Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen

Größe: px
Ab Seite anzeigen:

Download "Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen"

Transkript

1 Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Einleitung: Drosophila melanogaster hat sich als Modellorganismus in der Entwicklungsbiologie und der Genetik bewährt, und findet heute auch als Modell für menschliche Krankheiten in der präklinischen Forschung Anwendung. Die kurze Generationszeit, die verhältnismäßig leichte Haltung und die große Anzahl von produzierten Nachkommen erleichtern die Haltung von Drosophila in der wissenschaftlichen Forschung. Drosophila besitzt vier Chromosomenpaare: die Geschlechtschromosomen (X/X- bzw. X/Y) und die Autosomen 2, 3 und 4. Das gesamte Genom ist etwa 140 Millionen Basen groß und enthält rund Gene (FB2015_02 release of FlyBase). Einer der größten Vorteile von Drosophila als Modellorganismus ist jedoch seine leichte genetische Manipulierbarkeit, was die Generation mutanter Allele von Fliegengenen, die Einführung zusätzlichen genetischen Materials (Transgene) und ihre Kombination durch chromosomale Rekombination umfasst (Ashburner et al., 2005). Die Häufigkeit chromosomaler Rekombinationen ist proportional zu der Distanz zwischen den beiden genomischen Loci. Daher erfordert es die Testung einer großen Anzahl von Tieren um ein Individuum zu identifizieren, bei dem chromosomales Crossover zwischen zwei nah beieinander gelegenen Loci stattgefunden hat. Abbildung 1: Unterscheidung des Geschlechts bei Drosophila melanogaster. Die letzten beiden Hinterleibsegmente der Männchen sind dunkel gefärbt und auf der Vorderseite verfügt das Männchen über einen Genitalbogen mit Penis. Männchen tragen zudem an den Vorderbeinen eine als Geschlechtskamm bezeichnete dunkle Borstenreihe. Weibchen sind im Durchschnitt geringfügig größer als Männchen, ihr Hinterleib läuft spitz zu und alle Hinterleibsegmente sing gleichmäßig gebändert. Weibchen weisen auf Ihrer Vorderseite eine strukturell unauffällige Vaginalplatte auf. Abbildungen modifiziert nach: Flymove; Childress, Behringer und Halder. 1

2 Die genomische DNA einer Fliege kann mittels Squish single fly Protokoll (Gloor et al., 1993) schnell und unkompliziert isoliert werden. Die genomische DNA muss dabei nicht gesondert aufgereinigt werden, sondern kann direkt für die Amplifikation mittels Polymerase- Kettenreaktion (polymerase chain reaction, PCR) eingesetzt werden. Diese einfache Methode erlaubt es eine große Anzahl von Individuen mit wenig Zeitaufwand auf einen bestimmten Genotyp hin zu testen. Die PCR ist eine Methode zum Nachweis und zur enzymatischen Vermehrung kleinster Mengen spezifischer DNA zwischen zwei Nukleotid-Primern. Eine PCR besteht aus Zyklen. Jeder Zyklus umfasst die folgenden drei Schritte: Die zu amplifizierende DNA wird in Einzelstränge aufgeschmolzen (1. Denaturierung), die Primer binden gegenläufig an die DNA-Stränge (2. Hybridisierung) und die DNA-Polymerase heftet Nukleotide an die 3 -OH Primer-Enden und synthetisiert komplementäre DNA-Sequenzen (3. DNA- Synthese). Man spricht von einer Kettenreaktion, da die entstandenen Synthese-produkte eines jeden Zyklus als DNA-Matrize für den nächsten Zyklus dienen und es somit zur exponentiellen Vervielfältigung der DNA-Doppelstränge mit jedem Zyklus kommt (Knippers, 2006). Versuchsablauf: In diesem Experiment nutzen wir die Squish PCR um drei unbekannte Stämme auf Veränderungen im Genlokus des atf3 Gens (z.b. Insertionen, Deletionen, Inversionen) zu analysieren. 2

