MVZ Mikrobiologie & UKE. Hepatitisdiagnostik

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "MVZ Mikrobiologie & UKE. Hepatitisdiagnostik"

Transkript

1 MVZ Mikrobiologie & UKE Hepatitisdiagnostik

2 Hepatitisviren Virus Familie Struktur Genom Genotypen chron. Infektion HAV Picornaviren 27nm ohne Hülle ss(+)rna, 7.5kb 7 (I-VII) nein HBV Hepadnaviren 45nm mit Hülle circ DNA, 3.2kb 8 (A-H) ja HCV Flaviviren 50-60nm mit Hülle ss(+) RNA, 9.5kb 6 (1-6) ja HDV Deltavirus 35nm mit Hülle circ.ss RNA 1.8kb 3 (I-III) ja HEV Caliciviren 30nm ohne Hülle ss(+) RNA, 7.2kb 1 Serotyp nein HGV Flaviviren 40-50nm mit Hülle ss(+) RNA, 9.5kb 1 ja

3 Erreger der viralen Hepatitis (n=8803) (Deutschland, 2007) HCV (77,9%)* HAV (10,6%) HBV (11,5%) * Meldepflicht für alle Nachweise, soweit nicht bekannt ist, dass eine chronische Infektion vorliegt ( 7 IfSG)

4 Prävalenz (aktuell infizierte Menschen):? Chronische Hepatitis B: geographische Verbreitung

5 Prävalenz (aktuell infizierte Menschen): 350 Mill. Chronische Hepatitis B: geographische Verbreitung

6 Prävalenz (aktuell infizierte Menschen):? Hepatitis C: Verbreitung

7 Prävalenz (aktuell infizierte Menschen): Mill. Hepatitis C: Verbreitung

8 Hepatitis B: Infektionswege (USA, 1993) IVDA (15%) homosexuelle Kontakte (9%) heterosexuelle Kontakte (41%) unbekannt (31%) Haushaltskontakte (2%) andere (1%) medizinisches Personal (1%)

9 HCV: Risikofaktoren (USA, ) Haushaltskontakt (3%) med.pers. (4%) Transfus. (4%) multiple RF (14%) unbekannt (1%) Sexualkontakt (14%) IVDA (59%)

10 Inzidenz (weltweit): 1.4 Millionen (WHO, geschätzt) Hepatitis A: Verbreitung

11 Hepatitis A Verlauf Infektion Ikterus HAV-RNA/Antigen (Stuhl) HAV-RNA (Serum) Anti-HAV-IgG Anti-HAV-IgM Wochen Jilg, 2006

12 Nachweisverfahren Direkte Methoden - Elektronenmikroskopie - Nachweis viraler Antigene - Nachweis viraler Nukleinsäuren Indirekte Methoden - IgG/IgM Antikörper (EIAs, Westernblots)

13 HBV: EM-Bild aus dem Serum Dane-Partikel HBsAg (zirkulär) HBsAg (filamentös)

14 HBV: Aufbau (Dane-Partikel) Hülle (HBsAg) Kapsid (HBcAg) HBV-DNA DNA-Polymerase

15 HBV Genomstruktur

16 HBV: Serologischer Verlauf Klinik HBsAg HBeAg Anti-HBc Anti-HBc-IgM Anti-HBs Anti-HBe Jahre Wochen nach Exposition

17 HBs Antigen Test MEIA, Abbott Axsym Magnetpartikel Anti HBs beschichtet HBs Antigen AP-konjugierter Anti HBsAK Y Y Y Y Y Fluoreszenz signal Magnetische Separation Y Y Substratlösung Y Y Magnet

18 MVZ Mikrobiologie & UKE Akute Hepatitis B? HBsAg (AP) ahbs ahbc ahbc (IgM) HBeAg ahbe HBV- DNA akute Hepatitis B Ø Ø Ø Ø Ø Ø Ø Ø

19 HBsAg (AP) MVZ Mikrobiologie & UKE Akute Hepatitis B? (oder: es gibt mehr als Schwarz und Weiß) (Teil 1) HBsAg (OPD) ahbs ahbc ahbc (IgM) HBeAg ahbe HBV- DNA akute Hepatitis B >200 > Ø Ø Ø Ø 14 Ø Ø Ø Ø Ø Ø Ø Ø Ø 22 Ø Ø Ø Ø Ø Ø 11 Ø Ø Ø Ø Ø Ø Ø Ø Ø Ø Antikörper gegen Alkalische Phosphatase? 4 Ø

20 MVZ Mikrobiologie & UKE Akute Hepatitis B? (Teil 2) HBsAg HBsAg ahbc (AP) (OPD) ahbs ahbc (IgM) HBeAg ahbe HBV- DNA >200 > Ø Ø Ø Ø 1x Ø Ø Ø 12 Ø 1x Ø Ø Ø Ø 8x Ø Ø Ø Ø 1x Ø Ø Ø Akute Hepatitis B bei Immunsuppression!!! 11 Ø 4x10 6

21 HBV DNA Nachweisverfahren Hybridisierungstests Southern, Northern Blot Hybridisierung Hybrid Capture Test Amplifikationstests PCR NASBA branched DNA

22 Prinzip der Hybridisierung RNA Sonde 5 -AACGUGUCCAGUACUGCCUGUCAAAAA-3 5 -CAGGTCATGACG-3 Sonde DNA DNA 5 -CAGGTCATGACG-3 5 -AACGTGTCCAGTACTGCCTGACA-3 3 -TTGCACAGGTCATGACGGACTGT-5

23 Hybridisierung mit nicht-radioaktiv markierten Sonden

24 Sensitivität molekularer Nachweisverfahren Antigen Test (HIV p24 EIA) Nukleinsäure Hybridisierung In vitro Amplifikation (PCR) Anzahl der Erreger

25 Polymerase-Kettenreaktion Prinzip Denaturierung Annealing C C Reaktionsmix: DNA-Template (z.b. genomische DNA) Primer 1 Primer 2 dntps: datp, dctp, dgtp, dttp Mg 2+ PCR Puffer DNA Polymerase (thermostabil) Extension C

26 Polymerase Chain Reaction (PCR)

27 Polymerase-Kettenreaktion Prinzip > 10 6 fache Vervielfältigung der Zielsequenz

28 Sensitivität der HBV Amplifikationstests Methodik Nachweis- linearer Messbereich grenze Real Time PCR Roche (Cobas TaqMan) 12 U/ml U/ml Abbott (RealTime HBV) 10 U/ml U/ml b DNA (Siemens, Versant HBV) 360 U/ml 360-2x10 8 U/ml Hybrid Capture (Qiagen/Digene) 3500 U/ml x10 8 U/ml

29 PCR in der HBV Diagnostik - Abklärung unklarer serologischer Befunde Grenzwertiges HBs Antigen Persistierende HBs Antigen Reaktion ohne AK Bildung Verdacht auf HBV Infektion bei negativem HBs Antigen (akute Infektion, okkulte Infektion, HBs Antigenvarianten) - Bestimmung der viralen Replikationsaktivität/Infektösität - Prognostische Abklärung chronischer HBV Infektion - Initiierung und Monitoring der antiviralen Therapie - Charakterisierung von Virusisolaten (Genotyp, Resistenzund Virulenz-assoziierte Mutationen/Polymorphismen)

