Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Größe: px
Ab Seite anzeigen:

Download "Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)"

Transkript

1 PCR

2 Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am Nobelpreis für Chemie 1993

3 Kary B. Mullis Nobelpreis surfer and scientist...

4 Kleppe et al. (1971) J. Mol. Biol. 56:341

5 Prinzip der PCR Vervielfältigung der DNA-Abschnitte nach dem Prinzip der Replikation

6 Der PCR-Zyklus 1. Denaturierung (94-98 C, 1-60 sec) 2. Primerbindung (50-65 C, 1-60 sec), ca. 5 C unter Tm der Primer 3. DNA-Synthese (72 C, 1 sec bis 12 min u.mehr)

7 Minimale Sequenzinformation für die PCR: Beiderseits des zu amplifizierenden Abschnitts müssen kurze Sequenzabschnitte bereits bekannt sein, um dort die Bindung definierter Primer zu ermöglichen!

8 PCR Polymerase Kettenreaktion 3 -GGCCTTAAGCTAGTTTTAAACCGATCCGGTA-5 5 -CCGGAATTCGATCAAAATTTGGCTAGGCCAT-3 3 -GGCCTTAAGCTAGTTTTAAACCGATCCGGTA-5 TTCGA GATCG 5 -CCGGAATTCGATCAAAATTTGGCTAGGCCAT-3

9 PCR Polymerase Kettenreaktion 3 -GGCCTTAAGCTAGTTTTAAACCGATCCGGTA-5 TTCGATCAAAATTTGGCTAGGCCAT GGCCTTAAGCTAGTTTTAAACCGATCG 5 -CCGGAATTCGATCAAAATTTGGCTAGGCCAT-3

10

11 Exponentielle Vermehrung der Zielsequenz Zyklen sinnvoll

12

13 Praktische Hinweise zum Primerdesign 18-25mere, 40-60% GC, gut gemischte Sequenz keine Teile von Repeats: Spezifität über Datenbanksuchen überprüfen 3 Ende bevorzugt ein G od. C keine 3 End-Komplementarität der zwei Primer! (sonst u.u. Primer-Dimer-Bildung) keine internen Homopolymer-Runs (>4) oder simple sequences keine internen Inverted repeats (>3 Nt im Stamm)

14 Schmelztemperatur von Primer T m = 4 * ( Anzahl G+C) + 2 * ( Anzahl A+T)

15 Polymerase Zunächst: Klenow-Fragment der DNA- Polymerase aus E. coli thermolabil, d.h. Zugabe nach jedem Zyklus Reaktion sehr aufwendig und teuer Hybridisierung und Polymerisation bei 37 C Folge: durch Fehlhybridisierung der Primer viele Nebenprodukte Produktlänge auf 200 Bp beschränkt

16 Taq DNA Polymerase aus Thermus aquaticus T. aquaticus Stamm YT-1, gesammelt von T. Brock 1967 im Yellowstone Natl. Park 892 As, 94 kd ph opt. 8,3-8,8 prozessiv : 60 Nt/sec bei 72 C; 1,5Nt/sec bei 37 C > 1kb pro Minute synthetisiert keine proofreading Aktivität!

17 Eigenschaften thermostabiler Polymerasen

18 Mutationsraten verschiedener hitzestabiler DNA-Polymerasen Taq Vent Pfu 1, x 10-6 Ca. 1 Fehler pro 1 kb - Molekül nach 35 Zyklen

19 ...weitere experimentelle Bedingungen Primerkonzentration: ca. 0,5µM; d.h. bis Moleküle Matrize: 0,1-1 µg Genom-DNA; 10 ng Plasmid dntps: 200 µm Endkonz. (genug für 6 µg DNA) Denaturierung: C (abhängig von Matrize+Enzym) Annealing: 5 bis 10 C niedriger als Tm des Templates (meist: C) Extension: ca. 1 min pro kb

20 Spielarten der PCR XL-PCR Nested-PCR RT-PCR (Reverse Transkriptase + PCR) Quantitative PCR klassisch oder real-time RT-PCR Quantitative PCR RACE (rapid amplification of cdna ends) inverse PCR (PCR von flankierenden Regionen) In situ PCR Mutagenese und Nachweis von bekannter Punktmutationen Sondenherstellung