3 Erste Versuchswoche: 1. Stellen Sie den Squish Extraktionspuffer (SE) in einem 1.5 ml Reaktionsgefäß her: 200 µl Squish Puffer (SP) [10 mm Tris-HCl ph 8.2, 1 mm EDTA ph 8, 25 mm NaCl] 4 µl Proteinase K (PK) [20 mg/ml stock) Vortexen Sie die Lösung, zentrifugieren Sie kurz runter und stellen Sie anschließend auf Eis kalt. 2. Markieren Sie drei PCR-Reaktionsgefäße mit der entsprechenden Stock-Nr. und Ihrer Gruppennummer und stellen Sie sie auf Eis kalt. 3. Die Fliegenstämme wurden zuvor durch einstündige Inkubation bei -20 C eingeschläfert. Überführen Sie die Fliegen des ersten Stammes auf die bereitgestellte Petrischale und identifizieren Sie unter dem Binokular unter zu Hilfenahme von Abbildung 1 ein einzelnes Weibchen. 4. Überführen Sie das Weibchen mit Hilfe einer Pinzette in das entsprechende PCR- Reaktionsgefäß. 5. Entsorgen Sie die restlichen Fliegen aus der Petrischale in dem dafür vorgesehenen Autoklavierabfall. 6. Verfahren Sie gleichermaßen mit den beiden anderen Stämmen. 7. Nehmen Sie 50 µl des vorbereiteten SE mit der Pipette in eine gelbe Spitze auf. Zerdrücken Sie die Fliege in dem PCR Reaktionsgefäß mit Hilfe der gelben Spitze ohne die Flüssigkeit auszuwerfen. Erst wenn die Fliege deutlich aufgeschlossen wurde, werfen Sie die Flüssigkeit aus und vermischen sie mit dem Fliegenextrakt. 8. Gleichermaßen verfahren Sie mit den zwei weiteren Proben. 9. Zentrifugieren Sie die Proben kurz, stellen sie in die vorbereitete PCR Maschine und laufen Sie folgendes Programm nachdem alle Gruppen ihre Proben in dem Gerät platziert haben: Squish Programm 55 o C für 30 min 95 o C für 5 min 4 o C 3

4 10. Stellen Sie den Mastermix für die PCR wie folgt her: Master Mix PCR Reagenzien Volumen [µl] steriles ddh 2O 17 2x ExTaq PCR mix 25 dntps 4 Primer 1 (P1) 2 Primer 2 (P2) 2 Gesamtvolumen 50 Tabelle 1: Primer Primer Name Sequenz Nr. 1 Deletion Atf3 For GACAAATGGACAAATGGACAAACGG 2 Brian rev TGGGATGGTTGCTGGCACTGCCAGTT 11. Mischen Sie den Master Mix durch vortexen und zentrifugieren ihn anschließend kurz um die Flüssigkeit am Boden des Reaktionsgefäßes zu sammeln. 12. Kennzeichnen Sie einen PCR-Streifen auf der Seite des Gefäßes wie folgt: N-1 N-2 N-3 N-NK N: Gruppennummer; NK: Negativ Kontrolle 13. Pipettieren Sie jeweils 11 µl des Mastermixes in jedes gekennzeichnete Gefäß des Streifens. 14. Pipettieren Sie 2 µl des Fliegenextraktes in die jeweilige PCR-Reaktion (entsprechend dem Schema: Fliegenextrakt von Stamm 1 in das Reaktionsgefäß N-1, 2 in Reaktionsgefäß N-2, usw.). 15. Pipettieren Sie 2 µl steriles ddh2o in die Negativkontrolle (NK). 16. Zentrifugieren Sie den PCR-Streifen kurz, stellen Sie ihn in die vorbereitete PCR Maschine und laufen Sie folgendes Programm nachdem alle Gruppen ihre Proben in dem Gerät platziert haben: 4

5 atf3 PCR Programm C für 5 min, C für 30 sec C für 30 sec C für 2 min 30 sec, wiederhole Schritt x 5. 8 C/end Zweite Versuchswoche 17. Stellen Sie ein ein-prozentiges Agarosegel wie folgt her: 0.5 g Agarose 50 ml 1xTAE 18. Kochen Sie die Lösung in der Mikrowelle kurz auf bis sich die Agarose vollständig gelöst hat (VORSICHT! Beim Erhitzen der Lösung kann es zum Siedeverzug kommen! Deswegen: Flüssigkeit zwischendurch gelegentlich umschwenken und nach dem Erhitzen die Flüssigkeit noch mind. 20 sec im Gerät stehen lassen!)) 19. Lassen Sie die Lösung kurz abkühlen. Bauen Sie währenddessen die Kammer zum Gießen des Gels zusammen. 20. Fügen Sie unter Aufsicht eines Tischassistenten 2 µl Ethidiumbromid zu der Agaroselösung (ACHTUNG: Ethidiumbromid ist gifitig und mutagen! Auf jeden Fall Nitril-Handschuhe tragen! Kontakt vermeiden!), mischen Sie die Lösung durch vorsichtiges schwenken und gießen sie vorsichtig in die vorbereitete Gießapparatur. 21. Fügen Sie 2 µl Ladepuffer (LP) zu jeder PCR-Reaktion hinzu und zentrifugieren Sie erneut runter. 22. Transferieren Sie das erhärtete Agarosegel in die Gelkammer und bedecken Sie es großzügig mit 1xTAE Puffer. 23. Laden Sie 10 µl jeder Ihrer PCR Proben auf dem Agarosegel sowie 4 µl DNA- Leiter (1 kb) entsprechend folgendem Schema: Ladeschema Agarosegel: kb N 1 N 2 N 3 N NK 5

