Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen"

Transkript

1 Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Vorbereitung auf diesen Praktikumsteil: Organisation - Für den Bioinformatik-Teil benötigen Sie pro Gruppe einen Laptop - Installieren Sie den sequencher auf diesem Laptop - Stellen Sie sicher, dass der Akku am Praktikumstag vollständig geladen ist (die Anzahl der Steckdosen im Seminarraum ist begrenzt) - Stellen Sie sicher, dass Sie über das Uni-Netzwerk Zugang zum Internet haben. Lesen Sie das gesamte Script als Vorbereitung auf das Praktikum durch. - Was sind MADS-Box-Gene? - Mit welchen Methoden können cdna-sequenzen vervollständigt werden. - Wie funktioniert die PCR? Welche Faktoren beeinflussen das PCR-Ergebnis. - Was sind Plasmide? - Welche Eigenschaft muss ein Plasmid haben, um als Klonierungsvektor benutzt werden zu können? - Erklären sie das Prinzip der Plasmidreinigung mittels der alkalischen Lyse. - Was sind Restriktionsenzyme? - Was ist sequence assembly? - Welche Programme gibt es für das sequence assembly? - Wie funktioniert die Sanger-Sequenzier-Methode mit Fluoreszenzmarkierung? - Wie beeinflussen die Parameter minimum match percentage und minimum overlap das sequence assembly? - Was ist eine BLAST-Suche und wie funktioniert diese? - Welche Informationen können Sie aus der BLAST-Suche über das von Ihnen sequenzierte Gen gewinnen? Seite 1 von 11

2 Tag 1 Tag 2 Tag 2 Abb. 1: Übersicht über den Ablauf des Praktikumsteil 3 - RACE-PCR und Klonierung von MADS-Box-Genen aus Monokotylen. Im Praktikum wird Ihnen cdna zur Verfügung gestellt, so dass die 3 RACE-PCR das 1. Experiment von diesen Praktikumsteil sein wird. Seite 2 von 11

3 1. Rapid Amplification of cdna Ends (RACE-PCR) Die Methode der RACE-PCR ermöglicht es, die vollständige Sequenz von cdnas zu ermitteln. Ausgehend von einer bekannten Sequenz im Transkript kann das 5 -Ende (5 -RACE-PCR) bzw. das 3 -Ende (3 -RACE-PCR) untersucht werden. Bei der 3 -RACE-PCR verwendet man für die cdna-synthese einen oligo(dt)-primer, an dessen 5 Ende sich eine sogenannte Ankersequenz befindet. Dieser Oligo(dT)-Primer bindet im Bereich des Poly(A)-Schwanzes der mrna. Die Amplifizierung der cdna wird unter Verwendung jeweils eines transkriptund eines ankerspezifischen Primers durchgeführt. Abb. 2: Schematische Übersicht einer 3 RACE-PCR (Protocols & Applicatios Guide, rev. 3/11) 1.1. Pipettieren Sie folgenden Komponenten in der angegebenen Reihenfolge auf Eis: Komponente Endkonzentration bzw. Menge in einem Reaktionsansatz ddh 2 O 10x Reaktionspuffer 1x dntp Mix (je 10 mm) je 400 µm Ankerprimer (50 µm) 1 µm Primer (50 µm) 1 µm cdna template variabel 1 µl Taq (5 U/µl) 2 U Endvolumen: 50 µl Eingesetzte Menge 1.2. Mischen Sie den Reaktionsansatz und zentrifugieren Sie diesen kurz an. Stellen Sie ihre PCR-Reaktion so lange auf Eis bis das PCR-Programm gestartet wird. Seite 3 von 11

4 1.3. PCR-Programm: Bezeichnung Temperatur [ C] Zeit Initiale Denaturierung 96 2 min Denaturierung sec Primer-Annealing variabel 30 sec 30 x Elongation 72 1 min Abschließende Elongation min 4 hold 1.4. Nach der PCR pipettieren Sie 15 µl der PCR in ein neues und gut beschriftetes 1,5 ml tube für eine spätere nested-pcr Geben sie zu den restlichen 35 µl der PCR-Reaktion 0,1x Volumen DNA-Ladepuffer Gelelektrophorese: 1% iges Agarose Gel mit großen Taschen, 120 V 1.7. Ausschneiden von DNA-Banden. DNA im Agarosegel kann auf Eis aufbewahrt werden oder bei - 20 C für eine längere Lagerung. 2. Nested-PCR Manchmal erhält man nach der ersten Amplifizierungsrunde von cdna keine spezifischen Banden. Um die Spezifität und Sensititvität der PCR zu erhöhen, kann man die nested-pcr (verschachtelte PCR) anwenden. Für eine nested-pcr wird eine geringe Menge des PCR-Ansatzes aus der ersten Amplifikationsrunde genommen und für eine zweite PCR (die nested-pcr) mit anderen Primern verwendet. Die Primer der zweiten PCR-Runde binden auf dem zu amplifizierenden DNA-Fragment weiter innen als die Primer für die erste PCR-Runde. Somit werden nur die DNA-Stücke aus der ersten PCR-Runde amplifiziert die eine entsprechende Bindungsstelle für die Primer der zweiten PCR-Reaktion enthalten Pipettieren Sie folgenden Komponenten in der angegebenen Reihenfolge auf Eis: Komponente Endkonzentration bzw. Menge in einem Reaktionsansatz ddh 2 O 10x Reaktionspuffer 1x dntp Mix (je 10 mm) je 400 µm Ankerprimer (50 µm) 1 µm Primer (50 µm) 1 µm Template: 1. PCR reaktion Taq (5 U/µl) variabel 2 U Endvolumen: 50 µl Eingesetzte Menge 2.2. Mischen Sie den Reaktionsansatz und zentrifugieren Sie diesen kurz an. Stellen Sie ihre PCR-Reaktion so lange auf Eis bis das PCR-Programm gestartet wird. Seite 4 von 11