30 Isoliertes anti-hbc Jahre nach abgelaufener Hepatitis B? (1 Dosis Hepatitis-B-Impfstoff Boosterung des anti-hbs) unspezifisch? (anderer Test, Verdünnung von 1:2) latenter Virusträger? (hoher anti-hbc-titer, HBV-DNA (PCR)) 1% haben HBV-DNA > 100 Kopien/ml

31 Isoliertes anti-hbc Extinktion (MEIA): 0,88 (positiv: < 1,0; spezifische Reaktivitäten: < 0,1) 1:2: negativ, ELISA anti-hbc: negativ, anti-hbe: negativ, PCR: negativ

32 MVZ Mikrobiologie & UKE Hepatitis B nach LTx oder: Wie ausgeheilt ist eine ausgeheilte Hepatitis B? (* 09/90, LTx 12/91) HBsAg anti-hbs HBsAg (µg/ml) LTx Re-LTx anti-hbs (miu/ml) Lebersegment des Vaters: HBsAg neg., anti-hbs pos., anti-hbc pos., HBV-DNA negativ (NWG: 2x10 5 Kopien/ml)

33 Antivirale Therapie (HBV) Indikation HBV DNA > 10 4 copies/ml (2000 U/ml) (insbesondere bei erhöhten Transaminasen, Leberfibrose oder Zirrhose) Monitoring VL-Kontrolle nach 6w, 12w und dann in 3-6 Monats Intervallen Ziel: VL < 2000U/ml, idealerweise unter die Nachweisgrenze >10x Anstieg der VL: Hinweis auf Therapieversagen - Compliance - Pharmakologische Faktoren - Resistenzentwicklung

34 Resistenzmutationen V84M/ S85A L180M A181V/T T184G/S S202I M204V/I V214A/ Q215S N236T M250V 3TC ADV ETV TBV FTC TDF

35 HBV Resistenzanalyse pol HBV-Polymerase PCR 204 Y M D D AATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATATA Sequenzanalyse HBV-Referenzsequenz HBV-Patientenisolat Internet-Datenabgleich HIV-GRADE, HBV tool Geno-2 pheno, HBV M204V Identifizierung und Interpretation der Resistenz-assoziierten Mutationen

36 HBV-Resistenzmutationen quantitative Aussagen HBV 3TC ADV ETV Clevudine Telbivudine WT L180M > M204I > > L180M+ M204V > > A181T/V NA NA NA N236T I169T/ M250V > NA >100 >1000 T184G/ S202I > NA >1000 >1000 Chin 2001, Angus 2004, Levine 2002, Tenny 2004, Ono-Nits 2002

37 3TC-Resistenz

38 Adefovir-Resistenz

39 1989 identifiziert (Non-A-Non-B-Hepatitiden) Einzelsträngiges RNS-Virus mit Lipoproteinhülle Gehört zur Gruppe der Flaviviren Durchmesser nm Hohe Chronizität 6 Genotypen (keine Unterschiede bzgl. Virulenz) Hepatitis-C Virus

40 Hepatitis C Serologischer und klinischer Verlauf Chronisch-aktive Hepatitis Akute Hepatitis Klinik Zirrhose HCC GPT (U/l) HCV-Antikörper (ELISA) HCV-RNA (RT-PCR) Wochen Monate Jahre Jahrzehnte *Polywka, 2002

41 HCV-Diagnostik Antikörpersuchtest Bestätigungstest (Blot, Matrix) HCV-PCR (Genotypisierung)

42 MVZ Mikrobiologie & UKE Gutachten berufsgenossenschaftlich anerkannte berufsbedingte chronische Hepatitis C keine Therapie Suchtest: positiv Blot: negativ PCR: negativ

43 MVZ Mikrobiologie & UKE Spezifität der Reaktivität im Antikörpersuchtest (n=2148) fraglich reaktiv (1,2%) falsch positiv (13,2%) bestätigt positiv (85,6%)

44 MVZ Mikrobiologie & UKE Spezifität der Antikörperreaktivität (n=2148) falsch positiv fraglich bestätigt positiv > 40 (S/CO)

45 Pat. A., M.,, *1955) Datum Antikörper PCR Genotyp (IU/ml) negativ x10 4 4a x10 4 4a

46 HCV bei Dialysepatienten (n=1774) chronische HCV-Inf. (9,8%) akute HCV-Inf. (1,4%) (n=25) 9 PCR u. AK pos. 16 verzögerte AK-Bildung HCV-negativ (88,9%)

47 Verlauf der chronischen HCV-Infektion HCV-Antikörper (S/CO) Nachweisgrenze HCV-RNA (log 10 IU/ml)

48 Geographische Verteilung der HCV-Genotypen 1a (60%) 1b (20%) 2a, 2b, 3a 1a, 1b, 3a 4a (90%) 3a 1b, 2a, 2b 6 1b, 2 1a, 1b, 2, 3a 5 1, 2, 3

49 Verteilung der HCV- Genotypen in Hamburg 3a (2%) 4a (3%) 4a (4%) 1b (48%) 1a (46%) 2 (3%) 3a (16%) 1b (50%) 1a (28%) (n=447) (n=747)

50 HCV Genotypisierung Bedeutung der Genotypisierung - Unterschiedliches Ansprechen auf eine antivirale Behandlung - Unterschiedliche Dauer der antiviralen Behandlung

51 HCV Genotypisierung Durchführung reverse Hybridisierung (LiPA; line probe assay)

52 HCV Genotypisierung Durchführung reverse Hybridisierung (LiPA; line probe assay) Versant, InnoLiPA HCVII, Bayer/Siemens

53 6 Monate nach Therapie anhaltender Therapieerfolg = Viruselimination? HCV-Antikörper (S/CO) peg IFNα + Riba HCV-RNA (log 10 IU/ml) Jahre

54 Hepatitis Diagnostik Zusammenfassung Chronische Virushepatitis durch HBV und HCV: in Deutschland ca. 0.6% (~ ) chronische HBV Infektion ca. 0.4% (~ ) chronische HCV Infektion Basis Diagnostik: HBV: Serologie (HBsAg, HBs AK, HBc AK) HCV: AK-Test (in kürze AK/Ag-Test) Molekularbiologische Verfahren (PCR) Virusaktivität, Infektiösität, prognostische Abklärung Therapieindikation und Monitoring Charakterisierung der Viren (Genotyp, Virulenz, Resistenz)

Die Labordiagnose der Virushepatitis

Die Labordiagnose der Virushepatitis Seite 1 von 6 Die Labordiagnose der Virushepatitis Die primär hepatotropen Erreger HepatitisAVirus (HAV) HepatitisBVirus (HBV) HepatitisCVirus (HCV) HepatitisDVirus (HDV) (HepatitisDeltaVirus) HepatitisEVirus

Mehr

Tricky cases in Hepatology. Tilman Gerlach Gastroenterologie und Hepatologie UniversitätsSpital Zürich

Tricky cases in Hepatology. Tilman Gerlach Gastroenterologie und Hepatologie UniversitätsSpital Zürich Tricky cases in Hepatology Tilman Gerlach Gastroenterologie und Hepatologie UniversitätsSpital Zürich Fall 1 - F.W. 23J. Verkäuferin bisher immer gesund 3/2005 Vorstellung bei Permanence Oberbauchschmerzen