6 24. Lassen Sie das Gel bei 80V 40 min laufen und analysieren Sie die Banden anschließend mit Hilfe der Geldokumentation. 25. In der Zwischenzeit nutzen Sie die auf Ihren Computern installierte ApE Software um herauszufinden wo im atf3 Genlokus die für die PCR verwendeten Primer binden und wie groß das zu erwartende PCR-Produkt ist (Datei mit dem atf3 Genlokus finden Sie auf dem Desktop). Tabelle 2: Squish-PCR Ergebnisse Stamm PCR-Fragmentgröße Genotyp Referenzen Ashburner,M., Golic K.G., and Hawley,R.S. (2005). Drosophila - A laboratory handbook. (New York: Cold Spring Harbor). Carvalho,G.B., Ja,W.W., and Benzer,S. (2009). Non-lethal PCR genotyping of single Drosophila. Biotechniques 46, Gloor,G.B., Preston,C.R., Johnson-Schlitz,D.M., Nassif,N.A., Phillis,R.W., Benz,W.K., Robertson,H.M., and Engels,W.R. (1993). Type I repressors of P element mobility. Genetics 135, Knippers, R., 2006, Molekulare Genetik, Stuttgart, Thieme. 6

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in

Mehr

Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf

Mehr

GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR)

GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) GVO-Screening Kit Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) I. Einführung Die Gentechnik stellt die Landwirtschaft vor neue Herausforderungen. Einerseits eröffnet

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers FIGURE 20.1 Biology 6/e Biotechnologie Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli

Mehr

Mycoplasma gallisepticum

Mycoplasma gallisepticum BACTOTYPE PCR Amplification Kit Mycoplasma gallisepticum Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Borrelia burgdorferi s.l.

Borrelia burgdorferi s.l. BACTOTYPE PCR Amplification Kit Borrelia burgdorferi s.l. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Vorbereitung Lehrer Für jede Arbeitsgruppe werden 550 µl InstaGene-Matrix aliquotiert! Das Tube wird mit IG beschriftet!

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

Protokoll zur Übung PCR

Protokoll zur Übung PCR Protokoll zur Übung PCR im Rahmen des Praktikums Labor an der TU Wien Durchgeführt bei Ao.Univ.Prof. Mag. Dr.rer.nat. Robert Mach Verfasser des Protokolls: Gwendolin Korinek 0625083 & Daniel Bomze 0726183

Mehr

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig BACTOTYPE PCR Amplification Kit Chlamydia sp. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen

Mehr

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila 01.-04.03.04 Joachim Marhold, Regine Garcia Boy, Natascha Kunert, Cora Mund, Frank Lyko Programm 01.03.04: Präparation genomischer

Mehr

3 GFP green fluorescent protein

3 GFP green fluorescent protein SCHNUPPERKURS GENTECHNIK 1 ExploHeidelberg 2 Klonierung des Phagen Lambda 3 GFP green fluorescent protein 4 Gens in a bottle Vanessa Hecht 1 ExploHeidelberg Stiftung Jugend und Wissenschaft GmbH Technologiepark

Mehr

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Vorbereitung auf diesen Praktikumsteil: Organisation - Für den Bioinformatik-Teil benötigen Sie pro Gruppe einen Laptop -

Mehr

Produktkatalog 2010. Molekularbiologische Reagenzien

Produktkatalog 2010. Molekularbiologische Reagenzien Produktion, Vertrieb und Serviceleistung im Bereich der Molekularbiologie und Medizin Produktkatalog 2010 Molekularbiologische Reagenzien Molegene GmbH Bienenweg 28 35764 Sinn Tel. 02772-570952 Fax 02772-570945

