BIOWISSENSCHAFTEN IN SCHULE UND ÖFFENTLICHKEIT

Größe: px
Ab Seite anzeigen:

Download "BIOWISSENSCHAFTEN IN SCHULE UND ÖFFENTLICHKEIT"

Transkript

1 BIOWISSENSCHAFTEN IN SCHULE UND ÖFFENTLICHKEIT Fachdidaktische Beiträge zur Vermittlung aktuellen biologischen Wissens Institut für Biologie und ihre Didaktik Institut für Genetik PD Dr. Daniel C. Dreesmann Universität zu Köln

2 SCHULE ALLTAG Aufgabe des Biologieunterrichts: Kenntnisse, Fähigkeiten und Fertigkeiten vermitteln, um mit dem vorhandenen Wissen begrûndet handeln zu können.

3 Nicht für die Schule, sondern für das Leben lernen wir. in Anlehnung an Seneca

4 ALLTAG (Schul)-Wissen Neues Wissen Vorhandenes aneignen nutzen

5 Aufgabe der Biologiedidaktik Erschließung neuer und aktueller Themen für den Unterricht Erarbeitung fachdidaktischer Konzepte für deren Vermittlung im Biologieunterricht als anschlussfähiges Basiswissen Erforschung der Darstellung dieser Themen in der Öffentlichkeit in die Öffentlichkeit

6 EVOLUTION Biologiedidaktik als forschende Wissenschaft z.b. Selbstund Weltverständnis ZOOLOGIE REFLEXION MEDIEN BOTANIK BIOLOGIEDIDAKTIK INTERNET GENETIK & GENTECHNIK VERMITTLUNG SCHULE ÖKOLOGIE & NATURSCHUTZ WISSENSCHAFT z. B. solide fachliche Grundlage EINZEL- PERSONEN ÖFFENTLICHKEIT

7 Biologiedidaktik als forschende Wissenschaft EVOLUTION Auswahl der Inhalte Anordnung der Inhalte ZOOLOGIE Lernvoraussetzungen Schülervorstellungen Begriffe BOTANIK Methoden REFLEXIONS- WISSENSCHAFT BIOLOGIEDIDAKTIK MEDIEN INTERNET GENETIK & GENTECHNIK Laien und Experten EINZEL- Alltags- vs. Fachsprache PERSONEN Transfer neuen Wissens Kommunikationswege Methoden ÖFFENTLICHKEIT VERMITTLUNGS- WISSENSCHAFT SCHULE ÖKOLOGIE & NATURSCHUTZ WISSENSCHAFT

8 Brücken bauen zwischen Wissenschaft und Öffentlichkeit EVOLUTION ZOOLOGIE Fachdidaktische Forschungsprojekte MEDIEN BOTANIK Institut für Biologie und ihre Didaktik Universität zu Köln INTERNET GENETIK & GENTECHNIK Praktische Wissensvermittlung SCHULE ÖKOLOGIE & NATURSCHUTZ WISSENSCHAFT EINZEL- PERSONEN ÖFFENTLICHKEIT

9 Brücken bauen zwischen Wissenschaft und Öffentlichkeit EVOLUTION ZOOLOGIE BOTANIK Wissensvermittlung durch die Medien MEDIEN Institut für Biologie und ihre Didaktik Universität zu Köln INTERNET Gentechnik bereits in der Orientierungsstufe? GENETIK & GENTECHNIK SCHULE EINZEL- PERSONEN ÖKOLOGIE & NATURSCHUTZ Wissensvermittlung WISSENSCHAFT in Nachschlagewerken ÖFFENTLICHKEIT

10 Warum das Thema Gentechnik? Thema Gentechnik

11 Warum das Thema Gentechnik? aktueller Bezug zum Zeitpunkt der Untersuchungen Gegenstand öffentlicher Diskurse, großes Interesse reproduktives und therapeutisches Klonen: unmittelbare Relevanz für den Menschen ( Medizin) ethische und juristische Implikationen Wissenschaftskommunikation Experten-Laien-Kommunikation Wissen Noch-Nicht-Wissen Nicht-Wissen

12 Untersuchte Themen - Beispiele Klonen/Klonieren Stammzellen genetischer Fingerabdruck PID

13 Gentechnik bereits in der Orientierungsstufe?

14 Gentechnik im Alltag von Jugendlichen Ausgangsfrage: Wo begegnen Jugendliche im Alltag dem Thema Gentechnik? Gentechnik in Kino und Fernsehen Gentechnik in Comics und Zeichentrick Gentechnik in Jugendsachbüchern in Gesprächen mit Freunden, Eltern etc.

15 Gentechnik im Alltag von Jugendlichen Fazit Elf- bis Zwölfjährige treffen im Alltag häufig auf das Thema Gentechnik. Sie sollten deshalb bereits über Wissen verfügen, das im Biologieunterricht genutzt werden kann. Basierend auf diesem Wissen ist es möglich, das Thema genetischer Fingerabdruck bei entsprechend didaktischer Bearbeitung - bereits in der Sekundarstufe I zu vermitteln.

16 Gentechnik im Alltag von Jugendlichen Pilotstudie: Gentechnik bereits in der Jahrgangsstufe 6? Fragestellungen: Welches Vorwissen haben die Schülerinnen und Schüler? Welche ersten Vorstellungen und Einstellungen haben sich bei Ihnen bereits entwickelt? Sind an diesem Thema überhaupt interessiert? Ist der Genetische Fingerabdruck bereits in der Orientierungsstufe (Jahrgangsstufe 6) vermittelbar (z.b. bei aktuellem Bezug)?

17 Gentechnik im Alltag von Jugendlichen Pilotstudie: Gentechnik bereits in der Jahrgangsstufe 6? Fragestellungen: Welches Vorwissen haben die Schülerinnen und Schüler? Welche ersten Vorstellungen und Einstellungen haben sich bei Ihnen bereits entwickelt? Sind an diesem Thema überhaupt interessiert? Ist der Genetische Fingerabdruck bereits in der Orientierungsstufe (Jahrgangsstufe 6) vermittelbar (z.b. bei aktuellem Bezug)?

18 Pilotstudie: Gentechnik bereits in der Jahrgangsstufe 6? Forschungsdesign Fragebogenstudie, überwiegend geschlossene Fragen mit Mehrfachantworten (Multiple Choice) Pretest-Posttest-Analyse 30 d 3 d 30 d Vortest Unterricht Nachtest Langzeittest Auswertung: Vortest vs. Langzeittest

19 Pilotstudie: Gentechnik bereits in der Jahrgangsstufe 6? Untersuchungszeitraum Nov Dez Jan Feb Schule 1 Schule 2 Stichprobe Orientierungsstufe Niedersachsen n = 100 [11 J. = 36; 12 J. = 53; 13 J. = 6] Versuchsgruppe: 2 Klassen (1 pro Schule), n = w, 30 m Kontrollgruppe: 2 Klassen (1 pro Schule), n = w, 31 m Kontrollgruppe 2: (nur Vortest) 2 Klassen Gymnasium (Köln) 64 Schüler: 33 w, 31 m

20 Pilotstudie: Gentechnik bereits in der Jahrgangsstufe 6? genetischer Fingerabdruck im Unterricht Einsatzgebiete: medizinische Diagnostik Verwandtschaftsanalysen Vaterschaftstests Kriminalistik Täterüberführung, Personenidentifizierung

21 Pilotstudie: Gentechnik bereits in der Jahrgangsstufe 6? genetischer Fingerabdruck im Unterricht Erläuterung des genetischen Fingerabdrucks anhand eines historischer Falles der Personenidentifizierung: War Anna Anderson die letzte Zarentochter? 2 Doppelstunden Unterricht Nikolaus II und Alexandra Anna Anderson = Anastasia

22 Pilotstudie: Gentechnik bereits in der Jahrgangsstufe 6? genetischer Fingerabdruck im Unterricht Die Schülerinnen und Schüler sollen 1. Kenntnisse über Lage, Aufbau und Funktion der DNA erwerben. 2. eine Vorstellung davon bekommen, was unter Gentechnik im weitesten Sinne zu verstehen ist. 3. Prinzip und Anwendung des genetischen Fingerabdrucks verstehen. [nicht die technische Umsetzung] 4. anhand fiktiver genetischer Fingerabdrücke Anna Anderson als Schwindlerin entlarven.

23 Gentechnik im Klassenzimmer Didaktische Reduktion erforderlich u.a. Aufbau & Funktion der DNA: langer Faden - 4 Buchstaben : ATCG Gene = Bau- und Betriebsanleitung - ATGCAGTCCAGGATCCGACTCTAGGGACTGTCCA Funktion von Restriktionsenzymen: Genscheren

24 Gentechnik im Klassenzimmer Didaktische Reduktion erforderlich u.a. Fingerabdruck Genetischer Fingerabdruck

25 Ergebnisse I: Vorwissen - Informationsquellen Ergebnisse II: Lernzuwachs in Bezug auf Vorwissen Ergebnisse III: Lernzuwachs durch den Unterricht

26 Ergebnisse I: Vorwissen - Informationsquellen Hast du schon einmal etwas über Gentechnik gehört oder gelesen? 65,6 VOR-07 55,1 44,9 34,4 ja nein Orientierungsstufe % (n = 100) (n = 64) Gymnasium %

27 Ergebnisse I: Vorwissen - Informationsquellen Wo hast du schon einmal etwas über Gentechnik gehört oder gelesen? Fernsehen Print Buch Elte r n Internet Lehrer Freunde Gymnasium % Orientierungsstufe % (n = 64) (n = 100) Mehrfachnennungen möglich

28 Ergebnisse II: Lernzuwachs in Bezug auf Vorwissen Fragen, die sich auf außerhalb der Schule erworbenes Wissen beziehen Frage 1: Besitzen alle Lebewesen Gene? Frage 2: Warum sehen Kinder ihren Eltern ähnlich? Frage 6: Was glaubst Du ist ein genetischer Fingerabdruck? Frage 9: Beschäftigt sich Gentechnik nur mit Pflanzen und Tieren?