21 RT-PCR 1. Schritt: Reverse Transkription von mrna, es entsteht sogenannte cdna (complementary DNA) 2. Schritt: PCR Zielsetzung: welches Gen ist in einer bestimmten Zelle aktiv

22 Quantitative PCR eine Methode zur Quantifizierung der Ausgangsmenge an Template in einer Lösung Voraussetzung : während der exponentiellen Phase der Amplifikation verläuft die DNA- Vermehrung linear

23 Exponentielle Vermehrung der Zielsequenz Zyklen sinnvoll

24 Quantitative PCR Prinzip: Vergleich zu einem Standard-DNA- Molekül

25 Real-Time PCR

26 Quantitative PCR Hauptanwendung: Quantifizierung von mrna z.b. zum Vergleich von Genexpressionsraten in verschiedenen Geweben (z.b. zwischen gesunden und pathogenen Gewebeproben)

27 Race - rapid amplification of cdna ends Ziel: Vervollständigung der 5 bzw. 3 Ende von cdna-klonen

28 Inverse PCR

29 Long range / XL - PCR herkömmliche Taq Pol amplifiziert nur ineffizient Moleküle größer 5-6 kb Grund: sich akkumulierende Fehleinbauten am 3 OH- Ende können nicht entfernt werden und verhindern weitere Polymerisierung Lösung: Kombination einer prozessiven Taq Pol mit anderer thermostabiler Pol mit proof-reading-funktion > ermöglicht Amplifikation von bis zu > 20 kb

30 weitere PCR- basierende Methoden LM-PCR (Ligation-mediated PCR unter Verwendung anligierter Linker) multiplex PCR (mehrere Amplikons parallel) Nested PCR hotstart PCR (verbessert Spezifität)...und sehr viele mehr...

31 Anwendungen der PCR Medizinische und mikrobiol. Diagnostik Herstellung von Genbanken aus limitierendem Material Isolierung von Transkripten (RT-PCR) Bestimmung von Transkriptionsstart/endpunkten Isolierung von DNA-Abschnitten Quantifizierung von DNA und RNA ancient DNA Mutagenese von DNA-Molekülen Markierung von Sonden für die Hybridisierung Etc...

32 PCR in der Nahrungsmitteldiagnostik

33 Schwein-DNA Negativ-K. Rind-DNA Rind B4 Marker Lyoner 910 Bp 659 Bp 521 Bp 403 Bp 281 Bp 257 Bp 226 Bp

34

35 PCR-Ansatz auf Eis pipettieren!: 1 µl genomische DNA (ca ng) 5 µl 10x PCR-Puffer 1 µl 10 mm dntp-mix (datp, dctp, dttp, dgtp) 1 µl Primer 1 (10 pmol/µl) 1 µl Primer 2 (10 pmol/µl) 40 µl A. bidest 1 µl Taq-(DNA)-Polymerase (1-2,5 U) 50 µl Gesamtvolumen mischen, kurz anzentrifugieren, zurück auf Eis

36 PCR-Programm 1. Denaturierung 94 C 120 sec 1x 2. Denaturierung 94 C 30 sec 3. Annealing 55 C 30 sec 35x 4. Elongation 72 C 90 sec 5. finale Elongation72 C 6 min 1x 4 C

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in

Mehr

PCR. Inhalt. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR?

PCR. Inhalt. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Inhalt Was ist? Eine Definition Optimierung Anwendungsgebiete - in der Gentechnologie - in der Diagnostik Zusammenfassung von Christian Jogler (Abteilung für Mol. & Med. Virologie) Was ist? Eine Definition

Mehr

SCRIPTUM HIGH PRECISE

SCRIPTUM HIGH PRECISE Nur für Forschungszwecke Datenblatt Artikel BS.50.020 = 20 Reaktionen x 50 µl Artikel BS.50.100 = 100 Reaktionen x 50 µl Artikel BS.50. 500 = 500 Reaktionen x 50 µl Haltbarkeit: 12 Monate Lagerung bei