Mehr

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans AVID X / 1998 Lawsonia intracellularis Seite -1- Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans 1. ALLGEMEINES

Mehr

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr

Auf der Suche nach der Wundermedizin

Auf der Suche nach der Wundermedizin Auf der Suche nach der Wundermedizin Experimente im Schullabor 1 Herausgeber Novartis Pharma AG, CH-4002 Basel Autoren: Dr. Gesche Standke und Dr. Christiane Röckl Michel Zeichnungen: Fonds der Chemischen

Mehr

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 ChromoQuant Das ChromoQuant in vitro Diagnose-Set QF-PCR 1 zur Analyse von häufigen chromosomalen Erkrankungen der Chromosomen 13, 18 und 21 412.001-48u

Mehr

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Versuch 1: Restriktionsenzyme als molekulare Werkzeuge Versuchsinhalt Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Zwei

Mehr

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion Einleitung Der Tierart-Kit SK1-12 enthält die notwendigen Materialien, um verarbeitete Tierarten in gängigen Fleisch- und Milchprodukten, z.b. Wurst oder Käse zu bestimmen. Ein Lehrerheft und fünf Schülerhefte,

Mehr

SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!!

SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!! aktualisiert, 08.03.2011, Wera Roth1 SDS Polyacrylamidgelelektrophorese (SDS-PAGE) Anleitung für Minigele Mini-Gelträger nach Anleitung zusammenbauen. Saubere Handschuhe tragen!!! Glasscheiben ordentlich

Mehr

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich?

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Im Unterricht habt ihr bereits einige Methoden und Vorgehensweisen der Molekularbiologie kennengelernt. Aber wo finden diese Methoden im täglichen

Mehr

Nachweis von DNA im Wein

Nachweis von DNA im Wein Abschlussbericht über den Forschungsauftrag Nachweis von DNA im Wein Projektlaufzeit: 01.01.2001 bis 31.03.2003 Prof. Dr. Ralf Kaldenhoff Universität Würzburg Julius-von-Sachs-Institut für Biowissenschaften

Mehr

Drosophila melanogaster

Drosophila melanogaster Modul biol113 Zellbiologie Drosophila melanogaster Komponenten der angeborenen Immunabwehr Experimente 1) RT (Reverse Transkriptase)-PCR zum Nachweis einer AMP- Expression nach Infektion 1.1 PCR-Reaktion

Mehr

Gentechnologie: Isolierung und Charakterisierung von DNA

Gentechnologie: Isolierung und Charakterisierung von DNA Genetisches Grundpraktikum 9. Kurstag 23.06.2005 Gentechnologie: Isolierung und Charakterisierung von DNA Lerninhalte: Klonierung, Plasmid, Polylinker ( multiple cloning site ), Restriktionsendonuklease,

Mehr

1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II

1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II Arbeitsblatt 1 Analyse von DNA 1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II Bevor Sie anfangen: Alle Reagenzien müssen vor Gebrauch vollständig aufgetaut sein und durchmischt

Mehr

Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten

Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten Im diesem Praktikumsteil sollen homöotische Mutanten von Arabidopsis untersucht werden. Abb 1, Aufbau einer Blüte einer

Mehr

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP Informationsveranstaltung Heimtierfuttermittel PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln C. Haldemann, ALP Grundidee des Nachweises von GVOs mittels PCR Die Bestimmung genveränderter

Mehr

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989).

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3 Methoden 3.1 Isolierung von Cosmid-DNA Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3.2 Präparation von YAC-DNA aus Hefezellen Die Hefe-DNA wurde modifiziert

Mehr

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein DNA-Extraktion Photometrie Polymerase-Kettenreaktion (PCR) Restriktionsanalyse Agarose-Gelelektrophorese Polyacrylamid-Gelelektrophorese

Mehr

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C 3 Methoden 3.1 Extraktion der DNA aus den Paraffinschnitten 3.1.1 Extraktions-Kit Das QIAamp DNA Mini Kit- System beruht auf dem Prinzip der Auflösung der Eiweiße mit Proteinase K, DNA Bindung an eine

Mehr

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) PCR-Nachweis der pfmv / CTP / EPSPS-Genkassette in transgenen Kulturpflanzen

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) PCR-Nachweis der pfmv / CTP / EPSPS-Genkassette in transgenen Kulturpflanzen Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) PCR-Nachweis der pfmv / CTP / EPSPS-Genkassette in transgenen Kulturpflanzen AM009 Erstellt vom Unterausschuss Methodenentwicklung

Mehr

Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint

Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint RFLP als Modell für einen DNA-Fingerprint Teil 1: Restriktionsverdau 1.1: Thermoblock / Wasserbad auf 37 C vorheizen 1.2: Puffer Y+/Tango auftauen und auf Eis stellen 1.3: 4 Proben, RSA I und H 2 O demin.

