? Formulieren Sie die Bruttoreaktion! Benennen Sie die Art der chemischen Bindung, die neu geknüpft wird! Benennen (oder skizzieren) Sie das transient gebildete energiereiche Intermediat. C: Was versteht man im Zusammenhang von Aminoazyl-tRNA-Synthetasen unter "proofreading"? D: Benennen Sie einen weiteren fundamentalen biologischen Prozess, bei dem proofreading eine entscheidende Rolle spielt und beschreiben Sie in wenigen Worten den Ablauf dieser proofreading- Reaktion.

2 Frage 2 A: Der Bakteriophage ist ein sogenannter temperenter Phage, der sich über zwei Strategien in seinem bakteriellen Wirt vermehren kann. Benennen und beschreiben sie in wenigen Worten diese beiden Strategien. B: Beschreiben Sie in aller Kürze das Restriktions/ Modifikationssystem. Benennen Sie dabei dessen biologische Funktion, die beteiligten Enzyme sowie die Basis seiner Selektivität. C: T-Phagen produzieren ein "Lysozym" genanntes Enzym. Welche Reaktion wird von diesem Enzym katalysiert? Was ist die biologische Funktion dieses Enzyms? Lysozym wird auch von Vertebraten synthetisiert. Geben Sie ein Beispiel, wo in diesen Lebewesen dieses Enzym vorkommt und welche Funktion es dort erfüllt. 2

3 Frage 3 A: Alternative Sigma-Faktoren sind ein wesentliches Element der regulierten Genexpression bei Bakterien. Welche Klasse von Genen wird durch den alternativen Sigma-Faktor Sigma32 kontrolliert? Welchen Teil dieser Gene erkennt das Protein? B: Welche Polymerase transkribiert in Eukaryonten die Gene, die für die ribosomale RNA codieren? Wie kann man diese Polymerase pharmakologisch von den anderen beiden unterscheiden? Wo in der Zelle findet die Ribosomen-Biosynthese statt? C: Sie möchten gerne ein Enzym rekombinant in Bakterien herstellen, das nur in der menschlichen Schilddrüse vorkommt. In Ihrer Arbeitsgruppe stehen eine genomische Bibliothek aus humaner DNA sowie eine Sammlung von 15 verschiedenen humanen cdna-bibliotheken vor. Welche Art von Bibliothek wählen Sie, um das für Sie relevante offene Leseraster in den bakteriellen Expressionsvektor zu klonieren? Können Sie aufgrund der hier gegebenen Information sicher sein, dass Ihre Arbeitsgruppe eine geeignete Bibliothek besitzt? Begründen Sie Ihre Antwort. 3

4 Frage 4 A: Benennen Sie drei verschiedene DNA-Reparatur-Systeme und geben Sie jeweils ein Beispiel für die Art des Schadens, den das jeweilige System reparieren kann. B: Das Mismatch-Reparatur-System muss während der Replikation zwischen Matrizenstrang und neu synthetisiertem Strang unterscheiden. Woran erkennen die entsprechenden Proteine in Eschericia coli den zu reparierenden Strang? C: Der Ames-Test dient der Messung der Mutagenizität von Chemikalien. Welche Rolle spielt der Zusatz von Leberextrakt bei der Durchführung des Tests? Sie wollen mit einem analogen Verfahren die mutagene Wirkung von UV-Strahlen messen. Müssen Sie für dieses Experiment auch Leberextrakt einsetzen? Begründen Sie Ihre Antwort. D: Wie werden Doppelstrangbrüche in Eschericia coli repariert? Sie isolieren Mutanten, die Defekte in diesem Reparaturprozess aufweisen. Nennen Sie ein Beispiel für ein Gen, das in einem solchen mutanten Stamm mutiert sein könnte. 4

5 Frage 5 A: Die Begriffe -Helix, Doppelhelix und Tripelhelix beschreiben wichtige biologische Strukturen. Benennen Sie Makromoleküle, bei denen diese Strukturen typischerweise vorkommen. -Helix: Doppelhelix: Tripelhelix: B: Benennen Sie die unmittelbaren Wechselwirkungen, die eine -Helix stabilisieren. Zwischen welchen konkreten funktionellen Gruppen treten diese Wechselwirkungen auf? C: Kann eine isolierte (typische) -Helix in wäßriger Lösung einen stabilen Faltungszustand annehmen? D: Kann eine isolierte -Helix in einer Lipiddoppelschicht stabil sein? E: Beschreiben Sie in wenigen Worten die Struktur einer Doppelhelix. Konzentrieren Sie sich dabei auf die wesentlichsten nichtkovalenten Wechselwirkungen. 5

6 Frage 6 A: Definieren Sie den Begriff "offenes Leseraster" (open reading frame). B: In wievielen verschiedenen Leserastern kann ein doppelsträngiger DNA-Abschnitt theoretisch gelesen werden? C: Der Begriff Genexpression umfaßt die Prozesse, die von einem Gen zum kodierten Protein führen. Wie wählen Bakterien aus einem doppelsträngigen DNA-Abschnitt das "richtige" Leseraster zur Proteinsynthese aus? D: Definieren Sie in aller Kürze die folgenden Begriffe. Punktmutation: Stille Mutation: Nonsense-Mutation: 6

7 Frage 7 A: Im tet-operon bindet der tet-repressor an einen tet-operator. Tetrazyklin induziert die Expression der nachgeschalteten Gene. Handelt es sich um positive oder negative Kontrolle der Genexpression? B: Welchen Effekt hat die Bindung von Tetrazyklin an das Repressor-Protein auf dessen DNA- Bindeeigenschaften? C: Sie möchten die Expression der Gene des tet-operons mit IPTG induzieren können. Ihr Bakterienstamm exprimiert den laci-repressor. Schlagen Sie eine gentechnische Strategie vor, um die Gene des tet-operons unter IPTG-Kontrolle zu bringen. D: Das tet-operon ist Teil eines DNA-Transposons (Tn10). Wie heißt der Mechanismus, mit dem sich dieses bewegliche genetische Element im Genom von E. coli bewegt? E: Welches Enzym bewerkstelligt die Bewegung des Tn10 Transposons und wo befindet sich das für dieses Enzym kodierende Gen? F: Wieviele Kopien des Tn10 Transposons liegen im Genom eines Bakterienstammes nach drei Sprüngen des Transposons vor, wenn man von einem Bakterienstamm mit einer Kopie des Transposons im Genom ausgeht? 7

8 Frage 8 A: Die meisten mrnas tragen einen so genannten poly-a-schwanz. Durch welches Sequenzelement ist die Information für diesen Schwanz im entsprechenden Gens codiert? Benennen Sie die enzymatischen Aktivitäten, die für die Interpretation dieses Sequenzelements notwendig sind. B: Sie möchten ein humanes Gen isolieren, das für eine bestimmte trna codiert. In welcher Art von Genbibliothek würden Sie danach suchen? Begründen Sie Ihre Wahl! C: Unter bestimmten Umweltbedingungen, z.b. bei Aminosäuremangel, wird der eukaryontische Initiationsfaktor eif2 phosphoryliert. Was ist die Konsequenz dieser Phosphorylierungsreaktion? Skizzieren Sie in wenigen Worten den zugrunde liegenden Mechanismus. 8