Mehr

Produktkatalog 2010. Molekularbiologische Reagenzien

Produktkatalog 2010. Molekularbiologische Reagenzien Produktion, Vertrieb und Serviceleistung im Bereich der Molekularbiologie und Medizin Produktkatalog 2010 Molekularbiologische Reagenzien Molegene GmbH Bienenweg 28 35764 Sinn Tel. 02772-570952 Fax 02772-570945

Mehr

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein DNA-Extraktion Photometrie Polymerase-Kettenreaktion (PCR) Restriktionsanalyse Agarose-Gelelektrophorese Polyacrylamid-Gelelektrophorese

Mehr

Polymerase-Kettenreaktion

Polymerase-Kettenreaktion Polymerase-Kettenreaktion Universität für Bodenkultur Wien Interuniversitäres Department für Agrarbiotechnologie Tulln Ein Einblick über eine der wohl bekanntesten Analysemethoden der Neuzeit Martin Kellner

Mehr

Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign

Mehr

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase)

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase) Methodensammlung des LAG PCR-Nachweis der 35S-nptII-Übergangssequenz, der pnapin-bayte- Übergangssequenz und des plsc-gens erstellt vom Unterausschuss Methodenentwicklung des LAG Status: verabschiedet

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers FIGURE 20.1 Biology 6/e Biotechnologie Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli

Mehr

Gentechnik in Lebens- und Futtermitteln

Gentechnik in Lebens- und Futtermitteln BfR - Jubiläum FEDERAL INSTITUTE FOR RISK ASSESSMENT Gentechnik in Lebens- und Futtermitteln Dr. Jutta Zagon Produktidentität, Rückverfolgbarkeit und Neuartige Lebensmittel Thielallee 88-92, 14195 Berlin

Mehr

5x QPCR Mix (ROX) Datenblatt. Artikel-Nr. BS µl Artikel-Nr. BS µl. (Nur für Forschung und in vitro-anwendungen)

5x QPCR Mix (ROX) Datenblatt. Artikel-Nr. BS µl Artikel-Nr. BS µl. (Nur für Forschung und in vitro-anwendungen) Datenblatt Artikel-Nr. BS76.520.0200 200 µl Artikel-Nr. BS76.520.1000 1.000 µl Artikel-Nr. BS76.520.5000 5.000 µl (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen:

Mehr

Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück

Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück Klinische Chemie und Laboratoriumsmedizin Institut für MTA-Ausbildung am Klinikum Osnabrück Polymerase-Kettenreaktion (PCR) Die Polymerase-Kettenreaktion (englisch Polymerase Chain Reaction, PCR) ist eine

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Dr. Peter Kainz Einführung in die Nucleinsäure-Biochemie Teil 2. III.Einführung in die Polymerase Chain Reaction (PCR)

Dr. Peter Kainz Einführung in die Nucleinsäure-Biochemie Teil 2. III.Einführung in die Polymerase Chain Reaction (PCR) Dr. Peter Kainz Einführung in die Nucleinsäure-Biochemie Teil 2 III.Einführung in die Polymerase Chain Reaction (PCR) DI Praktikumsergebnisse SS 2009 Restriktionsverdau MI V MI N DI Praktikumsergebnisse

Mehr

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Vorbereitung auf diesen Praktikumsteil: Organisation - Für den Bioinformatik-Teil benötigen Sie pro Gruppe einen Laptop -

Mehr

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Definition: Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

Charakterisierung von Transkripten mittels RT-PCR

Charakterisierung von Transkripten mittels RT-PCR Charakterisierung von Transkripten mittels RT-PCR Versuchsleiter: Ulrike Gerischer Protokollführung: Karl Varadi Gruppe: 11 Durchführung: 18.11 22.11.2002 Protokoll testiert: WS02 Universität Ulm Inhaltsverzeichnis

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

Platzhalter für Bild

Platzhalter für Bild Instrumentelle Bioanalytik in der Molekularbiologie Anke Neumann Platzhalter für Bild KIT die Kooperation von Forschungszentrum Karlsruhe GmbH und Universität Karlsruhe (TH) www.kit.edu Motivation und

Mehr

Life Science Konferenz 05. Mai 2010 in Jena. Chancen und Möglichkeiten - Real-time PCR