Mehr

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher

Mehr

Mycobacterium paratuberculosis

Mycobacterium paratuberculosis BACTOTYPE PCR Amplification Kit Mycobacterium paratuberculosis Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

AdnaTest ColonCancerDetect

AdnaTest ColonCancerDetect AdnaTest ColonCancerDetect RT-PCR-Nachweis von Darmkrebs-assoziierter Genexpression in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-505 Inhaltsverzeichnis Bestellinformation...

Mehr

2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24

2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 IV. Ergebnisse 90 2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 Die Konstruktion einer isogenen Toxinmutante des Stx2-produzierenden EHEC- Stamm O157:H7 86-24

Mehr

Plasmidpräparation aus Bakterien Inhalt

Plasmidpräparation aus Bakterien Inhalt Inhalt Einleitung... 2 Materialien... 4 Gewinnung der Bakterien... 6 Zerstörung der Bakterien... 7 Trennung von Plasmid-DNA und genomischer DNA... 8 Reinigung der Plasmid-DNA... 10 Elution der gereinigten

Mehr

2. DNA-Fingerprinting

2. DNA-Fingerprinting Obwohl die Untersuchung von Mikrosatelliteninstabilität und LOH nicht Ziel der vorliegenden Arbeit war, kann es im Rahmen der Vaterschaftsbegutachtung dazu kommen, dass von einem verstorbenen Putativvater

Mehr

AdnaTest ER/PR-Detect

AdnaTest ER/PR-Detect PCR-Expressionsanalyse der Östrogen- und Progesteron- Hormonrezeptoren in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-532 Inhaltsverzeichnis Bestellinformation... 3 Anwendungszweck...

Mehr

DNA Isolierung. Praktikum Dr. László Kredics

DNA Isolierung. Praktikum Dr. László Kredics Isolierung Praktikum Dr. László Kredics Aufgabe: Isolierung von Plasmid aus Bakterienzellen Plasmid : pbluescript Vektor, Gröβe: 2960 Bps 1. 1,5 ml Bakterienkultur in Eppendorf-Röhrchen pipettieren, 2

Mehr

Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern.

Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Plasmidisolierung Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Was können Sie lernen? Sie lernen eine ringförmige DNA, ein Plasmid, zu isolieren. Mit diesem

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

Gentechnik in Lebens- und Futtermitteln

Gentechnik in Lebens- und Futtermitteln BfR - Jubiläum FEDERAL INSTITUTE FOR RISK ASSESSMENT Gentechnik in Lebens- und Futtermitteln Dr. Jutta Zagon Produktidentität, Rückverfolgbarkeit und Neuartige Lebensmittel Thielallee 88-92, 14195 Berlin

Mehr

AdnaTest EMT-2/StemCell Add-on ProstateDetect

AdnaTest EMT-2/StemCell Add-on ProstateDetect AdnaTest EMT-2/StemCell Add-on ProstateDetect RT-PCR-Nachweis von Prostatakrebs-assoziierter Genexpression in angereicherten Tumorzellen Nur für Forschungszwecke Gebrauchsanweisung T-1-537-PP Inhaltsverzeichnis

Mehr

MutaREAL Cytomegalovirus real time PCR Kit

MutaREAL Cytomegalovirus real time PCR Kit MutaREAL Cytomegalovirus real time PCR Kit Screening Test für den Nachweis von humanen Cytomegaloviren (CMV) mittels real time PCR. KV2900324 KV2900396 Nur für Forschungszwecke Immundiagnostik AG, Stubenwald-Allee

Mehr

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase)

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase) Methodensammlung des LAG PCR-Nachweis der 35S-nptII-Übergangssequenz, der pnapin-bayte- Übergangssequenz und des plsc-gens erstellt vom Unterausschuss Methodenentwicklung des LAG Status: verabschiedet

Mehr

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Vorbereitung auf diesen Praktikumsteil: Organisation 2. Praktikumstag: - Für den Bioinformatik-Teil benötigen Sie am 2. Tag dieses