29 Ergebnisse II: Lernzuwachs in Bezug auf Vorwissen Auswertung Langzeittest vs. Vortest (richtige Antworten) Versuchsgruppe Kontrollgruppe VOR LANG p VOR LANG p Lebewesen , ,414 Ähnlichkeit ,025* ,414 Fingerabdruck ,008** ,593 Gentechnik < 0,001*** ,033* Versuchsgruppe n = 50; Kontrollgruppe n = 50 Wilcoxon-Test, * = p < 0,05 ** = p < 0,01 *** = p < 0,001) Frage 1: Besitzen alle Lebewesen Gene? Frage 2: Warum sehen Kinder ihren Eltern ähnlich? Frage 6: Was glaubst Du ist ein genetischer Fingerabdruck? Frage 9: Beschäftigt sich Gentechnik nur mit Pflanzen und Tieren?

30 Ergebnisse III: Lernzuwachs durch den Unterricht Fragen, die sich unmittelbar auf den Unterricht beziehen Frage 5: Wo befindet sich die DNA? Frage 6: Funktion der DNA? Frage 10: Gibt es jemanden, der denselben genetischen Fingerabdruck hat wie Du? Frage 12: Sind Gentechniker in der Lage, DNA zu zerschneiden?

31 Ergebnisse III: Lernzuwachs durch den Unterricht Auswertung Wissensfragen im Langzeittest (richtige Antworten) Versuchsgruppe Kontrollgruppe p DNA-Lage ,082 DNA-Funktion < 0,001*** Fingerabdruck ,04* Restriktion 42 7 < 0,001*** Mann-Whitney-U-Test, * = p < 0,05 ** = p < 0,01 *** = p < 0,001) Versuchsgruppe n = 50; Kontrollgruppe n = 50 Frage 5: Wo befindet sich die DNA? DNA-Lage Frage 6: Funktion der DNA? DNA-Funktion Frage 10: Gibt es jemanden, der denselben genetischen Fingerabdruck hat wie Du? Frage 12: Sind Gentechniker in der Lage, DNA zu zerschneiden? Restriktion

32 Gentechnik bereits in der Jahrgangsstufe 6? Fazit: Bei entsprechender fachdidaktischer Bearbeitung lässt sich das Thema Gentechnik in der Jahrgangsstufe 6 unterrichten, um einem aktuellen Bezug im Alltag Rechnung zu tragen. Dabei kann auch auf Wissen zurückgegriffen werden, das z.b. durch die Medien erworben wurde. Durch die unterrichtliche Intervention konnte bereits bekannten Begriffen das korrespondierende Wissen zugeordnet werden.

33 Vermittlung von Wissen in Nachschlagewerken Druck- und elektronische Werke Brockhaus Enzyklopädie [ ] Meyers Taschenlexikon [ ] Microsoft Encarta [2003] Wissen.de [Frühjahr 2004] Duden Schülerlexikon [ ] Meyers Jugendlexikon [ ] Bertelsmann Jugendlexikon [ ] Großes Ravensburger Lexikon [ ]

34 Wissensvermittlung in Nachschlagewerken Aufbau von Allgemeinen Nachschlagewerke Lesemodus Konsultieren: nur in bestimmtem Kontext gefragt; Selbststudium semasiologische Struktur: Nachschlagewerke sind in der Regel alphabetisch geordnet Lemmatisierung: Ein Fachgebiet wird in zahlreiche Einzelinformationen aufgeteilt (Stichworteinträge) Verweise: setzen Lemmata hypertextartig miteinander in Bezug

35 Wissensvermittlung in Nachschlagewerken Anforderungen an Allgemeine Nachschlagewerke Nachschlagewerke sollen 1. möglichst schnell konsultiert werden können primär lexikographisches Problem 2. fachlich kompetent informieren primär biologiedidaktisches Problem 3. auf verständliche Weise informieren primär sprachdidaktisches Problem [in Kooperation mit dem Lehrstuhl für Empirische Sprachdidaktik, Uni Köln]

36 Wissensvermittlung in Nachschlagewerken Kriterien für eine fachdidaktische Analyse Untersuchungen zur Geschichte von Nachschlagewerken [vgl. zum Hingst 1995, Tomkowiak 2002] Untersuchungen zur Lexikographie (d.h. Anforderungen an den Aufbau eines Lexikons) [vgl. Schlaefer 2002, Herbst & Klotz 2003] Untersuchungen zu Fachlexika und Fachwörterbüchern [vgl. Schaeder 1994, Knobloch & Schaeder 1994, Bergenholtz & Kaufmann 1997] keine Untersuchungen zur Vermittlung von Fachwissen in Allgemeinen Nachschlagewerken

37 Wissensvermittlung in Nachschlagewerken Kriterien für eine fachdidaktische Analyse Lexikographie Biologiedidaktik Sprachdidaktik quantitative und qualitative empirische Forschungsmethoden [vgl. Dreesmann et al. 2004, Dreesmann & Ballod 2006, Dreesmann 2007]

38 Wissensvermittlung in Nachschlagewerken Kriterien für biologiedidaktische Analyse Kriterien zur Beurteilung von Schulbüchern: 1. Sachrichtigkeit, in Bezug auf didaktische Reduktion 2. Inhaltsauswahl 3. Anordnung der Inhalte, Lernziele 4. Textgestaltung, Verständlichkeit, Fachwörter 5. Bildgestaltung Lexikographie Biologiedidaktik [vgl. Unterbruner 2006; Graf 1989, 1995; Hedewig & Wenning 2002] Sprachdidaktik

39 Wissensvermittlung in Nachschlagewerken Beispiel: Klonieren/Klonen Meyers Taschenlexikon

40 Wissensvermittlung in Nachschlagewerken Beispiel: Klonieren/Klonen Fachwörter Klonieren (Klonen), Bez. für das Herstellen einer größeren Anzahl gleichartiger, genetisch ident. Nachkommen einer Zelle oder identischer DNA-Moleküle ( Klon). Die moderne Biologie arbeitet mit mehreren Verfahren: 1) Selektion und Vermehrung eines einzelnen Bakteriums, das Träger für eine bestimmte Mutation ist; 2) Anregung einzelner Lymphozyten des Immunsystems zu Zellteilungen auf einen Reiz durch ein Antigen hin; 3) Vermehrung von DNA- Stücken durch den Einbau in Plasmide von Bakterien; 4) Züchtung von vollständigen, normalen Pflanzen aus isolierten Zellen in einem Nährmedium durch bestimmte Wuchsstoffzusätze; 5) Ersatz der Zellkerne in unbefruchteten Eizellen durch Kerne aus Körperzellen eines anderen Tierembryos (v. a. Frösche, Mäuse). Das K. eines Säugers aus Somazellen (Körperzellen) eines erwachsenen Tieres gelang erstmals 1996 in einem schott. Labor unter Leitung von Ian Wilmut und ist 1997 der Öffentlichkeit in Gestalt eines sieben Monate alten Schafes (»Dolly«) vorgestellt worden. Hierbei wurde die entkernte Eizelle eines Schafes mit einer Körperzelle aus dem Euter eines anderen Schafes verschmolzen. Die so manipulierte Eizelle teilte sich im Reagenzglas, ein Embryo wuchs heran, den man einem dritten Schaf in die Gebärmutter einpflanzte. Geboren wurde ein genetisch ident. Ebenbild des Schafes, dem die Körperzelle aus dem Euter entnommen worden war. Inzwischen sind auch andere Säugetiere aus Körperzellen mit dem gleichen oder ähnl. Verfahren kloniert worden. - Das Klonen menschl. Embryonen, z.b. zur Gewinnung von Stammzellen, die zur Bildung von Zell- und Gewebeersatz verwendet werden können (therapeut. Klonen), ist aus eth. Gründen heftig umstritten. Dieses therapeut. Klonen zur Gewinnung von Stammzellen ist in Großbritannien ab erlaubt. Spätestens am 14. Tag ihrer Existenz müssen die Embryonen aber zerstört werden. Das reproduktive Klonen, also das Implantieren und Austragen solcher geklonter Embryonen bis zur bis Geburt zur Geburt eines eines Menschen, Menschen, bleibt bleibt dagegen dagegen auch in auch Großbritannien in weiterhin weiterhin untersagt. untersagt. Wörter 282 Fachwörter 42 Dilemma: Versuch, Wissen umfassend und kompakt zu vermitteln, führt zur Begriffüberfrachtung! Lexikographie Biologiedidaktik Sprachdidaktik

