Inhaltsverzeichnis. Bibliografische Informationen digitalisiert durch

Größe: px
Ab Seite anzeigen:

Download "Inhaltsverzeichnis. Bibliografische Informationen http://d-nb.info/992492254. digitalisiert durch"

Transkript

1 Inhaltsverzeichnis 1 Einleitung 1.1 Die transkranielle Magnetstimulation (TMS) - allgemeine Einführung Die TMS - technisches Prinzip Einsatz der TMS in der neuro-psychiatrischen Forschung Kortikale Exzitabilität Motorische Ruheschwelle (RMT)/ Motorisch Evozierte Potentiale (MEP) "Cortical silent period" (CSP) "Ispilateral silent period" (ISP) "Short interval intra-cortical inhibition" (SICI)/ "intracortical facilitation" (ICF) Long interval intra-cortical inhibition" (LICI) Motorische Dysfunktionen, morphologische Befunde und kortikale Exzitabilität bei ausgewählten Krankheitsbildern Einführung Schizophrenie Aufmerksamkeitsdefizit-/ Hyperaktivitäts-Störung (ADHS) Depression Pharmakologische Einflüsse auf die kortikale Exzitabilität Repetitive transkranielle Magnetstimulation (rtms) Allgemeines Prinzip rtms Effekte bei neuropsychiatrischen Erkrankungen und Dysfunktionen rtms bei Depressionen rtms Effekte auf kognitive Funktionen rtms bei weiteren psychiatrischen Erkrankungen Wirkmechanismen der rtms Funktionen bildgebende Befunde Biochemische Befunde Cerebrale Monamine Brain derived neurotrophic factor"(bdnf) 48 Bibliografische Informationen digitalisiert durch

2 Neurophysiologische Befunde Kortikale Exzitabilität Elektroencephalographie (EEG) Nebenwirkungen der TMS Fragestellungen und Hypothesen 2.1 Diagnostischer Einsatz der TMS ISP bei Schizophrenie Kortikale Exzitabilität bei ADHS Therapeutischer Einsatz der rtms Hochfrequente versus niedrigfrequente rtms bei Depressionen (4.3) Augmentativer Effekt der rtms bei Depressionen (4.4) Effekte der rtms auf das qeeg depressiver Patienten (4.5) 58 3 Material und Methoden 3.1 Allgemeiner Methodikteil TMS Patienten-Vorbereitung MEP und zentrale motorische Leitungszeit (ZML) CSP ISP SICI und ICF LICI quantitatives Elektroencephalogramm (qeeg) 62 4 Studienbeschreibung, Ergebnisse, Diskussion 4.1 Studie I - ISP bei Schizophrenie Methodik Stichprobe TMS-Methode Magnetresonanztomografie (MRT) Statistik Ergebnisse ISP Morphometrie des Corpus callosum Diskussion 67-74

3 4.2 Studie H - Kortikale Exzitabilität bei ADHS Methodik Stichprobe Klinisch - diagnostische Methoden Messung der kortikalen Exzitabilität Untersuchungsablauf Statistik Ergebnisse RMT, MEP-Amplitude, ZML CSP Vor Methylphenidat Behandlung Nach Methylphenidat Behandlung ISP Ergebnisse der ANOVA t-test vor Methylphenidat Behandlung t-test nach Methylphenidat Behandlung SICI, ICF und LICI Vor Methylphenidat Behandlung - Ergebnisse der T-Teste Unter Methylphenidat Behandlung - Ergebnisse der ANOVA Diskussion Studie III - Hochfrequente versus niedrigfrequente rtms bei Depressionen Methoden Stichprobe rtms-parameter Methoden und Design Statistik Ergebnisse Anzahl der Responder Therapie - Response nach Selbstbeurteilung Therapie - Response nach Fremdbeurteilung Psychomotorische Befunde Konzentration und Aufmerksamkeit Gruppendifferenzen

4 4.4 Studie IV / a - Augmentativer Effekt der rtms bei Depressionen Methoden Stichprobe Studiendesign rtms-parameter Ratingverfahren und Zusatzuntersuchungen Statistik Ergebnisse Response Schweregrad der Depression Psychomotorik Kognition Diskussion - Klinische Wirksamkeit - Ergebnisse der rtms - Studie I und n Zusammenfassung der klinischen Ergebnisse der rtms bei Depressionen Diskussion der Ergebnisse der 20 Hz rtms Diskussion der Ergebnisse der 1 Hz rtms Diskussion der Ergebnisse der 10 Hz rtms Psychomotorik Kognitive Befunde Mögliche Ursachen der Negativergebnisse Studie IV / b - Effekte der rtms auf das qeeg depressiver Patienten Stichprobe Statistik Ergebnisse Vergleich des qeegs nach Verumund Placebostimulation Asymmetrie - Indices für das Alpha-Band Verlaufsanalysen Korrelationsanalysen Diskussion - qeeg Zusammenfassung der Ergebnisse qeeg - rtms bei Depressionen" Diskussion mit qeeg Ergebnissen aus der Literatur Mögliche Ursachen der qeeg-befunde

5 5 Zusammenfassung 5.1 Diagnostische Wertigkeit der TMS in der Psychiatrie Schizophrenie (Studie I) ADHS (Studie II) Therapeutische Wertigkeit der rtms bei depressiven Störungen Einfluss der rtms auf qeeg-befunde Ausblick - TMS-Forschung Anhang: Literatur Tabellen AbbUdungen

Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin, Clomipramin, Doxepin und Maprotilin unter naturalistischen Bedingungen

Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin, Clomipramin, Doxepin und Maprotilin unter naturalistischen Bedingungen Aus der Klinik und Poliklinik für Psychiatrie, Psychosomatik und Psychotherapie der Universität Würzburg Direktor: Professor Dr. med. J. Deckert Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin,

Mehr

Transkranielle Magnetstimulation: Hokuspokus oder Therapie der Zukunft?