Life Science Konferenz 05. Mai 2010 in Jena. Chancen und Möglichkeiten - Real-time PCR Life Science Konferenz 05. Mai 2010 in Jena Chancen und Möglichkeiten - Real-time PCR Die 3 Phasen der PCR 1. Denaturierung DNA-Doppelstrang wird in Einzelstränge aufgeschmolzen Für 30 sec auf 95 C erhitzen

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet

Mehr

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP Informationsveranstaltung Heimtierfuttermittel PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln C. Haldemann, ALP Grundidee des Nachweises von GVOs mittels PCR Die Bestimmung genveränderter

Mehr

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion Einleitung Der Tierart-Kit SK1-12 enthält die notwendigen Materialien, um verarbeitete Tierarten in gängigen Fleisch- und Milchprodukten, z.b. Wurst oder Käse zu bestimmen. Ein Lehrerheft und fünf Schülerhefte,

Mehr

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Versuch 2: Polymerasekettenreaktion Betreuer: Knut Jahreis Versuchsinhalt Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Zwei verschiedene Plasmide werden als Matrizen für eine Polymerasekettenreaktion

Mehr

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C 3 Methoden 3.1 Extraktion der DNA aus den Paraffinschnitten 3.1.1 Extraktions-Kit Das QIAamp DNA Mini Kit- System beruht auf dem Prinzip der Auflösung der Eiweiße mit Proteinase K, DNA Bindung an eine

Mehr

Mikrobiologie 3, Teil 1

Mikrobiologie 3, Teil 1 Fachrichtung Biologie, Institut für Mikrobiologie, Lehrstuhl für Mikrobielle Diversität Mikrobiologie 3, Teil 1 Dresden, 21.-24. Jan 2013 Sandro Wolf, Marina Totrova Institut für Mikrobiologie Professur

Mehr

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Vorbereitung auf diesen Praktikumsteil: Organisation 2. Praktikumstag: - Für den Bioinformatik-Teil benötigen Sie am 2. Tag dieses

Mehr

Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR

Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR Nils Scharke, inano Abstract Die Verwendung neuartiger Seltenerd-Komplexe in Verbindung mit zeitaufgelöster Fluoreszenzmessung liefert

Mehr

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Einleitung: Drosophila melanogaster hat sich als Modellorganismus in der Entwicklungsbiologie und der Genetik bewährt, und findet

Mehr

1.Theoretischer Hintergrund

1.Theoretischer Hintergrund 1.Theoretischer Hintergrund Die Molekularbiologie oder Molekulargenetik befasst sich mit den zellulären Vorgängen bei der Vervielfältigung, Übertragung und Expression des genetischen Materials. Bei der

Mehr

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Bernd Hoffmann, Klaus R. Depner, Horst Schirrmeier & Martin Beer Friedrich-Loeffler-Institut Greifswald-Insel Riems

Mehr

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus Aus dem Institut für Virologie der Tierärztlichen Hochschule Hannover und dem Institut für Virusdiagnostik des Friedrich-Loeffler-Instituts, Insel Riems Etablierung, Validierung und praktische Anwendung

Mehr

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig BACTOTYPE PCR Amplification Kit Chlamydia sp. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen

Mehr

4 Die Polymerase-Kettenreaktion (PCR)

4 Die Polymerase-Kettenreaktion (PCR) 4 Die Polymerase-Kettenreaktion (PCR) Heil dem Wasser! Heil dem Feuer! Heil dem seltnen Abenteuer! Eigentlich gehört die Polymerase-Kettenreaktion (PCR) in das Kapitel Werkzeug, doch ist sie momentan sicherlich

Mehr

2. DNA-Fingerprinting

2. DNA-Fingerprinting Obwohl die Untersuchung von Mikrosatelliteninstabilität und LOH nicht Ziel der vorliegenden Arbeit war, kann es im Rahmen der Vaterschaftsbegutachtung dazu kommen, dass von einem verstorbenen Putativvater

Mehr

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans AVID X / 1998 Lawsonia intracellularis Seite -1- Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans 1. ALLGEMEINES

Mehr

Product Catalogue 2011-2012. PCR Related

Product Catalogue 2011-2012. PCR Related Product Catalogue 2011-2012 PCR Related geneon.net A good decision... GeneON GmbH Hubertusstraße 20 D-67065 Ludwigshafen Phone: +49-621-5720 864 Fax: +49-621-5724 462 E-Mail: info@geneon.net Web: www.geneon.net

Mehr

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989).

Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3 Methoden 3.1 Isolierung von Cosmid-DNA Die Isolierung von Cosmid-DNA erfolgte entsprechend den Protokollen von Sambrook et al. (1989). 3.2 Präparation von YAC-DNA aus Hefezellen Die Hefe-DNA wurde modifiziert

Mehr

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese

Mehr

Reagenzien-Wegweiser für das LightCycler 480 System

Reagenzien-Wegweiser für das LightCycler 480 System Reagenzien-Wegweiser für das LightCycler 480 System qpcr Reagenzien in Premium Qualität für jede Applikation die optimale Lösung www.roche-applied-science.com Roche Applied Science Haben Sie schon Ihr

Mehr

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?

Mehr

MVZ Mikrobiologie & UKE. Hepatitisdiagnostik

MVZ Mikrobiologie & UKE. Hepatitisdiagnostik MVZ Mikrobiologie & UKE Hepatitisdiagnostik Hepatitisviren Virus Familie Struktur Genom Genotypen chron. Infektion HAV Picornaviren 27nm ohne Hülle ss(+)rna, 7.5kb 7 (I-VII) nein HBV Hepadnaviren 45nm

Mehr

Mycoplasma gallisepticum

Mycoplasma gallisepticum BACTOTYPE PCR Amplification Kit Mycoplasma gallisepticum Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat

Mehr

Reagenzien Isolierung von Nukleinsäuren

Reagenzien Isolierung von Nukleinsäuren Aufbewahrung bei Raumtemperatur Anwendung Isolierung ultrareiner Plasmid-DNA aus Bakterienkulturen von 1 ml bis 800 ml. Die Plasmid-DNA eignet sich für Manuelle und automatisierte Sequenzierung mit Fluoreszenzfarbstoffen

Mehr

Molekularbiologische Methoden

Molekularbiologische Methoden Molekularbiologische Methoden im Lebensmittel-Labor Dr. rer. nat. Armin Pahl LADR GmbH MVZ Dr. Kramer & Kollegen 04152 803-0 www.ladr.de DNA 1866 Gregor Mendel veröffentlicht seine Versuche über Pflanzen-Hybriden,

Mehr

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich?

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Im Unterricht habt ihr bereits einige Methoden und Vorgehensweisen der Molekularbiologie kennengelernt. Aber wo finden diese Methoden im täglichen

Mehr

Methodensammlung der Bund-/ Länder Arbeitsgemeinschaft Gentechnik (LAG) Quantitativer Nachweis von Lentiviren (HIV1)-RNA mittels Real time RT-PCR

Methodensammlung der Bund-/ Länder Arbeitsgemeinschaft Gentechnik (LAG) Quantitativer Nachweis von Lentiviren (HIV1)-RNA mittels Real time RT-PCR Methodensammlung der Bund-/ Länder Arbeitsgemeinschaft Gentechnik (LAG) Quantitativer Nachweis von Lentiviren (HIV1)-RNA mittels Real time RT-PCR Erstellt vom Unterausschuss Methodenentwicklung der LAG,

Mehr

Borrelia burgdorferi s.l.

Borrelia burgdorferi s.l. BACTOTYPE PCR Amplification Kit Borrelia burgdorferi s.l. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation

Mehr

Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.

Mehr

Rekombinante Wirkstoffe

Rekombinante Wirkstoffe Gentechnik/Biotechnik Rekombinante Wirkstoffe Vorlesung im WS 2010/2011 Prof. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt/Main Dingermann@em.uni-frankfurt.de Die

Mehr

Analytik Jena bio solutions bietet ein umfassendes Angebot an Kits zur Nukleinsäure-Aufreinigung, für Enzyme, Reagenzien und auch für Additive an.