5 2.3. PCR-Programm: Bezeichnung Temperatur [ C] Zeit Initiale Denaturierung 96 2 min Denaturierung sec Primer-Annealing variabel 30 sec 30 x Elongation 72 1 min Abschließende Elongation min 4 hold 2.4. Nach der PCR pipettieren Sie 15 µl der PCR in ein neues und gut beschriftetes 1,5 ml tube für eine evtl. spätere zweite nested-pcr Geben sie zu den restlichen 35 µl der PCR-Reaktion 0,1x Volumen DNA-Ladepuffer Gelelektrophorese: 1% iges Agarose Gel mit großen Taschen, 120 V 2.7. Ausschneiden von DNA-Banden. DNA im Agarosegel kann (in einem 1,5 ml bzw. 2 ml tube) auf Eis aufbewahrt werden oder bei -20 C für eine längere Lagerung. 3. Aufreinigen von DNA-Fragmenten aus dem Agarosegel (mit dem Wizard SV Gel and PCR Clean-Up System der Firma Promega) Auflösen des Agarosegelstücks: 4.1. Geben Sie zu dem Agarosegelstück mit DNA 350 µl Membrane Binding Solution Vortexen Sie und inkubieren Sie solange bei 56 C bis das Gelstück komplett gelöst ist. Vortexen Sie kurz ca. alle 2 3 min während der Inkubationszeit, um den Lösungsvorgang zu beschleunigen. Bindung der DNA an die Säulchen: 4.1. Stecken Sie eine SV-Minisäulchen in ein Sammel-Tube Geben sie das gelöste Agarosegel aus Schritt 4.1 auf das Säulchen Inkubieren Sie 1 min bei Raumtemperatur Zentrifugieren Sie für 1 min bei x g Geben Sie den Durchfluß in den Flüssigabfall. Waschen 4.6. Geben Sie 700 µl Membrane Wash Solution (mit EtOH) auf das Säulchen 4.7. Zentrifugieren Sie für 1 min bei x g Geben Sie den Durchfluß in den Flüssigabfall Geben Sie 500 µl Membrane Wash Solution (mit EtOH) auf das Säulchen Zentrifugieren Sie für 5 min bei x g Geben Sie den Durchfluß in den Flüssigabfall. Seite 5 von 11

6 4.12. Zentrifugieren Sie das Säulchen mit Sammel-Tube erneut für 1 min bei x g um das restliche Ethanol von dem Säulchen zu entfernen. Elution der DNA vom Säulchen Stecken Sie das Säulchen mit der gewaschenen DNA in ein gut beschriftetes 1,5 ml tube Geben Sie 30 µl ddh 2 O in die Mitte des Säulchens. Die Membran mit der Pipettenspitze nicht berühren! Inkubieren Sie 1 min bei Raumtemperatur Zentrifugieren Sie für 1 min bei x g Lagern der DNA bei -20 C bzw. 4 C möglich. 4. pjet-klonierung (mit dem CloneJet PCR Cloning Kit von Thermo Scientific) Die eluierten PCR-Produkte werden in den Klonierungsvektor pjet1.2/blunt ligiert und anschließend in chemokompetente E. coli DH5α transformiert. Der pjet1.2/blunt Vektor ist ein linearisierter Vektor, so dass DNA-Fragmente direkt in den Vektor ligiert werden können. Der Vektor enthält in der Multiplen Cloning Site (MCS) das Gen eco47ir, dessen Genprodukt lethal für die Bakterienzelle ist. Durch die Ligation eines DNA Fragmentes in die MCS wird die Sequenz des Gens eco47ir unterbrochen. Demzufolge werden nach der Transformation nur die E. coli Zellen wachsen können, welche nur das rekombinante Plasmid aufgenommen haben. Zellen welche den rezirkularisierten Vektor aufgenommen haben, können nicht wachsen. Seite 6 von 11

7 Abb. 2: Da die Taq-Polymerase PCR-Produkte mit einem 3 -da Überhang produziert, müssen diese Überhänge in der sogenannten blunting reaction mittels dem DNA Blunting Enzym vom PCR-Produkt entfernt werden. Das DNA Blunting Enzym ist eine thermostabile DNA Polymerase mit proofreading Aktivität. Es entfernt 3 - Überhänge und füllt 5 Enden auf Blunting Reaction Pipettieren Sie folgenden Ansatz auf Eis 5 µl 2x Reaction Buffer 2,5 µl ddh 2 O 1 µl eluiertes PCR-Produkt 0,5 µl DNA Blunting Enzym Kurz vortexen und anzentrifugieren Inkubation: 70 C, 5 min Auf Eis abkühlen Seite 7 von 11

8 4.2. Ligation Zum Reaktionsansatz aus Schritt 4.1 pipettieren Sie folgende Reagenzien auf Eis: 0,5 µl pjet1.2 blunt Cloning Vector 0,5 µl T4 DNA Ligase Kurz vortexen und anzentrifugieren Inkubation: 22 C, 15 min 5. Transformation von E. coli mittels der CaCl 2 -Methode Eine einfache Methode freie DNA in Bakterienzellen zu schleusen ist die Calciumchlorid-Methode mit Hitzeschock. Da die Membran der Bakterienzelle und die zu transformierende DNA negativ geladen sind, stoßen sich diese ab. Um diesen Abstoßungseffekt zu reduzieren, werden die Zellen durch Behandlung mit CaCl 2 kompetent gemacht. Ein kurzer Hitzeschock von 42 C erhöht die Membranfluidität, so dass die DNA in die Zelle gelangen kann µl chemokompetente E. coli- Zellen (Stamm DH5α) werden auf Eis aufgetaut Pipettieren Sie den gesamten Ligationsansatz aus Schritt 4.2 zu den chemokompetenten Zellen Inkubieren Sie den Transformationsansatz 30 min auf Eis Führen Sie den Hitzeschock durch: Inkubation der Zellen für 2 min bei 42 C Stellen Sie die Zellen nach dem Hitzeschock unmittelbar auf Eis Geben Sie 1 ml LB-Medium zum Transformationsansatz Inkubieren Sie den Transformationsansatz mindestens 30 min bei 37 C Zentrifugieren Sie den Transformationsansatz 1 min bei rpm Entfernen Sie den Überstand vorsichtig mit einer Pipette. Benutzen Sie für jeden Transformationsansatz eine neue Spitze. Sollten Sie ausversehen das Pellet mit pipettieren, wiederholen Sie den Schritt Resuspensieren Sie das Bakterienpellet in 100 ml LB-Medium Plattieren sie 30 µl des Transformationsansatzes auf einer LB-Platte mit Ampicillin. Der restliche Transformationsansatz wird bei 4 C aufbewahrt Inkubieren Sie die Transformationsplatte ü.n. bei 37 C. Auswertung: Warum müssen wir die transformierten Zellen auf LB-Platten mit Ampicillin ausplattieren? Wie wirkt Ampicillin? Welche Kolonien werden nur auf der Platte wachsen und warum? Seite 8 von 11