Transkranielle Magnetstimulation: Hokuspokus oder Therapie der Zukunft? Transkranielle Magnetstimulation: Hokuspokus oder Therapie der Zukunft? Thomas Kammer Psychiatrische Universitätsklinik Ulm d'arsonval 1896 1 1985: moderne TMS Motorkortex: Muskelzuckung Visueller Kortex:

Mehr

Störungsspezifische Behandlung der Zwangsstörungen

Störungsspezifische Behandlung der Zwangsstörungen Ulrich Förstner, Anne Katrin Külz # Ulrich Voderholzer Störungsspezifische Behandlung der Zwangsstörungen Ein Therapiemanual Verlag W. Kohlhammer Geleitwort 5 Vorwort 11 1 Diagnose und Behandlung der Zwangserkrankung

Mehr

Fachbereich Erziehungswissenschaften und Psychologie der Freien Universität Berlin

Fachbereich Erziehungswissenschaften und Psychologie der Freien Universität Berlin Fachbereich Erziehungswissenschaften und Psychologie der Freien Universität Berlin Aufmerksamkeitsdefizit /Hyperaktivitätsstörung (ADHS) bei arabischen Kindern in Grundschulalter in Berlin Ergebnisse von

Mehr

Sport und Depression. Beiträge zur Sportwissenschaft Bd. 13. Verlag Harri Deutsch. Gerhard Huber. Ein bewegungstherapeutisches Modell

Sport und Depression. Beiträge zur Sportwissenschaft Bd. 13. Verlag Harri Deutsch. Gerhard Huber. Ein bewegungstherapeutisches Modell Beiträge zur Sportwissenschaft Bd. 13 Herausgegeben von Edgar Rummele Gerhard Huber Sport und Depression Ein bewegungstherapeutisches Modell Verlag Harri Deutsch INHALTSVERZEICHNIS 1. Einleitung 1 1.1

Mehr

ADHS und medikamentöse Behandlungsoptionen - Dr. Torsten Passie Abt. klinische Psychiatrie und Psychotherapie Medizinische Hochschule Hannover

ADHS und medikamentöse Behandlungsoptionen - Dr. Torsten Passie Abt. klinische Psychiatrie und Psychotherapie Medizinische Hochschule Hannover ADHS und medikamentöse Behandlungsoptionen - Dr. Torsten Passie Abt. klinische Psychiatrie und Psychotherapie Medizinische Hochschule Hannover Überblick Symptomatik, Epidemiologie + Diagnostik Ätiologie

Mehr

Depression und Manie

Depression und Manie Depression und Manie Erkennen und erfolgreich behandeln Bearbeitet von Christian Simhandl, Klaudia Mitterwachauer 1. Auflage 2007. Taschenbuch. xiv, 150 S. Paperback ISBN 978 3 211 48642 9 Format (B x

Mehr

Sport und Depression. Beiträge zur Sportwissenschaft Bd. 13. Verlag Harri Deutsch. Gerhard Huber. Ein bewegungstherapeutisches Modell

Sport und Depression. Beiträge zur Sportwissenschaft Bd. 13. Verlag Harri Deutsch. Gerhard Huber. Ein bewegungstherapeutisches Modell Beiträge zur Sportwissenschaft Bd. 13 Herausgegeben von Edgar Rummele Gerhard Huber Sport und Depression Ein bewegungstherapeutisches Modell Verlag Harri Deutsch «/' INHALTSVERZEICHNIS 1. Einleitung 1

Mehr

Wirksamkeit von Verhaltenstherapie, Pharmakotherapie und deren Kombination bei depressiven Patienten

Wirksamkeit von Verhaltenstherapie, Pharmakotherapie und deren Kombination bei depressiven Patienten Wirksamkeit von Verhaltenstherapie, Pharmakotherapie und deren Kombination bei depressiven Patienten Seminar: Affektive Störungen II Dozent: Dr. M. Backenstraß Referentin: Liesa Büche Literatur Hautzinger,

Mehr

Forschungsprojekte des LWL-Forschungsinstituts für seelische Gesundheit (Stand: Sept. 2011)

Forschungsprojekte des LWL-Forschungsinstituts für seelische Gesundheit (Stand: Sept. 2011) Forschungsprojekte des LWL-Forschungsinstituts für seelische Gesundheit (Stand: Sept. 2011) Institutsprojekte F001-2009: Genetische Prädiktion des Verlaufs schizophrener Erkrankungen Im Rahmen des Projektes

Mehr

Um glücklich zu sein, müssen mehrere Gehirnareale gleichzeitig simultan stimuliert werden...

Um glücklich zu sein, müssen mehrere Gehirnareale gleichzeitig simultan stimuliert werden... DEPRESSIONEN Um glücklich zu sein, müssen mehrere Gehirnareale gleichzeitig simultan stimuliert werden... BURN OUT Zuviel Stress schädigt. Die Folgen können fatal sein. Schätzen sie sich! Wir zeigen Ihnen

Mehr

Männerpolitische Grundsatzabteilung. Vereinbarkeit von Familie und Beruf aus Männersicht

Männerpolitische Grundsatzabteilung. Vereinbarkeit von Familie und Beruf aus Männersicht Männerpolitische Grundsatzabteilung Vereinbarkeit von Familie und Beruf aus Männersicht Vielen Dank den Sponsoren: Inhaltsverzeichnis 4 Inhaltsverzeichnis 5 Inhaltsverzeichnis 6 Vorwort 7 Danksagung 8

Mehr

Relevanz der Neuroplastizität für das Bewegungslernen beim Menschen: Erkenntnisse durch nicht-invasive Hirnstimulation

Relevanz der Neuroplastizität für das Bewegungslernen beim Menschen: Erkenntnisse durch nicht-invasive Hirnstimulation Relevanz der Neuroplastizität für das Bewegungslernen beim Menschen: Erkenntnisse durch nicht-invasive Hirnstimulation Michael A. Nitsche, Abteilung Klinische Neurophysiologie. Georg-August-Universität,

Mehr

Wie schreibe ich (m)eine Dissertation???

Wie schreibe ich (m)eine Dissertation??? Wie schreibe ich (m)eine Dissertation??? Arbeitsmethodik und Standards Frank Krummenauer Promovierendensymposium Mülheim, 10. Juni 2011 Redaktionelle Aspekte Übliche Gliederung einer medizinischen Dissertation:

Mehr

Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Dissertation finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin Nähere

Mehr

Tele EEG. werner.mess@mumc.nl

Tele EEG. werner.mess@mumc.nl Tele EEG werner.mess@mumc.nl Ein Netzwerk entsteht TAAA Rekonstruktion TAAA Rekonstruktion Neurologische Komplikationen bis zu 25% spinale Ischämie (transient oder permanent) Coselli J, et al. Ann Thorac

Mehr

Effekte der Theta-Burst Stimulation (TBS) auf den primär motorischen Kortex

Effekte der Theta-Burst Stimulation (TBS) auf den primär motorischen Kortex Aus dem Zentrum für Neurologie und Psychiatrie der Universität zu Köln Klinik und Poliklinik für Neurologie Direktor: Universitätsprofessor Dr. med. G. R. Fink Effekte der Theta-Burst Stimulation (TBS)

Mehr

Inhaltsverzeichnis I EINLEITUNG... 1

Inhaltsverzeichnis I EINLEITUNG... 1 i INHALTSVERZEICHNIS I EINLEITUNG......................................................... 1 II THEORETISCHER HINTERGRUND......................................... 2 1 Schizophrenie.......................................................