Mehr

Das ABC der Virushepatitis

Das ABC der Virushepatitis Das ABC der Virushepatitis Dr. Parnaz Ordubadi 4. Med. Abteilung, Wilhelminenspital Wien, 5.6.2009 1. Klassische Hepatitisviren - Hepatitis A Virus(HAV) - Hepatitis B Virus (HBV) - Hepatitis C Virus (HCV)

Mehr

Therapieoptionen Hepatitis B

Therapieoptionen Hepatitis B Therapieoptionen Hepatitis B Interferon alpha Viral entry Uncoating Nuclear import Assembly & budding cccdna HBsAg ER Positive strand synthesis Removal of pregenome Lamivudin Adefovir Entecavir Tenofovir

Mehr

Neues zur chronischen Hepatitis B

Neues zur chronischen Hepatitis B Gesellschaft für Gastroenterologie in Herne e.v. Hepatitis Selbsthilfe e.v.- Herne 15. Herner Lebertag 2012 Neues zur chronischen Hepatitis B Dr. Johanna Preiss Gastroenterologische Schwerpunktpraxis Wanne-Eickel

Mehr

Ruhr-Universitä t Bochum. Modellregion West. Akute und chronische Hepatitis. Medizinische Universitätsklinik

Ruhr-Universitä t Bochum. Modellregion West. Akute und chronische Hepatitis. Medizinische Universitätsklinik Ruhr-Universitä t Bochum Modellregion West Akute und chronische Hepatitis Medizinische Universitätsklinik HAV EBV CMV,... Ausheilung ASH DILD HBV HDV HCV Akute Hepatitis Chron. Hepatitis Zirrhose HCC,

Mehr

Chronische Hepatitis B Update 2009

Chronische Hepatitis B Update 2009 Chronische Hepatitis B Update 2009 Markus Peck-Radosavljevic Klinik Innere Medizin III Abteilung Gastroenterologie & Hepatologie AKH & MU Wien Chronische Hepatitis B in Europa HBs-Antigen Prävalenz 0.2%

Mehr

Moderne Hepatitis Diagnostik Neue Therapieoptionen neue Herausforderungen

Moderne Hepatitis Diagnostik Neue Therapieoptionen neue Herausforderungen Moderne Hepatitis Diagnostik Neue Therapieoptionen neue Herausforderungen ÖQUASTA Symposium: Innsbruck Igls 29.-30. 09. 2011 Heidemarie Holzmann Department für Virologie Hepatitis Viren (1) Hepatitis A

Mehr

Erfahrungen mit dem Anti-HBc-Stufenplan 2006

Erfahrungen mit dem Anti-HBc-Stufenplan 2006 Erfahrungen mit dem Anti-HBc-Stufenplan 2006 Notwendigkeit der Anti-HBc-Testung lt. Votum 31 des AK Blut Anti-HBc auch vorhanden, wenn HBsAg-Bildung gering oder/und Escape-Mutanten vorliegen USA: 0,24

Mehr

Neue Therapiekonzepte in der Hepatologie

Neue Therapiekonzepte in der Hepatologie Neue Therapiekonzepte in der Hepatologie Dr.med.Marco Bernardi Praxis für Magen-Darmkrankheiten, Seestrasse 90, 8002 Zürich Zentrum für Gastroenterologie und Hepatologie Klinik Im Park info@magen-darm-praxis.ch,

Mehr

Ein 50 jähriger gesunder Italiener geht zum Check-up

Ein 50 jähriger gesunder Italiener geht zum Check-up 10. Zürcher Oberländer Gastromeeting 26.8.2010 Ein 50 jähriger gesunder Italiener geht zum Check-up Dr. H.U. Ehrbar, Rüti DD Erhöhte Leberwerte Mischbilder Hepatitis Cholestase Transaminasen Bili Cholestasewerte

Mehr

Virale Hepatitis. Dienstag, Fortbildung Kinderärzte -Vereinigung Zentralschweiz Virale Hepatitis - Hepatitis A - B- C

Virale Hepatitis. Dienstag, Fortbildung Kinderärzte -Vereinigung Zentralschweiz Virale Hepatitis - Hepatitis A - B- C Fortbildung Kinderärzte -Vereinigung Zentralschweiz Fortbildung Kinderärzte Vereinigung Zentralschweiz Dienstag 26. Juni 2012 Beurteilung Leberfunktion Virale Hepatitis Virale Hepatitis Hepatitis A Hepatitis

Mehr

Institut für Nieren- und Hochdruckkrankheiten Rostock

Institut für Nieren- und Hochdruckkrankheiten Rostock HEPATITIS. Aspekte Ann Michelsen, R.E.Winkler, M.Tieß, W.Ramlow, Gabriele Weber, Doris Hofmann, Jana-Maria Schneidewind, H.Prophet Dialyse-Gemeinschaft Nord e.v.- Institut für Nieren- und Hochdruckkrankheiten

Mehr

Hepatitis B. Prof. Dr. med. Patrick Gerner Jahrestagung DGPI, Mannheim Folie 1

Hepatitis B. Prof. Dr. med. Patrick Gerner  Jahrestagung DGPI, Mannheim Folie 1 Hepatitis B Prof. Dr. med. Patrick Gerner www.kinder-gastroenterologie-essen.de Jahrestagung DGPI, Mannheim 2012 Folie 1 1 12.03.2012 Prof. Dr. med. Patrick Gerner Der Weg zur personalisierten Behandlung

Mehr

Interpretation von serologischen Befunden

Interpretation von serologischen Befunden Interpretation von serologischen Befunden Cédric Hirzel Berner Infektiologie Symposium 2014 Hausärztliche serologische Fragen Borreliose EBV HBV Interpretation von serologischen Befunden Epstein Barr Virus

Mehr

Update Hepatitis C-Diagnostik

Update Hepatitis C-Diagnostik Update Hepatitis C-Diagnostik Christian Noah Hamburg Therapieindikation Frühzeitiger Behandlungsbeginn erhöht Chancen auf einen Therapieerfolg Therapieindikation ist unabhängig von erhöhten Transaminasen

Mehr

Immunprophylaxe,Diagnostik und Therapie bei Hepatitis B und C

Immunprophylaxe,Diagnostik und Therapie bei Hepatitis B und C Immunprophylaxe,Diagnostik und Therapie bei Hepatitis B und C Serologische Verläufe der Hepatitis-B Infektion Definitionen der B-Hepatitiden Akute Hepatitis B: Erstmals aufgetretene Leberentzündung durch

Mehr

Hepatitis B. Dr. med. Carl M. Oneta Schaffhauserstrasse Winterthur. Aerztefortbildung im April 2006 in Horgen

Hepatitis B. Dr. med. Carl M. Oneta Schaffhauserstrasse Winterthur. Aerztefortbildung im April 2006 in Horgen Dr. med. Carl M. Oneta Schaffhauserstrasse 7 8400 Winterthur Aerztefortbildung im April 2006 in Horgen Interpretation serologischer Befunde Marker Anti-HBc+ HBsAg+ HBeAg+ HBV-DNA Anti-HBs+ Interpretation