9 6. Kolonie-PCR Mittels Kolonie-PCR kann man schnell nach einer Transformation entsprechende E. coli - Kolonien identifizieren, welche das gewünschte Plasmidkonstrukt (d.h. Plasmid + Insert) aufgenommen haben. Für die Kolonie-PCR wird keine DNA isoliert, sondern ganze E. coli Zellen eingesetzt. Im vorliegenden Protokoll werden mittels der Initialen Denaturierung bei 94 C, 7 min die Zellen aufgeschlossen. verwendete Primer: pjet1.2 for: CGACTCACTATAGGGAGAGCGGC pjet1.2 rev: AAGAACATCGATTTTCCATGGCAG Es werden 4 Kolonien pro Transformation untersucht Pipettieren Sie folgenden Komponenten in der angegebenen Reihenfolge auf Eis: Komponente Endkonzentration bzw. Menge in einem Reaktionsansatz ddh 2 O 10x Reaktionspuffer 1x dntp Mix (je 2 mm) je 200 µm pjet 1.2 for (10 µm) 0,2 µm pjet1.2 rev (10 µm) 0,2 µm Homemade Taq (1 U/µl) 1,5 U Endvolumen: 25 µl Eingesetzte Menge 6.2. Mischen Sie den Master-Mix, zentrifugieren Sie diesen kurz an und aliquotieren Sie diesen zu je 25 µl in ein PCR tube auf Eis Picken Sie eine Einzelkolonie mit einer weißen Spitze und beimpfen damit eine Masterplatte (LB mit Ampicillin). Anschließend stellen Sie diese weiße Spitze in ein PCR tube mit dem PCR-Mix. Die Masterplatte wird über Nacht bei 37 C inkubiert PCR-Programm: Bezeichnung Temperatur [ C] Zeit Initiale Denaturierung 94 7 min Denaturierung sec Primer-Annealing sec 30 x Elongation 72 1 min Abschließende Elongation min 4 hold 6.5. Geben sie 0,1x Volumen DNA-Ladepuffer zur PCR 6.6. Gelelektrophorese: 1% iges Agarose Gel mit kleinen Taschen, 120 V Auswertung: Wie groß müsste die DNA-Bande für Ihr erwartetes PCR-Produkt sein? Finden Sie eine Erklärung für Banden unerwarteter Größe. Seite 9 von 11

10 7. Plasmid-Aufreinigung (mit dem GeneJET Plasmid Miniprep Kit von Thermo Scientific) Von der Transformation aus Schritt 5 wurden je 1-2 Kolonien in 2 ml flüssiges LB mit Ampicillin in einem Reagenzglas angeimpft und über Nacht bei 37 C geschüttelt. Aus dieser Kultur sollen Sie heute das Plasmid isolieren, welches in der Transformation im Schritt 5 von E. coli aufgenommen wurde. Durch einen anschließenden Restriktionsverdau (Schritt 9) kontrollieren Sie, ob das Plasmid auch das PCR-Produkt als Insert enthält. Die Isolierung der Plasmid-DNA aus E.coli geschieht nach dem Prinzip der alkalischen Lyse der Bakterien. Die E. coli Kultur wird abzentrifugiert und in EDTA-haltigem Puffer resuspendiert. EDTA destabilisiert die Zellwand durch Komplexierung von zweiwertigen Ionen wie Mg 2+, Ca 2+. Anschließend werden die Bakterien mit Hilfe von SDS lysiert und die DNA durch NaOH denaturiert. Durch Zugabe von Kaliumacetat wird das Lysat neutralisiert. Denaturierte Proteine und chromosomale DNA präzipitieren mit dem Kaliumsalz des Dodecylsulfats. Die niedermolekulare Plasmid-DNA bleibt dabei in Lösung und kann renaturieren. Die unlöslichen Komponenten (denaturierte Proteine, hochmolekulare RNA, denaturierte chromosomale DNA, bakterieller Zelldebris) werden abzentrifugiert und im klaren Überstand befindet sich die Plasmid-DNA. Diese wird über Säulchen aufgereinigt Geben Sie 1 ml der E. coli-kultur in ein 1,5 ml tube Zentrifugieren Sie für 1 min bei x g Pipettieren Sie den Überstand mit einer blauen Pipettenspitze vorsichtig ab und geben Sie den Überstand in den flüssigen S1-Abfall. Sollten Sie ausversehen das Pellet mit pipettieren, wiederholen Sie den Schritt Resuspendieren Sie das Zellpellet in 250 µl Resuspensions Solution mit RNaseA durch auf- und abpipettieren. Achten Sie darauf, dass das Pellet komplett resuspendiert ist Alkalische Lyse: Geben Sie zu den resuspendierten Zellen 250 µl Lysis Solution. Mischen Sie unmittelbar nach Zugabe der Lösung durch viermaliges Invertieren des tubes. Nicht vortexen! es kann zum scheren der chromosomalen DNA kommen. Nicht länger als 5 min inkubieren, um eine Denaturierung der Supercoiled Plasmid-DNA zu verhindern Inkubieren Sie 2 min bei Raumtemperatur Neutralisation: Geben Sie 350 µl Neutralisation Solution dazu. Mischen Sie unmittelbar nach Zugabe der Lösung durch vier- bis sechsmaliges Invertieren des tubes. Reinigung: 7.8. Pipettieren Sie den klaren Überstand auf ein Säulchen des GeneJET -Kits. Vorsicht: nicht das weiße Präzipitat mitpipettieren 7.9. Zentrifugieren Sie für 1 min bei x g Geben Sie den Durchfluß in den Flüssigabfall Geben Sie 500 µl Wash Solution (mit EtOH) auf das Säulchen Zentrifugieren Sie für 1 min bei x g Geben Sie den Durchfluß in den Flüssigabfall Geben Sie erneut 500 µl Wash Solution (mit EtOH) auf das Säulchen. Seite 10 von 11