9 Frage 9 Antibiotika im engeren Sinne sind niedermolekulare Stoffwechselprodukte, die in bereits geringen Konzentrationen auf andere Organismen toxisch wirken, indem sie lebenswichtige "drug targets" im Zielorganismus hemmen. Nennen Sie drei generelle Strategien, durch die sich Bakterien einer solchen toxischen Wirkung entziehen können und belegen Sie jede der Strategien durch jeweils ein Beispiel. Frage 10 Oft sind die Genprodukte, die in einem Stoffwechselweg wirken, in einem gemeinsamen Operon kodiert. Beispiele sind das trp- und das lac-operon. A) Für welche Stoffwechselwege stellen die beiden Operons die Enzymausstattung bereit? (2 Punkte) B) Beide Operons stehen jeweils unter Kontrolle eines spezifischen Repressor-Proteins. Welchen Effekt hat die Bindung des Repressors an den Operator und wie wird in den beiden Beispielen die Bindung des Repressors jeweils reguliert? (6 Punkte) C) Sie arbeiten mit einem Bakterien-Stamm, bei dem die lac-operator-sequenz vor dem lac Operon deletiert wurde. Sie plattieren diesen Stamm auf Medium mit X-Gal (A) und auf Medium mit X-Gal und IPTG (B) aus. Welche Farbe haben die Kolonien auf Medium (A) und (B)? Warum? (2 Punkte) 9

10 Frage 11 A) Erklären Sie in wenigen Worten, durch welche unmittelbaren Wechselwirkungen eine alpha- Helix stabilisiert wird (4 Punkte). B) Zeichnen Sie die Strukturformel von Prolin (3 Punkte). C) Erklären Sie, warum Prolin ein alpha-helix-brecher ist (3 Punkte). Frage 12 IPTG beeinflußt als sogenanntes kleines Molekül das Verhalten des lac-repressor-proteins und damit die Genexpression vom lac-operon. A) Warum bezeichnet man diesen Typ der Genregulation als negative Kontrolle? (3 Punkte) B) Welches Protein vermittelt im Gegensatz dazu die "positive Kontrolle" bei der Genexpression vom lac-operon? Welche Parameter werden so bei der Expression der lac-gene integriert? (3 Punkte) C) Sie untersuchen einen Bakterien-Stamm, der zwar ein lac Operon enthält, aber dessen laci-gen im für die IPTG-Bindungsstelle codierende Bereich mutiert ist. Das entsprechende Protein hat keine nennenswerte Affinität für IPTG mehr, entspricht in allen anderen Eigenschaften aber dem Wildtypprotein. Sie plattieren diesen Stamm auf Medium mit X-Gal (A) und auf Medium mit X- Gal und IPTG (B) aus. Welche Farbe haben die Kolonien auf Medium (A) und (B)? Warum? (4 Punkte) 10

11 Frage 13 A:Wie wirkt Puromycin? B: Kann Puromycin in der Humanmedizin zur Bekämpfung bakterieller Infektionen eingesetzt werden? Begründen Sie Ihre Antwort. C: Wie können Organismen Puromycin-Resistenz erreichen? Frage 14 Erläutern Sie mit mindestens zwei stichhaltigen Argumenten, warum doppelsträngige DNA einen stabileren Speicher genetischer Information darstellt als einzelsträngige RNA. Frage 15 A:Welche äußeren Einflüsse können Mutationen induzieren? B: Wozu dient der Ames-Test? C: Wieso benötigt man für die Durchführung des Tests einen Leber-Extrakt? Frage 16 Bei der Translation wird das Startcodon in Bakterien und eukaryontischen Zellen auf unterschiedliche Weise erkannt. Benennen Sie die Sequenzmotive, die zur effizienten Initiation der Translation an den Startcodons bakterieller bzw. eukaryontischer mrnas notwendig sind. Frage 17 A: Was ist die zelluläre Funktion der SOS-Antwort? B: Beschreiben Sie kurz das Regulationsprinzip des SOS-Regulons. 11

12 Frage 18 A: Beschreiben Sie die Wirkung von Penicillin. B: Wie können Bakterien Penicillin-Resistenz erreichen? C: Nennen Sie drei Antibiotika, die die bakterielle Proteinsynthese hemmen Frage 19 Welche biologische Funktion hat das Restriktions/ Modifikationsystem und wie funktioniert es? Frage 20 A: Welches DNA-Reparatursystem ist bei der menschlichen Erbkrankheit Xeroderma pigmentosum betroffen? B: Die Patienten sind extrem empfindlich gegen UV-Licht. Welcher DNA-Schaden kann durch UV-Strahlung hervorgerufen werden? C: Warum bekommen die betroffenen Patienten sehr häufig Krebs? Frage 21 Im Rahmen einer humangenetischen Forschungsarbeit zu einer Erbkrankheit stellt sich heraus, dass bei vielen der betroffenen Familien eine sogenannte Spleißmutation in dem defekten Gen vorliegt. Was versteht man unter Spleißmutation? Nennen Sie ein Beispiel für die möglichen Konsequenzen einer solchen Mutation für das codierte Protein. Frage 22 A: Definiere den lysogenen Zustand eines Bakteriophagen. Wie nennt man Bakteriophagen, die als Lysogene existieren können? B: Wie kann der Bakteriophage Lambda aus dem lysogenen Zustand herauskommen und lytisch werden? Welches Schlüsselereignis passiert hierbei auf regulatorischer Ebene? 12

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene Übung 11 Genregulation bei Prokaryoten Konzepte: Entwicklungs /gewebespezifische Genexpression Coexpression funktional überlappender Gene Positive Genregulation Negative Genregulation cis /trans Regulation

Mehr

Aufgabe 1. Bakterien als Untersuchungsgegenstand!

Aufgabe 1. Bakterien als Untersuchungsgegenstand! Genetik I Aufgabe 1. Bakterien als Untersuchungsgegenstand 1. Beschriften Sie die Abbildung zu den Bakterien. 2. Nennen Sie Vorteile, die Bakterien wie Escherichia coli so wertvoll für die genetische Forschung

Mehr

Einführung in die Biochemie Antworten zu den Übungsaufgaben

Einführung in die Biochemie Antworten zu den Übungsaufgaben Einführung in die Biochemie Antworten zu den Übungsaufgaben Dank Die vorliegenden Antworten zu den Übungsaufgaben für das Seminar zum Modul Einführung in die Biochemie wurden im Wintersemester 2014/2015

Mehr

AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig

AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig Restriktionsenzyme Füllen Sie den Lückentext aus. PCR 1a Mit dem folgenden Quiz können Sie Ihr Wissen zum Thema PCR überprüfen. Klicken Sie jeweils die richtige Antwort an. PCR 1b Mit dem folgenden Quiz

Mehr

9. Mutationen. Konzepte: Vorwärts-/Rückwärts-Mutationen. Somatische Zellen oder Keimzellen. Loss-of-function/gain-of-function.