Mehr

Hepatitis B Diagnostik und klinische Verläufe

Hepatitis B Diagnostik und klinische Verläufe 74 4 Hepatitis B Diagnostik und klinische Verläufe Andreas Erhardt 4.1 Diagnostik Die spezifische Diagnostik der Hepatitis-B-Infektion umfasst neben laborchemischen Untersuchungen die Hepatitis-Serologie

Mehr

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr

Dr. Mathilde Kutilek Österreichisch-Iranische Ärztegesellschaft 13.11.2010

Dr. Mathilde Kutilek Österreichisch-Iranische Ärztegesellschaft 13.11.2010 Dr. Mathilde Kutilek Österreichisch-Iranische Ärztegesellschaft 13.11.2010 Hepatitis Labor: GOT = Glutamat-Oxalacetat-Transaminase = AST = Aspertat-Aminotransferase GPT = Glutamat-Pyrovat-Transaminase

Mehr

Hepatitis bei Dialysepatienten. Prof. Dr. Matthias Girndt Klinik für Innere Medizin II Martin-Luther-Universität Halle-Wittenberg

Hepatitis bei Dialysepatienten. Prof. Dr. Matthias Girndt Klinik für Innere Medizin II Martin-Luther-Universität Halle-Wittenberg Hepatitis bei Dialysepatienten Prof. Dr. Matthias Girndt Klinik für Innere Medizin II Martin-Luther-Universität Halle-Wittenberg Prävalenz der Hepatitis B Land Prävalenz Jahr USA 0.9% 2000 Deutschland

Mehr

Infektionsserologie/PCR

Infektionsserologie/PCR CMV-IgG oder IgM-Antikörper (Anti-CMV-IgG / -IgM) Screening von Blutspender- und Patientenproben mit unbekanntem Antikörperstatus Hepatitis-A-Virus-IgM-Antikörper (Anti-HAV-IgM) Nachweis einer akuten HAV-Infektion

Mehr

Hepatologie-Update 2007

Hepatologie-Update 2007 Hepatologie-Update 2007 Moderne Therapiemöglichkeiten der chronischen Hepatitis Hepatitis C Hepatitis B Hepatitis D Hans L. Tillmann Leipzig Hepatologie-Update 2007 Moderne Therapiemöglichkeiten der chronischen

Mehr

Chronische Hepatitis B

Chronische Hepatitis B Chronische Hepatitis B - einmal Nukleos(t)id immer Nukleos(t)id? - Prof. Dr. G. Gerken Universitätsklinikum Essen Zentrum für Innere Medizin Klinik für Gastroenterologie u. Hepatologie Essen, Kulturhauptstadt

Mehr

Hepatitis B und C. Hartwig Klinker. Schwerpunkt Infektiologie Medizinische Klinik und Poliklinik II der Universität Würzburg

Hepatitis B und C. Hartwig Klinker. Schwerpunkt Infektiologie Medizinische Klinik und Poliklinik II der Universität Würzburg Hepatitis B und C Hartwig Klinker Schwerpunkt Infektiologie Medizinische Klinik und Poliklinik II der Universität Würzburg 1. Münchener Infektiologie Workshop 11.6.2010 STD für Fortgeschrittene Importierte

Mehr

Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus

Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus Seminar Molekulare Diagnostik 2011 30. November 2011, Wien AnDiaTec Kernkompetenz Entwicklung und Produktion

Mehr

Screening zur Prävention von transfusionsübertragenen viralen Infektionen

Screening zur Prävention von transfusionsübertragenen viralen Infektionen Screening zur Prävention von transfusionsübertragenen viralen Infektionen Christoph Niederhauser CNI/2010 Hämovigilanztagung Bern 2010 1 Topics Sicherheit von Blutprodukten bezüglich Infektionserregern

Mehr

HBV HCV HIV Erregerscreening. Wozu? Wie? Wann?

HBV HCV HIV Erregerscreening. Wozu? Wie? Wann? HBV HCV HIV Erregerscreening Wozu? Wie? Wann? Wozu? Welches sind die Konsequenzen für Mutter Kind! falls nicht getestet wird??! eines negativen Resultates??! eines positiven Resultates?? Antikörpertests:

Mehr

Diagnostik der akuten und chronischen Virushepatitis

Diagnostik der akuten und chronischen Virushepatitis Diagnostik der akuten und chronischen Virushepatitis Dr. med. Daniela Huzly Abt. Virologie Uniklinik Freiburg daniela.huzly@uniklinik-freiburg.de Regionales Qualitätsforum DVTA Offenburg 16.10.2012 Patient

Mehr

Prophylaxe nach Stich- und Schnittverletzungen mit potentieller Infektionsgefahr (HBV, HCV, HIV) Was bezahlt die Unfallkasse Berlin?

Prophylaxe nach Stich- und Schnittverletzungen mit potentieller Infektionsgefahr (HBV, HCV, HIV) Was bezahlt die Unfallkasse Berlin? Die nachfolgenden Ausführungen beinhalten orientierende Vorgaben für die Auswahl der Maßnahmen nach Stich- und Schnittverletzungen mit potentieller Infektionsgefahr (HBV, HCV, HIV) 1. Die Entscheidung

Mehr

Hepatitis Hepatitis Hepatitis-Viren

Hepatitis Hepatitis Hepatitis-Viren Hepatitis 1. Allgemeines Unter Hepatitis versteht man eine Infektion der Leber durch Hepatitis-Viren. Es gibt verschiedene Typen: A, B, C, D, E und G, welche unterschiedliche Formen von Hepatitis hervorrufen

Mehr

Die antivirale Therapie der chronischen Hepatitis B: Identifikation neuer Resistenzmutationen und Optimierung der Verlaufskontrolle

Die antivirale Therapie der chronischen Hepatitis B: Identifikation neuer Resistenzmutationen und Optimierung der Verlaufskontrolle Angefertigt am Fachbereich 08 - Biologie und Chemie in Zusammenarbeit mit dem Institut für Medizinische Virologie am Fachbereich 11- Medizin der Justus-Liebig-Universität Gießen Die antivirale Therapie

Mehr

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus Aus dem Institut für Virologie der Tierärztlichen Hochschule Hannover und dem Institut für Virusdiagnostik des Friedrich-Loeffler-Instituts, Insel Riems Etablierung, Validierung und praktische Anwendung

Mehr

Hepatitis B. Markus Cornberg Medizinische Hochschule Hannover

Hepatitis B. Markus Cornberg Medizinische Hochschule Hannover 9.10.2010 Hepatitis B Markus Cornberg Medizinische Hochschule Hannover 03.11.2010 0 Hepatitis B Nur ein geringer Anteil der Patienten mit chronischer Hepatitis B in Europa wird diagnostiziert Prävalenz

Mehr

Anlage zur Akkreditierungsurkunde D-ML nach DIN EN ISO 15189:2014

Anlage zur Akkreditierungsurkunde D-ML nach DIN EN ISO 15189:2014 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-ML-13297-04-00 nach DIN EN ISO 15189:2014 Gültigkeitsdauer: 11.06.2015 bis 24.07.2017 Ausstellungsdatum: 11.06.2015 Urkundeninhaber:

Mehr

Virus-Hepatitis kompakt: Welche Änderungen bescheren uns die neuen Leitlinien? Hepatitis B