11 7.15. Zentrifugieren Sie für 1 min bei x g Geben Sie den Durchfluß in den Flüssigabfall Zentrifugieren Sie erneut für 1 min bei x g um den restlichen EtOH zu entfernen Stecken Sie das Säulchen in ein neues und gut beschriftetes 1,5 ml tube Geben Sie 50 µl nucleasefreies ddh 2 O auf das Säulchen Inkubieren Sie für 2 min bei Raumtemperatur Zentrifugieren Sie für 2 min bei x g Messen Sie die DNA-Konzentration Gereinigte Plasmid-DNA kann bei -20 C gelagert werden. 8. Restriktionsverdau von Plasmiden 8.1. Pipettieren Sie folgende Kompenten in der angegebenen Reihenfolge auf Eis: Komponente ddh 2 O 10x Reaktionspuffer 1x Plasmid-DNA 1 µg Restriktionsenzyme (10 U/µl) Endkonzentration bzw. Menge in einem Reaktionsansatz 5 U Endvolumen: 20 µl Eingesetzte Menge 8.2. Kurz vortexen und anzentrifugieren 8.3. Inkubieren Sie die Reaktion 1-3 Stunden bei 37 C Geben sie 0,1x Volumen DNA-Ladepuffer zum Restriktionsverdau 8.5. Gelelektrophorese: 1% iges Agarose Gel mit kleinen Taschen, 120 V Auswertung: Wie viele Banden erwarten Sie nach dem Restriktionsverdau, wenn Ihr aufgereinigtes Plasmid das Insert enthält? Wie groß sind diese Banden? 9. Anhang Abb. 3: GeneRuler DNA Ladder Mix (Thermo Scientific) Seite 11 von 11

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Vorbereitung auf diesen Praktikumsteil: Organisation 2. Praktikumstag: - Für den Bioinformatik-Teil benötigen Sie am 2. Tag dieses

Mehr

3 GFP green fluorescent protein

3 GFP green fluorescent protein SCHNUPPERKURS GENTECHNIK 1 ExploHeidelberg 2 Klonierung des Phagen Lambda 3 GFP green fluorescent protein 4 Gens in a bottle Vanessa Hecht 1 ExploHeidelberg Stiftung Jugend und Wissenschaft GmbH Technologiepark

Mehr

Plasmidpräparation aus Bakterien Inhalt

Plasmidpräparation aus Bakterien Inhalt Inhalt Einleitung... 2 Materialien... 4 Gewinnung der Bakterien... 6 Zerstörung der Bakterien... 7 Trennung von Plasmid-DNA und genomischer DNA... 8 Reinigung der Plasmid-DNA... 10 Elution der gereinigten

Mehr

Plasmid DNA purification

Plasmid DNA purification Plasmid DNA purification Excerpt from user manual - Deutsch - NucleoBond Xtra NucleoBond Xtra NucleoBond Xtra Plus NucleoBond Xtra Plus January 2013 / Rev. 11 Plasmid DNA Purification Deutsch Einleitung

Mehr

Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern.

Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Plasmidisolierung Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Was können Sie lernen? Sie lernen eine ringförmige DNA, ein Plasmid, zu isolieren. Mit diesem

Mehr

Gentechnologie: Isolierung und Charakterisierung von DNA

Gentechnologie: Isolierung und Charakterisierung von DNA Genetisches Grundpraktikum 9. Kurstag 23.06.2005 Gentechnologie: Isolierung und Charakterisierung von DNA Lerninhalte: Klonierung, Plasmid, Polylinker ( multiple cloning site ), Restriktionsendonuklease,

Mehr

DNA Isolierung. Praktikum Dr. László Kredics

DNA Isolierung. Praktikum Dr. László Kredics Isolierung Praktikum Dr. László Kredics Aufgabe: Isolierung von Plasmid aus Bakterienzellen Plasmid : pbluescript Vektor, Gröβe: 2960 Bps 1. 1,5 ml Bakterienkultur in Eppendorf-Röhrchen pipettieren, 2

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli Reinigung Protein (1) Kolonie-PCR Polymerase

Mehr

Molekulargenetische Experimente IV: Plasmidpräparation

Molekulargenetische Experimente IV: Plasmidpräparation Molekulargenetische Experimente IV: Plasmidpräparation Plasmide sind kleine, ringförmige DNA-Moleküle in Bakterien, die in der Lage sind, sich selbst mit Hilfe von Enzymen zu replizieren. Gene, die auf

Mehr

Reagenzien Isolierung von Nukleinsäuren

Reagenzien Isolierung von Nukleinsäuren Aufbewahrung bei Raumtemperatur Anwendung Isolierung ultrareiner Plasmid-DNA aus Bakterienkulturen von 1 ml bis 800 ml. Die Plasmid-DNA eignet sich für Manuelle und automatisierte Sequenzierung mit Fluoreszenzfarbstoffen

Mehr

1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II

1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II Arbeitsblatt 1 Analyse von DNA 1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II Bevor Sie anfangen: Alle Reagenzien müssen vor Gebrauch vollständig aufgetaut sein und durchmischt

Mehr

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Gruppe 8 Susanne Duncker und Friedrich Hahn Einleitung und Aufgabenstellung Ziel dieses Versuchs ist es, das Gen für ein bestimmtes

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

Molekulare Klonierung Praktikum

Molekulare Klonierung Praktikum Molekulare Klonierung Praktikum 2013 Praktikumsaufgabe Ligation 1. Zusammensetzung des Ligationsreaktions-ansatzes : 1 l Vektor DNA 1 l Insert DNA 2 l 10X Ligase Puffer 15 l destillertes Wasser 1 l Ligase

Mehr

Datasheet. TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe

Datasheet. TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe Features: - Extraktion von RNA, DNA und Proteinen aus der gleichen Probe - Für kleine und große Mengen von Probe - Gleichzeitiges

Mehr

Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil

Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil 2 Inhaltsverzeichnis Sicherheitshinweise DNA-Analytik 1 Arbeitshinweise DNA-Analytik 2 Gießen von Agarosegelen 3 Isolierung genomischer DNA 4 Isolierung

Mehr

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Vorbereitung Lehrer Für jede Arbeitsgruppe werden 550 µl InstaGene-Matrix aliquotiert! Das Tube wird mit IG beschriftet!