Mehr

Charakterisierung von Transkripten mittels RT-PCR

Charakterisierung von Transkripten mittels RT-PCR Charakterisierung von Transkripten mittels RT-PCR Versuchsleiter: Ulrike Gerischer Protokollführung: Karl Varadi Gruppe: 11 Durchführung: 18.11 22.11.2002 Protokoll testiert: WS02 Universität Ulm Inhaltsverzeichnis

Mehr

Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung

Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung In Zusammenarbeit mit Katharina Mumm, Alexander Prange Gewinnung des Hefe - Bakterienisolates

Mehr

Facharbeit. Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen

Facharbeit. Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen Bernhard Strigel Gymnasium Kollegstufe/ Jahrgang: 2007/ 2009 Memmingen Leistungskurs: Biologie Kollegiat: Stefanie Funk Facharbeit Restriktionsverdau am Plasmid puc 18 mit verschiedenen Enzymen Abgegeben

Mehr

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz Luitgardis Seigner Schaderregernachweis mit der Polymerase-Kettenreaktion (PCR) Schaderregernachweis mit der Polymerase- Kettenreaktion

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94.

Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94. In diesem Skript wird der Versuch unternommen, der Prozess Pyrosequencing so zu erklären, dass Schüler die Chance haben Pyrosequencing zu verstehen. Es basiert auf einem Vortrag im Rahmen des Science Bridge

Mehr

Reagenzien Isolierung von Nukleinsäuren

Reagenzien Isolierung von Nukleinsäuren Aufbewahrung bei Raumtemperatur Anwendung Isolierung ultrareiner Plasmid-DNA aus Bakterienkulturen von 1 ml bis 800 ml. Die Plasmid-DNA eignet sich für Manuelle und automatisierte Sequenzierung mit Fluoreszenzfarbstoffen

Mehr

Identifizierung positiver Klone aus einer λ-phagenbibliothek

Identifizierung positiver Klone aus einer λ-phagenbibliothek Identifizierung positiver Klone aus einer λ-phagenbibliothek Betreuer: Elke Muth-Köhne und Nora Cavara Beginn des Versuchs: 9.00 Uhr im Praktikumssaal NBCF 04 Nord 1. Theoretischer Hintergrund 1.1 Screening

Mehr

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Versuch 2: Polymerasekettenreaktion Betreuer: Knut Jahreis Versuchsinhalt Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Zwei verschiedene Plasmide werden als Matrizen für eine Polymerasekettenreaktion

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung Sequenzierung von Thomas Grunwald Abteilung für Med. und Mol. Virologie Sequenzierung Hintergrund Allgemeiner Überblick Funktionsweise der Sequenzierung Sequenzierungsprotokoll Auswertung der Daten Probleme

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign

Mehr

Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil

Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil Biochemisches Praktikum 1 DNA-Analytik Praktischer Teil 2 Inhaltsverzeichnis Sicherheitshinweise DNA-Analytik 1 Arbeitshinweise DNA-Analytik 2 Gießen von Agarosegelen 3 Isolierung genomischer DNA 4 Isolierung

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Vaterschaftsanalyse mittels genetischem Fingerabdruck

Vaterschaftsanalyse mittels genetischem Fingerabdruck Vaterschaftsanalyse mittels genetischem Fingerabdruck Klassenstufe Oberthemen Unterthemen Anforderungsniveau Durchführungsniveau Vorlauf Vorbereitung Durchführung SII Moderne Genetik Sequenzanalyse Genetischer

Mehr

ThromboType 1 Test (HPA- 1)

ThromboType 1 Test (HPA- 1) GEBRAUCHSANLEITUNG ThromboType 1 Test (HPA- 1) REF THROMBOTYPE1 IVD ThromboType1 Reagenzien E-Gel 48 TABLE OF CONTENTS Inhaltsverzeichnis GEBRAUCHSANLEITUNG... 2 ZUSAMMENFASSUNG UND ERLÄUTERUNGEN... 2

Mehr

GEBRAUCHSANLEITUNG. Glutatione Agarose Resin

GEBRAUCHSANLEITUNG. Glutatione Agarose Resin GEBRAUCHSANLEITUNG Glutatione Agarose Resin Agarose zur Affinitätsreinigung von GST-Tag-Fusionsproteinen und anderen Glutathion-Bindungsproteinen (Kat.-Nr. 42172) SERVA Electrophoresis GmbH - Carl-Benz-Str.