Virus-Hepatitis kompakt: Welche Änderungen bescheren uns die neuen Leitlinien? Hepatitis B Virus-Hepatitis kompakt: Welche Änderungen bescheren uns die neuen Leitlinien? Hepatitis B HAG, 24.02.2010 Prof. Dr. JörgJ Petersen Leberzentrum Hamburg im IFI Institut für f r Interdisziplinäre re Medizin

Mehr

Hepatitis A. Morphologie Picornavirus ss RNA genom. icosahedral Kapsid 27 nm. Elektronenmikroskopische Ansicht der Hepatitis-A- Virus

Hepatitis A. Morphologie Picornavirus ss RNA genom. icosahedral Kapsid 27 nm. Elektronenmikroskopische Ansicht der Hepatitis-A- Virus Hepatitis Viren Hepatitis A Morphologie Picornavirus ss RNA genom icosahedral Kapsid 27 nm Elektronenmikroskopische Ansicht der Hepatitis-A- Virus Hepatitis A Kultivierung Affenzelllinie (im Labor) Affinität

Mehr

Molekulare Diagnostik Hans Nitschko

Molekulare Diagnostik Hans Nitschko Molekulare Diagnostik Hans Nitschko Nachweis viraler Erreger durch molekularbiologische Methoden Antikörpernachweise Nachweis antigenspezifischer T-Zellen Neutralisationsteste Nachweis Therapie-resistenter

Mehr

Diagnostik der akuten HIV Infektion: Reicht der HIV Screening Test oder braucht es eine PCR?

Diagnostik der akuten HIV Infektion: Reicht der HIV Screening Test oder braucht es eine PCR? Diagnostik der akuten HIV Infektion: Reicht der HIV Screening Test oder braucht es eine PCR? PD Dr. Jürg Böni Institut für Medizinische Virologie Nationales Zentrum für Retroviren Universität Zürich Die

Mehr

Ergänzende Empfehlungen zur Testung von Blut- und Plasmaspenden und zum Rückverfolgungsverfahren

Ergänzende Empfehlungen zur Testung von Blut- und Plasmaspenden und zum Rückverfolgungsverfahren Bundesgesundheitsbl - Gesundheitsforsch - Gesundheitsschutz 1999 42: 888 892 Springer-Verlag 1999 Bekanntmachung des Arbeitskreises Blut des Bundesministeriums für Gesundheit Bei der 34. Sitzung des Arbeitskreis

Mehr

Hepatitis C: Was gibt es Neues?

Hepatitis C: Was gibt es Neues? Hepatitis C: Was gibt es Neues? Heiner Wedemeyer Medizinische Hochschule Hannover 1 37 Jähriger Patient, Fibrose HCV-Genotyp 3a, HCV-RNA >800.000 IU/ml Z.n. PEG-IFN/RBV, Abbruch bei starken Nebenwirkungen

Mehr

Antivirale Therapie der Hepatitis B

Antivirale Therapie der Hepatitis B Antivirale Therapie der Hepatitis B Hartwig Klinker Schwerpunkt Infektiologie Medizinische Klinik und Poliklinik II der Universität Würzburg Hepatitis B- und HIV-Prävalenz 2006 350.000.000 300.000 500.000

Mehr

Update Hepatitis B und C

Update Hepatitis B und C Update Hepatitis und C Dr. med. eat Helbling und Prof. Dr. med. Stephan Vavricka beat.helbling@hin.ch stephan.vavricka@usz.ch VZI www.gastrobethanien.ch Symposium, 28.1.2016 s HV und HCV 2016 Screening

Mehr

Virushepatitis und Nierentransplantation. Prof. Dr. Matthias Girndt Department of Internal Medicine II Martin-Luther-University Halle-Wittenberg

Virushepatitis und Nierentransplantation. Prof. Dr. Matthias Girndt Department of Internal Medicine II Martin-Luther-University Halle-Wittenberg Virushepatitis und Nierentransplantation Prof. Dr. Matthias Girndt Department of Internal Medicine II Martin-Luther-University Halle-Wittenberg Fallbericht Patient 36 Jahre aus Vietnam Dialysepflichtig

Mehr

58. Jahrestagung der deutschen STD-Gesellschaft

58. Jahrestagung der deutschen STD-Gesellschaft 58. Jahrestagung der deutschen STD-Gesellschaft 17.-19. September 2009 Bochum Neues zur Chlamydien Diagnostik T. Meyer Institut für Medizinische Mikrobiologie, Virologie und Hygiene Universitätsklinikum

Mehr

Humanes Immundefizienz Virus (HIV) Schema zum Rückverfolgungsverfahren. Erste Blutprobe 1 x Anti-HIV 1/2-EIA. Negativ. Konserve endgültig sperren

Humanes Immundefizienz Virus (HIV) Schema zum Rückverfolgungsverfahren. Erste Blutprobe 1 x Anti-HIV 1/2-EIA. Negativ. Konserve endgültig sperren Humanes Immundefizienz Virus (HIV) Schema zum Rückverfolgungsverfahren Anhang A1 Erste Blutprobe 1 x Anti-HIV 1/2-EIA Nicht und Spende Konserve endgültig sperren Einer der Tests reaktiv HIV-Labordiagnostik

Mehr

Virusinfektionen bei Immunsupprimierten - Hepatitis B und C

Virusinfektionen bei Immunsupprimierten - Hepatitis B und C Innere Medizin 1 Gastroenterologie, Hepatologie, Infektiologie Virusinfektionen bei Immunsupprimierten - Hepatitis B und C Christoph Werner 01.03.2013: 11. Symposium Infektionsmedizin in Tübingen Hepatitis

Mehr

Titer. französisch titre: Feingehalt

Titer. französisch titre: Feingehalt Serologie Testverfahren (in der Mikrobiologie und Virologie) zur Bestimmung spezifischer Antikörper im Serum oder in anderen Körperflüssigkeiten gegen infektiöse Erreger Titer französisch titre: Feingehalt

Mehr

Hepatitis. Markus Heim Gastroenterologie USB

Hepatitis. Markus Heim Gastroenterologie USB Hepatitis Markus Heim Gastroenterologie USB Frau G.A., 27j Prolongierte Vigilanzminderung (GCS 5) nach Septumplastik-Operation Status, Routinelabor und CT Schädel unauffällig Hospitalisation 3 Monate später:

Mehr

Hepatitis B - eine unterschätzte Infektion? C. Berg

Hepatitis B - eine unterschätzte Infektion? C. Berg Hepatitis B - eine unterschätzte Infektion? C. Berg Med. Univ.-Klinik Tübingen T Abt. I Z. Gastroenterol. 2007 J. Hepatol. 2009 Hepatology 2009 Aktualisierung für Frühjahr 2011 erwartet Aktualisierung

Mehr

5.1 Grundlegende Informationen zu Hepatitis-B-Virus 22. 5.2 Allgemeine Daten zur Labordiagnostik der Hepatitis-B- Virusinfektion 23

5.1 Grundlegende Informationen zu Hepatitis-B-Virus 22. 5.2 Allgemeine Daten zur Labordiagnostik der Hepatitis-B- Virusinfektion 23 21 Hepatitis B Klaus Korn.1 Grundlegende Informationen zu Hepatitis-B-Virus 22.2 Allgemeine Daten zur Labordiagnostik der Hepatitis-B- Virusinfektion 23.2.1 Diagnostische Methoden (Stand der Technik) und