Mehr

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in

Mehr

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr

Identifizierung positiver Klone aus einer λ-phagenbibliothek

Identifizierung positiver Klone aus einer λ-phagenbibliothek Identifizierung positiver Klone aus einer λ-phagenbibliothek Betreuer: Elke Muth-Köhne und Nora Cavara Beginn des Versuchs: 9.00 Uhr im Praktikumssaal NBCF 04 Nord 1. Theoretischer Hintergrund 1.1 Screening

Mehr

Modifizierte Gene Editor Mutagenese

Modifizierte Gene Editor Mutagenese Modifizierte Gene Editor Mutagenese zur gleichzeitigen Einführung mehrerer Punktmutationen DNA Template Präparation: 2 µg Plasmid DNA (bei 6 kb, sonst entsprechend mehr oder weniger) + 2 µl 2M NaOH, 2

Mehr

Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS

Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Von: Andreas Tschammer, Fachhochschule Aalen-Hochschule f. Technik und Wirtschaft, Fachbereich Chemie, Schwerpunkt Molekulare Biotechnologie Material

Mehr

Laborkurs des Heidelberger Life-Science Lab und des igem-teams Heidelberg 2014 2. Woche/14. 16.07.2014

Laborkurs des Heidelberger Life-Science Lab und des igem-teams Heidelberg 2014 2. Woche/14. 16.07.2014 Laborkurs des Heidelberger Life-Science Lab und des igem-teams Heidelberg 2014 2. Woche/14. 16.07.2014 Tag 1 PCR Die Polymerase-Kettenreaktion (engl. polymerase chain reaction) ermöglicht die selektive

Mehr

AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig

AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig Restriktionsenzyme Füllen Sie den Lückentext aus. PCR 1a Mit dem folgenden Quiz können Sie Ihr Wissen zum Thema PCR überprüfen. Klicken Sie jeweils die richtige Antwort an. PCR 1b Mit dem folgenden Quiz

Mehr

Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1

Mehr

Mycoplasma gallisepticum

Mycoplasma gallisepticum BACTOTYPE PCR Amplification Kit Mycoplasma gallisepticum Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung Sequenzierung von Thomas Grunwald Abteilung für Med. und Mol. Virologie Sequenzierung Hintergrund Allgemeiner Überblick Funktionsweise der Sequenzierung Sequenzierungsprotokoll Auswertung der Daten Probleme

Mehr

Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten

Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten Im diesem Praktikumsteil sollen homöotische Mutanten von Arabidopsis untersucht werden. Abb 1, Aufbau einer Blüte einer

Mehr

peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben.

peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben. peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben. Best.-Nr. 30-2110 100 ml 30-2120 200 ml 30-2130 500 ml Lagerung: Lichtgeschützt bei 4 C für

Mehr

Borrelia burgdorferi s.l.

Borrelia burgdorferi s.l. BACTOTYPE PCR Amplification Kit Borrelia burgdorferi s.l. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers FIGURE 20.1 Biology 6/e Biotechnologie Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli

Mehr

Facharbeit. Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen

Facharbeit. Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen Bernhard Strigel Gymnasium Kollegstufe/ Jahrgang: 2007/ 2009 Memmingen Leistungskurs: Biologie Kollegiat: Stefanie Funk Facharbeit Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen Abgegeben

Mehr

Protokoll zur Übung PCR

Protokoll zur Übung PCR Protokoll zur Übung PCR im Rahmen des Praktikums Labor an der TU Wien Durchgeführt bei Ao.Univ.Prof. Mag. Dr.rer.nat. Robert Mach Verfasser des Protokolls: Gwendolin Korinek 0625083 & Daniel Bomze 0726183

Mehr

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich?

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Im Unterricht habt ihr bereits einige Methoden und Vorgehensweisen der Molekularbiologie kennengelernt. Aber wo finden diese Methoden im täglichen

Mehr

Molekularbiologie I. PCR Klonierung Transformation Southern Blot Hybridisierung BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN V 2.

Molekularbiologie I. PCR Klonierung Transformation Southern Blot Hybridisierung BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN V 2. V 2.6 Molekularbiologie I BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN PCR Klonierung Transformation Southern Blot Hybridisierung Abteilung für Biochemie und Molekularbiologie, Fachbereich

Mehr

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Versuch 1: Restriktionsenzyme als molekulare Werkzeuge Versuchsinhalt Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Zwei

Mehr

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt USERGUIDE Seite 1 No. 201 Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt Temperierbereich: (RT 13 C) bis 99 C [MTPs: (RT 10 C) bis 70 C], Minimal

Mehr

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Einleitung: Drosophila melanogaster hat sich als Modellorganismus in der Entwicklungsbiologie und der Genetik bewährt, und findet

Mehr

Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf

Mehr

Molekularbiologie I BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN. PCR Klonierung Transformation Southern Blot Hybridisierung V 2.

Molekularbiologie I BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN. PCR Klonierung Transformation Southern Blot Hybridisierung V 2. V 2.5 Molekularbiologie I BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN PCR Klonierung Transformation Southern Blot Hybridisierung Abteilung für Biochemie und Molekularbiologie, Fachbereich

Mehr

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig BACTOTYPE PCR Amplification Kit Chlamydia sp. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen

Mehr

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase)

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase) Methodensammlung des LAG PCR-Nachweis der 35S-nptII-Übergangssequenz, der pnapin-bayte- Übergangssequenz und des plsc-gens erstellt vom Unterausschuss Methodenentwicklung des LAG Status: verabschiedet

Mehr

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989).