9. Mutationen. Konzepte: Vorwärts-/Rückwärts-Mutationen. Somatische Zellen oder Keimzellen. Loss-of-function/gain-of-function. 9. Mutationen Konzepte: Vorwärts-/Rückwärts-Mutationen Somatische Zellen oder Keimzellen Loss-of-function/gain-of-function Mutagenese 1. Loss-of-function -Mutationen treten häufiger auf als gain-of-function

Mehr

Praktikum Biochemie B.Sc. Water Science WS Enzymregulation. Marinja Niggemann, Denise Schäfer

Praktikum Biochemie B.Sc. Water Science WS Enzymregulation. Marinja Niggemann, Denise Schäfer Praktikum Biochemie B.Sc. Water Science WS 2011 Enzymregulation Marinja Niggemann, Denise Schäfer Regulatorische Strategien 1. Allosterische Wechselwirkung 2. Proteolytische Aktivierung 3. Kovalente Modifikation

Mehr

Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16

Mehr

Integron und Integrase

Integron und Integrase Integron und Integrase Ein Versuch zum Nachweis von Antibiotikaresistenzen. Ein NUGI-Projekt am Albert-Einstein-Gymnasium, Wiblingen These Der Einsatz von Antibiotika führt zu einer erhöhten Resistenzbildung

Mehr

Antibakterielle Naturstoffe in der medizinischen Chemie

Antibakterielle Naturstoffe in der medizinischen Chemie OC 07-Vortrag Antibakterielle Naturstoffe in der medizinischen Chemie Tobias Geid Schlagwort: Selektive Toxizität (Paul Ehrlich) 1 Unterschiede zwischen menschlicher (eukaryotischer) und bakterieller (prokaryotischer)

Mehr

Wiederholungsklausur zur Vorlesung Biochemie IV im SS 2000

Wiederholungsklausur zur Vorlesung Biochemie IV im SS 2000 Wiederholungsklausur zur Vorlesung Biochemie IV im SS 2000 am 15.11.2000 von 13.45 15.15 Uhr (insgesamt 100 Punkte, mindestens 50 erforderlich) Bitte Name, Matrikelnummer und Studienfach 1. Wie erfolgt

Mehr

Inhalt. Entdeckung und allgemeine Informationen. Klassifizierung. Genom Viren untypische Gene Tyrosyl-tRNA Synthetase. Ursprung von grossen DNA Viren

Inhalt. Entdeckung und allgemeine Informationen. Klassifizierung. Genom Viren untypische Gene Tyrosyl-tRNA Synthetase. Ursprung von grossen DNA Viren Mimivirus Inhalt Entdeckung und allgemeine Informationen Klassifizierung Genom Viren untypische Gene Tyrosyl-tRNA Synthetase Ursprung von grossen DNA Viren Entstehung von Eukaryoten Entdeckung 1992 in

Mehr

Zellzyklus, Replikation und Chromosomen

Zellzyklus, Replikation und Chromosomen Zellzyklus, Replikation und Chromosomen Wiederholung: Größenverhältnisse im DNA-Molekül 3 5 Das größte menschliche Chromosom enthält 247 Millionen Basenpaare Moleküllänge: 8.4 cm Die Länge des gesamten

Mehr

Weitere Übungsfragen

Weitere Übungsfragen 1 Strategie bei multiple choice Fragen Wie unterscheidet sich Glucose von Fructose? (2 Punkte) Glucose hat 6 C Atome, Fructose hat nur 5 C Atome. In der Ringform gibt es bei Glucose α und β Anomere, bei

Mehr

3.2. Welche Folgen hätte der Verlust einer Guaninbase im dargestellten codogenen Strang:... G G A C T T C T T..? Begründen Sie!

3.2. Welche Folgen hätte der Verlust einer Guaninbase im dargestellten codogenen Strang:... G G A C T T C T T..? Begründen Sie! Kurs: MOK und Externe Hilfsmittel: keine Aufgaben: Die Klausur besteht aus einem Zentralthema ( Bewertungsanteil 50 %) und vier Wahlthemen (Bewertungsanteile je 25 %), von denen je zwei zu bearbeiten sind.

Mehr

Translation Teil 3 Proteinfaktoren und ihre Rolle in der Proteinsynthese

Translation Teil 3 Proteinfaktoren und ihre Rolle in der Proteinsynthese Translation Teil 3 Proteinfaktoren und ihre Rolle in der Proteinsynthese Damit die Proteinsynthese beginnen kann, müssen m-rna und fmet-trna zum Ribosom gebracht werden. Wie geschieht das??? Von entscheidender

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 7 (11.07-15.07.) Methoden und Techniken II 1. Sie bekommen

Mehr

Nukleotide und Nukleinsäuren. Prof. Dr. Albert Duschl

Nukleotide und Nukleinsäuren. Prof. Dr. Albert Duschl Nukleotide und Nukleinsäuren Prof. Dr. Albert Duschl Genetischer Code Der genetische Code entsteht durch die Abfolge von Basen in der DNA. Dadurch wird die Abfolge von Aminosäuren in einem Protein codiert.

Mehr

Genetik Was ist ein Gen - Der Code des Lebens

Genetik Was ist ein Gen - Der Code des Lebens Genetik Was ist ein Gen - Der Code des Lebens A) Teilungsvorgänge 1. Körperzellen Unser Körper besteht aus ca 3 Billionen Zellen, die alle die gleiche Erbsubstanz haben. Nur wirken die Erbanlagen nicht

Mehr

W i e P r o t e i n e f e r t i g g e m a c h t w e r d e n

W i e P r o t e i n e f e r t i g g e m a c h t w e r d e n EINSICHTEN 2007 N E W S L E T T E R 0 1 l e b e n s w i s s e n s c h a f t e n Susanne Wedlich W i e P r o t e i n e f e r t i g g e m a c h t w e r d e n Etwa 10.000 verschiedene Proteine enthält eine

Mehr

Antibiotika und ihre Wirkung. Sonntag, den

Antibiotika und ihre Wirkung. Sonntag, den Antibiotika und ihre Wirkung Sonntag, den 23. 04. 2006 Die Bakterienzelle - einzellige Mikroorganismen (Größe:0,5-5Mikrometer) - Bakterienformen: Kokken Stäbchen Spirillen - Wachstum: Streptokokken Staphylokokken