Mehr

Klinische Chemie und Laboratoriumsdiagnostik Vorlesung: Virale Hepatitis

Klinische Chemie und Laboratoriumsdiagnostik Vorlesung: Virale Hepatitis Klinische Chemie und Laboratoriumsdiagnostik Vorlesung: Virale Hepatitis Dr. med. Michael Erren Centrum für Laboratoriumsmedizin Zentrallaboratorium Universitätsklinikum Münster Albert-Schweitzer-Campus

Mehr

Produktkatalog 2010. Molekularbiologische Reagenzien

Produktkatalog 2010. Molekularbiologische Reagenzien Produktion, Vertrieb und Serviceleistung im Bereich der Molekularbiologie und Medizin Produktkatalog 2010 Molekularbiologische Reagenzien Molegene GmbH Bienenweg 28 35764 Sinn Tel. 02772-570952 Fax 02772-570945

Mehr

Virale Hepatitidenmodernes

Virale Hepatitidenmodernes Virale Hepatitidenmodernes Managment Hauptvorlesung Innere Medizin WS 2008_09 04.12.2008 Dr. Marion Ganslmayer, Dr. Steffen Zopf Hepatologie Med. Klinik 1 (Dir. Prof. Dr. med. E. G. Hahn) Spätfolgen chr.

Mehr

Hepatitis B. Doppelsträngige DNA kleinste bekannte Virus horizontale und perinatale Übertragung

Hepatitis B. Doppelsträngige DNA kleinste bekannte Virus horizontale und perinatale Übertragung Hepatitis B Doppelsträngige DNA kleinste bekannte Virus horizontale und perinatale Übertragung 65-90% der Neugeborenen von HBs-Ag positiven Mütter werden chronische HBs-Ag Carrier perinatale Übertragung

Mehr

INSTAND e.v. in Zusammenarbeit mit:

INSTAND e.v. in Zusammenarbeit mit: Vorauswertung zu den virologischen en September 2015 INSTAND e.v. in Zusammenarbeit mit: Deutsche Vereinigung zur Bekämpfung der Viruskrankheiten (DVV) Gesellschaft für Virologie (GfV) Deutsche Gesellschaft

Mehr

Bewertung des kausalen Zusammenhangs eines Verdachts einer HIV-Übertragung beim Empfänger durch Blut und Blutkomponenten

Bewertung des kausalen Zusammenhangs eines Verdachts einer HIV-Übertragung beim Empfänger durch Blut und Blutkomponenten Votum 34 des Arbeitskreises Blut Anhang D 1: Bewertung des Verdachts einer HIV-, HBV- und/oder HCV- Übertragung durch Blut und Blutkomponenten gemäß 63b AMG* HIV Infektionsmerkmale beim Empfänger Serologisch

Mehr

Infektionsmonitorings

Infektionsmonitorings Dr. J. Mihm, Klinik für Innere Medizin IV Klinische Bedeutung des Infektionsmonitorings 23. JAHRESTAGUNG des Arbeitskreises Nierentransplantation der Deutschen Gesellschaft für Urologie e.v. Infektionsmonitoring

Mehr

Grundlagen Arbeits- und Sozialmedizin Sicherheit und Gesundheitsschutz (Arbeitsschutz) im Krankenhaus

Grundlagen Arbeits- und Sozialmedizin Sicherheit und Gesundheitsschutz (Arbeitsschutz) im Krankenhaus Betriebsärztlicher Dienst Grundlagen Arbeits- und Sozialmedizin Sicherheit und Gesundheitsschutz (Arbeitsschutz) im Krankenhaus Prof. Dr. Joachim Rösler 04.05.2006 Das duale Arbeitsschutzsystem Grundgesetz

Mehr

Formular Untersuchungsverzeichnis Zentrallabor (Beispiel)

Formular Untersuchungsverzeichnis Zentrallabor (Beispiel) Formular Untersuchungsverzeichnis Zentrallabor (Beispiel) AFP Methode Alpha-Fetoprotein Serum /1ml MEIA-Test Tumormarker für Leber- und Keimzelltumor Männer:

Mehr

ANGABEN ZUM PATIENTEN

ANGABEN ZUM PATIENTEN Bitte zurücksenden an: Robert Koch-Institut HIV-Studienlabor FG 18 - HIV und andere Retroviren Nordufer 20 13353 Berlin HIV-Serokonverterstudie FOLLOW-UP Stempel des Berichtenden (Zentrum) Blutprobe an

Mehr

Hepatitis B Virusinfektion (HBV)

Hepatitis B Virusinfektion (HBV) Hepatitis B Virusinfektion (HBV) Therapie Vakzine Screening-RIA Dane Partikel 1981 2012 Au-Ag 1972 1970 1963 Globale Epidemiologie ~ 2 Milliarden Menschen mit HBV-Infektion ~ 350 Millionen mit chronischer

Mehr

Molekulargenetischer Nachweis und Genotypisierung von HPV

Molekulargenetischer Nachweis und Genotypisierung von HPV Molekulargenetischer Nachweis und Genotypisierung von HPV Dr. Sabine Sussitz-Rack Institut für Labordiagnostik und Mikrobiologie Vorstand: Prim. Prof. DDr. Pranav Sinha Humanes Papillomavirus HPV HPV ist

Mehr

Hepatitis B HBV-DNA. DNA-Polymerase. Äussere Lipidhülle (mit HBs-Ag) Innere Protein-Hülle (HBc-Ag) Sezerniertes HBe-Ag. Sezerniertes HBs-Ag

Hepatitis B HBV-DNA. DNA-Polymerase. Äussere Lipidhülle (mit HBs-Ag) Innere Protein-Hülle (HBc-Ag) Sezerniertes HBe-Ag. Sezerniertes HBs-Ag Hepatitis B DNA-Polymerase HBV-DNA Äussere Lipidhülle (mit HBs-Ag) Innere Protein-Hülle (HBc-Ag) Sezerniertes HBe-Ag Sezerniertes HBs-Ag Hepatitis B Infektion Replikation HBs-Ag, Anti-HBc, Anti-HBe HBe-Ag,

Mehr

Urogenitale Infektionserreger mittels PCR

Urogenitale Infektionserreger mittels PCR Urogenitale Infektionserreger mittels PCR Dr. Monika Börner Planegg 09. September 2009 Urogenitale Infektionserreger mittels PCR Grundlagen / Allgemeines Chlamydia trachomatis Neisseria gonorrhoeae Mykoplasmen

Mehr

Epstein-Barr-Virus-Infektion: Möglichkeiten und Grenzen der serologischen Diagnostik von Reaktivierungen und chronischen Verläufen

Epstein-Barr-Virus-Infektion: Möglichkeiten und Grenzen der serologischen Diagnostik von Reaktivierungen und chronischen Verläufen Epstein-Barr-Virus-Infektion: Möglichkeiten und Grenzen der serologischen Diagnostik von Reaktivierungen und chronischen Verläufen Dr. Claudia Wolff Viramed Biotech AG 1 Akute EBV-Primärinfektion Erster