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3 Methoden 3.1 Isolierung von Cosmid-DNA Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3.2 Präparation von YAC-DNA aus Hefezellen Die Hefe-DNA wurde modifiziert

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

GEBRAUCHSANLEITUNG. Glutatione Agarose Resin

GEBRAUCHSANLEITUNG. Glutatione Agarose Resin GEBRAUCHSANLEITUNG Glutatione Agarose Resin Agarose zur Affinitätsreinigung von GST-Tag-Fusionsproteinen und anderen Glutathion-Bindungsproteinen (Kat.-Nr. 42172) SERVA Electrophoresis GmbH - Carl-Benz-Str.

Mehr

AdnaTest ColonCancerDetect

AdnaTest ColonCancerDetect AdnaTest ColonCancerDetect RT-PCR-Nachweis von Darmkrebs-assoziierter Genexpression in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-505 Inhaltsverzeichnis Bestellinformation...

Mehr

Klonierung von GFP in E.coli

Klonierung von GFP in E.coli Bernhard-Strigel-Gymnasium Memmingen Kollegstufe Jahrgang:...2007/2009 Leistungskurs:...Biologie Kollegiatin:...Nicole Makowski Facharbeit Klonierung von GFP in E.coli Abgegeben am: 30.01.2009 Bewertung:

Mehr

2. MATERIAL UND METHODEN

2. MATERIAL UND METHODEN 2. MATERIAL UND METHODEN 2.1 Bakterienkulturen 2.1.1 Bakterienstämme Die bei den Arbeiten verwendeten Stämme sind sämtlich Derivate des 1922 in Stanford/ Kalifornien isolierten, anerkannten Sicherheitsstammes

Mehr

GFP - Klonierung in E.coli

GFP - Klonierung in E.coli Bernhard-Strigel-Gymnasium Kollegstufe Jahrgang:...2008/2010 Memmingen Leistungskurs:...Biologie Kollegiatin:...Anja Rießenberger Facharbeit GFP - Klonierung in E.coli Abgegeben am Bewertung: Facharbeit:

Mehr

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 1.2.1.1. Molekulare Struktur von NCAM S.

Mehr

1 Einleitung... 13. 1.1 Staphylokokken... 13. 1.2 Koagulase-negative Staphylokokken... 13. 1.4 MSCRAMM-Proteine... 16. 1.5 LPXTG-Motive...

1 Einleitung... 13. 1.1 Staphylokokken... 13. 1.2 Koagulase-negative Staphylokokken... 13. 1.4 MSCRAMM-Proteine... 16. 1.5 LPXTG-Motive... Inhaltsverzeichnis 1 Einleitung... 13 1.1 Staphylokokken... 13 1.2 Koagulase-negative Staphylokokken... 13 1.3 Staphylococcus saprophyticus... 14 1.4 MSCRAMM-Proteine... 16 1.5 LPXTG-Motive... 16 1.6 Oberflächenassoziierte

Mehr

S-Dis Hotstart Polymerase

S-Dis Hotstart Polymerase Datenblatt Artikel-Nr. BS91.219.0200 Artikel-Nr. BS91.219.1000 200 Units 1000 Units (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen: Farbe: 1 Beschreibung Die

Mehr

Fortbildung für Biologen an der Oranienschule

Fortbildung für Biologen an der Oranienschule Fortbildung für Biologen an der Oranienschule Am 28.01.08 fand die erste ganztägige schulinterne Lehrerfortbildung für Biologen an der Oranienschule unter der Leitung von Frau Dr. Wismar und Herrn Bender

Mehr

Pflanze direkt 2x PCR-Mastermix

Pflanze direkt 2x PCR-Mastermix Datenblatt Artikel-Nr. BS91.322.0250 Artikel-Nr. BS91.322.1250 250 Reaktionen in 20 μl 1250 Reaktionen in 20 μl (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen:

Mehr

Nachweis von DNA im Wein

Nachweis von DNA im Wein Abschlussbericht über den Forschungsauftrag Nachweis von DNA im Wein Projektlaufzeit: 01.01.2001 bis 31.03.2003 Prof. Dr. Ralf Kaldenhoff Universität Würzburg Julius-von-Sachs-Institut für Biowissenschaften

Mehr

Produktkatalog 2010. Molekularbiologische Reagenzien

Produktkatalog 2010. Molekularbiologische Reagenzien Produktion, Vertrieb und Serviceleistung im Bereich der Molekularbiologie und Medizin Produktkatalog 2010 Molekularbiologische Reagenzien Molegene GmbH Bienenweg 28 35764 Sinn Tel. 02772-570952 Fax 02772-570945

Mehr

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila 01.-04.03.04 Joachim Marhold, Regine Garcia Boy, Natascha Kunert, Cora Mund, Frank Lyko Programm 01.03.04: Präparation genomischer

Mehr

Gentechnologie: Klonierung und Transformation von DNA

Gentechnologie: Klonierung und Transformation von DNA Grundpraktikum Genetik 8. Kurstag 16.06.2005 Gentechnologie: Klonierung und Transformation von DNA Lerninhalte: Transformation, natürliche Kompetenz, Transformationseffizienz, Vektor, Plasmid, Resistenzgen,

Mehr

Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign

Mehr

Protokoll für MolekularBiologische Praktikum

Protokoll für MolekularBiologische Praktikum Protokoll für MolekularBiologische Praktikum Guan Zhang (Gruppe 6) 4. Mai 2006 Inhaltsverzeichnis 1 Einleitung 2 2 Gewinnung des GFP-codierenden Gens 3 2.1 06.März 2006............................ 3 2.1.1

Mehr

Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese

Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die Regulation der enterobakteriellen Kapselbiosynthese Inaugural-Dissertation zur Erlangung der Doktorwürde vorgelegt

Mehr

Isolierung von Plasmid-DNA aus einem Bakterienlysat mittels Ionenaustauschchromatographie an einer DEAE-Säule

Isolierung von Plasmid-DNA aus einem Bakterienlysat mittels Ionenaustauschchromatographie an einer DEAE-Säule Versuch 2 Isolierung von Plasmid-DNA aus einem Bakterienlysat mittels Ionenaustauschchromatographie an einer DEAE-Säule Versuchsbeschreibung Die Isolierung hochreiner Nucleinsäuren ist eine der grundlegenden