Analytik Jena bio solutions bietet ein umfassendes Angebot an Kits zur Nukleinsäure-Aufreinigung, für Enzyme, Reagenzien und auch für Additive an. Analytik Jena bio solutions bietet ein umfassendes Angebot an Kits zur Nukleinsäure-Aufreinigung, für Enzyme, Reagenzien und auch für Additive an. Kits für die Proteinanalyse und molekulare Diagnostik?

Mehr

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61 Tier-Biotechnologie Inhaltsverzeichnis Vorwort. 9 Mitarbeiter. 10 Einführung in die Tier-Biotechnologie. 11 Teil I: Zellkultur- und Bioverfahrenstechniken. 23 1 Kultivierung tierischer Zellen. 25 1.1 Voraussetzungen

Mehr

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung Sequenzierung von Thomas Grunwald Abteilung für Med. und Mol. Virologie Sequenzierung Hintergrund Allgemeiner Überblick Funktionsweise der Sequenzierung Sequenzierungsprotokoll Auswertung der Daten Probleme

Mehr

Entwicklung und Validierung der VIROTYPE BVDV real-time RT-PCR

Entwicklung und Validierung der VIROTYPE BVDV real-time RT-PCR Entwicklung und Validierung der real-time RT-PCR Gaunitz C, Engemann C, Labitzke M, Schroeder C, Kühn TE, Gabert, J Labor Diagnostik GmbH Leipzig Gliederung Testprinzip Testprotokoll Testcharakteristik

Mehr

Grundlagen der Physiologie

Grundlagen der Physiologie (2) Grundlagen der Physiologie Klassifizierung und Stammbaum aller Lebewesen www.icbm.de/pmbio Taxonomie Ziel: System mit Übereinstimmung zur natürlichen Verwandtschaft, der Phylogenie 1 Taxonomie 2 Was

Mehr

Multiplex Polymerasekettenreaktion mit fluoreszenzoptischer Produktdetektion durch den Einsatz von Primern mit primerintegrierten Reportersequenzen

Multiplex Polymerasekettenreaktion mit fluoreszenzoptischer Produktdetektion durch den Einsatz von Primern mit primerintegrierten Reportersequenzen Multiplex Polymerasekettenreaktion mit fluoreszenzoptischer Produktdetektion durch den Einsatz von Primern mit primerintegrierten Reportersequenzen Inauguraldissertation zur Erlangung des Grades eines

Mehr

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Zellzyklus- und neuronale Gene in Trichoplax adhaerens S. Sagasser Praktikanten: Patrick Reinke und Jan Kleveman Betreuerin: Karolin von der Chevallerie

Mehr

Bruder oder Vetter - was verbindet uns mit dem Neandertaler? 1

Bruder oder Vetter - was verbindet uns mit dem Neandertaler? 1 Bruder oder Vetter - was verbindet uns mit dem Neandertaler? 1 BÄRBEL KUNZE 2, Universität Lübeck Erweiterter Bericht von Wolfram Eckloff In ihrem beeindruckenden Vortrag berichtete Frau Dr. Kunze über

Mehr

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Inaugural-Dissertation zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen

Mehr

NUKLEINSÄUREN UND GENTECHNOLOGIE

NUKLEINSÄUREN UND GENTECHNOLOGIE NUKLEINSÄUREN UND GENTECHNOLOGIE Beispiele für Stoffinhalte aus der Chemie als Grundlage für das Verständnis dieses Teiles: nicht-kovalente chemische Bindungen, Koordinationsbindungen, funktionelle Gruppen

Mehr

Drosophila melanogaster

Drosophila melanogaster Modul biol113 Zellbiologie Drosophila melanogaster Komponenten der angeborenen Immunabwehr Experimente 1) RT (Reverse Transkriptase)-PCR zum Nachweis einer AMP- Expression nach Infektion 1.1 PCR-Reaktion

Mehr

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine

Mehr

- Polymerase-Kettenreaktion (PCR) - Theorie und Darstellung als digitales Medium

- Polymerase-Kettenreaktion (PCR) - Theorie und Darstellung als digitales Medium Gymnasium Penzberg Kollegstufenjahrgang 2006/2008 F a c h a r b e i t aus dem Fach Chemie - Polymerase-Kettenreaktion (PCR) - Theorie und Darstellung als digitales Medium Verfasser: Thomas Jungwirth Leistungskurs:

Mehr

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Gruppe 8 Susanne Duncker und Friedrich Hahn Einleitung und Aufgabenstellung Ziel dieses Versuchs ist es, das Gen für ein bestimmtes

Mehr

Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94.

Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94. In diesem Skript wird der Versuch unternommen, der Prozess Pyrosequencing so zu erklären, dass Schüler die Chance haben Pyrosequencing zu verstehen. Es basiert auf einem Vortrag im Rahmen des Science Bridge

Mehr

Praktikum Molekularbiologie, 5. Semester, BT 12 Martin Sievers, Gottfried Dasen und Tobias Wermelinger RT 418

Praktikum Molekularbiologie, 5. Semester, BT 12 Martin Sievers, Gottfried Dasen und Tobias Wermelinger RT 418 Praktikum Molekularbiologie, 5. Semester, BT 12 Martin Sievers, Gottfried Dasen und Tobias Wermelinger RT 418 Datum Gruppe Thema 18.09.14 I Forensik: PCR und Restriktionsanalyse am Beispiel der ITS-Region

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

Europäisches Patentamt European Patent Office Dffice europeen des brevets 3> J ) 2) Veröffentlichungsnummer: 0 409 078 AZ

Europäisches Patentamt European Patent Office Dffice europeen des brevets 3> J ) 2) Veröffentlichungsnummer: 0 409 078 AZ 3> J ) Europäisches Patentamt European Patent Office Dffice europeen des brevets 2) Veröffentlichungsnummer: 0 409 078 AZ 3> EUROPAISCHE PATENTANMELDUNG Anmeldenummer: 90113328.0 ) Int. CIA C1 20. 1/68

Mehr

Funktionelle Genomik. praktische Anwendungen

Funktionelle Genomik. praktische Anwendungen Funktionelle Genomik praktische Anwendungen Schmelzpunkt der DNA Einzelsträngige DNA absorbiert UV-Licht effektiver SYBR Green fluoresziert nur wenn es an doppelsträngiger DNA bindet Fluoreszenz erhöht

Mehr

Mycobacterium paratuberculosis

Mycobacterium paratuberculosis BACTOTYPE PCR Amplification Kit Mycobacterium paratuberculosis Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

(51) Int Cl.: C12Q 1/68 (2006.01)

(51) Int Cl.: C12Q 1/68 (2006.01) (19) TEPZZ_79ZZ7B_T (11) EP 1 79 007 B1 (12) EUROPÄISCHE PATENTSCHRIFT (4) Veröffentlichungstag und Bekanntmachung des Hinweises auf die Patenterteilung: 27.0.1 Patentblatt 1/22 (21) Anmeldenummer: 038084.1

Mehr

Trouble-Shooting Sequenzierergebnisse

Trouble-Shooting Sequenzierergebnisse Trouble-Shooting Sequenzierergebnisse Mixed Base Definitionen Problem 1: Keine Reaktion, Keine Sequenzdaten Problem 2: Überlappende Signale Problem 3: Überlappende Signale beginnen in der Mitte der Sequenz

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

PCR basierte- Detektionstechniken

PCR basierte- Detektionstechniken PCR basierte- Detektionstechniken Warum überhaupt? Forensische Analysen: Vaterschaftstests, Kriminalistik Mikrobielle Gemeinschaften: Biofilme, medizinische Mikrobiologie 2 Warum überhaupt? minimale Mengen

Mehr

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz Luitgardis Seigner Schaderregernachweis mit der Polymerase-Kettenreaktion (PCR) Schaderregernachweis mit der Polymerase- Kettenreaktion

Mehr

Techniken der. Nukleinsäure- und. Protein-Biochemie

Techniken der. Nukleinsäure- und. Protein-Biochemie Techniken der Nukleinsäure- und Protein-Biochemie Techniken der Nukleinsäure-Biochemie (Primer-) Synthese Restriktion, Analyse Ligation Expression PCR Klonierung in einen Expressions- Vektor Transformation

Mehr

Vorläufige Empfehlung des UAM zum Nachweis von SMRV in Zellinien Stand: Mai 2007

Vorläufige Empfehlung des UAM zum Nachweis von SMRV in Zellinien Stand: Mai 2007 Vorläufige Empfehlung des Unterausschuss Methodenentwicklung (UAM) der Bund/Länder-AG Gentechnik (LAG) zur Untersuchung von Zelllinien auf Kontamination mit dem Squirrel Monkey Retrovirus Aus der Überwachung

Mehr

Medizinische Fakultät Auswertestrategien von Microarrays Einführung

Medizinische Fakultät Auswertestrategien von Microarrays Einführung Medizinische Fakultät Auswertestrategien von Microarrays Einführung PD Dr. Knut Krohn IZKF Leipzig Dr. Markus Eszlinger Med. Klinik III Forschungslabor DNA RNA Hintergrund Charakteristisches Muster der

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

Die Diagnostik der Koi-Herpesvirus-Infektion

Die Diagnostik der Koi-Herpesvirus-Infektion Die Diagnostik der Koi-Herpesvirus-Infektion Sven M. Bergmann und Dieter Fichtner Institut für Infektionsmedizin Nationales Referenzlabor für Fischkrankheiten Verbreitung der Infektion mit dem KHV Klinisches

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

3 Material und Methoden

3 Material und Methoden 22 Material und Methoden 3 Material und Methoden 3.1 Patienten und Patientenproben TEL-AML1-Spleißvarianten und MRD-Messungen wurden an RNA-Proben von Kindern, die an einer TEL-AML1 positiven B-Vorläuferzell

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

4. Diskussion. 4.1. Polymerase-Kettenreaktion

4. Diskussion. 4.1. Polymerase-Kettenreaktion 59 4. Diskussion Bei der Therapie maligner Tumoren stellt die Entwicklung von Kreuzresistenz gegen Zytostatika ein ernstzunehmendes Hindernis dar. Im wesentlich verantwortlich für die so genannte Multidrug

Mehr

Southern Blot, in-situ Hybridisierung, (quantitative) PCR. Northern Blot, Quantitative RT-PCR, DNA-Chip

Southern Blot, in-situ Hybridisierung, (quantitative) PCR. Northern Blot, Quantitative RT-PCR, DNA-Chip Molekularbiologie Proteinnachweis, -quantifizierung Western Blot, Immunhistochemie DNA Nachweis / Quantifizierung Southern Blot, in-situ Hybridisierung, (quantitative) PCR RNA Quantifizierung Northern

Mehr

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher

Mehr

Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf

Mehr

Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen

Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen Überproduktion der Taq DNA Polymerase mit rekombinanten E. coli Zellen Versuchsleiter: Bernhard Eikmanns Protokollführung: Karl Varadi Gruppe: 11 Durchführung: 11.11 15.11.2002 Protokoll testiert: WS02

Mehr

Real-time RT-PCR: Neue Ansätze zur exakten mrna Quantifizierung Pfaffl, M.W.: BIOspektrum, Sonderausgabe PCR, 10 (2004) S. 92-95

Real-time RT-PCR: Neue Ansätze zur exakten mrna Quantifizierung Pfaffl, M.W.: BIOspektrum, Sonderausgabe PCR, 10 (2004) S. 92-95 Real-time RT-PCR: Neue Ansätze zur exakten mrna Quantifizierung Pfaffl, M.W.: BIOspektrum, Sonderausgabe PCR, 10 (2004) S. 92-95 Quantification strategies in real-time RT-PCR Pfaffl, M.W.: The real-time

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

2. MATERIAL UND METHODEN

2. MATERIAL UND METHODEN 2. MATERIAL UND METHODEN 2.1 Bakterienkulturen 2.1.1 Bakterienstämme Die bei den Arbeiten verwendeten Stämme sind sämtlich Derivate des 1922 in Stanford/ Kalifornien isolierten, anerkannten Sicherheitsstammes

Mehr

Urogenitale Infektionserreger mittels PCR

Urogenitale Infektionserreger mittels PCR Urogenitale Infektionserreger mittels PCR Dr. Monika Börner Planegg 09. September 2009 Urogenitale Infektionserreger mittels PCR Grundlagen / Allgemeines Chlamydia trachomatis Neisseria gonorrhoeae Mykoplasmen

Mehr