Mehr

Infektionsgefährdung und Akzeptanz von Arbeitsschutzmaßnahmen bei Beschäftigten im Gesundheitswesen. Sabine Wicker 23. April 2013

Infektionsgefährdung und Akzeptanz von Arbeitsschutzmaßnahmen bei Beschäftigten im Gesundheitswesen. Sabine Wicker 23. April 2013 Infektionsgefährdung und Akzeptanz von Arbeitsschutzmaßnahmen bei Beschäftigten im Gesundheitswesen Sabine Wicker 23. April 2013 Was kommt jetzt? Zahlen zum Berufskrankheitengeschehen Daten zur Epidemiologie

Mehr

Hepatitis. Hartwig Klinker. Medizinische Klinik und Poliklinik II der Universität Würzburg Schwerpunkt Infektiologie

Hepatitis. Hartwig Klinker. Medizinische Klinik und Poliklinik II der Universität Würzburg Schwerpunkt Infektiologie Hepatitis Hartwig Klinker Medizinische Klinik und Poliklinik II der Universität Würzburg Schwerpunkt Infektiologie Chronische Hepatitis Klinische Symptomatik Uncharakteristisch!: Abgeschlagenheit, Müdigkeit,

Mehr

Hepatitis C. Landkreis Harburg Der Landrat

Hepatitis C. Landkreis Harburg Der Landrat Erkennung, Behandlung und Verhütung Stand: Februar 2007 Herausgegeben vom Robert Koch-Institut Einführung Der Begriff der Hepatitis (Hepar = Leber) bezeichnet eine Entzündung der Leber, deren Ursache vielgestaltig

Mehr

Hepatitis ( Gelbsucht )

Hepatitis ( Gelbsucht ) Hepatitisviren Hepatitisviren Hepatitis ( Gelbsucht ) Die akute Hepatitis ist eine systemische Infektion, die überwiegend die Leber betrifft! 3 wesentliche Kriterien: Ikterus (Gelbsucht) deutlich erhöhte

Mehr

Dr. med. Dario Fontanel. Das C E der Hepatitis A, B, D,

Dr. med. Dario Fontanel. Das C E der Hepatitis A, B, D, Dr. med. Dario Fontanel Das C E der Hepatitis A, B, D, hot topics Hepatitis C - Epidemiologie (CH) - Krankheitsbild und Übertragung - Diagnostik - Therapie!!! - Screening/Nachkontrollen Hepatitis E - Epidemiologie

Mehr

Hepatitis. Akute Virushepatitis: Klinik. Virusinfektion: Zell-, Gewebe- und Organotropismus. Seminar für Zahnmediziner: Infektionsdiagnostik

Hepatitis. Akute Virushepatitis: Klinik. Virusinfektion: Zell-, Gewebe- und Organotropismus. Seminar für Zahnmediziner: Infektionsdiagnostik Klinische Chemie & Laboratoriumsdiagnostik Seminar für Zahnmediziner: Infektionsdiagnostik Wintersemester 2011/12 Dr. med. Michael Erren Centrum für Laboratoriumsmedizin Zentrallaboratorium Universitätsklinikum

Mehr

Sex und die Leber. sexuell übertragbare Hepatitiden. Patrick Schmid Infektiologie KSSG

Sex und die Leber. sexuell übertragbare Hepatitiden. Patrick Schmid Infektiologie KSSG Sex und die Leber sexuell übertragbare Hepatitiden Patrick Schmid Infektiologie KSSG Gliederung Vortrag Sex und Leber einige Erreger Hepatitis B Krankheitsverlauf Diagnostik Therapie Hepatitis + Sex Virushepatitis

Mehr

Versorgungssituation von Patienten mit chronischer Hepatitis B an der Universitätsklinik Ulm von 2000-2008

Versorgungssituation von Patienten mit chronischer Hepatitis B an der Universitätsklinik Ulm von 2000-2008 Universitätsklinikum Ulm - Zentrum für Innere Medizin Klinik für Innere Medizin I Gastroenterologie, Endokrinologie, Stoffwechsel, Ernährungswissenschaften und Nephrologie Ärztlicher Direktor: Prof. Dr.

Mehr

Rekombinante Wirkstoffe! 9. Vorlesung!

Rekombinante Wirkstoffe! 9. Vorlesung! Rekombinante Wirkstoffe! 9. Vorlesung! Prof. Dr. Theo Dingermann Ins2tut für Pharmazeu2sche Biologie Goethe- Universität Frankfurt Dingermann@em.uni- frankfurt.de Hepatitiden als Hauptindikation für rekombinante

Mehr

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein DNA-Extraktion Photometrie Polymerase-Kettenreaktion (PCR) Restriktionsanalyse Agarose-Gelelektrophorese Polyacrylamid-Gelelektrophorese

Mehr

Hepatitis C. Dr. med. Carl M. Oneta Schaffhauserstrasse 7 8400 Winterthur. Aerztefortbildung im April 2006 in Horgen

Hepatitis C. Dr. med. Carl M. Oneta Schaffhauserstrasse 7 8400 Winterthur. Aerztefortbildung im April 2006 in Horgen Dr. med. Carl M. Oneta Schaffhauserstrasse 7 8400 Winterthur Aerztefortbildung im April 2006 in Horgen Risikofaktoren Transfusion oder Organtransplantation Transfusion von Spendern, die später als HCV-infiziert

Mehr

HIV-Test Wann ist eine HIV-Infektion ausgeschlossen?

HIV-Test Wann ist eine HIV-Infektion ausgeschlossen? HIV-Test Wann ist eine HIV-Infektion ausgeschlossen? Christian Noah, Hamburg Antiretrovirale Therapie: das aktuelle Arsenal Videx Viramune Epivir Trizivir Zerit Agenerase Sustiva Fuzeon Emtriva Isentress

Mehr

Anlage zur Akkreditierungsurkunde D-ML nach DIN EN ISO 15189:2013

Anlage zur Akkreditierungsurkunde D-ML nach DIN EN ISO 15189:2013 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-ML-13130-03-00 nach DIN EN ISO 15189:2013 Gültigkeitsdauer: 13.10.2014 bis 15.04.2017 Ausstellungsdatum: 13.10.2014 Urkundeninhaber:

Mehr

Multizentrische interdisziplinäre Studie für den Kanton Aargau

Multizentrische interdisziplinäre Studie für den Kanton Aargau Management von Hepatitis C in Drogensubstitutionsprogrammen Fragebogen 1 - Standortbestimmung Multizentrische interdisziplinäre Studie für den Kanton Aargau A. Bregenzer 1, J. Knuchel 2, A. Friedl 3, F.

Mehr

Kompetenzfeld Virushepatitis Klinik. T. Goeser Gastroenterologie und Hepatologie

Kompetenzfeld Virushepatitis Klinik. T. Goeser Gastroenterologie und Hepatologie Kompetenzfeld Virushepatitis Klinik T. Goeser Gastroenterologie und Hepatologie Leber GB Magen Dünndarm Dickdarm Fallvorstellung 1 Rentnerin, 63 Jahre Vor 2 Wochen Beginn Abgeschlagenheit, Müdigkeit Fieber

Mehr

Anlage zur Akkreditierungsurkunde D ML 19288 01 00

Anlage zur Akkreditierungsurkunde D ML 19288 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D ML 19288 01 00 nach DIN EN ISO 15189:2014 Gültigkeitsdauer: 11.12.2014 bis 10.12.2019 Ausstellungsdatum: 11.12.2014 Urkundeninhaber:

Mehr

Erhöhte Leberwerte: sinnvolle Abklärung. Klaus H.W.Böker Hannover. Deutscher Lebertag 2011 Hannover 1.12.