Mehr

Das grün fluoreszierende Protein (GFP)

Das grün fluoreszierende Protein (GFP) Datum Arbeitsplan 17.10.11 S1 Belehrung, kompetente E. coli Zellen herstellen, PCR GFP 24.10.11 Gelelektrophorese GFP, Vortrag, Gel-Aufreinigung, Konzentrationsbestimmung 31.10.11 Reformationstag 07.11.11

Mehr

SCRIPTUM HIGH PRECISE

SCRIPTUM HIGH PRECISE Nur für Forschungszwecke Datenblatt Artikel BS.50.020 = 20 Reaktionen x 50 µl Artikel BS.50.100 = 100 Reaktionen x 50 µl Artikel BS.50. 500 = 500 Reaktionen x 50 µl Haltbarkeit: 12 Monate Lagerung bei

Mehr

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C F1-Praktikum Genetik Protokoll Versuch 2: Nachweis der Funktion von Promotor- und Enhancer-Sequenzen mittels Reportergen-Assay Gruppe 8, Manfred Depner & Susanne Duncker Einführung Um die Funktion von

Mehr

Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli

Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli 1 Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli Organisatorisches: Termine: 24.10.2014; 7.11.2014, 14.11.2014 Beginn: 8.15 Uhr im Seminarraum 124, Philosophenweg 12 Am Beginn

Mehr

NUKLEINSÄUREN UND GENTECHNOLOGIE

NUKLEINSÄUREN UND GENTECHNOLOGIE NUKLEINSÄUREN UND GENTECHNOLOGIE Beispiele für Stoffinhalte aus der Chemie als Grundlage für das Verständnis dieses Teiles: nicht-kovalente chemische Bindungen, Koordinationsbindungen, funktionelle Gruppen

Mehr

11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese

11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese 11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese 11.1 Einführung in die Problemstellung 11.1.1 Plasmid-DNA In der Gentechnik spielen Plasmide als Vektoren eine herausragende Rolle

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans AVID X / 1998 Lawsonia intracellularis Seite -1- Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans 1. ALLGEMEINES

Mehr

DNA Isolierung. Praktikum Dr. László Kredics

DNA Isolierung. Praktikum Dr. László Kredics Isolierung Praktikum Dr. László Kredics SZTE, Inst. für Med. Biol., Praktikum -Isolierung Zellaufschluss Isolierung genomischer Isolierung von Plasmid Konzentrationsbestimmung der -Lösungen Anhand Absorptionswert

Mehr

Bioinformatik I: Grundlagen der Gentechnik

Bioinformatik I: Grundlagen der Gentechnik Bioinformatik I: Grundlagen der Gentechnik Dr. Maik Böhmer Institut für Biologie und Biotechnologie der Pflanzen Schlossplatz 7 Schwerpunkte: Vorlesung 1: Einführung & Enzyme der Gentechnik Vorlesung 2:

Mehr

Charakterisierung von Transkripten mittels RT-PCR

Charakterisierung von Transkripten mittels RT-PCR Charakterisierung von Transkripten mittels RT-PCR Versuchsleiter: Ulrike Gerischer Protokollführung: Karl Varadi Gruppe: 11 Durchführung: 18.11 22.11.2002 Protokoll testiert: WS02 Universität Ulm Inhaltsverzeichnis

Mehr

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 ChromoQuant Das ChromoQuant in vitro Diagnose-Set QF-PCR 1 zur Analyse von häufigen chromosomalen Erkrankungen der Chromosomen 13, 18 und 21 412.001-48u

Mehr

SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!!

SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!! aktualisiert, 08.03.2011, Wera Roth1 SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Anleitung für Minigele Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!! Glasscheiben ordentlich

Mehr

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) Identifizierung von Bakterien durch Sequenzierung der 16S-rDNA Amplifikate

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) Identifizierung von Bakterien durch Sequenzierung der 16S-rDNA Amplifikate Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) Identifizierung von Bakterien durch Sequenzierung der 16S-rDNA Amplifikate Erstellt vom Unterausschuss Methodenentwicklung der LAG,

Mehr

RealLine DNA Extraction 2

RealLine DNA Extraction 2 RealLine Pathogen Diagnostic Kits Gebrauchsinformation RealLine DNA Extraction 2 KIT FÜR DIE EXTRAKTION VON DNA AUS KLINISCHEN PROBEN In-vitro Diagnostikum RealLine DNA-Extraction 2 VBC8897 96 Tests gültig

Mehr

Analytik Jena bio solutions bietet ein umfassendes Angebot an Kits zur Nukleinsäure-Aufreinigung, für Enzyme, Reagenzien und auch für Additive an.

Analytik Jena bio solutions bietet ein umfassendes Angebot an Kits zur Nukleinsäure-Aufreinigung, für Enzyme, Reagenzien und auch für Additive an. Analytik Jena bio solutions bietet ein umfassendes Angebot an Kits zur Nukleinsäure-Aufreinigung, für Enzyme, Reagenzien und auch für Additive an. Kits für die Proteinanalyse und molekulare Diagnostik?

Mehr

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C 3 Methoden 3.1 Extraktion der DNA aus den Paraffinschnitten 3.1.1 Extraktions-Kit Das QIAamp DNA Mini Kit- System beruht auf dem Prinzip der Auflösung der Eiweiße mit Proteinase K, DNA Bindung an eine

Mehr

Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen

Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen Versuchsleiter: Bernhard Eikmanns Protokollführung: Karl Varadi Gruppe: 11 Durchführung: 11.11 15.11.2002 Protokoll testiert: WS02

Mehr

GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR)

GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) GVO-Screening Kit Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) I. Einführung Die Gentechnik stellt die Landwirtschaft vor neue Herausforderungen. Einerseits eröffnet

Mehr

Biochemische Untersuchungsmethoden für Pharmazeuten Skript WS 2015/2016

Biochemische Untersuchungsmethoden für Pharmazeuten Skript WS 2015/2016 Biochemische Untersuchungsmethoden für Pharmazeuten Skript WS 2015/2016 Seite 1 von 59 Inhalt ALLGEMEINES... 3 Anmerkungen zur Auswertung und Gruppeneinteilung... 3 Regeln für das molekularbiologische