41 Wissensvermittlung in Nachschlagewerken Beispiel: Klonieren/Klonen Nutzerfreudlichkeit Klonieren (Klonen), Bez. für das Herstellen einer größeren Anzahl gleichartiger, genetisch ident. Nachkommen einer Zelle oder identischer DNA-Moleküle ( Klon). Die moderne Biologie arbeitet mit mehreren Verfahren: 1) Selektion und Vermehrung eines einzelnen Bakteriums, das Träger für eine bestimmte Mutation ist; 2) Anregung einzelner Lymphozyten des Immunsystems zu Zellteilungen auf einen Reiz durch ein Antigen hin; 3) Vermehrung von DNA- Stücken durch den Einbau in Plasmide von Bakterien; 4) Züchtung von vollständigen, normalen Pflanzen aus isolierten Zellen in einem Nährmedium durch bestimmte Wuchsstoffzusätze; 5) Ersatz der Zellkerne in unbefruchteten Eizellen durch Kerne aus Körperzellen eines anderen Tierembryos (v. a. Frösche, Mäuse). Das K. eines Säugers aus Somazellen (Körperzellen) eines erwachsenen Tieres gelang erstmals 1996 in einem schott. Labor unter Leitung von Ian Wilmut und ist 1997 der Öffentlichkeit in Gestalt eines sieben Monate alten Schafes (»Dolly«) vorgestellt worden. Hierbei wurde die entkernte Eizelle eines Schafes mit einer Körperzelle aus dem Euter eines anderen Schafes verschmolzen. Die so manipulierte Eizelle teilte sich im Reagenzglas, ein Embryo wuchs heran, den man einem dritten Schaf in die Gebärmutter einpflanzte. Geboren wurde ein genetisch ident. Ebenbild des Schafes, dem die Körperzelle aus dem Euter entnommen worden war. Inzwischen sind auch andere Säugetiere aus Körperzellen mit dem gleichen oder ähnl. Verfahren kloniert worden. - Das Klonen menschl. Embryonen, z.b. zur Gewinnung von Stammzellen, die zur Bildung von Zell- und Gewebeersatz verwendet werden können (therapeut. Klonen), ist aus eth. Gründen heftig umstritten. Dieses therapeut. Klonen zur Gewinnung von Stammzellen ist in Großbritannien ab erlaubt. Spätestens am 14. Tag ihrer Existenz müssen die Embryonen aber zerstört werden. Das reproduktive Klonen, also das Implantieren und Austragen solcher geklonter Embryonen bis zur bis Geburt zur Geburt eines eines Menschen, Menschen, bleibt bleibt dagegen dagegen auch in auch Großbritannien in weiterhin weiterhin untersagt. untersagt. Verweis 1 prinzipiell vorhanden 25 Dilemma: Informationsautonomie vs. sinnvolle Verweisführung Lexikographie Biologiedidaktik Sprachdidaktik

42 Wissensvermittlung in Nachschlagewerken Beispiel: Klonieren/Klonen Verständlichkeit Computer-unterstützte Textanalyse [CAPITO] Schlüsselwörter = schwere Wörter Lexikographie Biologiedidaktik Sprachdidaktik

43 Wissensvermittlung in Nachschlagewerken Beispiel: Klonieren/Klonen Verständlichkeit Schlüsselwörter Fachausdrücke Klonieren (Klonen), Bez. für das Herstellen einer größeren Anzahl gleichartiger, genetisch ident. Nachkommen einer Zelle oder identischer DNA-Moleküle ( Klon). Die moderne Biologie arbeitet mit mehreren Verfahren: 1) Selektion und Vermehrung eines einzelnen Bakteriums, das Träger für eine bestimmte Mutation ist; 2) Anregung einzelner Lymphozyten des Immunsystems zu Zellteilungen auf einen Reiz durch ein Antigen hin; 3) Vermehrung von DNA- Stücken durch den Einbau in Plasmide von Bakterien; 4) Züchtung von vollständigen, normalen Pflanzen aus isolierten Zellen in einem Nährmedium durch bestimmte Wuchsstoffzusätze; 5) Ersatz der Zellkerne in unbefruchteten Eizellen durch Kerne aus Körperzellen eines anderen Tierembryos (v. a. Frösche, Mäuse). Das K. eines Säugers aus Somazellen (Körperzellen) eines erwachsenen Tieres gelang erstmals 1996 in einem schott. Labor unter Leitung von Ian Wilmut und ist 1997 der Öffentlichkeit in Gestalt eines sieben Monate alten Schafes (»Dolly«) vorgestellt worden. Hierbei wurde die entkernte Eizelle eines Schafes mit einer Körperzelle aus dem Euter eines anderen Schafes verschmolzen. Die so manipulierte Eizelle teilte sich im Reagenzglas, ein Embryo wuchs heran, den man einem dritten Schaf in die Gebärmutter einpflanzte. Geboren wurde ein genetisch ident. Ebenbild des Schafes, dem die Körperzelle aus dem Euter entnommen worden war. Inzwischen sind auch andere Säugetiere aus Körperzellen mit dem gleichen oder ähnl. Verfahren kloniert worden. - Das Klonen menschl. Embryonen, z.b. zur Gewinnung von Stammzellen, die zur Bildung von Zell- und Gewebeersatz verwendet werden können (therapeut. Klonen), ist aus eth. Gründen heftig umstritten. Dieses therapeut. Klonen zur Gewinnung von Stammzellen ist in Großbritannien ab erlaubt. Spätestens am 14.Tag ihrer Existenz müssen die Embryonen aber zerstört werden. Das reproduktive Klonen, also das Implantieren und Austragen solcher geklonter Embryonen bis zur Geburt eines Menschen, bleibt dagegen auch in Großbritannien weiterhin untersagt. Klonieren (Klonen), Bez. für das Herstellen einer größeren Anzahl gleichartiger, genetisch ident. Nachkommen einer Zelle oder identischer DNA-Moleküle ( Klon). Die moderne Biologie arbeitet mit mehreren Verfahren: 1) Selektion und Vermehrung eines einzelnen Bakteriums, das Träger für eine bestimmte Mutation ist; 2) Anregung einzelner Lymphozyten des Immunsystems zu Zellteilungen auf einen Reiz durch ein Antigen hin; 3) Vermehrung von DNA- Stücken durch den Einbau in Plasmide von Bakterien; 4) Züchtung von vollständigen, normalen Pflanzen aus isolierten Zellen in einem Nährmedium durch bestimmte Wuchsstoffzusätze; 5) Ersatz der Zellkerne in unbefruchteten Eizellen durch Kerne aus Körperzellen eines anderen Tierembryos (v. a. Frösche, Mäuse). Das K. eines Säugers aus Somazellen (Körperzellen) eines erwachsenen Tieres gelang erstmals 1996 in einem schott. Labor unter Leitung von Ian Wilmut und ist 1997 der Öffentlichkeit in Gestalt eines sieben Monate alten Schafes (»Dolly«) vorgestellt worden. Hierbei wurde die entkernte Eizelle eines Schafes mit einer Körperzelle aus dem Euter eines anderen Schafes verschmolzen. Die so manipulierte Eizelle teilte sich im Reagenzglas, ein Embryo wuchs heran, den man einem dritten Schaf in die Gebärmutter einpflanzte. Geboren wurde ein genetisch ident. Ebenbild des Schafes, dem die Körperzelle aus dem Euter entnommen worden war. Inzwischen sind auch andere Säugetiere aus Körperzellen mit dem gleichen oder ähnl. Verfahren kloniert worden. - Das Klonen menschl. Embryonen, z.b. zur Gewinnung von Stammzellen, die zur Bildung von Zell- und Gewebeersatz verwendet werden können (therapeut. Klonen), ist aus eth. Gründen heftig umstritten. Dieses therapeut. Klonen zur Gewinnung von Stammzellen ist in Großbritannien ab erlaubt. Spätestens am 14. Tag ihrer Existenz müssen die Embryonen aber zerstört werden. Das reproduktive Klonen, also das Implantieren und Austragen solcher geklonter Embryonen bis zur Geburt eines Menschen, bleibt dagegen auch in Großbritannien weiterhin untersagt.

44 Wissensvermittlung in Nachschlagewerken Zusammenfassung der Ergebnisse: Die erforderliche Information ist prinzipiell vorhanden. Die didaktische Umsetzung ist vielfach mangelhaft, vor allem bei den untersuchten Schüler- und Jugendlexika. Die lexikographischen Hilfen sind stark verbesserungsfähig. Die Lexikonartikel entsprechen weitgehend der Textgattung. Lexikographie Biologiedidaktik [vgl. Dreesmann & Ballod 2006, Dreesmann 2007] Sprachdidaktik

45 Wissensvermittlung in Nachschlagewerken Fachdidaktische Forschungsfragen: Können Allgemeine Lexika ihrer Funktion als Wissensspeicher überhaupt noch gerecht werden? Welchen Beitrag kann die Biologiedidaktik für ein besseres Verständnis der Lexikonartikel leisten? Sind Allgemeine Lexika inzwischen viele Fachlexika in einem Band? Stößt das klassische Lexikon in Buchform an die Grenzen der Wissensvermittlung?

46 Vom Labor ins Klassenzimmer EVOLUTION ZOOLOGIE BOTANIK ievol Integratives Konzept für Lehre und Forschung in Evolutionsbiologie Institut für Biologie und ihre Didaktik Universität zu Köln MEDIEN INTERNET SCHULE GENETIK & GENTECHNIK e.v. Schülerkurse Sekundarstufen I und II Lehrerfortbildungen EINZELPERSONEN ÖKOLOGIE & NATURSCHUTZ WISSENSCHAFT ÖFFENTLICHKEIT

47 Vom Labor ins Klassenzimmer oder ins Schülerlabor Komplettausstattung Molekularbiologie für 30 Personen kompetente fachliche und fachdidaktische Betreuung kontinuierliche Aktualisierung des Angebotes Kooperationen mit universitären und außeruniversitären Forschungseinrichtungen

48 Vom Labor ins Klassenzimmer oder ins Schülerlabor Angebot für Sekundarstufe I Institut für Biologie und ihre Didaktik 1. Krimi im Klassenzimmer: Wer war Anna Anderson? 2. Jede Tomate ist eine Gentomate! : Isolierung von DNA aus Obst und Gemüse

49 Vom Labor ins Klassenzimmer oder ins Schülerlabor Angebot für Sekundarstufe I: Krimi im Klassenzimmer Vorbereitung im Biologieunterricht Experiment im Schülerlabor

50 Vom Labor ins Klassenzimmer oder ins Schülerlabor Angebot für Sekundarstufe I: Krimi im Klassenzimmer Vorbereitung im Biologieunterricht Experiment im Schülerlabor Spannender Einstieg Hinführung zum Experiment Erarbeitung der Theorie Vorstellen der Laborgeräte [mit freundlicher Unterstützung des ZDF]

51 Vom Labor ins Klassenzimmer oder ins Schülerlabor Angebot für Sekundarstufe I: Krimi im Klassenzimmer Vorbereitung im Biologieunterricht Experiment im Schülerlabor Geräte kennen lernen Experiment vorbereiten Experiment durchführen Auswertung, Ergebnis KölnPUB e.v.