Mehr

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von DNA- Replikation PowerPoint-Learning von Andrea Brügger Lernziele dieser Lerneinheit: 1. Sie kennen und verstehen die einzelnen Teilschritte der DNA-Replikation und können diese Teilschritte den entsprechenden

Mehr

Biologie für Mediziner

Biologie für Mediziner Biologie für Mediziner - Zellbiologie 1 - Prof. Dr. Reiner Peters Institut für Medizinische Physik und Biophysik/CeNTech Robert-Koch-Strasse 31 Tel. 0251-835 6933, petersr@uni-muenster.de Dr. Martin Kahms

Mehr

Biochemie Tutorium 10. Genetischer Code, Translation & Regulation der Proteinbiosynthese

Biochemie Tutorium 10. Genetischer Code, Translation & Regulation der Proteinbiosynthese Biochemie Tutorium 10 Genetischer Code, Translation & Regulation der Proteinbiosynthese IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der

Mehr

Genetik Praktikumsklausur SS2005

Genetik Praktikumsklausur SS2005 Genetik Praktikumsklausur SS2005 1. Aufgabe: Der Genotyp AbaB wird geselbstet, dabei werden 256 Nachkommen gebildet. Davon erhalten 16 Pflanzen den Genotyp ABAB a) gekoppelt b) nicht gekoppelt c) teilweise

Mehr

BIOWISSENSCHAFTEN. Die Biowissenschaften. Biochemie. Molekularbiologie. Mikrobiologie. Botanik, Zoologie. Genetik. Biotechnologie.

BIOWISSENSCHAFTEN. Die Biowissenschaften. Biochemie. Molekularbiologie. Mikrobiologie. Botanik, Zoologie. Genetik. Biotechnologie. Die Biowissenschaften Mikrobiologie Biotechnologie Biochemie Genetik Molekularbiologie Botanik, Zoologie weitere Disziplinen Physiologie Zellbiologie Zentrum f. Angew. Genetik BIOWISSENSCHAFTEN Genetik

Mehr

Veränderung der Zahl der Chromosomensätze (Polyploidisierung)

Veränderung der Zahl der Chromosomensätze (Polyploidisierung) Mutationen - Genommutationen - Chromosomenmutationen - Genmutationen (Punktmutationen) - Erkennbarkeit und Auswirkungen von Punktmutationen - neutrale Mutationen - Missense -Mutationen - Nonsense -Mutationen

Mehr

Viren. Größenverhältnisse von Viren, Bakterien und Eukaryotenzellen. Virus. tierische Zell. Campbell 17.1

Viren. Größenverhältnisse von Viren, Bakterien und Eukaryotenzellen. Virus. tierische Zell. Campbell 17.1 Viren Größenverhältnisse von Viren, Bakterien und Eukaryotenzellen tierische Zell Virus 0,5 µm Campbell 17.1 1 Viren die einfachsten Lebensformen Obligate intrazelluläre Parasiten, können sich nur in Wirt

Mehr

Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt

Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Rekombinante Wirkstoffe Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt.de Das Problem mit dem N-Terminus von rekombinanten Proteinen

Mehr

Genregulation. Physik der Transkriptionskontrolle und Expressionsanalyse. Vorlesung System-Biophysik 11. Dez. 2007

Genregulation. Physik der Transkriptionskontrolle und Expressionsanalyse. Vorlesung System-Biophysik 11. Dez. 2007 Genregulation Physik der Transkriptionskontrolle und Expressionsanalyse Vorlesung System-Biophysik 11. Dez. 2007 Literatur - Alberts/Lehninger - Kim Sneppen & G. Zocchi: Physics in Molecular Biology -

Mehr

Nucleophiler Angriff Ein Nucleophil greift ein positiv polarisiertes Kohlenstoff in einer Verbindung an.

Nucleophiler Angriff Ein Nucleophil greift ein positiv polarisiertes Kohlenstoff in einer Verbindung an. Weiter im Text: Der RNA-Primer, kann die DNA nucleophil angreifen. Nucleophil: ein stark "kernliebendes" Teilchen, das negativ polarisiert ist (z.b. OH-) und ein positiv polarisiertes (elektronenarmes)

Mehr

28 4. DIE MATHEMATIK HINTER DER COMPACT DISC. Abbildung 4.1: Selbstkorrigierende Codes

28 4. DIE MATHEMATIK HINTER DER COMPACT DISC. Abbildung 4.1: Selbstkorrigierende Codes 8 4. DIE MATHEMATIK HINTER DER COMPACT DISC y1 1 4 3 y3 y Abbildung 4.1: Selbstkorrigierende Codes 4. Die Mathematik hinter der Compact Disc 4.1. Selbstkorrigierende Codes Wenn wir eine Reihe von 0 und

Mehr

Gentechnologie: Klonierung und Transformation von DNA

Gentechnologie: Klonierung und Transformation von DNA Grundpraktikum Genetik 8. Kurstag 16.06.2005 Gentechnologie: Klonierung und Transformation von DNA Lerninhalte: Transformation, natürliche Kompetenz, Transformationseffizienz, Vektor, Plasmid, Resistenzgen,

Mehr

Vorname: Frage 1. Nennen Sie drei Metalle, die :für den Menschen essentiell sind und als Mengenelemente Körper vorkommen (3 P) Frage 2

Vorname: Frage 1. Nennen Sie drei Metalle, die :für den Menschen essentiell sind und als Mengenelemente Körper vorkommen (3 P) Frage 2 1\.1 Matrikelnummer: Name: Vorname: Bitte eintragen Bitte ankreuzen: Fachsemester: Fachrichtung: Chemie Sonstige Bitte prüfen Sie Ihre Klausur sofort auf Vollständigkeit (Seiten fortlaufend nummeriert

Mehr

Entdeckung der genetischen Transformation

Entdeckung der genetischen Transformation Bakterien Entdeckung der genetischen Transformation Prokaryoten nehmen aus ihrer Umgebung oft genetischen Material auf um ihren Genom verändern zu können Adaptation zur veränderten Umgebung Entdeckung

Mehr

Fundamentals of Biochemistry

Fundamentals of Biochemistry Fundamentals of Biochemistry Third Edition Donald Voet Judith G. Voet Charlotte W. Pratt Chapter 25 DNA Replication, Repair, and Recombination Copyright 2008 by John Wiley & Sons, Inc. Lernziele: 1. Verstehen,

Mehr

Westfälische Wilhelms-Universität Münster Institut für Allgemeine Zoologie und Genetik

Westfälische Wilhelms-Universität Münster Institut für Allgemeine Zoologie und Genetik Westfälische Wilhelms-Universität Münster Institut für Allgemeine Zoologie und Genetik Vorlesung "Grundlagen der Biologie I" WS 2009/10 Molekulargenetik 23.11. - 22.12.2009 Püschel 2009 Vorlesung Grundlagen