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein DNA-Extraktion Photometrie Polymerase-Kettenreaktion (PCR) Restriktionsanalyse Agarose-Gelelektrophorese Polyacrylamid-Gelelektrophorese

Mehr

1. Proteinnachweis mit Bradford-Farbreagenz

1. Proteinnachweis mit Bradford-Farbreagenz 1. Proteinnachweis mit Bradford-Farbreagenz 96-well-Platte Pipetten (10, 20 und 200 µl) Pipettenspitzen Proteinvorratslösung (1 mg/ml Albumin in destillierten Wasser) Destilliertes Wasser Bradford Farbreagenz

Mehr

Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint

Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint RFLP als Modell für einen DNA-Fingerprint Teil 1: Restriktionsverdau 1.1: Thermoblock / Wasserbad auf 37 C vorheizen 1.2: Puffer Y+/Tango auftauen und auf Eis stellen 1.3: 4 Proben, RSA I und H 2 O demin.

Mehr

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt.

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt. Western Blot Der Western Blot ist eine analytische Methode zum Nachweis bestimmter Proteine in einer Probe. Der Nachweis erfolgt mit spezifischen Antikörpern, die das gesuchte Protein erkennen und daran

Mehr

B i o c h e m i s c h e s B l o c k p r a k t i k u m

B i o c h e m i s c h e s B l o c k p r a k t i k u m B i o c h e m i s c h e s B l o c k p r a k t i k u m N U K L E I N S Ä U R E N WiSe 2010/11 Vorlesung: Praktikumsbetreuer: Jens Peter Fürste Katja Behling, Frank Kuppler, Holger Sieg, Petra Römer ALLGEMEINE

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli Reinigung Protein (1) Plasmidpräparation

Mehr

Platzhalter für Bild

Platzhalter für Bild Instrumentelle Bioanalytik in der Molekularbiologie Anke Neumann Platzhalter für Bild KIT die Kooperation von Forschungszentrum Karlsruhe GmbH und Universität Karlsruhe (TH) www.kit.edu Motivation und

Mehr

Methoden 17. 5% Triton X-100 50 mm EDTA 50 mm Tris-HCl ph 8,0

Methoden 17. 5% Triton X-100 50 mm EDTA 50 mm Tris-HCl ph 8,0 Methoden 17 3. Methoden 3.1 DNA-Präparationen 3.1.1 Isolierung von Plasmid-DNA nach der Rapid-Boiling-Methode (nach Evans and Wahl, 1987) Zur schnellen Isolation von Plasmid-DNA für Restriktions- und PCR-Analysen

Mehr

Molekularbiologie II. Rekombinante PCR Zielgerichtete Mutagenese Heterologe Expression His-Tag Aufreinigung BIOCHEMISCHES ANFÄNGERPRAKTIKUM

Molekularbiologie II. Rekombinante PCR Zielgerichtete Mutagenese Heterologe Expression His-Tag Aufreinigung BIOCHEMISCHES ANFÄNGERPRAKTIKUM V 1.8 Molekularbiologie II BIOCHEMISCHES ANFÄNGERPRAKTIKUM FÜR CHEMIKER UND BIOLOGEN Rekombinante PCR Zielgerichtete Mutagenese Heterologe Expression His-Tag Aufreinigung Abteilung für Biochemie und Molekularbiologie,

Mehr

AdnaTest ER/PR-Detect

AdnaTest ER/PR-Detect PCR-Expressionsanalyse der Östrogen- und Progesteron- Hormonrezeptoren in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-532 Inhaltsverzeichnis Bestellinformation... 3 Anwendungszweck...

Mehr

Grundlagen der rekombinanten. DNA-Technologie

Grundlagen der rekombinanten. DNA-Technologie Grundpraktikum Grundlagen der rekombinanten DNA-Technologie Bitte für das Praktikum mitbringen: Laborkittel, Taschenrechner und Schutzbrille TU Darmstadt Biochemie AG Kolmar Grundpraktikum 2 Inhaltsverzeichnis

Mehr

Auf der Suche nach der Wundermedizin

Auf der Suche nach der Wundermedizin Auf der Suche nach der Wundermedizin Experimente im Schullabor 1 Herausgeber Novartis Pharma AG, CH-4002 Basel Autoren: Dr. Gesche Standke und Dr. Christiane Röckl Michel Zeichnungen: Fonds der Chemischen

Mehr

GENETIK UND MOLEKULARBIOLOGIE (814148, für Lehramtskandidaten) Arbeitsanleitung

GENETIK UND MOLEKULARBIOLOGIE (814148, für Lehramtskandidaten) Arbeitsanleitung 1 GENETIK UND MOLEKULARBIOLOGIE (814148, für Lehramtskandidaten) J. Loidl, Y. Huber, H. Schneeweiss Arbeitsanleitung Im Cytologieteil bekommen Sie einen Einblick in die lichtmikroskopischen Strukturen

Mehr

Molekularbiologische / gentechnische Methoden

Molekularbiologische / gentechnische Methoden Molekularbiologische / gentechnische Methoden MPM 1 Wie lässt sich ein spezifisches Gen/Genprodukt molekular analysieren? Fundamentales Problem: Komplexität biologischer Systeme MPM 2 Ein Ausschnitt aus

Mehr

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion Einleitung Der Tierart-Kit SK1-12 enthält die notwendigen Materialien, um verarbeitete Tierarten in gängigen Fleisch- und Milchprodukten, z.b. Wurst oder Käse zu bestimmen. Ein Lehrerheft und fünf Schülerhefte,

Mehr

Versuch 8. Plasmid - Isolierung

Versuch 8. Plasmid - Isolierung Versuch 8 Plasmid - Isolierung Protokollant: E-mail: Studiengang: Gruppen-Nr: Semester: Betreuer: Max Mustermann max@quantentunnel.de X X X C. Weindel & M. Schwarz Wird benotet?: Einleitung Ein Plasmid

Mehr