52 Vom Labor ins Klassenzimmer oder ins Schülerlabor Angebot für Sekundarstufe I: Krimi im Klassenzimmer Nachbereitung im Biologieunterricht Experiment im Schülerlabor Ziele außerschulischer Lernorte: originale Begegnung mit biologischen Phänomenen Interesse und Aufgeschlossenheit fördern authentischen Forschungszusammenhänge ermöglichen eigenständige Planung, Durchführung und Auswertung eines Experimentes Gelegenheit geben, Berufsbilder kennen zu lernen

53 Vom Labor ins Klassenzimmer oder ins Schülerlabor Vorlesung 5. KölnerKinderUni: Wozu brauchen Tomaten Gene? Vorbereitung in der Schule

54 Vom Labor ins Klassenzimmer oder ins Schülerlabor Vorlesung 5. KölnerKinderUni: Wozu brauchen Tomaten Gene? Vorlesung in der Universität

55 Das Thema Evolutionsbiologie im Biologieunterricht (dpa) Wolff will Schöpfung als Biologie-Thema Christliche Tradition sollte laut CDU- Ministerin nicht nur im Religionsunterricht behandelt werden. so dass man nicht einfach Schüler in Biologie mit Evolutionslehre konfrontiert und Schüler im Religionsunterricht mit der Schöpfungslehre der Bibel. Sondern dass man auch schaut, ob es Gegensätze oder Konvergenzen gibt. 9. Oktober 2006 Kreationismus Intelligent Design

56 Das Thema Evolutionsbiologie im Biologieunterricht Welches Basiswissen ist für das Verständnis von Evolution erforderlich? Erfassung des Ist-Zustands Analyse von Bildungsstandards, Lehrplänen, Empfehlungen für den Biologieunterricht in den Sekundarstufen I und II Inhaltsanalyse bestehender Unterrichtsmedien (Schulbücher, Zeitschriften, etc.) Analyse der Darstellung des Themas Evolution in der Öffentlichkeit

57 Das Thema Evolutionsbiologie im Biologieunterricht Often cited as the nation s de facto curriculum, textbooks define what most students are taught. KOPALL & CALDWELL 2004

58 Das Thema Evolutionsbiologie im Biologieunterricht Prinzipien: eher statisch anstatt dynamisch Methoden: eher traditionell anstatt modern Beispiele: eher klassisch anstatt neu und angemessen I thought if I read one more description of peppered moth evolution I would scream. David Hillis, Evolution 6/2007

59 Das Thema Evolutionsbiologie im Biologieunterricht Prinzipien: eher statisch anstatt dynamisch Methoden: eher traditionell anstatt modern Beispiele: eher klassisch anstatt neu und angemessen Neue Unterrichtsmedien zur Evolutionsbiologie

60 Das Thema Evolutionsbiologie im Biologieunterricht Entwicklung von neuen Unterrichtsmedien Soll-Zustand spezifische Bedürfnisse spezifische Aspekte spezifische Voraussetzungen spezifisches Wissen aktuelle Forschungsergebnisse Hintergrundwissen Unterrichtsmaterial didaktische Kommentare Kooperation Evolutionsgenetik Fachdidaktik Schulen

61 Das Thema Evolutionsbiologie im Biologieunterricht Entwicklung von Unterrichtsmedien aktuelle Beispiele Spielerische Simulation von Zufall Evolution vor unserer Haustüre

62 Das Thema Evolutionsbiologie im Biologieunterricht nächste Schritte: Kontaktaufnahme mit an der Lehrplan-Entwicklung beteiligten Stellen Nordrhein-Westfalen Kontaktaufnahme mit Schulbuchverlagen und autoren Kontaktaufnahme mit Fachzeitschriften PdN-BioS 5/2008: Evo-Devo PdN-BioS 1/2009: Darwin Internet-Platform als Vertriebsbasis für erstellte Medien u.a. Kooperation mit Netzwerk aus Wissenschaftler/innen und Lehrer/innen zur Evaluation der Medien im Schulunterricht Lehrer/innen aus Sekundarstufen I und II setzen im Schuljahr 2007/2008 das Simulationsspiel im Unterricht ein. Workshop Evolution und Schule, Dez. 2007, Köln

63 Nothing in biology makes sense except in the light of evolution. Theodosius Dobzhansky

64 EVOLUTION ZOOLOGIE MEDIEN BOTANIK BIOLOGIEDIDAKTIK Institut für Biologie und ihre Didaktik Universität zu Köln INTERNET GENETIK & GENTECHNIK SCHULE EINZEL- PERSONEN ÖKOLOGIE & NATURSCHUTZ WISSENSCHAFT ÖFFENTLICHKEIT

65 Dank an: Institut für Biologie und ihre Didaktik, Köln Institut für Deutsche Sprache und ihre Didaktik, Köln Institut für Genetik, Köln Dorothee Markert Maike Teuffer Linda Hartwig Annika Schmaloske Prof. Dr. Wilfried Wichard Dr. Silke Dormeier PD Dr. Matthias Ballod, Köln/Koblenz Dr. Meike Teschke, Köln/Plön Prof. Dr. Diethard Tautz, Köln/Plön Prof. Dr. Dittmar Graf, Dortmund Prof. Dr. Klaudia Witte, Siegen Prof. Dr. Almut Gerhardt-Dircksen, Bielefeld Institut für Biologie und ihre Didaktik Institut für Genetik PD Dr. Daniel C. Dreesmann Universität zu Köln

66 BIOWISSENSCHAFTEN IN SCHULE UND ÖFFENTLICHKEIT Fachdidaktische Beiträge zur Vermittlung aktuellen biologischen Wissens Herzlichen Dank für Ihre Aufmerksamkeit Institut für Biologie und ihre Didaktik Institut für Genetik PD Dr. Daniel C. Dreesmann Universität zu Köln

INHALT Geschichte des Klonens Klonen in der Natur Vorgehensweise des Klonens Reproduktives Klonen Therapeutisches Klonen Dolly Prometea Pro & Contra

INHALT Geschichte des Klonens Klonen in der Natur Vorgehensweise des Klonens Reproduktives Klonen Therapeutisches Klonen Dolly Prometea Pro & Contra KLONEN INHALT Geschichte des Klonens Klonen in der Natur Vorgehensweise des Klonens Reproduktives Klonen Therapeutisches Klonen Dolly Prometea Pro & Contra Ethikdiskussion Bedeutung der Gentechnik im Weltvergleich

Mehr

Exposé. Zur Verständlichkeit der Biowissenschaften als Problem des Wissenstransfers. 1. Promotionsvorhaben. 2. Aktueller Forschungsstand

Exposé. Zur Verständlichkeit der Biowissenschaften als Problem des Wissenstransfers. 1. Promotionsvorhaben. 2. Aktueller Forschungsstand Exposé Arbeitstitel: Zur Verständlichkeit der Biowissenschaften als Problem des Wissenstransfers 1. Promotionsvorhaben 2. Aktueller Forschungsstand 3. Arbeitsplan 4. Literatur 1. Promotionsvorhaben Die

Mehr

Das Biotechnologische Schülerlabor Braunschweig zwischen Schule und Forschung

Das Biotechnologische Schülerlabor Braunschweig zwischen Schule und Forschung Das Biotechnologische Schülerlabor Braunschweig zwischen Schule und Forschung BioS: Brücke Kooperationspartner: Finanzielle Unterstützung: Weitere wissenschaftliche Beratung: Kooperationspartner Konzept

Mehr

Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem

Mehr

Das Thema 'Klonen' in der modernen Jugendliteratur

Das Thema 'Klonen' in der modernen Jugendliteratur Germanistik Timo Saß Das Thema 'Klonen' in der modernen Jugendliteratur Ein Vergleich zwischen Rabischs "Duplik Jonas 7" und Eschbachs "Perfect Copy" Examensarbeit ID 6941 Saß, Timo: Das Thema 'Klonen'

Mehr

Merkmale guten und schlechten Unterrichts

Merkmale guten und schlechten Unterrichts HS Diagnostik des Unterrichts Merkmale guten und schlechten Unterrichts Stellenausschreibung 2 Stellen als studentische Hilfskraft und eine Tutorenstelle: (40Std./Monat) Aufgaben am Lehrstuhl: Unterstützung

Mehr

Klonierung von Säugern durch Zellkerntransfer

Klonierung von Säugern durch Zellkerntransfer Klonierung von Säugern durch Zellkerntransfer Gentechnik und Genomics WiSe 2007/2008 Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Können differenzierte Zellen einen

Mehr

Therapeutisches und reproduktives Klonen. http://www.sisol.de/brennpunkt. TCI Institut für. Dr. Cornelia Kasper. Klonen.

Therapeutisches und reproduktives Klonen. http://www.sisol.de/brennpunkt. TCI Institut für. Dr. Cornelia Kasper. Klonen. Therapeutisches und reproduktives http://www.sisol.de/brennpunkt Überblick Was ist? Verschiedene Ansätze Historischer Überblick und neueste Entwicklungen Gesetzliche Anforderungen Entwicklungen von Menschen

Mehr

Mach-mit-Labor. Biochemie Prof. Rita Bernhardt

Mach-mit-Labor. Biochemie Prof. Rita Bernhardt Mach-mit-Labor Biochemie Prof. Rita Bernhardt Das Mach-mit-Labor Das Mach-mit-Labor (Betreiberin Prof. Dr. R. Bernhardt) bietet seit 2002 naturwissenschaftlich interessierten SchülerInnen die Möglichkeit,

Mehr

OECD Programme for International Student Assessment

OECD Programme for International Student Assessment OECD Programme for International Student Assessment PISA 2003 BEISPIELAUFGABEN AUS DEM NATURWISSENSCHAFTSTEST Beispielaufgaben PISA-Hauptstudie 2003 Seite 1 INHALT UNIT KLONEN... 3 Frage 1: KLONEN... 5

Mehr

Schulinterner Lehrplan zum Kernlehrplan am Ruhr-Gymnasium Witten. Physik. Teil I

Schulinterner Lehrplan zum Kernlehrplan am Ruhr-Gymnasium Witten. Physik. Teil I Schulinterner Lehrplan zum Kernlehrplan am Ruhr-Gymnasium Witten Physik Teil I Inhaltsverzeichnis Seite Schulische Rahmenbedingungen im Fach Physik 3 Grundsätze fachmethodischer und fachdidaktischer Arbeit

Mehr

Modulhandbuch für das Fach Englisch im Masterstudium für das Lehramt an Grundschulen Titel des Moduls Fachwissenschaft Kennnummer.

Modulhandbuch für das Fach Englisch im Masterstudium für das Lehramt an Grundschulen Titel des Moduls Fachwissenschaft Kennnummer. Modulhandbuch für das Fach Englisch im Masterstudium für das Lehramt an Grundschulen Titel des Moduls Fachwissenschaft MEd EGM 1 300 h 1.1 Vertiefung Ling: Sprachstruktur, Sprachgebrauch, Spracherwerb

Mehr

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie:

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie: Foto: Alina Ackermann Unsere Forschungsschwerpunkte Synthetische Biologie: Im Fachgebiet Synthetische Biologie arbeiten Biologen, Chemiker und Ingenieure zusammen, um biologische Systeme zu erzeugen, die

Mehr

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie:

Unsere Forschungsschwerpunkte Synthetische Biologie: Biologie der Stressantwort: Strahlenbiologie: Foto: Andreas Arnold Unsere Forschungsschwerpunkte Synthetische Biologie: Im Fachgebiet Synthetische Biologie arbeiten Biologen, Chemiker und Ingenieure zusammen, um biologische Systeme zu erzeugen, die

Mehr

Reproduktionsmedizin und Embryonenforschung

Reproduktionsmedizin und Embryonenforschung Wintersemester 2014/15 Vorlesung Ethik in der Medizin Reproduktionsmedizin und Embryonenforschung PD Dr. Alfred Simon Institut für Ethik, Geschichte und Theorie der Medizin Gliederung der Vorlesung Ethisch

Mehr

Masterstudiengang Pflanzenbiotechnologie

Masterstudiengang Pflanzenbiotechnologie Masterstudiengang Pflanzenbiotechnologie - e - Stand: Januar 2014 Schlüsselqualifikationen für Studierende der Pflanzenwissenschaften 2. Studienjahr, 3.+4. Semester je nach gewähltem Angebot MA-SK Modulbescheinigung

Mehr

Forschendes Lernen in Medizin und Gesundheitsstudiengängen. Annette Nauerth, FH Bielefeld

Forschendes Lernen in Medizin und Gesundheitsstudiengängen. Annette Nauerth, FH Bielefeld Forschendes Lernen in Medizin und Gesundheitsstudiengängen Annette Nauerth, FH Bielefeld * *Forschend lernen eine Einführung *Forschend lernen curriculare Aspekte *Forschend Lernen - Prüfungsgestaltung

Mehr

Pilotierung von Unterrichtsbeispielen

Pilotierung von Unterrichtsbeispielen Pilotierung von Unterrichtsbeispielen Prof. Dr. Manuela Paechter Karl-Franzens-Universität Graz Kick-Off-Veranstaltung 03. Oktober 2013, Linz Übersicht 1. Ziele der Pilotierung 2. Rückblick bisherige Pilotierungen,

Mehr

Anhang A Fragebogen. Mapping Science Center Aktivitäten in Österreich BMBWK GZ 3.010/0027-VI/3/2006

Anhang A Fragebogen. Mapping Science Center Aktivitäten in Österreich BMBWK GZ 3.010/0027-VI/3/2006 Landstraßer Hauptstraße 71/1/205 A 1030 Wien T +43/(1)7101981 F +43(1)7101985 E office@science-center-net.at www.science-center-net.at ZVR-613537414 Anhang A Fragebogen Mapping Science Center Aktivitäten

Mehr

Stammzellen. Therapie der Zukunft?

Stammzellen. Therapie der Zukunft? Stammzellen Therapie der Zukunft? Was sind Stammzellen? Embryo, aus embryonalen Stammzellen bestehend Stammzellen sind Ausgangszellen für die Bildung aller Gewebe und Organe, aus denen ein Lebewesen besteht

Mehr

Kompetenzorientiert Unterrichten

Kompetenzorientiert Unterrichten Kompetenzorientiert Unterrichten Manuela Paechter Pädagogische Psychologie Karl-Franzens-Universität Graz manuela.paechter@uni-graz.at Themen 1.Kognitionspsychologische Grundlagen: Welches Wissen soll

Mehr

Religionskritischen Arbeitskreis Wiesbaden

Religionskritischen Arbeitskreis Wiesbaden Internationaler Bund der Konfessionslosen und Atheisten e.v. und Freireligiöse Gemeinde Wiesbaden K.d.ö.R. Einladung zum Religionskritischen Arbeitskreis Wiesbaden Thema: Religion und Schule - Welchen

Mehr

Kompetenz-Erwartungen von Arbeitgeberinnen und Arbeitgebern an Absolventinnen und Absolventen der Sozialwissenschaftlichen Fakultät

Kompetenz-Erwartungen von Arbeitgeberinnen und Arbeitgebern an Absolventinnen und Absolventen der Sozialwissenschaftlichen Fakultät Kompetenz-Erwartungen von Arbeitgeberinnen und Arbeitgebern an Absolventinnen und Absolventen der Sozialwissenschaftlichen Fakultät Exploratives Forschungsprojekt zur Identifikation von Qualifikations-und

Mehr

Die Fortbildungsreihe STOCHASTIK kompakt

Die Fortbildungsreihe STOCHASTIK kompakt Die Fortbildungsreihe STOCHASTIK kompakt 4-teilige Fortbildung zum fachinhaltlichen Überblick der Stochastik, ihrer Methodik und Didaktik in der Sekundarstufe II Gemeinschaftsprojekt der DZLM-Abteilungen

Mehr

Reproduktionsmedizin und Embryonenforschung

Reproduktionsmedizin und Embryonenforschung Wintersemester 2015/16 Vorlesung Ethik in der Medizin Reproduktionsmedizin und Embryonenforschung Prof. Dr. Alfred Simon Institut für Ethik, Geschichte und Theorie der Medizin Gliederung der Vorlesung

Mehr

CAS-Kombination Modul + Abschluss Stand: 23.02.15

CAS-Kombination Modul + Abschluss Stand: 23.02.15 - Ihre Meinung ist uns wichtig Liebe Teilnehmerinnen und Teilnehmer des XXX Seit dem Ende des der Weiterbildung XXX ist nun eine Woche vergangen und wir würden gerne erfahren, wie Sie die Weiterbildung

Mehr

Besser Lernen mit digitalen Spielen? Ergebnisse eines Nationalfondsprojektes

Besser Lernen mit digitalen Spielen? Ergebnisse eines Nationalfondsprojektes Besser Lernen mit digitalen Spielen? Ergebnisse eines Nationalfondsprojektes Fachtagung Apps & Games 2013 Nina Iten Was erwartet Sie? Intro Level 1 Level 2 Level 3 game over Medienkompetenzförderung AWWWARE

Mehr

Perspektiven der Lehrerbildung

Perspektiven der Lehrerbildung Perspektiven der Lehrerbildung Das Beispiel Kristina Reiss Heinz Nixdorf-Stiftungslehrstuhl für Didaktik der Mathematik 1 Bildung im 21. Jahrhundert: Qualität von Schule Leistung Vielfalt Unterricht Verantwortung

Mehr

STAMMZELLEN. Therapie der Zukunft?

STAMMZELLEN. Therapie der Zukunft? STAMMZELLEN Therapie der Zukunft? WAS SIND STAMMZELLEN? Ausgangszellen für die Bildung aller Gewebe und Organe, aus denen ein Lebewesen besteht Charakteristische Merkmale (Unterscheidung von anderen Zellen)

Mehr

Basismodule zur Begabungs- und Exzellenzförderung

Basismodule zur Begabungs- und Exzellenzförderung Basismodule zur Begabungs- und Exzellenzförderung ÖZBF Österreichisches Zentrum für Begabtenförderung und Begabungsforschung Schillerstraße 30, Techno 12, A-5020 Salzburg, tel: +43(0)662 43 95 81, fax:

Mehr

Der Bachelor-Studiengang Pädagogik/ Bildungswissenschaft im Überblick

Der Bachelor-Studiengang Pädagogik/ Bildungswissenschaft im Überblick Lehrstuhl für Allgemeine Pädagogik und Bildungsforschung Der Bachelor-Studiengang Pädagogik/ Bildungswissenschaft im Überblick Dr. Bernhard Schmidt-Hertha Der Bachelor-Studiengang Pädagogik/Bildungswissenschaft

Mehr

E-Learning-Plattform für den naturwissenschaftlichen Unterricht. www.nawi-interaktiv.com

E-Learning-Plattform für den naturwissenschaftlichen Unterricht. www.nawi-interaktiv.com E-Learning-Szenarien für die Biologie Dr. Wiebke Homann, Abteilung Biologiedidaktik (Botanik/ Zellbiologie), wiebke.homann@uni-bielefeld.de Dr. Claas Wegner, Abteilung Biologiedidaktik (Botanik/Zellbiologie),

Mehr

Umweltgeschichte erforschen mit SchülerInnen: Herausforderungen und Potenziale

Umweltgeschichte erforschen mit SchülerInnen: Herausforderungen und Potenziale Umweltgeschichte erforschen mit SchülerInnen: Herausforderungen und Potenziale Erfahrungen aus dem Sparkling-Science-Projekt Unsere Umwelt hat Geschichte Simone Gingrich, Irene Ecker, Christopher Schmied,

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

INHALTSVERZEICHNIS. Vorwort... 11 TEIL I HINFÜHRUNG

INHALTSVERZEICHNIS. Vorwort... 11 TEIL I HINFÜHRUNG INHALTSVERZEICHNIS Vorwort..................................................... 11 TEIL I HINFÜHRUNG 1. Die Suche nach alternativen Quellen für pluripotente embryonale Stammzellen..............................................