Mehr

6. DNA -Bakteriengenetik

6. DNA -Bakteriengenetik 6. DNA -Bakteriengenetik Konzepte: Francis Crick DNA Struktur DNA Replikation Gentransfer in Bakterien Bakteriophagen 2. Welcher der folgenden Sätze entspricht der Chargaff-Regel? A) Die Menge von Purinen

Mehr

5,6- Carboxy- Rhodamin (Rox) TIB MolBiol, Berlin Desoxynukleosidtriphosphat (dntp)

5,6- Carboxy- Rhodamin (Rox) TIB MolBiol, Berlin Desoxynukleosidtriphosphat (dntp) 8 Anhang 8.1 Chemikalien und Reagenzien Bromphenolblau Bromma, Schweden 5,6- Carboxy- Rhodamin (Rox) TIB MolBiol, Berlin Desoxynukleosidtriphosphat (dntp) Invitrogen TM, Karlsruhe Ethanol (RNase-frei)

Mehr

Eine molekulare Lösung des Hamiltonkreisproblems mit DNA

Eine molekulare Lösung des Hamiltonkreisproblems mit DNA Eine molekulare Lösung des Hamiltonkreisproblems mit DNA Seminar Molecular Computing Bild: http://creatia2013.files.wordpress.com/2013/03/dna.gif Andreas Fehn 11. Juli 2013 Gliederung 1. Problemstellung

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

Versuch Blut Hämoglobin

Versuch Blut Hämoglobin Versuch Blut Hämoglobin Dieser Versuchstag soll ihnen eine Reihe unterschiedlicher Techniken sowie Eigenschaften von Blutfarbstoffen nahebringen. Blutfarbstoffe dienen im nahezu gesamten Tierreich dem

Mehr

GeneProfile Der Genetische Fingerabdruck: Verwandtschaftsnachweis mit PCR

GeneProfile Der Genetische Fingerabdruck: Verwandtschaftsnachweis mit PCR GeneProfile Der Genetische Fingerabdruck: Verwandtschaftsnachweis mit PCR Experimentierkit für den Biologieunterricht in der Oberstufe an Gymnasien Lehrerhandbuch Entwickelt in Zusammenarbeit mit dem Oberschulamt

Mehr

C V C. Gebrauchsanweisung für Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revision 2. Juli 2014

C V C. Gebrauchsanweisung für Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revision 2. Juli 2014 DOT133v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Seite 1 von 7 Gebrauchsanweisung für Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revision 2 Juli 2014

Mehr

Voraussetzungen für die Genomische Selektion beim Pferd

Voraussetzungen für die Genomische Selektion beim Pferd Agrar- und Ernährungswissenschaftliche Fakultät Institut für Tierzucht und Tierhaltung Voraussetzungen für die Genomische Selektion beim Pferd Prof. Dr. Georg Thaller 32. Jahrestagung zur Pferdegesundheit

Mehr

Fortbildung für Biologen an der Oranienschule

Fortbildung für Biologen an der Oranienschule Fortbildung für Biologen an der Oranienschule Am 28.01.08 fand die erste ganztägige schulinterne Lehrerfortbildung für Biologen an der Oranienschule unter der Leitung von Frau Dr. Wismar und Herrn Bender

Mehr

Plasmid DNA purification

Plasmid DNA purification Plasmid DNA purification Excerpt from user manual - Deutsch - NucleoBond Xtra NucleoBond Xtra NucleoBond Xtra Plus NucleoBond Xtra Plus January 2013 / Rev. 11 Plasmid DNA Purification Deutsch Einleitung

Mehr

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts

Mehr

Technische Universität Chemnitz Chemisches Grundpraktikum

Technische Universität Chemnitz Chemisches Grundpraktikum Technische Universität Chemnitz Chemisches Grundpraktikum Protokoll «CfP5 - Massanalytische Bestimmungsverfahren (Volumetrie)» Martin Wolf Betreuerin: Frau Sachse Datum:

Mehr

Bruder oder Vetter - was verbindet uns mit dem Neandertaler? 1

Bruder oder Vetter - was verbindet uns mit dem Neandertaler? 1 Bruder oder Vetter - was verbindet uns mit dem Neandertaler? 1 BÄRBEL KUNZE 2, Universität Lübeck Erweiterter Bericht von Wolfram Eckloff In ihrem beeindruckenden Vortrag berichtete Frau Dr. Kunze über