Erhöhte Leberwerte: sinnvolle Abklärung. Klaus H.W.Böker Hannover.  Deutscher Lebertag 2011 Hannover 1.12. Erhöhte Leberwerte: sinnvolle Abklärung Klaus H.W.Böker Hannover www.leberpraxis-hannover.de Wer ist überhaupt leberkrank; wie Leberkrankheiten erkennen? Symptome Ikterus, Inappetenz, Erschöpfung Schmerzen,

Mehr

Ringversuche geschlossen. Information zu Probeneigenschaften. INSTAND e.v. in Zusammenarbeit mit:

Ringversuche geschlossen. Information zu Probeneigenschaften. INSTAND e.v. in Zusammenarbeit mit: Virologische e September 2015 e geschlossen Information zu INSTAND e.v. in Zusammenarbeit mit: Deutsche Vereinigung zur Bekämpfung der krankheiten (DVV) Gesellschaft für Virologie (GfV) Deutsche Gesellschaft

Mehr

Serologische Infektionsdiagnostik hellseherische Fähigkeiten gefragt! Dr. med. Daniela Huzly Abt. Virologie, Uniklinik Freiburg

Serologische Infektionsdiagnostik hellseherische Fähigkeiten gefragt! Dr. med. Daniela Huzly Abt. Virologie, Uniklinik Freiburg Serologische Infektionsdiagnostik hellseherische Fähigkeiten gefragt! Dr. med. Daniela Huzly Abt. Virologie, Uniklinik Freiburg Wofür werden serologische Teste verwendet? Zur schnellen Diagnostik bei Infektionen

Mehr

Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres (Marmota monax)

Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres (Marmota monax) Aus der Abteilung Innere Medizin II der Medizinischen Universitätsklinik der Albert-Ludwigs-Universität Freiburg im Breisgau Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres

Mehr

Das Spektrum der chronischen Hepatitis

Das Spektrum der chronischen Hepatitis Das Spektrum der chronischen Hepatitis AUTO IMMUN Typ 1 Typ 2 Typ 3 PBC METABOLISCH Wilson, CESD metabolisches Syndrom CHRONISCHE HEPATITIS TOXISCH Medikamente ETOH VIRAL HBV HCV HDV HEV Die HCV Revolution

Mehr

Virologie 2.0 von Roche Diagnostics. Die neue Dimension an Sicherheit und Zuverlässigkeit

Virologie 2.0 von Roche Diagnostics. Die neue Dimension an Sicherheit und Zuverlässigkeit Virologie 2.0 von Roche Diagnostics Die neue Dimension an Sicherheit und Zuverlässigkeit Das ist Virologie 2.0 von Roche Diagnostics Sicherheit Die neuen Technologie-Designs (Dual-Probe und Dual-Target)

Mehr

Fallstricke in der HIV-Diagnostik. Elisabeth Puchhammer-Stöckl Department für Virologie Medizinische Universität Wien

Fallstricke in der HIV-Diagnostik. Elisabeth Puchhammer-Stöckl Department für Virologie Medizinische Universität Wien Fallstricke in der HIV-Diagnostik Elisabeth Puchhammer-Stöckl Department für Virologie Medizinische Universität Wien HIV-Infektion: Diagnostik- Zeitverlauf Nach Pilcher et al, 2004 HIV-Infektion: Diagnostik-

Mehr

Virusinfektionen bei Urlaubsrückkehrern

Virusinfektionen bei Urlaubsrückkehrern Virusinfektionen bei Urlaubsrückkehrern Virusinfektionen bei Urlaubsrückkehrern Stephan Aberle Klinisches Institut für Virologie Medizinische Universität Wien ÖGTP-Fortbildung 30.1.2007 Hanta Pulmonary

Mehr

Hepatitis B und C in Deutschland

Hepatitis B und C in Deutschland Hepatitis B und C in Deutschland Ruth Zimmermann Abt. für Infektionsepidemiologie Robert Koch-Institut 17. NRW-Dialog Infektionsschutz 28.09.2016, Dortmund Action plan for the health sector response to

Mehr

HIV/Hepatitis B Koinfektion: watch and wait or going straight?

HIV/Hepatitis B Koinfektion: watch and wait or going straight? HIV/Hepatitis B Koinfektion: watch and wait or going straight? 2 Fallvorstellungen Bettina Khanlari Klinik für Infektiologie und Spitalhygiene 1 Fall Nr 1: Herr Z.Y. 46jährig - Vorstellung bei der Hausärztin

Mehr

Hepatitis-Diagnostik Das sichere Fundament für die Therapieentscheidung

Hepatitis-Diagnostik Das sichere Fundament für die Therapieentscheidung Hepatitis-Diagnostik Das sichere Fundament für die Therapieentscheidung cobas T modular platform Flexible Konfigurationen für maßgeschneiderte Lösungen Mit der cobas T modular platform (cobas T 4000 und

Mehr

Neues zur HCV Therapie

Neues zur HCV Therapie Neues zur HCV Therapie 58. Jahrestagung der Deutschen STD-Gesellschaft Bochum, 18. September 2009 Christoph Sarrazin Klinikum der J. W. Goethe-Universität Medizinische Klinik 1 Frankfurt am Main Diagnostik

Mehr

Zukunft der Hepatitis B Therapie. Oder Sind wir nicht schon am Ziel?

Zukunft der Hepatitis B Therapie. Oder Sind wir nicht schon am Ziel? Zukunft der Hepatitis B Therapie Oder Sind wir nicht schon am Ziel? HBV Viruslast wichtig für Prognose Reduktion der HBV DNA reduziert Fortschreiten Disease Progression (% Patients) 20 15 10 5 0 Patients

Mehr

2. interdisziplinärer HCV Qualitätszirkel Hepatitis C und Drogengebrauch

2. interdisziplinärer HCV Qualitätszirkel Hepatitis C und Drogengebrauch 2. interdisziplinärer HCV Qualitätszirkel Hepatitis C und Drogengebrauch Protokoll vom 21.2.2007 Experte: Prim. Dr. Michael Gschwantler Moderation: Dr. Hans-Joachim Fuchs Leitung: Dr. Hans Haltmayer Ort:

Mehr

Hantavirus-Diagnostik

Hantavirus-Diagnostik Hantavirus-Diagnostik A. Lucht, D. Münstermann, R. Geisel --------------------------------------------- Labor Dr. Krone & Partner Medizinaluntersuchungsstelle Bad Salzuflen, Herford Hanta-Virusstruktur

Mehr

Paul-Ehrlich-Institut Bundesamt für Sera und Impfstoffe

Paul-Ehrlich-Institut Bundesamt für Sera und Impfstoffe Paul-Ehrlich-Institut Bundesamt für Sera und Impfstoffe An alle pharmazeutischen Einrichtungen, die Blut oder Blutkomponente gewinnen oder herstellen nachrichtlich Stufenplanbeteiligte Ihr Zeichen/Ihre

Mehr