Mehr

Berufspädagogisch-fachdidaktisches Studium ECTS 60. Fachdidaktik 18. Bereichsdidaktik Gesellschaft III (Identität und Sozialisation, Ethik) 3

Berufspädagogisch-fachdidaktisches Studium ECTS 60. Fachdidaktik 18. Bereichsdidaktik Gesellschaft III (Identität und Sozialisation, Ethik) 3 ABU-Studiengang Modulübersicht Berufspädagogisch-fachdidaktisches Studium ECTS 60 Fachdidaktik 18 Bereichsdidaktische Grundlagen 1 Bereichsdidaktik Gesellschaft I (Recht und Wirtschaft) 3 Bereichsdidaktik

Mehr

Virtual Chemistry 2.0. Realisierung eines virtuellen Chemielabors Manuel Stach, Marios Karapanos Fachhochschule Kaiserslautern

Virtual Chemistry 2.0. Realisierung eines virtuellen Chemielabors Manuel Stach, Marios Karapanos Fachhochschule Kaiserslautern Virtual Chemistry 2.0 Realisierung eines virtuellen Chemielabors Manuel Stach, Marios Karapanos Fachhochschule Kaiserslautern Was Sie erwartet: 1. Open MINT Labs: Kurzportrait 2. Das virtuelle Chemielabor

Mehr

Vom Anfang des Lebens medizinethische Betrachtungen

Vom Anfang des Lebens medizinethische Betrachtungen Vom Anfang des Lebens medizinethische Betrachtungen Pro und Con der Präimplantationsdiagnostik PID Beispiel einer kontroversen bioethischen Debatte Gliederung des Vortrags Darstellung der med.-naturwissenschaftlichen

Mehr

Leistungskonzept des Faches Chemie

Leistungskonzept des Faches Chemie Leistungskonzept des Faches Chemie Inhalt Kriteriengestützte Korrekturen... 2 Anzahl und Dauer von Klassenarbeiten bzw. Klausuren... 2 Sekundarstufe I... 2 Sekundarstufe II... 2 Einführungsphase... 2 Qualifikationsphase...

Mehr

2495/AB XX. GP - Anfragebeantwortung 1 von 5 2495/AB XX.GP

2495/AB XX. GP - Anfragebeantwortung 1 von 5 2495/AB XX.GP 2495/AB XX. GP - Anfragebeantwortung 1 von 5 2495/AB XX.GP Auf die - aus Gründen der besseren Übersichtlichkeit in Kopie beigeschlossene - schriftliche Anfrage der Abgeordneten Petrovic, Freundinnen und

Mehr

Projekt. Supporting Equality in Science, Technology, and Mathematics related chocies of carreers. Bernhard Ertl

Projekt. Supporting Equality in Science, Technology, and Mathematics related chocies of carreers. Bernhard Ertl Projekt Supporting Equality in Science, Technology, and Mathematics related chocies of carreers Bernhard Ertl EU-Projekt zur Förderung der Chancengleichheit in MINT-Karrieren (Mathematik, Informatik, Naturwissenschaften

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: CARE-Paket Entwicklung des menschlichen Lebens

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: CARE-Paket Entwicklung des menschlichen Lebens Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: CARE-Paket Entwicklung des menschlichen Lebens Das komplette Material finden Sie hier: Download bei School-Scout.de Inhalt Vorwort

Mehr

und Landeswissenschaften) M 2 Basismodul Fachdidaktik 3 M 1 Basismodul Sprachpraxis 1 4 Summe 72

und Landeswissenschaften) M 2 Basismodul Fachdidaktik 3 M 1 Basismodul Sprachpraxis 1 4 Summe 72 Zweitfach Modulübersicht Sem Modul Inhalt Credits MA M14b Qualifikationsmodul Fachdidaktik 12 1-4 M10 Schulpraktische Studien 6 46 c M9 Qualifikationsmodul Sprachpraxis 6 M7b Aufbaumodul Landeswissenschaft

Mehr

Leitfaden zur Abfassung des Portfolios am Lehrstuhl. für Religionspädagogik und Katechetik

Leitfaden zur Abfassung des Portfolios am Lehrstuhl. für Religionspädagogik und Katechetik Katholisch-theologische Fakultät Lehrstuhl für Religionspädagogik und Katechetik Prof. Bernhard Grümme WM Stephanie Dahm M.Ed. Leitfaden zur Abfassung des Portfolios am Lehrstuhl für Religionspädagogik

Mehr

Inhaltsverzeichnis. Bibliografische Informationen http://d-nb.info/1010430564. digitalisiert durch

Inhaltsverzeichnis. Bibliografische Informationen http://d-nb.info/1010430564. digitalisiert durch 1 Einleitung 1 1.1 Zielsetzung, Definitionen und Umfang der Untersuchung 2 1.2 Definition und Abgrenzung des TE von der allgemeinen Sprache 8 1.3 Aufbau der Arbeit 11 1.4 Phasen des Forschungsprojekts

Mehr

im Rahmen der Fortbildung LEAD for Climate Justice

im Rahmen der Fortbildung LEAD for Climate Justice Dokumentation der lokalen Aktion im Rahmen der Fortbildung LEAD for Climate Justice Workshop Klimagerechtigkeit für Lebenskundelehrer/-innen in Kooperation mit dem Humanistischen Verband Deutschland (HVD

Mehr

Wie können wir unsere Schülerinnen und Schüler mit Migrationshintergrund gezielt und fächerübergreifend fördern?

Wie können wir unsere Schülerinnen und Schüler mit Migrationshintergrund gezielt und fächerübergreifend fördern? Wie können wir unsere Schülerinnen und Schüler mit Migrationshintergrund gezielt und fächerübergreifend fördern? Es ist vernünftiger, eine Kerze anzuzünden, als über Dunkelheit zu klagen Konfuzius Brigitte

Mehr

Förderung individueller Leistungsdispositionen in der Biologie durch virtuelle Lernangebote

Förderung individueller Leistungsdispositionen in der Biologie durch virtuelle Lernangebote Förderung individueller Leistungsdispositionen in der Biologie durch virtuelle Lernangebote Jörg Zumbach Kathrin Spanner Ulrike Unterbruner Georg Pfligersdorffer Übersicht Einleitung: Ein interessensbasiertes

Mehr

Jugendliche und Naturwissenschaften eine fachdidaktische Reflexion. Ilka Parchmann Wissenswerte, November 2009

Jugendliche und Naturwissenschaften eine fachdidaktische Reflexion. Ilka Parchmann Wissenswerte, November 2009 Jugendliche und Naturwissenschaften eine fachdidaktische Reflexion Ilka Parchmann Wissenswerte, November 2009 Science and technology are important for society Uganda Philippi Ghana Turkey Trinidad Egypt

Mehr

Spannungsfeld zwischen. Fachwissenschaft und Fachdidaktik

Spannungsfeld zwischen. Fachwissenschaft und Fachdidaktik Spannungsfeld zwischen Fachwissenschaft und Fachdidaktik Prof. Dr. Katja Maaß, Pädagogische Hochschule Freiburg Freiburg, 22.7.08 1 Fachwissenschaft und Fachdidaktik eine Darstellung aus Sicht der Mathematikdidaktik

Mehr

Inhalt. I. Naturwissenschaftliche Grundlagen. Vorwort... 13. Einleitung... 15. (Thomas Heinemann)... 19. 1. Das Begriffskonzept der Stammzelle...

Inhalt. I. Naturwissenschaftliche Grundlagen. Vorwort... 13. Einleitung... 15. (Thomas Heinemann)... 19. 1. Das Begriffskonzept der Stammzelle... Vorwort............................... 13 Einleitung.............................. 15 I. Naturwissenschaftliche Grundlagen (Thomas Heinemann)......................... 19 1. Das Begriffskonzept der Stammzelle............

Mehr

Möglichkeiten der Prävention einer Lese-Rechtschreib-Schwäche (LRS)

Möglichkeiten der Prävention einer Lese-Rechtschreib-Schwäche (LRS) Möglichkeiten der Prävention einer Lese-Rechtschreib-Schwäche (LRS) Dr. Gerd Mannhaupt (Universität Erfurt) / Susanne Keßler (Institut für Diagnostik und Lerntraining) EINE BESTANDSAUFNAHME Viele Eltern,

Mehr

Fortbildungsreihe STOCHASTIK kompakt 2015

Fortbildungsreihe STOCHASTIK kompakt 2015 Seite 1 von 5 Fortbildungsreihe STOCHASTIK kompakt 2015 Sehr geehrte Damen und Herren, aufgrund der großen Aktualität und starken Resonanz auf unsere Fortbildungsangebote aus dem Themengebiet der Stochastik

Mehr

Lernen durch Concept Maps

Lernen durch Concept Maps Lernen durch Concept Maps Elisabeth Riebenbauer & Peter Slepcevic-Zach Karl-Franzens-Universität Graz Institut für Wirtschaftspädagogik Linz, 15. April 2016 Hamburg, Mai 2014 Überblick Concept Maps Theoretische

Mehr

ICT-V Tagung der PHBern 31.10.2015 Workshop von Alain Geering www.medien-bildung.ch

ICT-V Tagung der PHBern 31.10.2015 Workshop von Alain Geering www.medien-bildung.ch ICT-V Tagung der PHBern 31.10.2015 Workshop von Alain Geering www.medien-bildung.ch 1 Übersicht Informatik-Biber Wettbewerb Informatik-Biber Module Praxis-Bericht Test Individuelle Vertiefung Fragen /