Mehr

Prüfungsfragenkatalog für Biochemie für Studierende der Pharmazie (Prof. A. Kungl)

Prüfungsfragenkatalog für Biochemie für Studierende der Pharmazie (Prof. A. Kungl) Prüfungsfragenkatalog für Biochemie für Studierende der Pharmazie (Prof. A. Kungl) Stand: Juni 2014 Termin: 24.06.2014 1. Geben sie die Formeln des Trinukleotids A-T-G an und erläutern Sie den strukturellen

Mehr

GENTECHNIK BEI PFLANZEN

GENTECHNIK BEI PFLANZEN - 1 - GENTECHNIK BEI PFLANZEN 1. Grüne Gentechnik - was ist das? "Grüne Gentechnik" ist laut Gentechnik-Wörterbuch eine "umgangssprachliche Bezeichnung für gentechnische Forschung mit Pflanzen, während

Mehr

Biologie für Mediziner

Biologie für Mediziner Biologie für Mediziner - Zellbiologie 1 - Prof. Dr. Reiner Peters Institut für Medizinische Physik und Biophysik/CeNTech Robert-Koch-Strasse 31 Tel. 0251-835 6933, petersr@uni-muenster.de Dr. Martin Kahms

Mehr

Gene, Umwelt & Verhalten II: Molekulare Genetik

Gene, Umwelt & Verhalten II: Molekulare Genetik Gene, Umwelt & Verhalten II: Molekulare Genetik 1. Struktur und Funktion der DNA 2. Die Vervielfältigung der genetischen Information 2.1 Replikation innerhalb des Zellzyklus 2.2 Entstehung von Keimzellen

Mehr

[Grundlagen der] Physiologie der [Mikro-]organismen

[Grundlagen der] Physiologie der [Mikro-]organismen [Grundlagen der] Physiologie der [Mikro-]organismen Heribert Cypionka Folien: www.icbm.de/pmbio... Teaching... Was ist Physiologie? Vgl. Morphologie, Taxonomie... Themen der Vorlesung: Gundlegende physiologische

Mehr

Inhaltsverzeichnis. a. Chemie der Aminosäuren und Peptide

Inhaltsverzeichnis. a. Chemie der Aminosäuren und Peptide Inhaltsverzeichnis 1 Zelluläre Grundlagen der Biochemie Typen lebender Zellen 2 Typen biochemischer Präparationen 2 Subzelluläre Fraktionierung 3 Biochemische Funktionen der Zellorganellen 4 2 Proteine

Mehr

Grundlagen des Farbensehens

Grundlagen des Farbensehens Das Farbensehen der Vögel, Arbeitsmaterial 1 Grundlagen des Farbensehens AB 1-1, S. 1 Arbeitsaufträge: 1. Beschriften Sie die Koordinatenachsen des Diagramms und schreiben Sie an das Absorptionsmaximum

Mehr

Ökologie. Die Lehre vom Haus

Ökologie. Die Lehre vom Haus Ökologie Die Lehre vom Haus Übersicht Ökologie 1. Welche Voraussetzungen braucht es für Leben: a. Abiotische Faktoren (Wo findet Leben statt?) b. Biotische Faktoren (Wie beeinflussen sich Lebewesen gegenseitig;

Mehr

Biologische Psychologie II Peter Walla

Biologische Psychologie II Peter Walla Kapitel 16 Lateralisierung, Sprache und das geteilte Gehirn Das linke und das rechte Gehirn: Das menschliche Gehirn besteht aus 2 cerebralen Hemisphären, die voneinander getrennt sind, abgesehen von den

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

TOPIC. Epigenetik. Prof. Dr. Max Mustermann Lehrstuhl/Institut

TOPIC. Epigenetik. Prof. Dr. Max Mustermann Lehrstuhl/Institut TOPIC Prof. Dr. Max Mustermann Lehrstuhl Dr. Max Mustermann für XYZ Referat Kommunikation & Marketing Verwaltung Epigenetik Prof. Dr. Max Mustermann Lehrstuhl/Institut Seminar: Gentechnik im Dialog Prof.

Mehr

Zellulärer Abbau von Proteinen in Aminosäuren:! Proteine werden in Zellen durch Proteasom-Komplexe in! einzelne Aminosäuren abgebaut.!

Zellulärer Abbau von Proteinen in Aminosäuren:! Proteine werden in Zellen durch Proteasom-Komplexe in! einzelne Aminosäuren abgebaut.! Zellulärer Abbau von Proteinen in Aminosäuren: Proteine werden in Zellen durch Proteasom-Komplexe in einzelne Aminosäuren abgebaut. Abbau von Aminosäuren: Uebersicht über den Aminosäureabbau Als erster

Mehr

Studienbegleitende Prüfung zum Modul Allgemeine Genetik

Studienbegleitende Prüfung zum Modul Allgemeine Genetik Studienbegleitende Prüfung zum Modul Allgemeine Genetik 01.10.2012 Name: Vorname: Matrikelnr. erzielte Punktzahl: Note: Überprüfung (Prüfer 2) Max.: 85 (Vorl./Übg.) + 55 (Prakt.) = 140 Punkte 1) Erklären

Mehr

Mikrobiologie Klausurfragen

Mikrobiologie Klausurfragen Mikrobiologie Klausurfragen Lösungen Keine Garantie auf Richtigkeit! Klausur 1999 4 Unterschiede zwischen Pro und Eukaryoten Prokaryoten ohne Zellkern/ohne Organellen Prokaryoten mit Zellwand aus Peptidoglycan

Mehr

Gentechnik/Gentechnologie

Gentechnik/Gentechnologie Gentechnik/Gentechnologie Bei zelltechnischen Verfahren werden Gene wenn überhaupt, dann nur im Gesamtverband, also als ganzes Genom verschoben oder kombiniert. Bei Gentechnologischen Verfahren wird in

Mehr

17. Biomoleküle : Nucleinsäuren

17. Biomoleküle : Nucleinsäuren Friday, February 2, 2001 Allgemeine Chemie B II Page: 1 Inhalt Index 17. Biomoleküle : Nucleinsäuren Die gesamte Erbinformation ist in den Desoxyribonucleinsäuren (DNA) enthalten. Die Übersetzung dieser

Mehr

1. id. Rödelhart Heimprojekt. notizen

1. id. Rödelhart Heimprojekt. notizen notizen ca. 400 Mitarbeiter davon 360 Forscher aus insgesamt 31 Nationen es gibt nur einen Eingang - man soll sehen wer kommt und geht der Eingang ist zentraler Ort im Gebäude und führt direkt zu Arbeit,

Mehr

Atomphysik NWA Klasse 9

Atomphysik NWA Klasse 9 Atomphysik NWA Klasse 9 Verwendung radioaktive Strahlung in Medizin und Alltag Eigenschaften radioaktiver Strahlung: 1. Sie kann viele Stoffe durchdringen! 2. Sie ist tödlich, da sie die DNA zerstört.