Mehr

Teil 1 Entwicklungspsychologie, allgemeine Neurosenlehre

Teil 1 Entwicklungspsychologie, allgemeine Neurosenlehre Teil 1 Entwicklungspsychologie, allgemeine Neurosenlehre 1 Die vier Psychologien der Psychoanalyse.................... 3 Triebpsychologie/Libidotheorie (nach Freud)................. 4 Strukturmodell (

Mehr

Alkoholkonsum deutscher und polnischer Schüler eine vergleichende Studie

Alkoholkonsum deutscher und polnischer Schüler eine vergleichende Studie Alkoholkonsum deutscher und polnischer Schüler eine vergleichende Studie Maria Anna Marchwacka / Stephanie Piückhahn Mit einem Vorwort von Prof. Dr. N. H. Weber Inhaltsverzeichnis Vorwort 7 I Einleitung

Mehr

Kognitive Dysfunktion bei Depression: häufig ein vergessenes Symptom?

Kognitive Dysfunktion bei Depression: häufig ein vergessenes Symptom? Kognitive Dysfunktion bei Depression: häufig ein vergessenes Symptom? Prof. Dr. med. Gregor Hasler Chefarzt und Extraordinarius Universitätsklinik für Psychiatrie Universität Bern 3. Netzwerktagung Psychische

Mehr

Depressiven und suizidalen Menschen begegnen

Depressiven und suizidalen Menschen begegnen UNIVERSITÄRE PSYCHIATRISCHE DIENSTE BERN (UPD) UNIVERSITÄTSKLINIK FÜR KINDER- UND JUGENDPSYCHIATRIE UND PSYCHOTHERAPIE Depressiven und suizidalen Menschen begegnen Dr. med. Stephan Kupferschmid Leitender

Mehr

ADHS Wie zeigt sich das?

ADHS Wie zeigt sich das? Kognitive Aspekte ADHS Wie zeigt sich das? Aufmerksamkeit Ablenkbarkeit, Daueraufmerksamkeit, Reaktionszeit Psychomotorische Aspekte Motorische Aktivität Aktimetrie Emotionale Aspekte Impulsivität Reizunterdrückung

Mehr

ADHS-Kinder im Sportunterricht

ADHS-Kinder im Sportunterricht Till Kramann ADHS-Kinder im Sportunterricht Eine empirische Studie zur Reduzierung ADHS-spezifischen Problemverhaltens im Sportunterricht der Grundschule Verlag Dr. Kovac Hamburg 2008 Inhalt 5 Inhalt Vorwort

Mehr

Inhalt. Institutionen, Therapien, Medikamente 17. Vorwort 15

Inhalt. Institutionen, Therapien, Medikamente 17. Vorwort 15 Inhalt Vorwort 15 Institutionen, Therapien, Medikamente 17 Allgemeine Informationen 18 Nehmen psychische Erkrankungen zu? 18 Berührungsängste und Stigmatisierung 22 Stigma: die wichtigsten Tipps 26 Ursachen

Mehr

Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod

Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod ABTEILUNG PSYCHIATRIE UND PSYCHOTHERAPIE Überblick über die aktuellen Forschungsprojekte Thema Projektbeteiligte Projektstatus Externe Kooperationspartner ADHS bei Erwachsenen Malignering von Unaufmerksamkeit

Mehr

Eine Indikation für die analytische Psychotherapie stellen dar:

Eine Indikation für die analytische Psychotherapie stellen dar: 1 Aussagenkombination Eine Indikation für die analytische Psychotherapie stellen dar: 1. Akute Psychosen 2. Oligophrenie 3. Angstneurose 4. Persönlichkeitsstörung 5. Schwere Depression A) Nur die Aussagen

Mehr

Inhaltsverzeichnis. Grundlagen. II Präparate VII

Inhaltsverzeichnis. Grundlagen. II Präparate VII VII Inhaltsverzeichnis I Grundlagen 1 Pharmakologische Grundlagen........ 3 1.1 Pharmaka......................... 4 1.1.1 Pharmakologisch wirksame Stoffe......... 4 1.1.2 Wirkstoffentwicklung.................

Mehr

Onkologische Erkrankungen und Fahreignung - Einschränkungen aus der Sicht der Psychologie

Onkologische Erkrankungen und Fahreignung - Einschränkungen aus der Sicht der Psychologie Onkologische Erkrankungen und Fahreignung - Einschränkungen aus der Sicht der Psychologie Dr. Monika Dorfmüller ltd. klinische Psychologin a.d., München Ausgangssituation Altersstufe bei Diagnosenstellung

Mehr

26. Psychiatrie und Psychotherapie

26. Psychiatrie und Psychotherapie Fertigkeiten in den Inhalten der Weiterbildung gemäß den Allgemeinen Bestimmungen der WBO (s. Seite 2) der psychiatrischen Anamnese und Befunderhebung der allgemeinen und speziellen Psychopathologie psychodiagnostischen

Mehr

1 Diagnostik und Therapie der Demenz (ICD-10 F0) 1.1 Diagnostik der Demenz 1.2 Therapie demenzieller Syndrome 2 Alkoholabhängigkeit (ICD-10 F1) 2.

1 Diagnostik und Therapie der Demenz (ICD-10 F0) 1.1 Diagnostik der Demenz 1.2 Therapie demenzieller Syndrome 2 Alkoholabhängigkeit (ICD-10 F1) 2. 1 Diagnostik und Therapie der Demenz (ICD-10 F0) 1.1 Diagnostik der Demenz 1.2 Therapie demenzieller Syndrome 2 Alkoholabhängigkeit (ICD-10 F1) 2.1 Epidemiologie 2.2 Diagnostische Kriterien 2.3 Neurobiologische

Mehr

Bipolare Störungen. Praxisrelevante Aspekte der Neurobiologie bipolarer Störungen. Schläper,T., Winkler, R. Nernvenheilkunde 3/2008, S.