Mehr

Fachbereich Geisteswissenschaften Fachgruppe Katholische Theologie Campus Essen

Fachbereich Geisteswissenschaften Fachgruppe Katholische Theologie Campus Essen Fachbereich Geisteswissenschaften Fachgruppe Katholische Theologie Campus Essen Studienordnung für das Fach Katholische Theologie an der Universität Duisburg-Essen im Studiengang für das Lehramt für Grund-,

Mehr

Ausbildung in Pflege und Medizin: Skills interprofessionell trainieren

Ausbildung in Pflege und Medizin: Skills interprofessionell trainieren Die Gesundheitswelt der Zukunft denken Ausbildung in Pflege und Medizin: Skills interprofessionell trainieren Gabriele Schroeder, Careum Bildungsentwicklung, Projektleiterin Referat Swiss Congress for

Mehr

Swiss Plant Science Web

Swiss Plant Science Web Swiss Plant Science Web SPSW Koordination coordination-spsw@unibas.ch SPSW Kommunikation communications-spsw@ethz.ch Administration +41 44 632 40 52 Arc Lémanique Plant Science http://www.unil.ch/alps

Mehr

Die DFG Projekte RU Bi Qua und KERK an der Humboldt Universität zu Berlin und der neue Rahmenlehrplan RU. Kern der gegenwärtigen Bildungsreform:

Die DFG Projekte RU Bi Qua und KERK an der Humboldt Universität zu Berlin und der neue Rahmenlehrplan RU. Kern der gegenwärtigen Bildungsreform: Die DFG Projekte RU Bi Qua und KERK an der Humboldt Universität zu Berlin und der neue Rahmenlehrplan RU 1. Was sind Standards und Kompetenzen? 2. Beschreibung religiöser Kompetenz 3. Erhebung religiöser

Mehr

EINFÜHRUNG SINNSORIK KURZBESCHREIBUNG UND ZIELSETZUNG: 1. UNTERRICHTSEINHEIT (CA. 2 STUNDEN) DIDAKTISCHE UND METHODISCHE HINWEISE

EINFÜHRUNG SINNSORIK KURZBESCHREIBUNG UND ZIELSETZUNG: 1. UNTERRICHTSEINHEIT (CA. 2 STUNDEN) DIDAKTISCHE UND METHODISCHE HINWEISE EINFÜHRUNG KURZBESCHREIBUNG UND ZIELSETZUNG: In diesem einführenden Modul wird fachübergreifend gearbeitet. Ziel ist es, eine Perspektivenbildung der SuS zu den Begriffen Sinne und Sensorik zu ermöglichen.

Mehr

Praxisnah, fundiert und hochwertig: Reform der Lehrerbildung in Baden-Württemberg

Praxisnah, fundiert und hochwertig: Reform der Lehrerbildung in Baden-Württemberg 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Praxisnah, fundiert und hochwertig: Reform der Lehrerbildung in Baden-Württemberg Schule im Wandel Lehrerausbildung zukunftsfähig machen

Mehr

Google findet Teilen gut? Eine empirische Studie zum Einfluss von Facebook- Shares und Co. auf das organische Ranking von Suchmaschinen

Google findet Teilen gut? Eine empirische Studie zum Einfluss von Facebook- Shares und Co. auf das organische Ranking von Suchmaschinen Google findet Teilen gut? Eine empirische Studie zum Einfluss von Facebook- Shares und Co. auf das organische Ranking von Suchmaschinen Christin Hildebrandt / Christina Schumann / Jens Wolling Agenda Einführung

Mehr

Informationsveranstaltung für StudienanfängerInnen im Lehramtsstudium HERZLICH WILLKOMMEN!

Informationsveranstaltung für StudienanfängerInnen im Lehramtsstudium HERZLICH WILLKOMMEN! Informationsveranstaltung für StudienanfängerInnen im Lehramtsstudium HERZLICH WILLKOMMEN! Die Lehramtsstudien an der Universität Innsbruck Studienjahr 2015/16 Nadja Köffler, Franz Pauer, Wolfgang Stadler

Mehr

Unterrichtsentwurf. (Unterrichtsbesuch im Fach Informatik)

Unterrichtsentwurf. (Unterrichtsbesuch im Fach Informatik) Gymnasium - - -, 30. Juni 2014 Unterrichtsentwurf (Unterrichtsbesuch im Fach Informatik) Entwicklung verschiedener Strategien zum Knacken von Texten, die mit verschiedenen Techniken verschlüsselt wurden

Mehr

Verstehe ich alles? Analyse einer PBL-Problemstellung Problembearbeitung Selbstverantwortliches Lernen. 5. Lernfragen formulieren

Verstehe ich alles? Analyse einer PBL-Problemstellung Problembearbeitung Selbstverantwortliches Lernen. 5. Lernfragen formulieren Was ist PBL? Problembasiertes Lernen (PBL) ist eine Unterrichtsmethode, bei der den Lernenden eine realistische Problemstellung vorgelegt wird. Diese kann ein Phänomen darstellen, eine Frage, ein konkreter

Mehr

Erfolgsfaktoren und Bewertungskriterien in Change Management Prozessen

Erfolgsfaktoren und Bewertungskriterien in Change Management Prozessen Marit Gerkhardt Erfolgsfaktoren und Bewertungskriterien in Change Management Prozessen Mehrebenenanalyse von drei Veränderungsprozessen innerhalb eines internationalen Automobilherstellers Verlag Dr. Kovac

Mehr

Wahlpflichtfach Naturwissenschaft und Ökologie IGS Gerhard Ertl

Wahlpflichtfach Naturwissenschaft und Ökologie IGS Gerhard Ertl Wahlpflichtfach Naturwissenschaft und Ökologie IGS Gerhard Ertl Hast du Interesse an der Natur? Bist du technisch und handwerklich interessiert? Hast du Interesse, auf den Spuren von Entdeckern und Erfindern

Mehr

Didaktisches Grundlagenstudium Mathematik

Didaktisches Grundlagenstudium Mathematik Ministerium für Schule, Jugend und Kinder des Landes Nordrhein-Westfalen Fächerspezifische Vorgaben Didaktisches Grundlagenstudium Mathematik für das Lehramt an Grund-, Haupt- und Realschulen sowie den

Mehr

MINT-Schülerinnen-Camp 25. 28. September 2003 in Berlin. Entwurf und Bau einer stabilen Brücke aus Papier - Technisches Experiment

MINT-Schülerinnen-Camp 25. 28. September 2003 in Berlin. Entwurf und Bau einer stabilen Brücke aus Papier - Technisches Experiment Sabrina Evers TU Braunschweig Sabrina.Evers@tu-bs.de MINT-Schülerinnen-Camp 25. 28. September 2003 in Berlin Entwurf und Bau einer stabilen Brücke aus Papier - Technisches Experiment 1. Teil 1 Erforschung

Mehr

ZIELE, INHALTE, METHODEN UND ABLAUFSCHRITTE

ZIELE, INHALTE, METHODEN UND ABLAUFSCHRITTE Qualitätsentwicklung in Wohnstätten mit dem Instrument LEWO II Qualifizierung von ModeratorInnen ZIELE, INHALTE, METHODEN UND ABLAUFSCHRITTE der 3. LEWO-Moderatorenschulung 2003/2004 1 KONZEPTION DER MODERATORINNENSCHULUNG

Mehr

2. Im Unterricht thematisieren: Warum ist die soziale Fertigkeit wichtig?

2. Im Unterricht thematisieren: Warum ist die soziale Fertigkeit wichtig? Einüben sozialer Kompetenzen Ludger Brüning und Tobias Saum Soziale Kompetenzen sind zugleich Bedingung und ein Ziel des Kooperativen Lernens. Sie sind die Voraussetzung für gelingende Kommunikation, wechselseitiges

Mehr

Die Forschung mit embryonalen Stammzellen ist ethisch nicht akzeptabel

Die Forschung mit embryonalen Stammzellen ist ethisch nicht akzeptabel Die Forschung mit embryonalen Stammzellen ist ethisch nicht akzeptabel Das Schweizer Volk soll sich selber äussern bezüglich der Gesetzgebung zur embryonalen Stammzellenforschung. Die ethische Bedeutung

Mehr

Stammzellenforschungsgesetz

Stammzellenforschungsgesetz Dokumentation Stammzellenforschungsgesetz Update: 13.12.2012 Mit dem klaren Ja (64.4 Prozent) zum Stammzellenforschungsgesetz anlässlich der Referendumsabstimmung im November 2004 haben sich die Stimmberechtigten

Mehr

Hochschule der Bildenden Künste Saar Modulhandbuch Master-Studiengang Museumspädagogik

Hochschule der Bildenden Künste Saar Modulhandbuch Master-Studiengang Museumspädagogik Hochschule der Bildenden Künste Saar Modulhandbuch Master-Studiengang Museumspädagogik Einleitung Master-Studiengang Museumspädagogik 2 Ziele des Studiengangs Der MA-Studiengang Museumspädagogik [MA MusPäd]

Mehr

DIDAKTISCHE WERKSTATT NATURWISSENSCHAFTEN

DIDAKTISCHE WERKSTATT NATURWISSENSCHAFTEN Deutsches Bildungsressort Bereich Innovation und Beratung Dipartimento Istruzione e formazione in lingua tedesca Area innovazione e consulenza DIDAKTISCHE WERKSTATT NATURWISSENSCHAFTEN 2. Treffen am 19.04.2013

Mehr

Spiralcurriculum der Stadtbibliothek Hannover

Spiralcurriculum der Stadtbibliothek Hannover Spiralcurriculum der Stadtbibliothek Hannover Zusammenarbeit von Bibliothek und Schule Wenn Bibliothek Bildungspartner wird kommt kein Kind am Lesen vorbei! Angebote zur Förderung der Lese- und Informationskompetenz

Mehr

Zelldifferenzierung und Morphogenese

Zelldifferenzierung und Morphogenese Zelldifferenzierung und Morphogenese Fragestellung: Wie ist es möglich, daß sich aus einer einzigen Zelle ein hochkomplexes Lebewesen mit hohem Differenzierungsgrad entwickeln kann? weniger gut verstanden