Mehr

Westfälische Wilhelms-Universität Münster Institut für Molekulare Zellbiologie

Westfälische Wilhelms-Universität Münster Institut für Molekulare Zellbiologie Westfälische Wilhelms-Universität Münster Institut für Molekulare Zellbiologie Vorlesung "Grundlagen der Biologie I" WS 2014/15 Molekulargenetik 17.11. - 19.12.2014 Püschel 2014 Vorlesung Grundlagen der

Mehr

Die Verbindungen zwischen Parkinson und der Huntington Krankheit

Die Verbindungen zwischen Parkinson und der Huntington Krankheit Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Erfolgreiche Studie zu Gentherapie bei Parkinson macht Hoffnung

Mehr

Organisation und Evolution des Genoms

Organisation und Evolution des Genoms Organisation und Evolution des Genoms Organisation und Evolution des Genoms Definition Genom: vollständige DNA-Sequenz eines Organismus I. Einfachstes Genom: Prokaryoten Zwei Gruppen, evolutionär unterschiedlicher

Mehr

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie Grundwissenkarten Gymnasium Vilsbisburg 9. Klasse Biologie Es sind insgesamt 10 Karten für die 9. Klasse erarbeitet. davon : Karten ausschneiden : Es ist auf der linken Blattseite die Vorderseite mit Frage/Aufgabe,

Mehr

2. Übung: Chromosomentheorie

2. Übung: Chromosomentheorie Konzepte: 2. Übung: Chromosomentheorie Mitose/Meiose Geschlechtschromosomale Vererbung Chromosomentheorie Zellzyklus G 1 Phase: postmitotische Phase oder Präsynthesephase Zelle beginnt wieder zu wachsen

Mehr

Box. Biologie. Biologie der Zelle

Box. Biologie. Biologie der Zelle Box Biologie Schülerarbeitsbuch 1. Halbjahr der Qualifikationsphase Niedersachsen Biologie der Zelle Die Übertragung von Informationen innerhalb der Zelle Enzyme: Grundlagen und Funktionen im Stoffwechsel

Mehr

Biotechnologie. Produkte mit lebenden Organismen oder Teilen davon herstellen. Enge Definition

Biotechnologie. Produkte mit lebenden Organismen oder Teilen davon herstellen. Enge Definition Biotechnologie Produkte mit lebenden Organismen oder Teilen davon herstellen Enge Definition Industrielle Produktion in Bioreaktoren - Mikroorganismen, Zellkulturen Enzymtechnik und Biokatalyse - Enzyme

Mehr

4 Kompetenzen und Inhalte (Leistungskurs)

4 Kompetenzen und Inhalte (Leistungskurs) 4 (Leistungskurs) 4.1 Physiologische Grundlagen ausgewählter Lebensprozesse am Beispiel der Nervenzelle - Aufbau lebender Organismen aus Zellen - Vorgänge an Biomembranen - Enzyme und ihre Bedeutung -

Mehr

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms?

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Brustkrebs aktuell - OSP am 21.10.2015 Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Prof. Dr. German Ott, Institut für Pathologie Robert-Bosch-Krankenhaus

Mehr

Lösungen zu Übungsaufgaben Mechanismen 1 LK 12/1 Chemie

Lösungen zu Übungsaufgaben Mechanismen 1 LK 12/1 Chemie 1. Die radikalische Substitution 2-Methylbutan soll mit Brom im Sinne einer radikalischen Substitution reagieren. Betrachtet sei zunächst nur die Monobromierung. a) Formulieren Sie die Summengleichung

Mehr

Westfälische Wilhelms-Universität Münster Institut für Molekulare Zellbiologie

Westfälische Wilhelms-Universität Münster Institut für Molekulare Zellbiologie Westfälische Wilhelms-Universität Münster Institut für Molekulare Zellbiologie Vorlesung "Grundlagen der Biologie I" WS 2013/14 Molekulargenetik 25.11. - 20.12.2013 Püschel 2013 Vorlesung Grundlagen der

Mehr

Die antivirale Therapie der chronischen Hepatitis B: Identifikation neuer Resistenzmutationen und Optimierung der Verlaufskontrolle

Die antivirale Therapie der chronischen Hepatitis B: Identifikation neuer Resistenzmutationen und Optimierung der Verlaufskontrolle Angefertigt am Fachbereich 08 - Biologie und Chemie in Zusammenarbeit mit dem Institut für Medizinische Virologie am Fachbereich 11- Medizin der Justus-Liebig-Universität Gießen Die antivirale Therapie

Mehr

Skript zum Kurz-Referat: Was sind Gene, was können sie? Was ist Umwelt?

Skript zum Kurz-Referat: Was sind Gene, was können sie? Was ist Umwelt? Prof. Dr. Klaus-Jürgen Tillmann/ Michael Lenz WS 2001/02 Fakultät für Pädagogik (AG 4) der Universität Bielefeld Seminar: Anlage und Umwelt: Der pädagogische Streit seit den 50er Jahren 2. Sitzung: Grundbegriffe

Mehr

Kombinatorik von Zahlenfolgen

Kombinatorik von Zahlenfolgen 6. April 2006 Vorlesung in der Orientierungswoche 1 Kombinatorik von Zahlenfolgen Einige Beispiele Jeder kennt die Fragen aus Intelligenztests, in denen man Zahlenfolgen fortsetzen soll. Zum Beispiel könnten

Mehr

Schimmelpilze aus mikrobiologischer Sicht. Dr. Daniel Mayer Corak AG, Zürich

Schimmelpilze aus mikrobiologischer Sicht. Dr. Daniel Mayer Corak AG, Zürich Schimmelpilze aus mikrobiologischer Sicht Dr. Daniel Mayer Corak AG, Zürich Einleitung: Was sind (Schimmel-)Pilze? Wo kommen sie vor? Was brauchen Sie zum Leben? Wie «bewegen» sie sich fort? Wo sind sie

Mehr

Zusammenfassung Genetik

Zusammenfassung Genetik Zusammenfassung Genetik 1 DNA als Träger der genetischen Information Welche Beobachtungen und Experimente haben gezeigt, dass DNA der Träger der Erbinformation ist? 1. Experiment von F. Griffith (1928):

Mehr

Klausur Ingenieurpsychologie Sommersemester 2016

Klausur Ingenieurpsychologie Sommersemester 2016 Prüfungsinfos Klausur Ingenieurpsychologie Sommersemester 2016 Psychologie Alle anderen Zeit Zeit: 10.08.2016, 11:10 Uhr Ort HSZ/02/E POT/81/H Dauer 90 min 60 min Inhalte Vorlesung + Seminar Vorlesung

Mehr

Protein-NMR. Vertiefungsfach Analytische Chemie (WS2015/16) Dr. Peter Bellstedt NMR Plattform IAAC & IOMC

Protein-NMR. Vertiefungsfach Analytische Chemie (WS2015/16) Dr. Peter Bellstedt NMR Plattform IAAC & IOMC Protein-NMR Vertiefungsfach Analytische Chemie (WS2015/16) Dr. Peter Bellstedt NMR Plattform IAAC & IOMC Peter.Bellstedt@uni-jena.de Themenübersicht Termin 1 am 30.11.15: Biochemie von Proteinen (Aufbau,

Mehr

Impressum. Zarenga GmbH, Bonn Zarenga GmbH, Pfaffenweg 15, Bonn. Alle Rechte sind vorbehalten.

Impressum. Zarenga GmbH, Bonn Zarenga GmbH, Pfaffenweg 15, Bonn. Alle Rechte sind vorbehalten. BORRELIOSE RATGEBER Impressum Zarenga GmbH, Bonn 2015 Zarenga GmbH, Pfaffenweg 15, 53227 Bonn Alle Rechte sind vorbehalten. Dieses Buch, einschließlich seiner einzelnen Teile ist urheberrechtlich geschützt.

Mehr

Neue Diagnostik für akute myeloische Leukämie

Neue Diagnostik für akute myeloische Leukämie Neue Diagnostik für akute myeloische Leukämie Neuherberg (9. März 2011) - Wissenschaftler des Helmholtz Zentrums München und der Ludwig-Maximilians-Universität München haben eine Methode entwickelt, mit

Mehr

Biotechnologische Herstellung von Chitosanen

Biotechnologische Herstellung von Chitosanen Für eine narbenfreie Wundheilung Biotechnologische Herstellung von Chitosanen Münster (7. April 2011) - Krabbenschalen liefern wertvolle Rohstoffe: sogenannte Chitosane. Diese Zuckerverbindungen können

Mehr

Antibiotika, mit Sinn und Verstand einsetzen!

Antibiotika, mit Sinn und Verstand einsetzen! Antibiotika, mit Sinn und Verstand einsetzen! Liebe Bürgerinnen und Bürger, die Einführung von Antibiotika zählt zu den bedeutendsten Fortschritten der Medizin im 20. Jahrhundert. Mit Antibiotika können

Mehr

Prüfungsfragenkatalog für Diagnostik (Prof. Astrid Ortner)

Prüfungsfragenkatalog für Diagnostik (Prof. Astrid Ortner) Prüfungsfragenkatalog für Diagnostik (Prof. Astrid Ortner) Stand: Dezember 2016 Termin: 15.12.2016 1. POCT-Systeme: Definition, Beispiele, Vorteile, Begriffserklärung 2. Leberdiagnostik GGT: Wann wird

Mehr

MOLEKULARBIOLOGIE. Repetitorium für Studierende der Human- und Veterinär-Medizin

MOLEKULARBIOLOGIE. Repetitorium für Studierende der Human- und Veterinär-Medizin MOLEKULARBIOLOGIE Repetitorium für Studierende der Human- und Veterinär-Medizin Prof. Hans Trachsel Institut für Biochemie und Molekularbiologie der Universität Bern Version 2002 1 Inhalt: EINLEITUNG 3

Mehr

Mein Lern-Tagebuch Arbeitsaufträge

Mein Lern-Tagebuch Arbeitsaufträge Mein Lern-Tagebuch Arbeitsaufträge Name: Mein kleines Lexikon zu Arbeitsaufträgen Mit diesem Wort habe ich mich beschäftigt: So erkläre ich es in meinen eigenen Worten: Wörterrätsel kannst du helfen, das

Mehr

Evolutionsfaktoren. = Gesamtheit der Gene aller Individuen einer Population bleibt nach dem HARDY-WEINBERG-Gesetz unter folgenden Bedingungen

Evolutionsfaktoren. = Gesamtheit der Gene aller Individuen einer Population bleibt nach dem HARDY-WEINBERG-Gesetz unter folgenden Bedingungen Evolutionsfaktoren 1 Genpool = Gesamtheit der Gene aller Individuen einer bleibt nach dem HARDY-WEINBERG-Gesetz unter folgenden Bedingungen gleich: keine Mutationen alle Individuen sind für Umweltfaktoren

Mehr

Fragen zum Versuch 1. Kohlenhydrate. Fragen zum Versuch 2. Aminosäuren. Fragen zum Versuch 3. Lipide

Fragen zum Versuch 1. Kohlenhydrate. Fragen zum Versuch 2. Aminosäuren. Fragen zum Versuch 3. Lipide Fragen zum Versuch 1 Kohlenhydrate 1) Worin unterscheiden sich chemisch die folgenden Kohlenhydrate? a) Glucose und Fructose b) Laktose und Saccharose c) Stärke, Glykogen und Dextrin d) Was ist Agar-Agar,

Mehr

Antibiotika-Resistenz: Aktuelle Herausforderungen in der Veterinärmedizin

Antibiotika-Resistenz: Aktuelle Herausforderungen in der Veterinärmedizin Antibiotika-Resistenz: Was kann ich konkret dagegen unternehmen? Alumni-Vorlesung, 28. April 2016, Bern Antibiotika-Resistenz: Aktuelle Herausforderungen in der Veterinärmedizin Prof. Dr Vincent Perreten

Mehr

Kapitel 8 Grundsätzliche Informationen über die autosomal rezessive Vererbung

Kapitel 8 Grundsätzliche Informationen über die autosomal rezessive Vererbung 97 Kapitel 8 Grundsätzliche Informationen über die autosomal rezessive Vererbung von Sandra Grilliot (Der Artikel wurde - mit unserem Dank - der Frühjahrsausgabe 1991 von TEXGENE entnommen.) Wie schwer

Mehr

4. Plastiden und die Vakuole sind pflanzentypische Organellen. Charakterisieren Sie beide hinsichtlich des Aufbaus und der Funktion.

4. Plastiden und die Vakuole sind pflanzentypische Organellen. Charakterisieren Sie beide hinsichtlich des Aufbaus und der Funktion. Beispiele für Klausurfragen 1. Pflanzen unterscheiden sich im Aufbau der Zellen von den anderen Organismengruppen. a) Welcher stammesgeschichtliche Hintergrund liegt diesem Aufbau zugrunde? b) Charakterisieren

Mehr

1. Zeichnen und beschriften Sie die stereochemische Struktur von L- Threonin. Geben Sie an, ob R- oder S-Konfiguration vorliegt.

1. Zeichnen und beschriften Sie die stereochemische Struktur von L- Threonin. Geben Sie an, ob R- oder S-Konfiguration vorliegt. Übung und Lösung zur Übung Aminosäuren 1. Zeichnen und beschriften Sie die stereochemische Struktur von L- Threonin. Geben Sie an, ob R- oder S-Konfiguration vorliegt. 2. Das Tripeptid Glutathion ( -Glu-Cys-Gly)

Mehr

Auswertung und Lösung

Auswertung und Lösung Dieses Quiz soll Ihnen helfen, Kapitel 4.7 und 4.8 besser zu verstehen. Auswertung und Lösung Abgaben: 71 / 265 Maximal erreichte Punktzahl: 8 Minimal erreichte Punktzahl: 0 Durchschnitt: 5.65 Frage 1

Mehr

NMR-Methoden zur chiralen Erkennung

NMR-Methoden zur chiralen Erkennung Spektroskopie in der rganischen hemie NMR-Methoden zur chiralen Erkennung Mit Ausnahme der D-Spektroskopie (D = irculardichroismus) sind alle spektroskopischen Methoden auch die NMR achiral, d.h. sie können

Mehr

Vergleich von IVF hescs mit NT hescs bzw. mit hipscs

Vergleich von IVF hescs mit NT hescs bzw. mit hipscs ESF II / 5 WS2014 7. Dst 26.11.2014 Vergleich von IVF ipsc und SCNT ESCs auf molekularer Ebene Ethische und sozio ökonomische Güterabwägung zum SCNT, therapeutischen und reproduktiven Klonens von Menschen

Mehr

Das Zytoskelett. Struktur der Intermediärfilamente. Polymerisation/ Depolymerisation. Einteilung der Intermediärfilamente

Das Zytoskelett. Struktur der Intermediärfilamente. Polymerisation/ Depolymerisation. Einteilung der Intermediärfilamente Das Zytoskelett Struktur der Intermediärfilamente Polymerisation/ Depolymerisation Einteilung der Intermediärfilamente Zell-Zell- und Zell-Matrix-Verbindungen Einteilung der Zytoskelettsysteme Aktin-Mikrofilamente

Mehr

ANGABEN ZUM EMPFÄNGERORGANISMUS 1

ANGABEN ZUM EMPFÄNGERORGANISMUS 1 ANGABEN ZUM EMPFÄNGERORGANISMUS 1 I. CHARAKTERISIERUNG DES EMPFÄNGERORGANISMUS 1. Vollständiger Name, taxonomischer Name bei Mikroorganismen sowie Zellkulturen (i.s. von 3 Nr. 1 und 1a GenTSV) Ursprung

Mehr

Unterrichtsvorhaben IV: Thema/Kontext: Enzyme im Alltag Welche Rolle spielen Enzyme in unserem Leben/beim Ablauf verschiedener Stoffwechselreaktionen?

Unterrichtsvorhaben IV: Thema/Kontext: Enzyme im Alltag Welche Rolle spielen Enzyme in unserem Leben/beim Ablauf verschiedener Stoffwechselreaktionen? Unterrichtsvorhaben IV: Thema/Kontext: Enzyme im Alltag Welche Rolle spielen Enzyme in unserem Leben/beim Ablauf verschiedener Stoffwechselreaktionen? Inhaltsfelder: IF 1 (Biologie der Zelle), IF 2 (Energiestoffwechsel)

Mehr

URSPRUNG UND EVOLUTION VON ARCHAEEN - EINE ABHANDLUNG AUF STAND VON 2006

URSPRUNG UND EVOLUTION VON ARCHAEEN - EINE ABHANDLUNG AUF STAND VON 2006 URSPRUNG UND EVOLUTION VON ARCHAEEN - EINE ABHANDLUNG AUF STAND VON 2006 Patrick Dörner Seminar Modul 13 Wintersemester 14/15 Johannes Gutenberg Universität Mainz GLIEDERUNG 1. Einführung Archaea 2. Die

Mehr

Datenstrukturen & Algorithmen

Datenstrukturen & Algorithmen Datenstrukturen & Algorithmen Matthias Zwicker Universität Bern Frühling 2010 Übersicht Dynamische Programmierung Einführung Ablaufkoordination von Montagebändern Längste gemeinsame Teilsequenz Optimale

Mehr

Fehlerquellen in Klausuren Hinweise und Übungen

Fehlerquellen in Klausuren Hinweise und Übungen 1 Fehlerquellen in Klausuren Hinweise und Übungen Einleitung/Einleitungssatz 1. Der erste Satz enthält die zentralen Angaben (Autor, Gattung, Titel, Entstehungszeit und das Thema in einem Satz). 2. Wichtig:

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt: Aldehyde, Ketone und Kohlenhydrate

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt: Aldehyde, Ketone und Kohlenhydrate Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Lernwerkstatt: Aldehyde, Ketone und Kohlenhydrate Das komplette Material finden Sie hier: School-Scout.de Titel: Lernwerkstatt: Aldehyde,

Mehr

Funktion und Hemmung der Carboanhydrase

Funktion und Hemmung der Carboanhydrase Funktion und emmung der Carboanhydrase 1 Aufgabe Lesen ie den folgenden Text über Funktion, Wirkung und emmung der Carboanhydrase genau. Lösen ie als Lernkontrolle die Aufgaben auf der letzten eite (Einzelarbeit).

Mehr

(vereinfacht auch Produkt) überführt. Substrat (Vorstufe) Intermediat (Zwischenstufe) Intermediat Produkt. Vorstufe Intermediat Produkt

(vereinfacht auch Produkt) überführt. Substrat (Vorstufe) Intermediat (Zwischenstufe) Intermediat Produkt. Vorstufe Intermediat Produkt 20 Biosynthese chemische Eigenschaften pflanzlicher Naturstoffe auch Polyketide, insbesone Anthrachinone. Letztere interferieren auch mit Adenylylcyclase, m Enzym das den Botenstoff camp (zyklisches Adenosinmonophosphat)

Mehr

Die elektrophile Addition

Die elektrophile Addition Die elektrophile Addition Roland Heynkes 3.10.2005, Aachen Die elektrophile Addition als typische Reaktion der Doppelbindung in Alkenen bietet einen Einstieg in die Welt der organisch-chemischen Reaktionsmechanismen.

Mehr

ESBL. Konsequenzen für die ambulante Pflege

ESBL. Konsequenzen für die ambulante Pflege ESBL Konsequenzen für die ambulante Pflege ESBL = Extended spectrum Betalaktamase ß Laktamase: Ein Enzym, das von den Bakterien gebildet wird und den ß-Laktam Ring der folgenden ß-Laktam Antibiotika. Diese

Mehr

Schulinterner Arbeitsplan für den Doppeljahrgang 7./8. im Fach Biologie Verwendetes Lehrwerk: BIOSKOP 7/8

Schulinterner Arbeitsplan für den Doppeljahrgang 7./8. im Fach Biologie Verwendetes Lehrwerk: BIOSKOP 7/8 Thema Inhaltskompetenzen Prozesskompetenzen Bezug zum Methodencurriculum (in Zukunft) Vorschlag Stunden - zahl Lebewesen bestehen aus Zellen 6 Die Schülerinnen und Schüler Das Mikroskop Pflanzen- und Tierzellen

Mehr