Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen"

Transkript

1 Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Inaugural-Dissertation zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen Fakultät, der Rheinischen Friedrich-Wilhelms-Universität Bonn vorgelegt von Ralf Gilsbach aus Hemer Bonn 2005

2 Inhaltsverzeichnis Abkürzungsverzeichnis I VI A. Einleitung 1 1. Monoaminerge Neurotransmission Noradrenerges System Der Noradrenalintransporter Dopaminerges System 7 2. Depression und Antidepressiva Noradrenalintransporter-Knockout-Mäuse Genexpressionsanalyse Zielsetzung der Arbeit 15 B. Versuchstiere, Material und Methoden Materialien Arbeitsgeräte 17 i 1.2 Verbrauchsmaterial Computersoftware und Datenbanken Kits für die Molekularbiologie Enzyme Größenmarker, Vektoren und Nukleinsäuren Chemikalien Radiochemikalien und Standards Strukturformeln der Liganden Nährmedien für die Bakterienkultur Pufferund Lösungen Haltung und Präparation der Versuchstiere Versuchstiere Transkardiale Perfusion Präparation der Hirnareale Anfertigung von Kryoschnitten 27 I

3 3. Molekularbiologische Methoden DNA Extraktion aus Blut zur Genotypisierung Isolierung von DNA aus Agarosegelen Plasmid Mini-Präparation RNA-Extraktion Isolierung von RNA aus peripheren Geweben Isolierung von RNA aus ZNS-Proben Isolierung von RNA aus Hirnarealen Isolierung von RNA aus Gesamthirnen Konzentrationsbestimmung von Nukleinsäuren Fällung von Nukleinsäuren In vitro Transkription 31 3.ß Reverse Transkription PCR Quantitative PCR Prinzip der quantitativen real-time PCR PCR-Effizienz Relative Quantifizierung Detektion...; Schmelzkurvenanalytik Standardreaktionsbedingungen Datenanalyse Qualitative PCR Auswahl der PCR-Primer Microarray Prinzip Versuchsdurchführung Reverse Transkription unter Einbau der Fluoreszenzfarbstoffe Hybridisierung und Waschen der Arrays Scannen und Datenanalyse Horizontale Agarose-Gelelektrophorese Klonierung von PCR-Produkten Bakterien-Dauerkulturen 48

4 3.17 Restriktionsverdau von DNA ; DNA-Sequenzierung Biochemische Methoden Radioligandbindung an Membransuspensionen Membranpräparation Proteinbestimmung Sättigungsexperiment Autoradiografie HPLC-Bestimmung von Catecholaminen Verhaltenspharmakologische Methoden Clonidin-induzierte Sedation Statistische Auswertung 55 C. Ergebnisse Charakterisierung der Versuchstiere Genotypisierung der Versuchstiere Körpergewicht und Probengewichte der Versuchstiere Ergebnisse der molekularbiologischen Versuche Optimierung der RNA-Extraktion Synthese der crna Genexpressionsanalyse mitqpcr Charakterisierung und Optimierung der Methode Effizienz und Spezifität der qpcr Optimierung des Reaktionsvolumens Charakterisierung der reversen Transkription Normalisierung der Expressionsdaten Normalverteilung der relativen Expressionsdaten Vergleich der Expressionsstärke der Zielgene im Gehirn Durch den Knockout des Noradrenalintransporters induzierte Regulation der Zielgene Genexpressionsanalyse mit der Microarray-Technologie Analyse der Daten 82 III

5 2.4.2 Validität und Präzision der Methode Differenziell exprimierte Gene Klonierung des murinen VMAT Klonierung der kodierenden Sequenz des mvmat Vergleich der ermittelten mvmat2 Aminosäuresequenz mit publizierten Daten anderer Spezies Ergebnisse der biochemischen Versuche Noradrenalintransporter-Knockout-induzierte Änderung der Expression von a2a,c-adrenozeptoren Sättigung der [ 3 H]RX Bindung an Homogenaten des Gesamthirns [ 3 H]RX Autoradiographie an koronaren Hirnschnitten Vergleich der Catecholaminspiegel von NAT"'"- und NAT +/+ -Mäusen Verhaltenspharmakologische Ergebnisse Einfluss des Noradrenalintransporter-Knockouts auf die Clonidininduzierte Hypoaktivität 101 D. Diskussion Noradrenalin-Homöostase in NAT'-Mäusen Änderung der Genexpression der Adrenozeptoren Regulation von ai-adrenozeptoren Regulation und Expression von a2-adrenozeptoren Expression der ci2-subtypen im Gesamthirn von Mäusen Noradrenalintransporter-Knockout-induzierte Regulation der mrna und des Rezeptorproteins von c<2-adrenozept.oren Regulation und Expression von ß-Adrenozeptoren Regulation des dopaminergen Systems Genexpressionsanalyse mit Microarrays Regulation der RNA-Expression von ribosomalen Proteinen Regulation der RNA-Expression von Proteinen der Atmungskette 118 E. Zusammenfassung 120 IV

6 F. Anhang Partielle genomische Sequenz des Noradrenalintransportergens von NAT'-und NAT +/+ -Tieren cdna-sequenz des murinen VMAT mrna-expressionsprofile der Zielgene Der qcalculator Die Befehlsleiste Das Setup"-Arbeitsblatt Die Data"-Arbeitsblätter Das Efficiency"-Arbeitsblatt Das lnternal Standard"-Arbeitsblatt Das Resulf- und das Diagram"-Arbeitsblatt Die IS"-Arbeitsblätter 144 G. Literaturverzeichnis Referenzen Eigene Veröffentlichungen während der Doktorarbeit: Orginalarbeiten: Vortrag: Poster: Im Rahmen dieser Arbeit in der GenBank-Datenbank (NCBI) abgelegte Nukleinsäuresequenzen: 158 Danksagung 159 Lebenslauf 161 v

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus Aus dem Institut für Virologie der Tierärztlichen Hochschule Hannover und dem Institut für Virusdiagnostik des Friedrich-Loeffler-Instituts, Insel Riems Etablierung, Validierung und praktische Anwendung

Mehr

Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR

Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR Aus dem Institut für Humangenetik der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Genexpressionsanalyse von DNA-Reparaturgenen in primären Fibroblasten von Tumorpatienten mittels Real

Mehr

Die antivirale Therapie der chronischen Hepatitis B: Identifikation neuer Resistenzmutationen und Optimierung der Verlaufskontrolle

Die antivirale Therapie der chronischen Hepatitis B: Identifikation neuer Resistenzmutationen und Optimierung der Verlaufskontrolle Angefertigt am Fachbereich 08 - Biologie und Chemie in Zusammenarbeit mit dem Institut für Medizinische Virologie am Fachbereich 11- Medizin der Justus-Liebig-Universität Gießen Die antivirale Therapie

Mehr

Untersuchungen zur Wirkung des Ginkgo biloba-extraktts EGb 761 auf die Proteinaggregation in der Huntington-Krankheit

Untersuchungen zur Wirkung des Ginkgo biloba-extraktts EGb 761 auf die Proteinaggregation in der Huntington-Krankheit Untersuchungen zur Wirkung des Ginkgo biloba-extraktts EGb 761 auf die Proteinaggregation in der Huntington-Krankheit Dissertation zur Erlangung des Grades Doktor der Naturwissenschaften am Fachbereich

Mehr

Rekombinante Antikorperfragmente fur die. Zoonosediagnostik

Rekombinante Antikorperfragmente fur die. Zoonosediagnostik Rekombinante Antikorperfragmente fur die Zoonosediagnostik Von der Fakultat fur Lebenswissenschaften der Technischen Universitat Carolo-Wilhelmina zu Braunschweig zur Erlangung des Grades eines Doktors

Mehr

Inhaltsverzeichnis. 1 Einleitung... 1

Inhaltsverzeichnis. 1 Einleitung... 1 Inhaltsverzeichnis 1 Einleitung... 1 1.1 G-Protein-gekoppelte Rezeptoren... 3 1.1.1 Klassifizierung und Struktur von G-Protein-gekoppelten Rezeptoren... 6 1.1.2 Purinerge Rezeptoren... 12 1.1.3 Pharmazeutische

Mehr

Aus dem Fachbereich Medizin der Johann Wolfgang Goethe-Universität Frankfurt am Main

Aus dem Fachbereich Medizin der Johann Wolfgang Goethe-Universität Frankfurt am Main Aus dem Fachbereich Medizin der Johann Wolfgang Goethe-Universität Frankfurt am Main Blutspendedienst des Deutschen Roten Kreuzes Institut für Transfusionsmedizin und Immunhämatologie Direktor: Professor

Mehr

Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres (Marmota monax)

Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres (Marmota monax) Aus der Abteilung Innere Medizin II der Medizinischen Universitätsklinik der Albert-Ludwigs-Universität Freiburg im Breisgau Herstellung und Charakterisierung von zellpermeablem Interferon-α des Waldmurmeltieres

Mehr

Männerpolitische Grundsatzabteilung. Vereinbarkeit von Familie und Beruf aus Männersicht

Männerpolitische Grundsatzabteilung. Vereinbarkeit von Familie und Beruf aus Männersicht Männerpolitische Grundsatzabteilung Vereinbarkeit von Familie und Beruf aus Männersicht Vielen Dank den Sponsoren: Inhaltsverzeichnis 4 Inhaltsverzeichnis 5 Inhaltsverzeichnis 6 Vorwort 7 Danksagung 8

Mehr

Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert

Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert Aus dem Institut für Funktionelle und Klinische Anatomie der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert

Mehr

Der Einfluss von Vitamin D 3 auf endotheliale Reparaturprozesse im Zusammenhang mit der Präeklampsie

Der Einfluss von Vitamin D 3 auf endotheliale Reparaturprozesse im Zusammenhang mit der Präeklampsie Aus der Klinik für Frauenheilkunde und Geburtshilfe der Medizinischen Hochschule Hannover Der Einfluss von Vitamin D 3 auf endotheliale Reparaturprozesse im Zusammenhang mit der Präeklampsie Dissertation

Mehr

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3

Mehr

Inhaltsverzeichnis. Zusammenfassung 1. Summary 4. 1 Einleitung Das Prostatakarzinom Entstehung und Bedeutung von Lymphknotenmetastasen 9

Inhaltsverzeichnis. Zusammenfassung 1. Summary 4. 1 Einleitung Das Prostatakarzinom Entstehung und Bedeutung von Lymphknotenmetastasen 9 Inhaltsverzeichnis Zusammenfassung 1 Summary 4 1 Einleitung 7 1.1 Das Prostatakarzinom 7 1.2 Entstehung und Bedeutung von Lymphknotenmetastasen 9 1.2.1 Das Lymphsystem 9 1.2.2 Lymphknotenmetastasierung

Mehr

https://cuvillier.de/de/shop/publications/2770

https://cuvillier.de/de/shop/publications/2770 Malgorzata Maria Jakubowska (Autor) Positive Regulation der Plasminogen-Aktivator-Inhibitor-1- Genexpression durch Insulin und Glucagon in primären Rattenhepatozyten https://cuvillier.de/de/shop/publications/2770

Mehr

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese

Mehr

Abbildungsverzeichnis

Abbildungsverzeichnis I INHALTSVERZEICHNIS Abkürzungen VI Abbildungsverzeichnis VIII I. Einleitung 1. Neurone und Axonwachstum 1 2. Oligodendrozyten und Myelin 3 3. Das Proteolipid Protein (PLP) 6 4. Mutationen im PLP-Gen und

Mehr

Wirkung der Blockade des Angiotensin II ATi-Rezeptors auf die Funktion und die Struktur des Herzens der Streptozotodn-diabetischen Ratte

Wirkung der Blockade des Angiotensin II ATi-Rezeptors auf die Funktion und die Struktur des Herzens der Streptozotodn-diabetischen Ratte Wirkung der Blockade des Angiotensin II ATi-Rezeptors auf die Funktion und die Struktur des Herzens der Streptozotodn-diabetischen Ratte Inaugural-Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen

Mehr

Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden

Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden Forschungszentrum Karlsruhe Technik und Umwelt Wissenschaftliche Berichte FZKA 6087 Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden Stefanie

Mehr

Analyse des Genoms des Pseudomonas-Phagen 0CTX, insbesondere der Steuerung der späten Gene

Analyse des Genoms des Pseudomonas-Phagen 0CTX, insbesondere der Steuerung der späten Gene Analyse des Genoms des Pseudomonas-Phagen 0CTX, insbesondere der Steuerung der späten Gene Frank Wilhelm Langewische Inhaltsverzeichnis Verzeichnis der Abbildungen Verzeichnis der Tabellen Verzeichnis

Mehr

Heterologe Expression einer funktionellen Domäne des nikotinischen Acetylcholinrezeptors

Heterologe Expression einer funktionellen Domäne des nikotinischen Acetylcholinrezeptors Heterologe Expression einer funktionellen Domäne des nikotinischen Acetylcholinrezeptors Inauguraldissertation zur Erlangung der Doktorwürde am Fachbereich Biologie/Chemie/Pharmazie der Freien Universität

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Ubiquitin-vermittelte Cadmium-Resistenz und MAC 1-abhängige Regulation des Kupferund Eisenstoffwechsels

Ubiquitin-vermittelte Cadmium-Resistenz und MAC 1-abhängige Regulation des Kupferund Eisenstoffwechsels 0 Molekulargenetische Analyse Metall-abhängiger Prozesse in S. cerevisiae: Ubiquitin-vermittelte Cadmium-Resistenz und MAC 1-abhängige Regulation des Kupferund Eisenstoffwechsels DISSERTATION der Fakultät

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose Aus der Medizinischen Universitätsklinik und Poliklinik Abteilung für Pneumologie der Albert-Ludwigs-Universität Freiburg im Breisgau Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen

Mehr

Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm)

Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm) Naturwissenschaft Daniel Knobeloch Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm) Diplomarbeit Bibliografische Information der Deutschen Nationalbibliothek:

Mehr

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 1.2.1.1. Molekulare Struktur von NCAM S.

Mehr

Medizinische Fakultät Auswertestrategien von Microarrays Einführung

Medizinische Fakultät Auswertestrategien von Microarrays Einführung Medizinische Fakultät Auswertestrategien von Microarrays Einführung PD Dr. Knut Krohn IZKF Leipzig Dr. Markus Eszlinger Med. Klinik III Forschungslabor DNA RNA Hintergrund Charakteristisches Muster der

Mehr

Forschungszentrum Karlsruhe

Forschungszentrum Karlsruhe Forschungszentrum Karlsruhe in der Helmholtz-Gemelnschaft Wissenschaftliche Berichte FZKA7106 Biochemische Charakterisierung der Isoprensynthase aus der Graupappel (Populus x canescens (Ait.) Sm.) und

Mehr

Genetik Praktikumsklausur SS2005

Genetik Praktikumsklausur SS2005 Genetik Praktikumsklausur SS2005 1. Aufgabe: Der Genotyp AbaB wird geselbstet, dabei werden 256 Nachkommen gebildet. Davon erhalten 16 Pflanzen den Genotyp ABAB a) gekoppelt b) nicht gekoppelt c) teilweise

Mehr

Transcriptomics: Analysis of Microarrays

Transcriptomics: Analysis of Microarrays Transcriptomics: Analysis of Microarrays Dion Whitehead dion@uni-muenster.de Division of Bioinformatics, Westfälische Wilhelms Universität Münster Microarrays Vorlesungsüberblick : 1. Überblick von Microarray

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom...

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... Inhaltsverzeichnis Abkürzungsverzeichnis... 7 Inhaltsverzeichnis... 11 Abbildungsverzeichnis... 17 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... 21 1.1.2 Protein-Protein Interaktionen allgemein...

Mehr

Verzeichnis der Abbildungen und Tabellen... VIII Verzeichnis der Abkürzungen und Trivialnamen... XI I Einleitung... 1

Verzeichnis der Abbildungen und Tabellen... VIII Verzeichnis der Abkürzungen und Trivialnamen... XI I Einleitung... 1 Verzeichnis der Abbildungen und Tabellen... VIII Verzeichnis der Abkürzungen und Trivialnamen... XI I Einleitung... 1 1 Extremophile Organismen... 1 2 Halophile Mikroorganismen... 2 2.1 Lebensräume und

Mehr

Kontrolle des murinen Cytomegalovirus durch. y6 T-Zellen

Kontrolle des murinen Cytomegalovirus durch. y6 T-Zellen Kontrolle des murinen Cytomegalovirus durch y6 T-Zellen Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat. vorgelegt

Mehr

Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.)

Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.) Interaktion von Renin-Angiotensin- und NO-System/ Physiologische Untersuchungen zur Herz- und Nierenfunktion in AT 2 -Rezeptordefizienten Mäusen nach L-NAME und DOCA-Salz-Behandlung Dissertation zur Erlangung

Mehr

Pharmazeutische Biologie und Phytochemie. Naturstoffe als Inhibitoren c-myb-abhängiger. Transkriptionsprozesse

Pharmazeutische Biologie und Phytochemie. Naturstoffe als Inhibitoren c-myb-abhängiger. Transkriptionsprozesse Pharmazeutische Biologie und Phytochemie Naturstoffe als Inhibitoren c-myb-abhängiger Transkriptionsprozesse Inaugural-Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften im Fachbereich

Mehr

DISSERTATION. Genanalyse bei Patienten mit Akuter Intermittierender Porphyrie. Zur Erlangung des akademischen Grades Doctor Medicinae (Dr. med.

DISSERTATION. Genanalyse bei Patienten mit Akuter Intermittierender Porphyrie. Zur Erlangung des akademischen Grades Doctor Medicinae (Dr. med. Aus der Medizinischen Klinik mit Schwerpunkt Onkologie und Hämatologie Charité Campus Mitte Charité Universitätsmedizin Berlin und dem Hämatologisch-Onkologischen Zentrum München DISSERTATION Genanalyse

Mehr

Inhaltsverzeichnis. Abbildungsverzeichnis. Tabellenverzeichnis. Abkürzungsverzeichnis

Inhaltsverzeichnis. Abbildungsverzeichnis. Tabellenverzeichnis. Abkürzungsverzeichnis Inhaltsverzeichnis Abbildungsverzeichnis Tabellenverzeichnis Abkürzungsverzeichnis vi viii ix 1. Einleitung 3 1.1. Phage Display................................ 4 1.1.1. Phage-Display-Bibliothekenformate................

Mehr

Molekulargenetische und biochemische Untersuchungen zur Pathogenese der Spinalen Muskelatrophie mit Atemnot Typ 1 (SMARD1)

Molekulargenetische und biochemische Untersuchungen zur Pathogenese der Spinalen Muskelatrophie mit Atemnot Typ 1 (SMARD1) Molekulargenetische und biochemische Untersuchungen zur Pathogenese der Spinalen Muskelatrophie mit Atemnot Typ 1 (SMARD1) Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften

Mehr

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?

Mehr

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 26.06.2015 bis 25.03.2017 Ausstellungsdatum: 26.06.2015 Urkundeninhaber:

Mehr

Produktkatalog 2010. Molekularbiologische Reagenzien

Produktkatalog 2010. Molekularbiologische Reagenzien Produktion, Vertrieb und Serviceleistung im Bereich der Molekularbiologie und Medizin Produktkatalog 2010 Molekularbiologische Reagenzien Molegene GmbH Bienenweg 28 35764 Sinn Tel. 02772-570952 Fax 02772-570945

Mehr

5x QPCR Mix (ROX) Datenblatt. Artikel-Nr. BS µl Artikel-Nr. BS µl. (Nur für Forschung und in vitro-anwendungen)

5x QPCR Mix (ROX) Datenblatt. Artikel-Nr. BS µl Artikel-Nr. BS µl. (Nur für Forschung und in vitro-anwendungen) Datenblatt Artikel-Nr. BS76.520.0200 200 µl Artikel-Nr. BS76.520.1000 1.000 µl Artikel-Nr. BS76.520.5000 5.000 µl (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen:

Mehr

Zwischenbericht: Research Project on Sebaceous Adenitis (SA) Dr. Ina Pfeiffer Institute of Veterinary Medicine University of Göttingen

Zwischenbericht: Research Project on Sebaceous Adenitis (SA) Dr. Ina Pfeiffer Institute of Veterinary Medicine University of Göttingen Zwischenbericht: Research Project on Sebaceous Adenitis (SA) Dr. Ina Pfeiffer Institute of Veterinary Medicine University of Göttingen SA betroffene Akita Photograph: Joop & Astrid Ouwerkerk Photograph:

Mehr

Platzhalter für Bild

Platzhalter für Bild Instrumentelle Bioanalytik in der Molekularbiologie Anke Neumann Platzhalter für Bild KIT die Kooperation von Forschungszentrum Karlsruhe GmbH und Universität Karlsruhe (TH) www.kit.edu Motivation und

Mehr

1 Einleitung... 1. 1.4 Glucoserepression...3. 1.8 Zielsetzung... 24. 2 Material und Methoden... 25

1 Einleitung... 1. 1.4 Glucoserepression...3. 1.8 Zielsetzung... 24. 2 Material und Methoden... 25 Inhaltsverzeichnis 1 Einleitung... 1 1.1 Zuckerstoffwechsel von Saccharomyces cerevisiae... 1 1.2 Glucoseinaktivierung... 2 1.3 Glucoseinduzierter gezielter mrna-abbau... 3 1.4 Glucoserepression...3 1.5

Mehr

Aus dem Universitätsklinikum Benjamin-Franklin der Freien Universität Berlin

Aus dem Universitätsklinikum Benjamin-Franklin der Freien Universität Berlin Aus dem Universitätsklinikum Benjamin-Franklin Abteilung: Urologische Klinik: Direktor: Prof. Dr. med. K. Miller Mutationsanalyse vom Tumorsuppressorgen PTEN (phosphatase and tensin homolog deleted on

Mehr

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik Ruprecht Kuner Abteilung Molekulare Genomanalyse DKFZ Heidelberg Vortragsübersicht Folie 1 1. Was ist ein Biochip? 2. Zielmoleküle

Mehr

Anlage zur Akkreditierungsurkunde D PL 13372 01 00

Anlage zur Akkreditierungsurkunde D PL 13372 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13372 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 22.05.2014 bis 25.03.2017 Ausstellungsdatum: 22.05.2014 Urkundeninhaber:

Mehr

Ursprung und Evolution der Landpflanzen: Untersuchungen zur molekularen Phylogenie der Charophyceae, Moose und Farngewächse

Ursprung und Evolution der Landpflanzen: Untersuchungen zur molekularen Phylogenie der Charophyceae, Moose und Farngewächse Ursprung und Evolution der Landpflanzen: Untersuchungen zur molekularen Phylogenie der Charophyceae, Moose und Farngewächse Den Naturwissenschaftlichen Fakultäten der Friedrich-Alexander-Universität Erlangen-Nümberg

Mehr

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

Inhaltsverzeichnis... I. Ein Vorwort... VII. Synopse der Arbeit... IX. Synopsis of the thesis... XIII

Inhaltsverzeichnis... I. Ein Vorwort... VII. Synopse der Arbeit... IX. Synopsis of the thesis... XIII I INHALTSVERZEICHNIS Inhaltsverzeichnis... I Ein Vorwort... VII Synopse der Arbeit... IX Synopsis of the thesis... XIII A. Untersuchungen über die Stereoselektivität bakterieller, Pyruvat-abhängiger Aldolasen...

Mehr

Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin

Mehr

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin

Mehr

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens 6 Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens Von der Gemeinsamen Naturwissenschaftlichen Fakultät der Technischen Universität

Mehr

Untersuchungen zu Qualitätskriterien und zum antiemetischen Wirkmechanismus von Ingwer

Untersuchungen zu Qualitätskriterien und zum antiemetischen Wirkmechanismus von Ingwer Untersuchungen zu Qualitätskriterien und zum antiemetischen Wirkmechanismus von Ingwer Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer: nat.) der Naturwissenschafllichen Fakultät

Mehr

Transgene Organismen

Transgene Organismen Transgene Organismen Themenübersicht 1) Einführung 2) Komplementäre DNA (cdna) 3) Vektoren 4) Einschleusung von Genen in Eukaryontenzellen 5) Ausmaß der Genexpression 6) Genausschaltung (Gen-Knockout)

Mehr

Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32

Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32 Inhaltsverzeichnis 1. Einleitung... 9 1.1 Posttranslationale Modifikationen... 10 1.2 N-Glykosylierung... 11 1.3 O-Glykosylierung... 12 1.4 Veränderungen der Glykosylierung bei der Tumorentstehung... 13

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Flavonoide in Zitronensaft. Stabilität und antioxidative Wirkung

Flavonoide in Zitronensaft. Stabilität und antioxidative Wirkung Medizin Vanessa Schuh Flavonoide in Zitronensaft. Stabilität und antioxidative Wirkung Masterarbeit UNTERSUCHUNGEN ZUR STABILITÄT UND ANTIOXIDATIVEN WIRKUNG VON FLAVONOIDEN IM ZITRONENSAFT Masterarbeit

Mehr

Abkürzungsverzeichnis. 1. Einleitung 1. 2. Material und Methoden 8

Abkürzungsverzeichnis. 1. Einleitung 1. 2. Material und Methoden 8 Inhaltsverzeichnis I Abkürzungsverzeichnis VI 1. Einleitung 1 1.1 Stabilisierung von Makromolekülen 1 1.2 Natürliche Umgebungen von Proteinen 4 1.3 Künstliche Umgebungen von Proteinen 5 1.4 Ziel der vorliegenden

Mehr

Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin

Mehr

Tierärztliche Hochschule Hannover

Tierärztliche Hochschule Hannover Tierärztliche Hochschule Hannover Vergleich der magnetresonanztomographischen und computertomographischen Darstellung der Organstrukturen von Wasserschildkröten INAUGURAL - DISSERTATION zur Erlangung des

Mehr

Zweigbibliofhek Medizin

Zweigbibliofhek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Dissertation finden Sie original in Printform zur Ausleihe in der Zweigbibliofhek Medizin Nähere

Mehr

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1 I... I Abbildungs- und Tabellenverzeichnis... VI Abkürzungsverzeichnis... IX 1 Einleitung... 1 1.1 Untersuchte uro-rektale Fehlbildungen... 1 1.1.1 Blasenekstrophie-Epispadie-Komplex (BEEK)... 1 1.1.1.1

Mehr

Real-time RT-PCR: Neue Ansätze zur exakten mrna Quantifizierung Pfaffl, M.W.: BIOspektrum, Sonderausgabe PCR, 10 (2004) S. 92-95

Real-time RT-PCR: Neue Ansätze zur exakten mrna Quantifizierung Pfaffl, M.W.: BIOspektrum, Sonderausgabe PCR, 10 (2004) S. 92-95 Real-time RT-PCR: Neue Ansätze zur exakten mrna Quantifizierung Pfaffl, M.W.: BIOspektrum, Sonderausgabe PCR, 10 (2004) S. 92-95 Quantification strategies in real-time RT-PCR Pfaffl, M.W.: The real-time

Mehr

Danksagungen 7 Widmung 7. Einführung 19

Danksagungen 7 Widmung 7. Einführung 19 Inhaltsverzeichnis Inhaltsverzeichnis Danksagungen 7 Widmung 7 Einführung 19 Über dieses Buch 19 Konventionen in diesem Buch 20 Was Sie nicht lesen müssen 20 Törichte Annahmen über den Leser 21 Wie dieses

Mehr

Humane mesenchymale Stammzellen (HMSC): Differenzierung und Fusion mit anderen Zellarten

Humane mesenchymale Stammzellen (HMSC): Differenzierung und Fusion mit anderen Zellarten Humane mesenchymale Stammzellen (HMSC): Differenzierung und Fusion mit anderen Zellarten Dissertation Zur Erlangung des Akademischen Grades doctor rerum naturalium (Dr. rer. nat.) vorgelegt der Mathematisch-Naturwissenschaftlichen-Technischen

Mehr

Veröffentlichungen aus dem Technologiezentrum Wasser Band 67 Anaerober CKW-Abbau: Molekularbiologie, Substanzspektrum, Isotopenfraktionierung

Veröffentlichungen aus dem Technologiezentrum Wasser Band 67 Anaerober CKW-Abbau: Molekularbiologie, Substanzspektrum, Isotopenfraktionierung Veröffentlichungen aus dem Technologiezentrum Wasser Band 67 Anaerober CKW-Abbau: Molekularbiologie, Substanzspektrum, Isotopenfraktionierung Inhaltsverzeichnis 1. Einleitung... 1 1.1. Wissenschaftliche

Mehr

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene Übung 11 Genregulation bei Prokaryoten Konzepte: Entwicklungs /gewebespezifische Genexpression Coexpression funktional überlappender Gene Positive Genregulation Negative Genregulation cis /trans Regulation

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik Ruprecht Kuner Abteilung Molekulare Genomanalyse DKFZ Heidelberg Vortragsübersicht Folie 1 1. Was ist ein Biochip / Microarray?

Mehr

neuropsychiatrische Erkrankungen

neuropsychiatrische Erkrankungen Keine Tauschexemplare, da euch als elektronische Version vorhanden. Neuronale Plastizität in Tiermodellen für neuropsychiatrische Erkrankungen Von der Naturwissenschaftlichen Fakultät der Gottfried Wilhelm

Mehr

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt

Mehr

1 Einleitung... 13. 1.1 Staphylokokken... 13. 1.2 Koagulase-negative Staphylokokken... 13. 1.4 MSCRAMM-Proteine... 16. 1.5 LPXTG-Motive...

1 Einleitung... 13. 1.1 Staphylokokken... 13. 1.2 Koagulase-negative Staphylokokken... 13. 1.4 MSCRAMM-Proteine... 16. 1.5 LPXTG-Motive... Inhaltsverzeichnis 1 Einleitung... 13 1.1 Staphylokokken... 13 1.2 Koagulase-negative Staphylokokken... 13 1.3 Staphylococcus saprophyticus... 14 1.4 MSCRAMM-Proteine... 16 1.5 LPXTG-Motive... 16 1.6 Oberflächenassoziierte

Mehr

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden Molbi Nachklausur 2009 Hier mal so die Fragen die mir noch so einfallen. Also es war gefragt: Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich

Mehr

Proteinbiochemischer Nachweis der Exprimierung von Myosin und Myosin-Light-Chain-Kinase in Trabekelwerkszellen des Auges

Proteinbiochemischer Nachweis der Exprimierung von Myosin und Myosin-Light-Chain-Kinase in Trabekelwerkszellen des Auges Charité Universitätsmedizin Berlin Campus Benjamin Franklin Aus dem Institut für Klinische Physiologie Geschäftsführender Direktor: Prof. Dr. med. Michael Fromm Proteinbiochemischer Nachweis der Exprimierung

Mehr

Diskussion 62 6 DISKUSSION

Diskussion 62 6 DISKUSSION Diskussion 62 6 DISKUSSION Kartierungsergebnisse Sowohl die Analyse von Deletionssyndromen, wie dem WAGR-Syndrom, als auch Beobachtungen von Allelverlusten der Region 11p13 14.1 in verschiedenen Tumoren

Mehr

Interaktionen von Pu-Signaltransduktionsproteinen im Stickstoffmetabolismus der Organismen Bacillus subtilis und Synechococcus elongatus

Interaktionen von Pu-Signaltransduktionsproteinen im Stickstoffmetabolismus der Organismen Bacillus subtilis und Synechococcus elongatus Interaktionen von Pu-Signaltransduktionsproteinen im Stickstoffmetabolismus der Organismen Bacillus subtilis und Synechococcus elongatus Inaugural-Dissertation zur Erlangung des Doktorsgrades der Naturwissenschaften

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 011 9. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (.000.000.000 Basenpaare)

Mehr

Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32

Mehr

Eine Arbeitsgemeinschaft der Verlage UTB 8449

Eine Arbeitsgemeinschaft der Verlage UTB 8449 UTB 8449 Eine Arbeitsgemeinschaft der Verlage Böhlau Verlag Köln Weimar Wien Verlag Barbara Budrich Opladen Farmington Hills facultas.wuv Wien Wilhelm Fink München A. Francke Verlag Tübingen und Basel

Mehr

Synthese und Analytik von TmHU, dem Histon-ähnlichen Protein aus Thermotoga maritima, und dessen Einsatz als proteinogenes Gentransfersystem

Synthese und Analytik von TmHU, dem Histon-ähnlichen Protein aus Thermotoga maritima, und dessen Einsatz als proteinogenes Gentransfersystem Synthese und Analytik von TmHU, dem Histon-ähnlichen Protein aus Thermotoga maritima, und dessen Einsatz als proteinogenes Gentransfersystem Dissertation Zur Erlangung des akademischen Grades doctor rerum

Mehr

Zweigbibliofhek Medizin

Zweigbibliofhek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliofhek Medizin

Mehr

Synthese von eukaryotischen RNA-Modifikationen

Synthese von eukaryotischen RNA-Modifikationen Dissertation zur Erlangung des Doktorgrades der Fakultät für Chemie und Pharmazie der Ludwig-Maximilians-Universität München Synthese von eukaryotischen RNA-Modifikationen und Quantifizierung nicht kanonischer

Mehr

ENTWICKLUNG UND CHARAKTERISIERUNG STRUKTURIERENDER LASERVERFAHREN FÜR DIE HERSTELLUNG KRISTALLINER SILIZIUM - SOLARZELLEN

ENTWICKLUNG UND CHARAKTERISIERUNG STRUKTURIERENDER LASERVERFAHREN FÜR DIE HERSTELLUNG KRISTALLINER SILIZIUM - SOLARZELLEN ENTWICKLUNG UND CHARAKTERISIERUNG STRUKTURIERENDER LASERVERFAHREN FÜR DIE HERSTELLUNG KRISTALLINER SILIZIUM - SOLARZELLEN DISSERTATION ZUR ERLANGUNG DES AKADEMISCHEN GRADS EINES DOKTORS DER NATURWISSENSCHAFTEN

Mehr

DISSERTATION. Vereinbarkeit von Familie und Beruf

DISSERTATION. Vereinbarkeit von Familie und Beruf Aus dem Zentrum der Human- und Gesundheitswissenschaften der Medizinischen Fakultät der Charité Universitätsmedizin Berlin und aus dem Deutschen Zentrum für Wachstum, Entwicklung und Gesundheitsförderung

Mehr

antimikrobielle Barriere

antimikrobielle Barriere Die intestinale Mukusschicht als antimikrobielle Barriere Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) Fakultät Naturwissenschaften Universität Hohenheim Institut

Mehr

Methylglyoxal in Manuka-Honig (Leptospermum scoparium):

Methylglyoxal in Manuka-Honig (Leptospermum scoparium): Methylglyoxal in Manuka-Honig (Leptospermum scoparium): Bildung, Wirkung, Konsequenzen DISSERTATION zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) vorgelegt der Fakultät

Mehr

Humanbiologie 4. Semester 1-Tages Praktikum Humangenom. Funktionelle Einzelzell-Genomik

Humanbiologie 4. Semester 1-Tages Praktikum Humangenom. Funktionelle Einzelzell-Genomik Humanbiologie 4. Semester 1-Tages Praktikum Humangenom Funktionelle Einzelzell-Genomik am Beispiel der dopaminergen Mittelhirn-Neuronen Institut für Normale und Pathologische Physiologie AG Molekulare

Mehr

A US DEM LEHRSTUHL FÜR KIEFERORTHOPÄDIE PROF. DR. DR. P. PROFF DER FAKULTÄT FÜR MEDIZIN DER UNIVERSITÄT REGENSBURG

A US DEM LEHRSTUHL FÜR KIEFERORTHOPÄDIE PROF. DR. DR. P. PROFF DER FAKULTÄT FÜR MEDIZIN DER UNIVERSITÄT REGENSBURG A US DEM LEHRSTUHL FÜR KIEFERORTHOPÄDIE PROF. DR. DR. P. PROFF DER FAKULTÄT FÜR MEDIZIN DER UNIVERSITÄT REGENSBURG Radiologische Bestimmung des dentalen Alters anhand der Weisheitszahnentwicklung sowie

Mehr

Was sind MICROARRAYS? Microarrays sind Technologieplattformen zur Messung der Aktivität einer großen Anzahl von Genen.

Was sind MICROARRAYS? Microarrays sind Technologieplattformen zur Messung der Aktivität einer großen Anzahl von Genen. MICROARRAYS Was sind Microarrays? Welche Technologieplattformen gibt es? Beispiel: Rot-Grün Chip Wie wird ein Chip hergestellt (Film)? Welche Fragen kann man mit Chips beantworten? Datenfluß: Experiment-Design

Mehr

Rekombinante Antikörper

Rekombinante Antikörper Frank Breitling und Stefan Dübel 2008 AGI-Information Management Consultants May be used for personal purporses only or by libraries associated to dandelon.com network. Rekombinante Antikörper Technische

Mehr

Bachelorarbeit. EIIa in Ferrovum sp. JA12. Herr. Stephan Koch. Mittweida, 2012

Bachelorarbeit. EIIa in Ferrovum sp. JA12. Herr. Stephan Koch. Mittweida, 2012 Bachelorarbeit Herr Stephan Koch < EIIa in Ferrovum sp. JA12 Mittweida, 2012 Fakultät MNI Bachelorarbeit EIIa in Ferrovum sp. JA12 Autor: Herr Stephan Koch Studiengang: Biotechnologie/Bioinformatik Seminargruppe:

Mehr

Tierärztliche Hochschule Hannover

Tierärztliche Hochschule Hannover Tierärztliche Hochschule Hannover Beurteilung der Entwicklungskompetenz boviner Oozyten aus Follikeln mit unterschiedlicher Durchblutung der Follikelwand INAUGURAL-DISSERTATION zur Erlangung des Grades

Mehr

und dem Institut für Medizinische Virologie des Fachbereichs Humanmedizin der Justus-Liebig-Universität Gießen Betreuer: Prof. Dr. W. H.

und dem Institut für Medizinische Virologie des Fachbereichs Humanmedizin der Justus-Liebig-Universität Gießen Betreuer: Prof. Dr. W. H. Aus der Klinik für Vögel, Reptilien, Amphibien und Fische des Fachbereichs Veterinärmedizin der Justus-Liebig-Universität Gießen Betreuer: Prof. Dr. E. F. Kaleta und dem Institut für Medizinische Virologie

Mehr

Bioinformatik Statistik und Analyse mit R 22.05.2009-1 -

Bioinformatik Statistik und Analyse mit R 22.05.2009-1 - Bioinformatik Statistik und Analyse mit R 22.05.2009-1 - Definition: Bioinformatik Die Bioinformatik http://de.wikipedia.org/wiki/bioinformatik (englisch bioinformatics, auch computational biology) ist

Mehr

RUHR-UNIVERSITÄT BOCHUM

RUHR-UNIVERSITÄT BOCHUM RUHR-UNIVERSITÄT BOCHUM Fakultät für Chemie Titel der Lehreinheit (LE) Modulpraktika Biochemie im Schwerpunkt Molekulare Biologie und Biotechnologie der Pflanzen und Mikroorganismen Molekularbiologie von

Mehr

Aus dem Alltag in der Molekularbiologie. Dr. Andreas Bergthaler

Aus dem Alltag in der Molekularbiologie. Dr. Andreas Bergthaler Aus dem Alltag in der Molekularbiologie Schulvortrag, 11.1.2010 A3rak4ve Gründe für eine Karriere Im Op4malfall: in der Forschung kann man selbst bes,mmen, was man erforscht. arbeitet man mit schlauen

Mehr