Mehr

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema Gentechnologie Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Die Genklonierung in Bakterien Vektor-DNA Spender-DNA Restriktionsenzym Rekombinante

Mehr

Syllabus: CON4012 Projektarbeit

Syllabus: CON4012 Projektarbeit Syllabus: CON4012 Projektarbeit Modulverantwortlicher Prof. Dr. Bernd Britzelmaier Hochschule Pforzheim / Pforzheim University Lehrveranstaltung: Workload: Level: Voraussetzungen: CON4012 Projektarbeit

Mehr

Leistungsbewertungskonzept. Physik

Leistungsbewertungskonzept. Physik Leistungsbewertungskonzept Physik Stand: November 2014 Inhaltsverzeichnis 2 Inhaltsverzeichnis Inhaltsverzeichnis... 2 1 Grundsätze zur Leistungsbewertung in der Sekundarstufe I... 3 1.1 Bewertung von

Mehr

Lehr-Lernpsychologische Grundlagen des Erwerbs von Fahr- und Verkehrskompetenz

Lehr-Lernpsychologische Grundlagen des Erwerbs von Fahr- und Verkehrskompetenz Universität Duisburg-Essen Campus Essen - Lehrstuhl für Lehr-Lernpsychologie Lehr-Lernpsychologische Grundlagen des Erwerbs von Fahr- und Verkehrskompetenz D. Leutner D. Leutner Kompetenzen im Handlungsfeld

Mehr

Berufsausbildungen vor Ort in Nürnberg! Berufe mit Zukunft. Biologisch-technischer Assistent oder Chemisch-technischer Assistent werden.

Berufsausbildungen vor Ort in Nürnberg! Berufe mit Zukunft. Biologisch-technischer Assistent oder Chemisch-technischer Assistent werden. Berufsausbildungen vor Ort in Nürnberg! Berufe mit Zukunft. Biologisch-technischer Assistent oder Chemisch-technischer Assistent werden. BERUFSBILDENDE SCHULEN Mit einer guten Ausbildung erfolgreich durchstarten.

Mehr

Mediation an Schulen. Diplomarbeit

Mediation an Schulen. Diplomarbeit Mediation an Schulen Untersuchung der Umsetzungspraxis und Wirksamkeit von Schülermediation anhand ausgewählter nationaler und internationaler Studien Diplomarbeit vorgelegt an der Universität Mannheim

Mehr

Was ist ein genetischer Fingerabdruck?

Was ist ein genetischer Fingerabdruck? Was ist ein genetischer Fingerabdruck? Genetischer Fingerabdruck od. DNA-Fingerprint ist ein molekularbiologisches Verfahren zur individuellen Identifizierung von Lebewesen Der genetische Fingerabdruck

Mehr

GENETIK UND GENTECHNIK IM ALLTAG

GENETIK UND GENTECHNIK IM ALLTAG Benötigte Arbeitszeit: 10 Minuten GENETIK UND GENTECHNIK IM ALLTAG Konzept: Die Grundlagen der Vererbung und deren Anwendungsmöglichkeiten sollen in Hinblick auf gesellschaftliche und ethische Fragen behandelbar

Mehr

Für LehrerInnen findet am 9. Dez. 2015 an der PH Salzburg eine Fortbildung zum stadtplanspiel statt.

Für LehrerInnen findet am 9. Dez. 2015 an der PH Salzburg eine Fortbildung zum stadtplanspiel statt. Das von Wolfgang Richter und Paul Raspotnig entwickelte stadtplanspiel ist eine Simulation zur strategischen Stadtraumentwicklung für SchülerInnen 3. und 4. Klassen der Sekundarstufe I. Ziel des stadtplanspiels

Mehr

WORKSHOP METHODEN ZUR TEST- UND FRAGEBOGENKONSTRUKTION UND VERFAHREN DER DATENAUSWERTUNG. Prof. Dr. Nadine Spörer

WORKSHOP METHODEN ZUR TEST- UND FRAGEBOGENKONSTRUKTION UND VERFAHREN DER DATENAUSWERTUNG. Prof. Dr. Nadine Spörer WORKSHOP METHODEN ZUR TEST- UND FRAGEBOGENKONSTRUKTION UND VERFAHREN DER DATENAUSWERTUNG Prof. Dr. Nadine Spörer Gliederung Messmodelle: Status- und Prozessdiagnostik Schulleistungstests und Fragebögen

Mehr

Konstruktivistischer Unterricht mit Laptops?

Konstruktivistischer Unterricht mit Laptops? Fachbereich Erziehungswissenschaft und Psychologie der Freien Universität Berlin Konstruktivistischer Unterricht mit Laptops? Eine Fallstudie zum Einfluss mobiler Computer auf die Methodik des Unterrichts

Mehr

Informationen zur schriftlichen Prüfung im Staatsexamen EWS: Schulpädagogik im Frühjahr 2014

Informationen zur schriftlichen Prüfung im Staatsexamen EWS: Schulpädagogik im Frühjahr 2014 Informationen zur schriftlichen Prüfung im Staatsexamen EWS: Schulpädagogik im Frühjahr 2014 Termine: Vgl: vorläufige Termine auf der Homepage des Prüfungsamtes: http://www.uniregensburg.de/studium/pruefungsverwaltung/medien/lehramtsstudiengaenge/terminplan_fr

Mehr

Pränataldiagnostik und Schwangerschaftsabbruch

Pränataldiagnostik und Schwangerschaftsabbruch Wintersemester 2015/16 Vorlesung Ethik in der Medizin Pränataldiagnostik und Schwangerschaftsabbruch Prof. Dr. Alfred Simon Institut für Ethik, Geschichte und Theorie der Medizin Fallbeispiel In Ihre Geburtshilfliche

Mehr

Bern, St.Gallen, Zürich: Für das Leben gerüstet?

Bern, St.Gallen, Zürich: Für das Leben gerüstet? Bildungsmonitoring Schweiz Bern, St.Gallen, Zürich: Für das Leben gerüstet? Die Grundkompetenzen der Jugendlichen Zusammenfassung des kantonalen Berichts PISA 2000 OECD PISA Programme for International

Mehr

Modulhandbuch Master of Education Sozialkunde für Gymnasium, Realschule plus und berufsbildende Schulen

Modulhandbuch Master of Education Sozialkunde für Gymnasium, Realschule plus und berufsbildende Schulen Modulhandbuch Master of Education Sozialkunde für Gymnasium, Realschule plus und berufsbildende Schulen Modul 8: Politik und Politikvermittlung für Lehramt Realschule plus und berufsbildende Schulen 1200h

Mehr

Theorie-Praxis-Verzahnung in der Berufsbildung

Theorie-Praxis-Verzahnung in der Berufsbildung Theorie-Praxis-Verzahnung in der Berufsbildung am Beispiel der Implementierung von IMST-Projekten in die Ausbildung Ingrid Hotarek Regine Mathies Institut für Berufspädagogik Agenda Struktur und Organisation

Mehr

TECHNISCHE UNIVERSITÄT BRAUNSCHWEIG FAKULTÄT FÜR GEISTES- UND ERZIEHUNGSWISSENSCHAFTEN

TECHNISCHE UNIVERSITÄT BRAUNSCHWEIG FAKULTÄT FÜR GEISTES- UND ERZIEHUNGSWISSENSCHAFTEN TECHNISCHE UNIVERSITÄT BRAUNSCHWEIG FAKULTÄT FÜR GEISTES- UND ERZIEHUNGSWISSENSCHAFTEN INSTITUT FÜR FACHDIDAKTIK DER NATURWISSENSCHAFTEN Abt. Biologie und Biologiedidaktik Prof. Dr. Maike Looß Projektdarstellung

Mehr

Modulhandbuch des Studiengangs Englisch im Master of Education - Lehramt an Grundschulen (2014)

Modulhandbuch des Studiengangs Englisch im Master of Education - Lehramt an Grundschulen (2014) Modulhandbuch des Studiengangs Englisch im Master of Education Lehramt an Grundschulen (014) 6. Mai 014 Inhaltsverzeichnis MENG Fachwissenschaft Englisch MEd G.................................... 3 MENG3

Mehr

Lehrangebot am Institut für Marketing für Bachelor of Science

Lehrangebot am Institut für Marketing für Bachelor of Science Univ.-Prof. Dr. Anton Meyer Institut für Marketing Lehrangebot am Institut für Marketing für Bachelor of Science - Informationen, Vorgehen, Richtlinien Stand: Februar 2013 www.marketingworld.de Semester

Mehr

Zur Entwicklung eines Fernstudienangebots "Deutsch als Fremdsprache" für Studienanfänger an der Ramkhamhaeng Universität Bangkok

Zur Entwicklung eines Fernstudienangebots Deutsch als Fremdsprache für Studienanfänger an der Ramkhamhaeng Universität Bangkok kassel university press Zur Entwicklung eines Fernstudienangebots "Deutsch als Fremdsprache" für Studienanfänger an der Ramkhamhaeng Universität Bangkok Prapawadee Kusolrod Inhaltsverzeichnis 1 Einleitung

Mehr

Schön formulierte Rehaziele vom Kontext über- oder eingeholt?

Schön formulierte Rehaziele vom Kontext über- oder eingeholt? Schön formulierte Rehaziele vom Kontext über- oder eingeholt? ICF Reflexion der praktischen Arbeit REHAB Basel, 9.11.2012 Mirjam Zwahlen Joder, Sandra Signer Rehabilitations- und Rheumazentrum der soh

Mehr

Schulformspezifischer Master Lehramt Mittelschule Sport

Schulformspezifischer Master Lehramt Mittelschule Sport 08-004-0004 Lehrformen Fitness und Gesundheit fördern Supporting Fitness and Health 1. 2. Semester Professur für Prävention und Rehabilitation jedes Wintersemester Vorlesung "Gesundheitstraining I" (1

Mehr