Bipolare Störungen. Praxisrelevante Aspekte der Neurobiologie bipolarer Störungen. Schläper,T., Winkler, R. Nernvenheilkunde 3/2008, S. Praxisrelevante Aspekte der Neurobiologie bipolarer Störungen. Schläper,T., Winkler, R. Nernvenheilkunde 3/2008, S. 127-132 Lebenszeitprävalenz für beide Geschlechter 1 % Bei ca. 20% rezidiv depressiver

Mehr

Alle Zeitangaben in Minuten, die in 80% der Fälle erreichbar sind, in sozialpädiatrischen, psychiatrischen und geriatrischen Kliniken eher zu 60%.

Alle Zeitangaben in Minuten, die in 80% der Fälle erreichbar sind, in sozialpädiatrischen, psychiatrischen und geriatrischen Kliniken eher zu 60%. Zeitbedarf für Untersuchungen im neurophysiologischen Labor Die Liste wurde durch den FNTA, basierend auf ausführlichen Recherchen, erstellt. Die Liste enthält Durchschnittswerte. Der Zeitbedarf für die

Mehr

Bericht zur Überprüfung und ggf. Anpassung des Einzelhandels- und Zentrenkonzeptes für die Stadt Wuppertal

Bericht zur Überprüfung und ggf. Anpassung des Einzelhandels- und Zentrenkonzeptes für die Stadt Wuppertal Überprüfung und ggf. Anpassung des Einzelhandels- und Zentrenkonzeptes für die Stadt Wuppertal Bericht zur Überprüfung und ggf. Anpassung des Einzelhandels- und Zentrenkonzeptes für die Stadt Wuppertal

Mehr

Syndrome. 12 Anwendungsfelder. 40 F-Diagnosen. Essstörung? Somatoform? Sexuell? Dementielles Syndrom. Katatones Syndrom

Syndrome. 12 Anwendungsfelder. 40 F-Diagnosen. Essstörung? Somatoform? Sexuell? Dementielles Syndrom. Katatones Syndrom 40 F-Diagnosen Essstörung? Somatoform? Sexuell? Katatones Syndrom Dissoziales Syndrom Paranoid halluzinatorisches Syndrom Schizophrenes Grundsyndrom Delirantes Syndrom Dämmerzustand Konversions-Syndrom

Mehr

Gemeinsam einsam fernsehen

Gemeinsam einsam fernsehen Alexander Blicker-Dielmann Gemeinsam einsam fernsehen Eine Untersuchung zum Einfluss sozialer Hinweisreize auf die Filmrezeption Diplomica Verlag Alexander Blicker-Dielmann Gemeinsam einsam fernsehen:

Mehr

Die Behandlung der Depression Bewährtes und Neues

Die Behandlung der Depression Bewährtes und Neues 3. Deutscher Patientenkongress Depression am 12.9.2015 Die Behandlung der Depression Bewährtes und Neues Ulrich Hegerl Vorsitzenden der Stiftung Deutsche Depressionshilfe Direktor der Klinik und Poliklinik

Mehr

Gerontopsychiatrie. Dr. medic. Ligia Comaniciu Leyendecker

Gerontopsychiatrie. Dr. medic. Ligia Comaniciu Leyendecker Gerontopsychiatrie ligley66@gmail.com ligley66@gmail.com Gerontopsychiatrie 1 / 19 Outline 1 Demenz 2 Demenz bei Alzheimerkrankheit 3 Vaskuläre Demenz 4 Andere Demenzformen 5 Diagnostische Verfahren 6

Mehr

1 Implantat-Akupunktur Einführung Die klassische Ohrakupunktur Die Suche nach Langzeitstimulation Implantat-Akupunktur 6

1 Implantat-Akupunktur Einführung Die klassische Ohrakupunktur Die Suche nach Langzeitstimulation Implantat-Akupunktur 6 Inhalt 1 Implantat-Akupunktur 2 1.1 Einführung 2 1.2 Die klassische Ohrakupunktur 4 1.3 Die Suche nach Langzeitstimulation 5 1.4 Implantat-Akupunktur 6 2 Die Implantate 10 2.1 Titan-Implantate 10 2.2 Resorbierbare

Mehr

Diagnostik Einführung und Gesamtüberblick

Diagnostik Einführung und Gesamtüberblick Diagnostik Einführung und Gesamtüberblick Jürgen Junglas 19.10.2006, Kurs 2006 Institut für Psychotherapie und Psychoanalyse Rhein-Eifel, Sinzig 4 UE 19.10.06 REI, Sinzig www.jjunglas.com 1 Diagnose-Quellen

Mehr

1.3 Zusammenfassung und Ausblick 26. 2 Medizinische Grundlagen des Diabetes mellitus 27

1.3 Zusammenfassung und Ausblick 26. 2 Medizinische Grundlagen des Diabetes mellitus 27 Inhaltsverzeichnis Inhaltsverzeichnis I Abbildungsverzeichnis VIII Tabellenverzeichnis IX Abkürzungsverzeichnis XI Zusammenfassung 1 Abstract 3 Einleitung 5 I. Stand der Forschung 9 1 Depressive Störungen

Mehr

Um glücklich zu sein, müssen mehrere Gehirnareale gleichzeitig simultan stimuliert werden...

Um glücklich zu sein, müssen mehrere Gehirnareale gleichzeitig simultan stimuliert werden... DEPRESSIONEN Um glücklich zu sein, müssen mehrere Gehirnareale gleichzeitig simultan stimuliert werden... BURN OUT Zuviel Stress schädigt. Die Folgen können fatal sein. Schützen sie sich! Wir zeigen Ihnen

Mehr

Statistik für Psychologen und Sozialwissenschaftler

Statistik für Psychologen und Sozialwissenschaftler Markus Bühner Matthias Ziegler Statistik für Psychologen und Sozialwissenschaftler Mit über 480 Abbildungen PEARSON Studium Ein Imprint von Pearson Education München Boston San Francisco Harlow, England

Mehr

2.2 Aufgabenstellung 16

2.2 Aufgabenstellung 16 INHALTSSCHWERPUNKTE UND GLIEDERUNG 1 EINLEITUNG 9 2 WISSENSCHAFTLICHE PROBLEM- UND AUFGABENSTELLUNG 2.1 Problemanalyse 10 2.2 Aufgabenstellung 16 3 THEORETISCHE EINORDNUNG UND VORÜBERLEGUNGEN 3.1. Begriff,

Mehr

Inhaltsverzeichnis. Vorwort zur deutschen Ausgabe... Geleitwort... Vorwort... XVII

Inhaltsverzeichnis. Vorwort zur deutschen Ausgabe... Geleitwort... Vorwort... XVII Inhaltsverzeichnis Vorwort zur deutschen Ausgabe.................................... Geleitwort...................................................... XIII XVI Vorwort........................................................

Mehr

Kurzfassung HTA. Medikamentöse Behandlung der ADHS (Aufmerksamkeitsdefizit-/Hyperaktivitätsstörung) im Erwachsenenalter in Deutschland

Kurzfassung HTA. Medikamentöse Behandlung der ADHS (Aufmerksamkeitsdefizit-/Hyperaktivitätsstörung) im Erwachsenenalter in Deutschland Kurzfassung HTA HTA-Bericht Kurzfassung Medikamentöse Behandlung der ADHS (Aufmerksamkeitsdefizit-/Hyperaktivitätsstörung) im Erwachsenenalter in Deutschland Benkert D, Krause KH, Wasem J, Aidelsburger

Mehr

Inhaltsverzeichnis. Abbildungsverzeichnis 9. Tabellenverzeichnis Einleitung Theoretischer Hintergrund 21. Inhaltsverzeichnis 1

Inhaltsverzeichnis. Abbildungsverzeichnis 9. Tabellenverzeichnis Einleitung Theoretischer Hintergrund 21. Inhaltsverzeichnis 1 Inhaltsverzeichnis 1 Inhaltsverzeichnis Abbildungsverzeichnis 9 Tabellenverzeichnis 14 1 Einleitung 17 2 Theoretischer Hintergrund 21 2.1 Das Auftreten von falschen Erinnerungen... 21 2.2 Der Prozess des

Mehr

https://cuvillier.de/de/shop/publications/1337

https://cuvillier.de/de/shop/publications/1337 Christina Reutelsterz (Autor) Vergleich umweltmedizinischer Patienten und Patienten mit depressiver Beschwerdesymptomatik hinsichtlich psychischer und körperlicher Beschwerdeprofile https://cuvillier.de/de/shop/publications/1337

Mehr

Depressive Störungen bei Frauen und Männern mit koronarer Herzerkrankung: Behandlungsraten und Einstellungen zu antidepressiver Therapie

Depressive Störungen bei Frauen und Männern mit koronarer Herzerkrankung: Behandlungsraten und Einstellungen zu antidepressiver Therapie Depressive Störungen bei Frauen und Männern mit koronarer Herzerkrankung: Behandlungsraten und Einstellungen zu antidepressiver Therapie N. Rieckmann, V. Arolt, W. Haverkamp, P. Martus, A. Ströhle, J.

Mehr

Was sind neuropsychologische Defizite?

Was sind neuropsychologische Defizite? Was sind neuropsychologische Defizite? Goldenberg (1998): Die klinische Neuropsychologie befasst sich mit Diagnose und Therapie der Folgen, die Hirnschädigungen auf Intellekt und Psyche des Menschen haben.

Mehr

I. Inhaltsverzeichnis

I. Inhaltsverzeichnis - 5 - Inhaitsverzeichnis I. Inhaltsverzeichnis I. Inhaltsverzeichnis 5 II. Abbildungsverzeichnis 10 III. Tabellenverzeichnis 13 IV. Abkürzungsverzeichnis 14 1 Einleitung 15 1.1 Relevanz der Thematik 15

Mehr

Diagnose Depression effektive Behandlung in der Hausarztpraxis

Diagnose Depression effektive Behandlung in der Hausarztpraxis Diagnose Depression effektive Behandlung in der Hausarztpraxis Prof. Dr. Göran Hajak Jede vierte Frau und jeder achte Mann erkranken in Deutschland bis zu Ihrem 65. Lebensjahr an einer behandlungsbedürftigen

Mehr

Wie wird man PsychotherapeutIn? Gesetzliche Grundlagen. Dipl.-Psych. vor dem PsychThG

Wie wird man PsychotherapeutIn? Gesetzliche Grundlagen. Dipl.-Psych. vor dem PsychThG Wie wird man PsychotherapeutIn? Gesetzliche Grundlagen Psychotherapeutengesetz (PTG) vom 16.06.1998 zum Änderung des SGBV Ausbildungs- und Prüfungsverordnung (PsychTh-AprV) vom 18.12.1998 Ausbildungs-

Mehr

Hinweise für den Leser 15 Vorwort zur 5. Auflage 23 Vorwort zur 1. Auflage 25. I Störungsbild und Behandlungsansätze 27

Hinweise für den Leser 15 Vorwort zur 5. Auflage 23 Vorwort zur 1. Auflage 25. I Störungsbild und Behandlungsansätze 27 http://www.beltz.de/de/nc/verlagsgruppe-beltz/gesamtprogramm.html?isbn=978-3-621-28033-4 Inhalt Hinweise für den Leser 15 Vorwort zur 5. Auflage 23 Vorwort zur 1. Auflage 25 I Störungsbild und Behandlungsansätze

Mehr

Bewegungstherapie bei Patienten mit schizophrenen Erkrankungen: Studienergebnisse

Bewegungstherapie bei Patienten mit schizophrenen Erkrankungen: Studienergebnisse Bewegungstherapie bei Patienten mit schizophrenen Erkrankungen: Studienergebnisse Interdisziplinärer Arbeitskreis Bewegungstherapie bei psychischen Erkrankungen Vierte Tagung: Praxis und Forschung im Dialog

Mehr

Nyberg Hofecker-Fallahpour Stieglitz. Ratgeber ADHS bei Erwachsenen. Informationen für Betroffene und Angehörige

Nyberg Hofecker-Fallahpour Stieglitz. Ratgeber ADHS bei Erwachsenen. Informationen für Betroffene und Angehörige Nyberg Hofecker-Fallahpour Stieglitz Ratgeber ADHS bei Erwachsenen Informationen für Betroffene und Angehörige Ratgeber ADHS bei Erwachsenen und an Dritte weitergegeben werden Aus E Nyberg/M Hofecker-Fallahpour/R-D

Mehr

Gmehlin, Aschenbrenner, Weisbrod. Gmehlin, Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod

Gmehlin, Aschenbrenner, Weisbrod. Gmehlin, Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod ABTEILUNG PSYCHIATRIE UND PSYCHOTHERAPIE Überblick über die aktuellen Forschungsprojekte Thema Projektbeteiligte Projektstatus Externe Kooperationspartner ADHS bei Erwachsenen Reaktionszeitvariabilität

Mehr

Inhaltsverzeichnis. Allgemeine Einführung in die Ursachen psychischer Erkrankungen sowie deren Bedeutung

Inhaltsverzeichnis. Allgemeine Einführung in die Ursachen psychischer Erkrankungen sowie deren Bedeutung Inhaltsverzeichnis Allgemeine Einführung in die Ursachen psychischer Erkrankungen sowie deren Bedeutung XIII 1 Diagnostik und Klassifikation in der Psychiatrie 1.1 Psychiatrische Anamneseerhebung 1 Synonyme

Mehr

Kritische Sicht auf die Diagnostik in Psychiatrie und Psychotherapie

Kritische Sicht auf die Diagnostik in Psychiatrie und Psychotherapie Kritische Sicht auf die Diagnostik in Psychiatrie und Psychotherapie Welche Probleme stellen sich uns? Paul Hoff 8. Vierwaldstätter Psychiatrietag 24. Januar 2008 Psychiatrische Diagnosen: Welche Probleme

Mehr

Fachhandbuch für F18 - Psychiatrie und Psychotherapie (8. FS)

Fachhandbuch für F18 - Psychiatrie und Psychotherapie (8. FS) Fachhandbuch für F18 - Psychiatrie und Psychotherapie (8. FS) Inhaltsverzeichnis 1. Übersicht über die Unterrichtsveranstaltungen... 2 1.1. Vorlesung... 2 1.2. Unterricht am... 4 2. Beschreibung der Unterrichtsveranstaltungen...

Mehr

Curriculum zur Weiterbildung im Schwerpunkt. Neuropädiatrie

Curriculum zur Weiterbildung im Schwerpunkt. Neuropädiatrie Anlage 2 Curriculum zur Weiterbildung im Schwerpunkt Neuropädiatrie Das nachfolgend ausgeführte Curriculum bietet die Vermittlung der wesentlichen Kenntnisse, Erfahrungen und Fertigkeiten, zur Erlangung

Mehr

Depressionserkrankungen

Depressionserkrankungen Depressionserkrankungen Spezialstation Privatklinik Schlössli Führend in Psychiatrie und Psychotherapie Depressionserkrankungen Bei uns suchen Menschen in unterschiedlichen Situationen Hilfe. Es gibt verschiedene

Mehr

Patientinnen-/ Patienten-Information für die Studie Neurofeedback-Behandlung bei akustischen Halluzinationen

Patientinnen-/ Patienten-Information für die Studie Neurofeedback-Behandlung bei akustischen Halluzinationen Universitäre Psychiatrische Dienste Bern (UPD) Universitätsklinik für Psychiatrie und Psychotherapie Prof. Dr. Thomas Koenig Bolligenstrasse 111, CH-3000 Bern 60 Tel. 031 930 91 69, Fax 031 930 99 58 email:

Mehr

Bisher veröffentlichte IGeL

Bisher veröffentlichte IGeL Bisher veröffentlichte IGeL Individuelle FAZIT Akupunktur zur weniger Migräneprophylaxe positiv weniger Nebenwirkungen im Vergleich zur und weniger Therapie- medikamentösen Abbrüche im Vergleich zur Akupunktur

Mehr

Demenzerkrankungen. Thomas Schulze. Psychiatrische Universitätsklinik der Charité im St. Hedwig-Krankenhaus

Demenzerkrankungen. Thomas Schulze. Psychiatrische Universitätsklinik der Charité im St. Hedwig-Krankenhaus Demenzerkrankungen Thomas Schulze Psychiatrische Universitätsklinik der Charité im St. Hedwig-Krankenhaus Ablauf 1. Definition der Demenz 2. Erscheinungsformen der Demenz 3. Häufigkeit von Demenzerkrankungen

Mehr

Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod

Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod. Aschenbrenner, Weisbrod ABTEILUNG PSYCHIATRIE UND PSYCHOTHERAPIE Überblick über die aktuellen Forschungsprojekte Thema Projektbeteiligte Projektstatus Externe Kooperationspartner ADHS bei Erwachsenen Daueraufmerksamkeit bei Erwachsenen

Mehr

Seroquel Prolong ermöglicht kontinuierliche Therapie über alle Phasen

Seroquel Prolong ermöglicht kontinuierliche Therapie über alle Phasen Monotherapie bipolar affektiver Störung Seroquel Prolong ermöglicht kontinuierliche Therapie über alle Phasen Bonn (8. März 2010) Mit der Zulassung von Seroquel Prolong (Quetiapin) zur Phasenprophylaxe

Mehr

Eine Analyse des Münchner Schlaganfallregisters: Diagnostik und Therapie bei Patienten mit Diabetes mellitus"

Eine Analyse des Münchner Schlaganfallregisters: Diagnostik und Therapie bei Patienten mit Diabetes mellitus Aus der Forschergruppe Diabetes e.v. am Helmholtz Zentrum München Vorstand: Professor Dr. med. Oliver Schnell Eine Analyse des Münchner Schlaganfallregisters: Diagnostik und Therapie bei Patienten mit

Mehr

Vertrauen zwischen Lehrern und Schülern

Vertrauen zwischen Lehrern und Schülern Barbara Thies Vertrauen zwischen Lehrern und Schülern Waxmann Münster / New York München / Berlin r Inhalt Einleitung 11 Theoretischer Teil 15 1. Theoretischer Bezugsrahmen 17 2. Das System Schule" 18

Mehr

Zur Problematik der Selbstauskunft über psychische Befindlichkeit in der medizinischen Rehabilitation

Zur Problematik der Selbstauskunft über psychische Befindlichkeit in der medizinischen Rehabilitation Zur Problematik der Selbstauskunft über psychische Befindlichkeit in der medizinischen Rehabilitation Dipl.-Psych. Nadine Schuster reha Kompetenzzentrum Bad Kreuznach/Bad Münster am Stein-Ebernburg 24.09.2009

Mehr

Inhalt. Vorwort 10. Lernbereich 1 Aufgaben und Konzepte in der Altenpflege 11

Inhalt. Vorwort 10. Lernbereich 1 Aufgaben und Konzepte in der Altenpflege 11 Vorwort 10 Lernbereich 1 Aufgaben und Konzepte in der Altenpflege 11 Lernfeld 1.1 Theoretische Grundlagen für die gerontopsychiatrische Pflege 11 1. Frage: Was verstehen Sie unter psychischer Gesundheit

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

Frust und Abbruch oder neue Chance für erwachsen werdende psychisch sch kranke Jugendliche?

Frust und Abbruch oder neue Chance für erwachsen werdende psychisch sch kranke Jugendliche? Universitätsklinikum RTWH Aachen Klinik für Kinder- und Jugendpsychiatrie und -psychotherapie (Klinikdirektorin: Prof. Dr. med. B. Herpertz-Dahlmann) Zuständigkeitswechsel von Kinder- und Jugendpsychiater

Mehr

Aktuelle Behandlung bei M. Parkinson: Update Früh - bis Spätphase. Prof. Dr. J. Kassubek Klinik für Neurologie, Universitätsklinikum Ulm

Aktuelle Behandlung bei M. Parkinson: Update Früh - bis Spätphase. Prof. Dr. J. Kassubek Klinik für Neurologie, Universitätsklinikum Ulm Aktuelle Behandlung bei M. Parkinson: Update Früh - bis Spätphase Prof. Dr. J. Kassubek Klinik für Neurologie, Universitätsklinikum Ulm Hawkes et al., Parkinsonism Rel Dis 2010 Morbus Parkinson: Therapie-Prinzipien

Mehr

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Ein Vortrag von Univ. Prof. Dr. Johannes Drach Medizinische Universität Wien Univ. Klinik für Innere Medizin I Klinische Abteilung

Mehr

Herausforderungen und Chancen aus Sicht des Kinder- und Jugendpsychiaters

Herausforderungen und Chancen aus Sicht des Kinder- und Jugendpsychiaters Herausforderungen und Chancen aus Sicht des Kinder- und Jugendpsychiaters Tobias Renner Abteilung für Psychiatrie und Psychotherapie im Kindes- und Jugendalter Universitätsklinik Tübingen Kompetenznetzwerk

Mehr

Aufmerksamkeits- Defizits- Hyperaktivitäts- Syndrom und Gehirnfunktion

Aufmerksamkeits- Defizits- Hyperaktivitäts- Syndrom und Gehirnfunktion Aufmerksamkeits- Defizits- Hyperaktivitäts- Syndrom und Gehirnfunktion Dr. med. Michael Matthis Allgemeinarzt Lübeck nach Professor Fred Travis Director, Center for Brain, Consciousness and Cognition Maharishi

Mehr

Leuphana Universität Lüneburg. Verordnungspraxis von Antidepressiva bei älteren und jüngeren Patienten Eine Routinedatenauswertung

Leuphana Universität Lüneburg. Verordnungspraxis von Antidepressiva bei älteren und jüngeren Patienten Eine Routinedatenauswertung Leuphana Universität Lüneburg Verordnungspraxis von Antidepressiva bei älteren und jüngeren Patienten Eine Routinedatenauswertung Einleitung Die Pharmakotherapie ist die am häufigsten genutzte Behandlungsstrategie

Mehr

Inhaltsverzeichnis. 1.1 Psychiatrische Klassifikation... 2 1.2 Häufigkeit... 4 1.3 Ätiologie... 5

Inhaltsverzeichnis. 1.1 Psychiatrische Klassifikation... 2 1.2 Häufigkeit... 4 1.3 Ätiologie... 5 VII Inhaltsverzeichnis ] Psychiatrische Syndrome und Krankheiten 1 Einführung... 2 1.1 Psychiatrische Klassifikation... 2 1.2 Häufigkeit... 4 1.3 Ätiologie... 5 2 Organische einschließlich symptomatischer

Mehr

Standardisierte Testverfahren

Standardisierte Testverfahren Standardisierte Testverfahren Minnesota Multiphasic Personality Inventory (MMPl) Fragebogen zur Persönlichkeitsdiagnostik bzw. zur Erfassung psychischer Auffälligkeiten. Aus den Antworten des Patienten

Mehr

Demenz Strategien für eine gemeinsame Versorgung

Demenz Strategien für eine gemeinsame Versorgung Demenz Strategien für eine gemeinsame Versorgung Demenz in der ambulanten Versorgung Gereon Nelles, Köln Demenz 1.3 Mo. 60% Alzheimer Demenz 733 000 Demenzkranke erhalten Leistungen (408,000 ambulant,

Mehr

Antidepressiva Risiko Suizidalität, Suizid

Antidepressiva Risiko Suizidalität, Suizid Antidepressiva Risiko Suizidalität, Suizid 62. Routinesitzung am 7. Mai 2008 1 Bisherige Änderungen FI, GI Paroxetin, SSRI/SNRI: Suizidalität, mangelnde Wirksamkeit Kinder + Jugendliche TCA: wie SSRI/SNRI

Mehr

B. Kröner Herwig 1, N. Nyenhuis 1, S. Zastrutzki 2, B. Jäger 2

B. Kröner Herwig 1, N. Nyenhuis 1, S. Zastrutzki 2, B. Jäger 2 Versorgungsnahe Forschung: Chronische Krankheiten und Patientenorientierung Transferworkshop 18.6. Berlin B. Kröner Herwig 1, N. Nyenhuis 1, S. Zastrutzki 2, B. Jäger 2 1 Georg August Universität Göttingen

Mehr

Psychosen bei Jugendlichen

Psychosen bei Jugendlichen Psychosen bei Jugendlichen Prof. Dr. Tobias Renner Abteilung für Psychiatrie und Psychotherapie im Kindes- und Jugendalter Universitätsklinik Tübingen Wintersemester 2016/2017 24.10.2017 Psychosen im Kindes-

Mehr

Inhalt. Vorwort Diagnostik peripherer Nervenerkrankungen. 1 Der Patient mit neuropathischen Beschwerden... 15

Inhalt. Vorwort Diagnostik peripherer Nervenerkrankungen. 1 Der Patient mit neuropathischen Beschwerden... 15 Inhalt Vorwort................................................ 11 A Diagnostik peripherer Nervenerkrankungen 1 Der Patient mit neuropathischen Beschwerden............. 15 2 Schlüsselinformationen aus Anamnese

Mehr

Psychiatrische Krankheitsbilder -Depression im Alter-

Psychiatrische Krankheitsbilder -Depression im Alter- Psychiatrische Krankheitsbilder -Depression im Alter- Andreas Altaner, Facharzt für Neurologie und Psychiatrie, Oberarzt der Fachklinik für Psychiatrie und Psychotherapie Zülpich, MARIENBORN ggmbh Affektive

Mehr

neuropsychiatrische Erkrankungen

neuropsychiatrische Erkrankungen Keine Tauschexemplare, da euch als elektronische Version vorhanden. Neuronale Plastizität in Tiermodellen für neuropsychiatrische Erkrankungen Von der Naturwissenschaftlichen Fakultät der Gottfried Wilhelm

Mehr

Einfluss von Immunsuppressiva auf die antivirale T-Zellantwort ex vivo

Einfluss von Immunsuppressiva auf die antivirale T-Zellantwort ex vivo Aus der Universitätsklinik für Kinder- und Jugendmedizin Tübingen Abteilung Kinderheilkunde I mit Poliklinik Ärztlicher Direktor: Professor Dr. R. Handgretinger Einfluss von Immunsuppressiva auf die antivirale

Mehr

Neuropsychologische Leistungen bei Manie und Depression

Neuropsychologische Leistungen bei Manie und Depression 11. DGBS Jahrestagung 29. September bis 1. Oktober 2011 in Mannheim Neuropsychologische Leistungen bei Manie und Depression Hans-Jörg Assion Klinik für Psychiatrie, Psychotherapie und Psychosomatik Detmold

Mehr

Universitätsklinikum Hamburg-Eppendorf

Universitätsklinikum Hamburg-Eppendorf Universitätsklinikum Hamburg-Eppendorf Aus der Klinik und Poliklinik für Neurologie Direktor: Prof. Dr. med C. Gerloff Untersuchung der interhemisphäriellen Inhibition zwischen beiden Hemisphären im Vergleich

Mehr

Psychologie als Wissenschaft

Psychologie als Wissenschaft Fakultat fur Psychologic Ursula Kastner-Koller, Pia Deimann (Hg. Psychologie als Wissenschaft 2., aktualisierte Auflage facultas.wuv Vorwort 11 1 Einfiihrung in die Psychologie 13 1.1 Einleitung 13 1.2

Mehr

Stress wirkt nicht bei jedem gleich: Die Gen-Umwelt-Interaktion

Stress wirkt nicht bei jedem gleich: Die Gen-Umwelt-Interaktion Stress wirkt nicht bei jedem gleich: Die Gen-Umwelt-Interaktion Influence of Life Stress on Depression: Moderation by a Polymorphism in the 5-HTT Gene (Caspi et al., 2003) Vulnerabilität, Risiko & Resilienz

Mehr

Inhaltsverzeichnis. 1 Einleitung Geschichtlicher Überblick Begriffsbestimmung... 5

Inhaltsverzeichnis. 1 Einleitung Geschichtlicher Überblick Begriffsbestimmung... 5 1 Einleitung................................................. 1 2 Geschichtlicher Überblick................................... 2 3 Begriffsbestimmung........................................ 5 4 Epidemiologie,

Mehr

Seelische Gesundheit im Langzeitverlauf - Die Mannheimer Kohortenstudie

Seelische Gesundheit im Langzeitverlauf - Die Mannheimer Kohortenstudie Seelische Gesundheit im Langzeitverlauf - Die Mannheimer Kohortenstudie Ein 25-Jahres-Follow-up Bearbeitet von Klaus Lieberz, Matthias Franz, Heinz Schepank 1. Auflage 2010. Buch. 251 S. Hardcover ISBN

Mehr

Sind wir noch normal? Psychische Störungen vor dem Hintergrund gesellschaftlicher Veränderungen.

Sind wir noch normal? Psychische Störungen vor dem Hintergrund gesellschaftlicher Veränderungen. Sind wir noch normal? Psychische Störungen vor dem Hintergrund gesellschaftlicher Veränderungen. Prof. Dr. Dr. Martin Holtmann Martin Holtmann LWL-Universitätsklinik Hamm der Ruhr-Universität Klinik für

Mehr

Dr. med. Erhard Deloch Facharzt für Neurologie Facharzt für Psychiatrie und Psychotherapie. Praxisinformation

Dr. med. Erhard Deloch Facharzt für Neurologie Facharzt für Psychiatrie und Psychotherapie. Praxisinformation Dr. med. Erhard Deloch Facharzt für Neurologie Facharzt für Psychiatrie und Psychotherapie Augustenstraße 1 80333 München Tel: 089-55 53 40 Fax: 089-59 29 69 Homepage: E-Mail: www.deloch.de praxis@deloch.de

Mehr

Coaching als Brücke. Wie Umgehen mit Grenzthemen im Coaching? Dipl.-Psych. / Senior Coach DBVC. Die Coachs mit dem Trüffelschwein-Prinzip

Coaching als Brücke. Wie Umgehen mit Grenzthemen im Coaching? Dipl.-Psych. / Senior Coach DBVC. Die Coachs mit dem Trüffelschwein-Prinzip Coaching als Brücke Wie Umgehen mit Grenzthemen im Coaching? 20.10.2012 Andreas Steinhübel Dipl.-Psych. / Senior Coach DBVC Die Coachs mit dem Trüffelschwein-Prinzip 2 Die meistgestellte Frage...! Wie

Mehr

In der folgenden Untersuchung von Renate Zimmer geht es um Motorik und Persönlichkeitsentwicklung bei Kindern im Vorschulalter.

In der folgenden Untersuchung von Renate Zimmer geht es um Motorik und Persönlichkeitsentwicklung bei Kindern im Vorschulalter. 2. KAPITEL INHALTSVERZEICHNISSE VON BÜCHERN Inhaltsverzeichnis, logische und inhaltliche Gliederung, Vorwort, Einleitung, Hauptteil, Zusammenfassung, Nachwort, Anhang, Anlagen, Sach- und Personenregister,

Mehr

Handlungsfähigkeit. in der Ergotherapie

Handlungsfähigkeit. in der Ergotherapie Marlys Blaser Csontos Handlungsfähigkeit in der Ergotherapie Mit 4 Abbildungen und 17 Tabellen U n ter M i ta r beit von Istvan Csontos und Theresa Witschi XI 1 2 2.1 2.2 2.2.1 2.2.2 2.2.3 2.3 Einleitung

Mehr

Psychosoziale Versorgungsleistungen für Menschen mit Seltenen Erkrankungen

Psychosoziale Versorgungsleistungen für Menschen mit Seltenen Erkrankungen Psychosoziale Versorgungsleistungen für Menschen mit Seltenen Erkrankungen Dr. Thomas Bär Versorgung von Patienten mit Seltenen Erkrankungen im Alltag Berlin, 31. Januar 2013 1 Forschungsbericht zu seltenen

Mehr