Mehr

Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück

Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück Polymerase-Kettenreaktion (PCR) Die Polymerase-Kettenreaktion (englisch Polymerase Chain Reaction, PCR) ist eine

Mehr

Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli

Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli 1 Heterologe Expression und Aufreinigung von SEPALLATA3 aus Escherichia coli Organisatorisches: Termine: 24.10.2014; 7.11.2014, 14.11.2014 Beginn: 8.15 Uhr im Seminarraum 124, Philosophenweg 12 Am Beginn

Mehr

PCR Eine Methode zum Nachweis gentechnisch veränderter Organismen (GVO)

PCR Eine Methode zum Nachweis gentechnisch veränderter Organismen (GVO) Nr.: V-011 PCR Eine Methode zum Nachweis gentechnisch veränderter Organismen (GVO) Egert, Michael, Dr. (LUFA Nord-West Institut für Futtermittel, Oldenburg); Einleitung Die Gentechnik eröffnet für die

Mehr

Skript zur Lehrveranstaltung Populationsgenetik / Molekulare Ökologie SS 2010

Skript zur Lehrveranstaltung Populationsgenetik / Molekulare Ökologie SS 2010 Skript zur Lehrveranstaltung Populationsgenetik / Molekulare Ökologie SS 2010 Inhaltsverzeichnis 1. Methoden im populationsgenetischen Labor... 2 1.1 Die DNA und ihre Bedeutung im Labor... 2 1.2 PCR...

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli Reinigung Protein (1) Kolonie-PCR Polymerase

Mehr

In situ Hybridisierung

In situ Hybridisierung In situ Hybridisierung eine Methode zum direkten und spezifischen Nachweis von Nukleinsäuren (DNA und RNA) in Gewebe, Zellen, Zellkompartimenten und Chromosomen Was kann damit erreicht werden? direkte

Mehr

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C

1 µl BamHI H 2 O 21 µl H 2 O 30 µl Volumen 18 µl H 2 O 30 µl Inkubation 2h @ 37 C 2h @ 37 C F1-Praktikum Genetik Protokoll Versuch 2: Nachweis der Funktion von Promotor- und Enhancer-Sequenzen mittels Reportergen-Assay Gruppe 8, Manfred Depner & Susanne Duncker Einführung Um die Funktion von

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

2. Übung: Chromosomentheorie

2. Übung: Chromosomentheorie Konzepte: 2. Übung: Chromosomentheorie Mitose/Meiose Geschlechtschromosomale Vererbung Chromosomentheorie Regeln zur Vererbung Autosomal rezessiv: - Merkmal tritt auf in Nachkommen nicht betroffener Eltern

Mehr

Probe und Probenmenge Wassermenge Auftragspuffermenge 5 µl Kaninchenmuskelextrakt 50 µl 100 µl

Probe und Probenmenge Wassermenge Auftragspuffermenge 5 µl Kaninchenmuskelextrakt 50 µl 100 µl Arbeitsgruppe D 6 Clara Dees Susanne Duncker Anja Hartmann Kristin Hofmann Kurs 3: Proteinanalysen Im heutigen Kurs extrahierten wir zum einen Proteine aus verschiedenen Geweben eines Kaninchens und führten

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung

Mehr

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt.

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt. Western Blot Der Western Blot ist eine analytische Methode zum Nachweis bestimmter Proteine in einer Probe. Der Nachweis erfolgt mit spezifischen Antikörpern, die das gesuchte Protein erkennen und daran

Mehr

ZytoLight FISH-Tissue Implementation Kit

ZytoLight FISH-Tissue Implementation Kit ZytoLight FISH-Tissue Implementation Kit Z-2028-20 20 Z-2028-5 5 Für die Fluoreszenz in situ Hybridisierung (FISH) unter Verwendung einer beliebigen ZytoLight-FISH-Sonde.... In-vitro-Diagnostikum gemäß

Mehr

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

Luke Alphey. DNA-Sequenzierung. Aus dem Englischen übersetzt von Kurt Beginnen. Spektrum Akademischer Verlag

Luke Alphey. DNA-Sequenzierung. Aus dem Englischen übersetzt von Kurt Beginnen. Spektrum Akademischer Verlag Luke Alphey DNA-Sequenzierung Aus dem Englischen übersetzt von Kurt Beginnen Spektrum Akademischer Verlag Inhalt Abkürzungen 11 Vorwort 15 Danksagung 16 Teil 1: Grundprinzipien und Methoden 1. 1.1 1.2

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr