Modulation der Interferon-γ vermittelten Persistenz von Chlamydia pneumoniae durch Hypoxie

Größe: px
Ab Seite anzeigen:

Download "Modulation der Interferon-γ vermittelten Persistenz von Chlamydia pneumoniae durch Hypoxie"


1 Aus dem Institut für Medizinische Mikrobiologie und Hygiene der Universität zu Lübeck Direktor: Prof. Dr. med. Werner Solbach Modulation der Interferon-γ vermittelten Persistenz von Chlamydia pneumoniae durch Hypoxie Inauguraldissertation zur Erlangung der Doktorwürde der Universität zu Lübeck Aus der Sektion Naturwissenschaften vorgelegt von Inga Dietz aus Bremen Lübeck 2012


3 1. Berichterstatter: Prof. Dr. med. Jan Rupp 2. Berichterstatter: Prof. Dr. rer. nat. Norbert Tautz Tag der mündlichen Prüfung: Zum Druck genehmigt. Lübeck, den


5 Inhaltsverzeichnis 1 Inhaltsverzeichnis Abkürzungsverzeichnis Zusammenfassung Einleitung Grundlagen von Chlamydien Taxonomische Einteilung Biologie des Entwicklungszyklus Persistenz C. pneumoniae assoziierte Krankheitsbilder Wechselwirkung zwischen dem Immunsystem und C. pneumoniae Typ II Interferon vermittelte Jak-STAT Signalkaskade Indolamin 2,3-Dioxygenase Hypoxie Bedeutung von Sauerstoff in der Zelle Hypoxie-induzierbarer Faktor-1 (HIF-1) C. pneumoniae-infektionen unter Hypoxie Fragestellung Material Geräte Verbrauchsmaterialien Chemikalien und Reagenzien Puffer und Lösungen Zelllinien Medien und Medienzusätze Enzyme und Kits Oligonukleotide Primer für die cdna Synthese Primer für die quantitative RT-PCR sirna für RNA-Interferenz Analysen Antikörper Antikörper für Western Blot Analysen Antikörper für Immunfluoreszenzfärbungen Software Methoden Zellkultur Kultivierung von Zelllinien... 33

6 Inhaltsverzeichnis Bestimmung der Zellzahl Konservierung von Zelllinien Präparation von humanem Lungengewebe Infektionsbiologische Methoden Herstellung eines Infektionsstocks von C. pneumoniae Infektion von Zelllinien mit C. pneumoniae Infektion von humanem Lungengewebe Reaktivierung persistenter C. pneumoniae durch Tryptophan Reaktivierungs-Modell von C. pneumoniae durch Hypoxie Wiederanzucht Quantifizierung des Chlamydien-Gehalts Mikroskopie Direkter Immunfluoreszenztest von C. pneumoniae Indirekter Immunfluoreszenztest von C. pneumoniae Indirekte Immunfluoreszenzfärbung von α-smooth muscle actin Live Cell Imaging Proteinbiochemische Methoden Probengewinnung SDS-PAGE Western Blot Analyse Molekularbiologische Methoden RNA-Isolation Reverse Transkription Quantitative RT-PCR RNA-Interferenz Analysen Inhibition von TGF-β Transkriptom-Analysen Metabolom-Analysen Aufarbeitung von Metaboliten für das FT/ICR-MS Analyse der Metabolite Auswertung der relevanten Massen Statistik Ergebnisse Untersuchungen der IFN-γ induzierten Persistenz von C. pneumoniae unter Hypoxie Aufhebung der Persistenzbildung von C. pneumoniae durch Hypoxie Reaktivierung persistenter C. pneumoniae durch Hypoxie Analyse von IFN-γ induzierenden Signalwegen unter Hypoxie... 53

7 Inhaltsverzeichnis Beeinflussung der Jak-STAT Signalkaskade durch Hypoxie Beeinflussung der IDO Expression durch Hypoxie Beeinflussung weiterer IFN-γ regulierter Proteine durch Hypoxie Analyse von IL-6 unter Hypoxie Einfluss von C. pneumoniae auf Differenzierungs-prozesse von Epithelzellen Einfluss von C. pneumoniae auf E-Cadherin Einfluss von C. pneumoniae auf α-smooth muscle actin (α-sma) Migrationsanalyse von C. pneumoniae infizierten Zellen TGF-β unabhängige C. pneumoniae vermittelte Remodelingprozesse Beteiligung von HIF-1 an C. pneumoniae vermittelten Remodelingprozessen Etablierung von Transkriptom-Analysen Etablierung von Metabolom-Analysen Hauptkomponentenanalyse Unterschiede der Metabolite in infizierten Zellen unter Normoxie und Hypoxie Diskussion Hypoxie verhindert die Persistenzinduktion von C. pneumoniae Hypoxie reduziert die Aktivität der Jak-STAT Signalkaskade Entzündungsvorgänge in persistent infizierten Zellen C. pneumoniae vermittelt Umbauprozesse von Epithelzellen Weiterführende Analysen zu C. pneumoniae Infektionen unter Hypoxie Schlussbetrachtung Literaturverzeichnis Abbildungsverzeichnis Tabellenverzeichnis A Anhang A.1 Lebenslauf A.2 Publikationen A.3 Kongressbeiträge A.4 Danksagung

8 Abkürzungsverzeichnis 4 Abkürzungsverzeichnis Im Folgenden sind die in dieser Arbeit verwendeten Abkürzungen aufgelistet. Englische Abkürzungen wurden ins Deutsche übersetzt, wenn diese im deutschen Sprachgebrauch vorhanden sind. C Grad Celsius A. dest. Destilliertes Wasser ADP ALK APS ATCC ATP bhlh bp CAP cdna COPD CPAF Cpn CXCR DEPC DMSO DNA DSMZ DTT EDTA EK EMT ESI Adenosindiphosphat Activin receptor-like kinase Ammoniumpersulfat American Type Culture Collection Adenosintriphosphat Basic helix-loop-helix Basenpaare Community acquired pneumonia, ambulant erworbene Pneumonie Complementary DNA, komplementäre DNA Chronic obstructive pulmonary disease, chronisch obstruktive Lungenerkrankung Chlamydial protease-like activity factor Chlamydia pneumoniae C-X-C Chemokinrezeptor Diethylpyrocarbonat Dimethylsulfoxid Deoxyribonucleic acid, Desoxyribonukleinsäure Deutsche Sammlung von Mikroorganismen und Zellkulturen 1,4-Dithiothreitol Ethylendiamintetraessigsäure Elementarkörperchen Epithelial-mesenchymal transition Elektrospray Ionisation

9 Abkürzungsverzeichnis 5 et al. Fa. FEV1 FGFR2 FITC FKS FSP1 FT/ICR-MS GAS GLUT GOLD h HIF-1 hpi HRE HRP IDO IFN-γ IFNGR IFT IFU IL inos Und andere Firma Forciertes exspiratorisches Volumen in der ersten Sekunde Fibroblast-growth-factor receptor-2 Fluoresceinisothiocyanat Fötales Kälberserum Fibroblast-specific protein-1 Fourier transform ion cyclotron resonance mass spectrometer, Fouriertransformation-Ionenzyklotronresonanz-Massenspektrometer IFN-γ aktivierte Sequenz Glukosetransporter Global initiative for chronic obstructive lung disease Hour, Stunde Hypoxia-inducible factor-1, Hypoxie-induzierbarer-Faktor-1 Hours post infection Hypoxia responsive element Horseradish peroxidase, Meerrettichperoxidase Indolamin 2,3-Dioxygenase Interferon-gamma IFN-γ Rezeptor Immunfluoreszenztest Infection forming units Interleukin Inducible nitric oxide synthase, induzierbare Stickstoffmonoxid- Synthase IP-10 IFN-γ induzierbares Protein 10 IRF-1 ISRE Jak kbp Interferon regulierter Faktor-1 IFN-stimulated response element Januskinase Kilobasenpaare

10 Abkürzungsverzeichnis 6 kda KEGG LDHA LPS m/z mmhg mrna NEAA NF-κB NK-Zellen NO NTP PAMP PBS PCA PCR PDK PHD PIAS PKCδ PLS-DA ppb ppm PRR RK RNA rpm rrna RSV Kilodalton Kyoto Encyclopedia of Genes and Genomes Laktatdehydrogenase A Lipopolysaccharid Masse-zu-Lade-Verhältnis Millimeter-Quecksilbersäule Messenger RNA Non-essential amino acid, nicht-essentielle Aminosäuren Nuclear factor 'kappa-light-chain-enhancer' of activated B-cells Natürliche Killerzellen Stickstoffmonoxid Nukleotidtriphosphat Pathogen-associated molecular pattern, Pathogen-assoziierte molekulare Muster Phosphate buffered saline, Phosphatgepufferte Salzlösung Principal component analysis, Hauptkomponentenanalyse Polymerase chain reaction, Polymerase-Kettenreaktion Pyruvatdehydrogenase Kinase Prolyl-Hydroxylase Protein inhibitors of activated STATs Protein kinase C δ Partial least squares-diskriminanzanalyse Parts per million Parts per billion Pattern recognition receptors Retikularkörperchen Ribonucleic acid, Ribonukleinsäure Rounds per minute Ribosomale RNA Respiratorisches Synzytial-Virus

11 Abkürzungsverzeichnis 7 RT RT-PCR SDS-PAGE Ser Raumtemperatur Reverse-Transkriptase PCR Sodiumdodecylsulfat-Polyacrylamidgelelektrophorese Serin SH2 Src-homology 2 SHP SMA SMAD SOCS STAT SH2 containing phosphatase Smooth muscle actin Small mother against decapentaplegic Suppressor of cytokine signaling Signal transducers and activators of transcription STRA13 Stimulated with retinoic acid 13 TBS TEMED TGF-β Th TLR Tuf Tyr U VEGF VHL VIP Tris-gepufferte Saline N,N,N,N -Tetramethylethylendiamin Transforming growth factor β T-Helferzellen Toll-like Rezeptor Thermo unstable elongation factor Tyrosin Units Vascular endothelial growth factor Von Hippel-Lindau Protein Variable importance in the projection

12 Zusammenfassung 8 1 Zusammenfassung Chlamydia pneumoniae ist ein obligat intrazelluläres Bakterium, welches im Rahmen akuter und chronisch-persistierender Infektionen in der Lunge mit dem Krankheitsbild der COPD (chronisch obstruktive Lungenerkrankung) assoziiert wird. Direkte Wechselwirkungen zwischen dem Erreger und pulmonalen Wirtszellen wurden bislang hauptsächlich unter Normoxie (20% O 2 ) untersucht. Dabei treten in der Lunge bereits physiologisch geringere Sauerstoffkonzentrationen auf, die durch Entzündungsreaktionen oder bei reduzierter Ventilation von Lungenabschnitten weiter abfallen können. Es ist bekannt, dass C. pneumoniae von niedrigen Sauerstoffkonzentrationen (Hypoxie) profitiert, indem die Infektionsrate und das Wachstum gesteigert sind. In dieser Arbeit wurde zum ersten Mal das Verhalten der Interferon-gamma (IFN-γ) vermittelten Persistenz von C. pneumoniae in Lungenepithelzellen unter Hypoxie analysiert. Es zeigte sich, dass bei Sauerstoffkonzentrationen 3% die antibakterielle Wirkung von IFN-γ aufgehoben wurde. Die verhinderte Persistenzinduktion ging mit einer reduzierten Aktivität der Jak-STAT Signalkaskade und Expression von Indolamin 2,3-Dioxygenase (IDO) in der frühen Phase der Infektion einher. In Zellen mit persistierender C. pneumoniae- Infektion führte ein Abfall der Sauerstoffkonzentration zu einer Reaktivierung. Hauptmerkmale einer COPD sind chronisch-rezidivierende Entzündungsprozesse und fortschreitende Umbauvorgänge des Lungenepithels. Interessanterweise war ein Entzündungsprozess, gekennzeichnet durch Interleukin-6 (IL-6), stärker in persistent infizierten Zellen als in Zellen mit einer reaktivierten Infektion zu detektieren. Zudem konnten zelluläre Umbauvorgänge in C. pneumoniae infizierten Lungenepithelzellen nachgewiesen werden. Dabei wiesen persistent infizierte Zellen unter Normoxie sowie akut infizierte Zellen unter Hypoxie einen ausgeprägten Umbau auf. Demnach könnten Umbauprozesse, verursacht durch eine persistente oder reaktivierte C. pneumoniae-infektion, zur Pathogenese von chronischen Erkrankungen beitragen. Um weitere Einblicke auf Erreger- und Wirtsseite unter Hypoxie zu erlangen, wurden Transkriptom- und Metabolom-Analysen etabliert. Erste Analysen des Metaboloms zeigten, dass sich dieses während einer Infektion unter Normoxie und Hypoxie unterschied und Veränderungen z.b. im Kohlenhydrat-, Lipid- und Aminosäure-Metabolismus zu detektieren waren. Diese Methode könnte in Zukunft neue Ansatzpunkte für Therapien oder Biomarker liefern.

13 Einleitung 9 2 Einleitung 2.1 Grundlagen von Chlamydien Chlamydien sind gramnegative Bakterien, die auf Grund ihrer obligat intrazellulären Lebensform zuerst zu den Viren gezählt wurden. Schon 1907 entdeckten Ludwig Halberstädter und Stanislaus von Prowazek Einschlusskörper von Chlamydien in Konjunktivalabstrichen von Trachomen [42]. Im Jahre 1932 beschrieben Bedson et al. den für Chlamydien charakteristischen Entwicklungszyklus [11], aber erst 1966 wurden Chlamydien den Bakterien zugeordnet [80]. Eine Vielzahl von Lebewesen wird von Chlamydien infiziert. So infiziert z.b. Chlamydia psittaci in erster Linie Vögel, kann jedoch von diesen, bei engem Kontakt, auf den Menschen übergehen und zur Ornithose führen [12]. Ein wichtiger Vertreter der humanpathogenen Chlamydien ist Chlamydia trachomatis, dessen verschiedene Serovar Infektionen des Auges sowie sexuell übertragbare Infektionen des Urogenitaltrakts verursachen [99]. Der Fokus dieser Arbeit liegt bei dem dritten Vertreter der humanpathogenen Chlamydien, Chlamydia pneumoniae. Dieser wurde 1965 von der Bindehaut eines Kindes aus Taiwan isoliert und seit 1971 als TW-183 bezeichnet [61]. Nach Isolation eines respiratorischen Isolats (AR-39) von einem Studenten mit Pharyngitis in Seattle 1983 wurde es als humanpathogen eingestuft. Zuerst wurde der Erreger, entsprechend der beiden Erstisolate, als TWAR bezeichnet und erst 1989 wurde TWAR als dritte Spezies C. pneumoniae taxonomisch eingeordnet [61] Taxonomische Einteilung Chlamydien werden auf Grund ihres charakteristischen, biphasischen Entwicklungszyklus und basierend auf rrna Analysen in eine eigene Ordnung (Chlamydiales) eingruppiert. Die Ordnung der Chlamydiales beinhaltet die Familien der Chlamydiaceae, Parachlamydiaceae, Waddliaceae und Simkaniaceae (Abbildung 2.1), wobei nur die Familie der Chlamydiaceae human- und tierpathogene Organismen beinhaltet [6;15;30;84]. Bis 1999 bestand die Familie der Chlamydiaceae nur aus der Gattung Chlamydia, die jedoch auf Grund von 18S und 23S rrna Analysen in die Gattungen Chlamydophila und Chlamydia unterteilt wurde [30]. Diese Einteilung wurde jedoch von vielen Wissenschaftlern abgelehnt,

14 Einleitung 10 da sie die biologische Bedeutung dieser Organismen nicht berücksichtigt. So wurde vorgeschlagen ausschließlich die Gattung Chlamydia zu verwenden [100;106]. In dieser Arbeit wurde einzig die alte Taxonomie für Chlamydia pneumoniae verwendet. Abbildung 2.1: Taxonomie der Ordnung Chlamydiales. Schematische Darstellung der Verwandtschaftsverhältnisse der Taxonomie von 1999 mit Angabe der typischen Wirte. Die Länge der Linien stellt nicht die tatsächlichen phylogenetischen Abstände dar. Abbildung modifiziert nach [15].

15 Einleitung Biologie des Entwicklungszyklus Chlamydien sind als obligat intrazelluläre Bakterien auf eine intakte Wirtszelle für ihre Replikation angewiesen. Ihr charakteristischer, biphasischer Entwicklungszyklus ist in Abbildung 2.2 dargestellt. Der Zyklus beginnt mit einem Elementarkörperchen (EK), welches mit einer Größe von ca. 0,3 µm die infektiöse, metabolisch wenig aktive Lebensform darstellt [120]. Bei der Infektion adhäriert ein EK an die Wirtszelle und wird über Rezeptor-vermittelte Endozytose aufgenommen. Dabei bilden die Chlamydien ein eigenes zelluläres Kompartiment, die sogenannte Inklusion (Einschlusskörper). Bereits 8 h nach der Aufnahme in die Zelle erfolgt die Dekondensation der DNA der EK, welche sich vergrößern und zu Retikularkörperchen (RK) umwandeln. Das RK hat eine Größe von ca. 1 µm und ist die intrazelluläre, metabolisch aktive Form der Chlamydien. Die Replikation der RK erfolgt 12 und 24 hpi (hours post infection) mittels binärer Teilung [38]. Durch ihre an die Wirtszelle angepasste Lebensweise, weist C. pneumoniae ein mit 1,2 Mio. Basenpaaren reduziertes Genom auf [57]. Zwar konnten im chlamydialen Genom Gene des Energiestoffwechsels (u.a. Glykolyse, Zitratzyklus, Atmungskette) nachgewiesen werden [51;57], jedoch sind die Stoffwechselwege häufig unvollständig kodiert. Daher müssen Zwischenprodukte vom Wirt bezogen werden [76]. So weisen Chlamydien z.b. einen Adenosintriphosphat/Adenosindiphosphat (ATP/ADP) Transporter auf, mit dem sie ATP im Austausch gegen ADP von der Wirtszelle aufnehmen können [45]. Zwischen 48 und 72 hpi findet die Redifferenzierung der RK zurück zu den EK statt [38]. Durch Lyse der Wirtszelle oder Abschnürung (Extrusion) des Einschlusskörpers aus der Zelle werden die EK schließlich freigesetzt und können neue Wirtszellen infizieren [50]. Ein vollständiger Entwicklungszyklus ist nach 72 h abgeschlossen [38]. Des Weiteren gibt es eine Erscheinungsform, die als Persistenz bezeichnet wird (Abschnitt 2.1.3). Durch extrazelluläre Stimuli verbleiben Chlamydien mit atypischer Morphologie in diesem Zustand. Wird der Stimulus der zur Persistenz führte wieder entzogen, gelangen die Chlamydien zurück in ihren aktiven Entwicklungszyklus [10].

16 Einleitung 12 Abbildung 2.2: Schematische Darstellung des Entwicklungszyklus von C. pneumoniae. Ein Elementarkörperchen (EK) infiziert die Wirtszelle und differenziert sich innerhalb der Inklusion zu einem Retikularkörperchen (RK). Nach einigen Teilungen redifferenzieren die RK zurück zu den EK und werden durch Extrusion oder Lyse der Zelle freigesetzt. Durch exogene und zelluläre Faktoren können die Chlamydien für lange Zeit im Stadium der Persistenz verharren (rote Pfeile), können aber auch wieder in den aktiven Entwicklungszyklus eintreten Persistenz Die Persistenz von Chlamydien ist charakterisiert durch kleinere Einschlusskörper, in denen vergrößerte, atypische RK mit einem veränderten Metabolismus zu finden sind. In diesem Zustand sind sie lebensfähig, weisen jedoch kein Wachstum auf [10]. In vitro kann die Persistenz durch verschiedene Faktoren hervorgerufen werden. Dabei sind Nährstoffmangel (z.b. von Aminosäuren, Glukose), Antibiotika Behandlung z.b. mit Penicillin sowie Eisenentzug beschrieben [19;43;74;93]. Zudem kann die Persistenz über Interferon-gamma (IFN-γ) induziert werden [108]. IFN-γ führt in der Wirtszelle über die Induktion von Indolamin 2,3-Dioxygenase (IDO) zu

17 Einleitung 13 einem Tryptophanabbau (Abschnitt 2.2.2). Da für Chlamydien diese Aminosäure essentiell ist, wird das chlamydiale Wachstum gehindert und sie gelangen in das Stadium der Persistenz [86]. Die Wirkung von IFN-γ ist dabei konzentrationsabhängig. Eine hohe Konzentration führt zum Absterben des Bakteriums, während bei einer niedrigen Konzentration die Persistenz von Chlamydien induziert wird [9]. Die Aufhebung der Persistenz und damit die Reaktivierung von Chlamydien erfolgt in vitro meist durch Wegfall des Persistenz-stimulierenden Faktors (z.b. Entzug von IFN-γ oder Zugabe von Tryptophan). Man nimmt an, dass persistierende Chlamydien-Infektionen über Tage bis Wochen andauern und für chronische Krankheiten verantwortlich sein können (Abschnitt 2.1.4) C. pneumoniae assoziierte Krankheitsbilder Persistente C. pneumoniae-infektionen sind mit verschiedensten chronischen Erkrankungen, wie der Arteriosklerose, Asthma und der chronisch obstruktiven Lungenerkrankung (COPD) (Abschnitt ) assoziiert [41;85;112;116]. Die primären Zielzellen von C. pneumoniae sind Epithelzellen des Respirationstrakts, wodurch akute respiratorische Krankheiten der oberen und unteren Atemwege wie Pharyngitis, Sinusitis und Bronchitis hervorgerufen werden [88]. Auch ca. 10% der ambulant erworbenen Pneumonien (CAP) gehen auf eine C. pneumoniae-infektion zurück [36]. Die meisten Primärinfektionen verlaufen jedoch asymptomatisch. Da die serologische Prävalenz für C. pneumoniae schon im Kindes- und Jugendalter hoch ist (50%) und in den höheren Altersgruppen weiter ansteigt (75%) [61] kann die Rolle einer C. pneumoniae-infektion an chronischen Erkrankungen schwer eingeschätzt werden. Zudem fehlt bisher ein diagnostischer Standard, um zuverlässig akute von persistierenden Infektionen unterscheiden zu können. In Studien zeigte sich eine erhöhte Seroprävalenz für eine C. pneumoniae-infektion bei COPD-Patienten [113]. Daneben konnten Infektionen mit C. pneumoniae in 15% der COPD-Patienten direkt mittels PCR (Polymerase-Kettenreaktion) nachgewiesen werden [27].

18 Einleitung Chronisch obstruktive Lungenerkrankung (COPD) COPD ist weltweit die vierthäufigste Todesursache [73]. Die Symptome einer COPD sind Auswurf, Husten und Atemnot. Die Diagnose und Einstufung erfolgt nach der GOLD Klassifikation (global initiative for chronic obstructive lung disease) und wird anhand der Abnahme des forcierten exspiratorischen Volumens in der ersten Sekunde (FEV 1 ) beurteilt. Es werden dabei 4 Schweregrade von mild bis sehr schwer unterschieden [91]. Wichtige Risikofaktoren für die Entstehung einer COPD sind Tabakkonsum sowie genetische Disposition, Stäube, Chemikalien und toxische Dämpfe [91]. Die COPD ist eine chronisch entzündliche Erkrankung der Lunge mit langsam fortschreitender Atemwegsobstruktion. Persistierende Entzündungs- und Umbauprozesse führen zur Entwicklung von chronischer Bronchitis und Lungenemphysem, als Manifestation späterer Stadien der COPD. Zu den Umbauprozessen einer COPD gehören fibrotische Veränderungen der Atemwegswand, Metaplasien des Epitheliums und strukturelle Änderungen der kleinen Atemwege [55]. Die Gesamtheit dieser Umbauprozesse wird auch als Remodeling bezeichnet. Während der Embryonalentwicklung ist solch ein Prozess grundlegend und wird epithelial-mesenchymal transition (EMT) genannt [55]. Remodeling bei Epithelzellen kann charakterisiert werden durch eine Abnahme von Zell-Zell-Kontakten, was den Verlust eines organisierten Zelllayers zur Folge hat (Abbildung 2.3). Dadurch bekommen sie den Charakter von mesenchymalen Zellen, welche sich durch eine spindelförmige Morphologie auszeichnen. Zudem weisen mesenchymale Zellen eine höhere Beweglichkeit als Epithelzellen auf [110].

19 Einleitung 15 Abbildung 2.3: Remodeling (epithelial-mesenchymal transition, EMT) von Epithelzellen. Durch Wachstumsfaktoren oder Zytokine verlieren Epithelzellen die für sie typischen Marker und zeigen Charakteristika von mesenchymalen Zellen. FGFR2: fibroblast-growth-factor receptor-2; FSP1: fibroblast-specific protein-1. Abbildung modifiziert nach [110]. Charakteristisch für eine COPD sind wiederkehrende Zyklen von akuten Exazerbationen. Dafür ursächlich sind vor allem exogene Noxe wie virale und bakterielle Infektionen, die zu einer Reaktivierung der Entzündung führen. Am häufigsten werden bakterielle Infektionen mit Haemophilus influenzae, Moraxella catarrhalis, Streptococcus pneumoniae oder Pseudomonas aeruginosa beobachtet [117]. Daneben wurden auch C. pneumoniae-infektionen in 34% der Patienten mit akuten Exazerbationen nachgewiesen [58]. Die bei Exazerbationen vorherrschende Entzündungsreaktion ist durch eine Vermehrung von Neutrophilen und CD8 + T-Lymphozyten in der Lunge gekennzeichnet [55]. Das Zytokin-Profil von COPD Patienten entspricht dabei hauptsächlich einer Th1-vermittelten Immunantwort (T-Helferzellen Typ 1), mit IFN-γ als vorherrschendes Zytokin [70]. 2.2 Wechselwirkung zwischen dem Immunsystem und C. pneumoniae Eine Th1-vermittelte Immunantwort spielt eine entscheidende Rolle bei der Kontrolle einer C. pneumoniae-infektion [92]. Die Ausbildung einer Th1-Antwort kann über die proinflammatorischen Zytokine Interleukin-12 (IL-12), welches von Makrophagen und IL-18, welches von Epithelzellen nach Kontakt mit C. pneumoniae sekretiert wird, erfolgen [20;67]. Die frühe Sekretion von IFN-γ durch natürliche Killerzellen (NK-Zellen) ist dabei ebenfalls von Bedeutung [111]. Die Aktivierung des angeborenen Immunsystems erfolgt über spezielle pattern

20 Einleitung 16 recognition receptors (PRR), die hoch-konservierte Strukturen von C. pneumoniae, welche als pathogen-associated molecular patterns (PAMP) bezeichnet werden, erkennt. Der Toll-like Rezeptor-4 (TLR-4) ist ein PRR und erkennt z.b. chlamydiales Lipopolysaccharid (LPS) [20]. In Rauchern mit COPD ist gerade die Expression von TLR-4 reduziert, wodurch die Th1-vermittelte Immunantwort nach Infektion von Gram-negativen Bakterien beeinträchtigt ist [60]. Droemann et al. konnten eine erhöhte Entzündung während einer akuten C. pneumoniae Infektion, nicht in Lungengewebe von COPD Patienten mit vermutlich persistierender Infektion nachweisen. Daher wird vermutet, dass Zyklen von Persistenz und Reaktivierungen in die aktive Form nötig sind, um zur Pathogenese beizutragen [27]. Mediatoren, die zu einer Reaktivierung in vivo führen, sind jedoch bisher unbekannt. Das vorherrschende Zytokin während einer Th1-vermittelten Immunantwort ist IFN-γ, welches durch CD4 + /CD8 + T-Helferzellen und NK-Zellen ausgeschüttet wird [95] Typ II Interferon vermittelte Jak-STAT Signalkaskade IFN-γ ist der einzige Vertreter der Typ II Interferone, welche die Jak-STAT Signalkaskade aktivieren (Abbildung 2.4). Auch Typ I und Typ III Interferone aktivieren diese Signalkaskade [109]. Die Signaltransduktion erfolgt jedoch über andere Rezeptoren und wird in dieser Arbeit nicht weiter behandelt. IFN-γ bindet an den inaktiven IFN-γ Rezeptor-Komplex (IFNGR), der aus den Untereinheiten IFNGR1 und IFNGR2 besteht. Diese Untereinheiten sind mit der Januskinase 1 (Jak1) und Jak2 konstitutiv assoziiert [109]. Die Bindung von IFN-γ führt zu Konformationsänderungen des IFNGR. Dadurch rücken Jak1 und Jak2 in enge Beziehung und phosphorylieren spezifische Tyrosinreste des Rezeptors. Die Tyrosin- Phosphorylierung der Jaks werden von dem signal transducer and activator of transcription 1 (STAT1) über seine Src-homology 2-Domäne (SH2-Domäne) gebunden, wodurch STAT1 am Tyrosin 701 durch eine Jak-abhängige Reaktion phosphoryliert wird. Phosphoryliertes STAT1 dissoziiert vom Rezeptorkomplex und bildet, durch reziproke Bindung der SH-2 Domäne mit der Tyrosin- Phosphorylierung, ein Dimer [101]. Das Homodimer transloziert in den Nukleus und bindet dort an eine spezifische DNA-Erkennungssequenz, die IFN-γ aktivierte Sequenz (GAS) und initiiert damit die Expression der entsprechenden Gene [22]. Eine Phosphorylierung am Serin 727 von STAT1 trägt zu einer vollständigen

21 Einleitung 17 Transkriptionsaktivität des Transkriptionsfaktors bei [118]. Um eine unkontrollierte Aktivität der Jak-STAT Signalkaskade zu verhindern, wird diese über SHP (SH2 containing phosphatase), PIAS (protein inhibitors of activated STATs) und SOCS (suppressor of cytokine signaling) kontrolliert. SHP und PIAS sind konstitutiv exprimierte Proteine, wohingegen SOCS-Proteine erst über die Jak-STAT Signalkaskade aktiviert werden [123]. Daneben wird auch die Expression von IDO über die Jak-STAT Signalkaskade induziert, die einen Einfluss auf das Wachstum von C. pneumoniae hat (Abschnitt 2.2.2). Abbildung 2.4: Vereinfachte Darstellung der Jak-STAT Signalkaskade. Durch Bindung von IFN-γ an den IFN-γ Rezeptorkomplex (IFNGR) vermitteln die am Rezeptor assoziierten Jaks (Januskinasen) eine Tyrosin-Phosphorylierung des Rezeptors. STATs (Signal transducer and activator of transcription) erkennen die Phosphorylierung, binden IFNGR, woraufhin STAT phosphoryliert wird. STATs dissoziieren vom Rezeptor, bilden Homodimere und translozieren in den Nukleus, wo sie an GAS-Elemente (IFN-γ activated sequences) binden und die Transkription IFN-γ-abhängiger Gene initiieren. IDO: Indolamin 2,3-Dioxygenase, IRF-1: IFN regulierter Faktor-1. Abbildung modifiziert nach [101] Indolamin 2,3-Dioxygenase IDO ist ein ca. 45 kda großes Protein und wird von einem ca. 15 kbp großen Gen mit 10 Exons kodiert [59]. In der Promotorregion des Gens befindet sich ein GAS-Element, wodurch die Expression durch IFN-γ über die Jak-STAT Signalkaskade aktiviert wird [18]. Daneben befinden sich noch weitere Sequenzen wie ein Homolog des IFN-stimulated response element (ISRE) in der Promotorregion. ISRE-Sequenzen können zu einem geringen Maße direkt über die IFN-γ induzierte Jak-STAT Signalkaskade aktiviert werden oder sekundär über den

22 Einleitung 18 Interferon regulierten Faktor-1 (IRF-1), welcher seinerseits ebenfalls über die IFN-γ induzierte Jak-STAT Signalkaskade aktiviert wird [109]. Auch Typ I Interferone induzieren Gene mit einer ISRE-Sequenz, wohingegen GAS-Elemente nur selten aktiviert werden. Deshalb wird IDO nur schwach durch Typ I Interferone induziert, da beide Sequenzen (GAS, ISRE) zur vollständigen Induktion der Expression benötigt werden [18;59]. Nach der Translation liegt IDO als Apoenzym vor und benötigt für seine Aktivität Häm als prosthetische Gruppe. Für die weitere Aktivierung wird die Reduktion von Eisen (III) zu Eisen (II) benötigt, damit Tryptophan und Sauerstoff das aktive Zentrum erreichen können. Dieses aktive Holoenzym ist das erste und geschwindigkeitsbestimmende Enzym des Kynurenin-Stoffwechselwegs. Dabei wird Tryptophan durch Spaltung des Indolrings zu N-Formylkynurenin oxidiert, aus welchem im weiteren Verlauf L-Kynurenin entsteht [59]. IDO ist nicht gewebsspezifisch und akzeptiert neben L-Tryptophan auch andere Indolamine [59]. IDO wirkt antimikrobiell gegen Tryptophan auxotrophe Pathogene, wie z.b. Toxoplasma gondii, Streptococcus agalactiae, Enterococcus faecalis und Staphylococcus aureus, da ihnen Tryptophan für viele metabolische Prozesse nicht mehr zur Verfügung steht [68;69;90;102]. Auch das Wachstum von Chlamydien wird durch die Aktivität von IDO beeinflusst. Dabei ist der Tryptophanabbau ein zentraler Mechanismus der Persistenzinduktion von Chlamydien durch IFN-γ [78]. Bisherige Untersuchungen zur Jak-STAT Signalkaskade und IDO-Aktivität sowie dessen antichlamydialer Wirkung beschränkten sich bislang auf Untersuchungen unter atmosphärischen Sauerstoffbedingungen. Analysen zu deren Funktionen und den Einfluss auf C. pneumoniae unter physiologischen (5-20% O 2 ) oder pathophysiologischen Sauerstoffverhältnissen (<5% O 2 ) wurden bisher nicht durchgeführt.

23 Einleitung Hypoxie Bedeutung von Sauerstoff in der Zelle Der Sauerstoffpartialdruck im Gewebe ist niedriger als der in der atmosphärischen Luft (Normoxie) und variiert von mmhg (0,5-14%) (Tabelle 2.1). Eine zusätzliche Reduzierung der Sauerstoffkonzentration kann z.b. durch gestörte Gefäßnetze, eine verminderte Blutversorgung oder eine unzureichende Neovaskularisierung auftreten. Diese kommen vor allem in Tumoren, ischämischen Geweben, Wunden oder bei Entzündungsprozessen vor [14]. Bei diesen pathophysiologischen Sauerstoffkonzentrationen übersteigt der Sauerstoffbedarf der Zelle das Sauerstoffangebot [82]. In Zellkulturexperimenten werden im Allgemeinen Sauerstoffkonzentrationen von 0,5-3% mit dem Begriff Hypoxie beschrieben [82]. Tabelle 2.1: Extrazelluläre Sauerstoffkonzentrationen in verschiedenen Geweben. Modifiziert nach [17;24;56]. Gewebe O 2 [mmhg] O 2 [%] Luft ,1 Brutschrank Luft der Alveolen ,5 Arterielles Blut ,2 Bindehaut 58 7,7 Lunge 42,8 5,6 Venöses Blut 40 5,3 Herzmuskel 34 4,5 Gebärmutterhals ,7-6,3 Vagina 3,8 0,5 Sauerstoff wird von aeroben Organismen zur Energiegewinnung benötigt. Um das Überleben bei niedrigen Sauerstoffkonzentrationen zu sichern, haben Zellen Regulationsmechanismen, die Einfluss auf die Homöostase nehmen, entwickelt. Der wichtigste Regulator ist dabei der Hypoxie-induzierbare Faktor-1 (HIF-1).

24 Einleitung Hypoxie-induzierbarer Faktor-1 (HIF-1) Der Transkriptionsfaktor HIF-1 reguliert, wenn geringe Sauerstoffverhältnisse vorliegen, eine Vielzahl von zellulären Prozessen von eukaryotischen Zellen (Abbildung 2.5). HIF-1 besteht aus einer α- und β-untereinheit, die konstitutiv exprimiert werden. Während HIF-1β stabil im Zellkern vorliegt, unterliegt HIF-1α unter Normoxie einem ständigen Abbau. Dabei wird HIF-1α durch eisen- und sauerstoffabhängige Prolyl-Hydroxylasen (PHD) im Zytoplasma der Zelle hydroxyliert. Über die Hydroxylierung interagiert das von Hippel-Lindau (VHL) Protein mit HIF-1α, welches durch eine Polyubiquitinierung HIF-1α für die Degradation durch das Proteasom markiert. Durch Substratmangel (O 2 ) unter Hypoxie wird die Prolyl-Hydroxylierung verhindert und HIF-1α transloziert in den Nukleus, wo es mit HIF-1β dimerisiert. Dieses Heterodimer bindet an das hypoxia responsive element (HRE) in den Promoterregionen von HIF-1 regulierten Genen [82]. Eine Vielzahl von Prozessen, wie z.b. die Glykolyse, Angiogenese und das Zellüberleben werden von HIF-1 reguliert [103]. Eine HIF-1α Stabilisierung innerhalb der Zelle erfolgt jedoch nicht nur aufgrund von geringen Sauerstoffkonzentration, sondern kann auch durch eine Reihe anderer Einflussfaktoren (z.b. Eisenentzug, LPS) unter Normoxie erreicht werden [34;44]. So ist außerdem bekannt, dass bakterielle Infektionen wozu auch Infektionen mit C. pneumoniae gehören, HIF-1α stabilisieren [97;119].

25 Einleitung 21 Abbildung 2.5: Vereinfachte Darstellung der HIF-1α Stabilisierung durch Hypoxie. (A) In der Anwesenheit von Sauerstoff wird HIF-1α durch sauerstoffabhängige Prolyl-Hydroxylasen (PHD) hydroxyliert. Dies führt zur Rekrutierung des von Hippel-Lindau Proteins (VHL), welches HIF-1α durch Polyubiquitynierung zur Degradation durch das Proteasom markiert. (B) Unter hypoxischen Bedingungen sind die PHD inaktiv und HIF-1α gelangt in den Nukleus, wo es mit HIF-1β einen Komplex bildet. Durch Bindung an HRE-Sequenzen (hypoxia responsive element) in Promotorregionen von HIF-1 regulierten Genen werden diese transkribiert. GLUT: Glukosetransporter, LDHA: Laktatdehydrogenase A, PDK: Pyruvatdehydrogenase Kinase, VEGF: vascular endothelial growth factor C. pneumoniae-infektionen unter Hypoxie Die Interaktion von C. pneumoniae mit HIF-1α unterscheidet sich zwischen der frühen und späten Phase des Entwicklungszyklus. In der frühen Phase einer C. pneumoniae-infektion wird HIF-1α unter Normoxie und Hypoxie stabilisiert. Ohne eine HIF-1α Stabilisierung unter Hypoxie wäre eine hohe Infektionsrate nicht möglich [97]. Neben einer erhöhten Infektionsrate weist C. pneumoniae unter Hypoxie zudem größere Einschlusskörper und ein schnelleres Wachstum auf, woraus eine höhere Wiederanzuchtsrate resultiert [56]. Eine Stabilisierung von HIF-1α wird

26 Einleitung 22 in der späten Phase der Infektion hingegen verhindert. Dabei wird HIF-1α durch die chlamydiale Protease CPAF (chlamydial protease-like activity factor) degradiert. Dies kommt dem Entwicklungszyklus von C. pneumoniae zugute, da Hypoxie über die Aktivierung von HIF-1 den programmierten Zelltod initiieren kann. Durch einen Abbau von HIF-1α in der späten Phase der Infektion unter Hypoxie unterbindet C. pneumoniae somit aktiv die Apoptose, um den Entwicklungszyklus abzuschließen [97]. Weitere Untersuchungen, wie z.b. zur IFN-γ induzierten Persistenz von C. pneumoniae unter Hypoxie, wurden bislang nicht durchgeführt. 2.4 Fragestellung In dieser Arbeit sollten direkte Interaktionen zwischen C. pneumoniae und Lungenepithelzellen in der Entstehung der COPD analysiert werden. Hauptmerkmale einer COPD sind chronisch-rezidivierende Entzündungsprozesse und fortschreitende Umbauvorgänge des Lungenepithels. Zu berücksichtigen ist dabei, dass bei chronischen Entzündungsprozessen ein verminderter Sauerstoffgehalt im Gewebe vorliegt, was das Wachstum von C. pneumoniae begünstigt. Untersuchungen zur Persistenz von C. pneumoniae unter verschiedenen Sauerstoffkonzentrationen wurden bislang nicht durchgeführt. Daher waren folgende Ziele Grundlage dieser Arbeit: Der Einfluss von Hypoxie auf die IFN-γ induzierte Persistenz von C. pneumoniae sollte morphologisch charakterisiert sowie Änderungen in der für die Persistenz relevanten Jak-STAT Signalkaskade näher analysiert werden. Ein Langzeit-Modell der Persistenz von C. pneumoniae sollte entwickelt werden und bezüglich des Wachstumsverhaltens von C. pneumoniae unter Hypoxie analysiert werden. Weiterhin sollte dieses Modell der Untersuchung von chronischen Entzündungsprozessen dienen. Es sollte untersucht werden, ob zelluläre Umbauprozesse durch eine C. pneumoniae-infektion von Lungenepithel ausgelöst werden und ob die Sauerstoffumgebung einen Einfluss auf diese ausübt. Um ein umfassenderes Verständnis über eine C. pneumoniae-infektion bei niedrigen Sauerstoffverhältnissen zu bekommen, sollten Metabolom- und Transkriptom Analysen etabliert werden.

27 Material 23 3 Material 3.1 Geräte Blotapparatur Mini Trans-Blot Cell Bio-Rad Laboratories GmbH, München Brutschränke (37 C, 5% CO 2 ) Forma Series II 3131 Typ: BB 6220 Thermo Fisher Scientific, Waltham, MS, USA Heraeus Instruments GmbH, Hanau Brutschränke (37 C, 5% CO 2, N 2 - Regulation, O 2 -Sensor) Forma Series II 3141 Hypoxiekammer THC Elektrophoresekammer Mini-Protean Tetra Gewebehomogenisator Precellys 24 Heizblock PCH-2 Imagingsystem Fusion FX7 Kamera AxioCam HRc LightCycler 1.0 Magnetrührer, RMO Thermo Fisher Scientific, Waltham, MS, USA Toepffer Lab Systems, Göppingen Bio-Rad Laboratories GmbH, München Bertin Technologies, Villeurbanne, Frankreich Grants-Instruments Ltd, Shepreth, Großbritannien Vilber Lourmat GmbH, Eberhardzell Carl Zeiss MikroImaging, Göttingen Roche Diagnostics GmbH, Mannheim Gerhardt GmbH, Königswinter Mikroskope Axioskop 2, 25, 40 Axiovert 25 BZ-9000 NanoDrop 2000 ph-meter MP220 Pippetierhilfe accu-jet PowerPac 3000 Carl Zeiss MikroImaging, Göttingen Carl Zeiss MikroImaging, Göttingen Keyence, Osaka, Japan Thermo Fisher Scientific, Waltham, MS, USA Mettler Toledo, Gießen Brand GmbH, Wertheim Bio-Rad Laboratories GmbH, München

28 Material 24 Präzisionswaage KB Kern & Sohn GmbH, Balingen-Frommen Sicherheitswerkbänke EN SterilGard Hood Class II A/B3 Taumelschüttler Polymax 1040 Thermocycler C1000 Ultraschallbad Transsonic 460/H Vortex-Schüttler REAX 2000 Clean Air Techniek B.V., Woerden, Niederlande Baker Company, Sanford, ME, USA Heidolph Instruments GmbH, Schwalbach Bio-Rad Laboratories GmbH, München Elma GmbH & Co KG, Singen Heidolph Instruments GmbH, Schwalbach Zentrifugen Centrifuge 5417R Megafuge 2.0 R Multifuge 3 S-R Rotina 38R Optima L-90K Eppendorf AG, Hamburg Heraeus Instruments GmbH, Hanau Heraeus Instruments GmbH, Hanau Hettich Zentrifugen, Tuttlingen Beckmann Coulter, Brea, CA, USA 3.2 Verbrauchsmaterialien 6-, 24-Lochplatte Greiner Bio-One GmbH, Frickenhausen Blotpapier Deckgläser, Ø10 mm Gelkämme: Mini Protean 3 (1,0 mm) Glasplatten: Mini Protean 3 (1,0 mm) Glasschrot Kryoröhrchen Nalgene Cryoware LightCycler Kapillaren (20 µl) Neubauer-Zählkammer Nitrocellulosemembran Protran Schleicher & Schuell, Dassel Menzel-Gläser, Braunschweig Bio-Rad Laboratories GmbH, München Bio-Rad Laboratories GmbH, München Karl Hecht GmbH & Co KG, Sondheim Nunc Brand Products, Rochester, NY, USA Roche Diagnostics GmbH, Mannheim Hassa Laborbedarf, Lübeck Whatman Inc, Florham Park, NJ, USA

29 Material 25 Objektträger (76 x 26 mm) Pipetten Eppendorf Reference 10, 100, 1000 µl Pipettenspitzen Biosphere filter tips 10, 100, 1000 µl Pipettenspitzen, Prot/Elec tips µl Precellys-Keramik-Kit 1,4/2,8 mm Reaktionsgefäße (0,5/ 1,5 ml) Röhrchen (12, 15, 50 ml) Transferpipetten (5, 10, 25 ml) Zellkulturflaschen Cellstar Filter Top (175 cm 2 ) Zellkulturschalen (9,6 cm 2 ) Zellschaber Menzel-Gläser, Braunschweig Eppendorf AG, Hamburg Sarstedt AG & Co, Nümbrecht Bio-Rad Laboratories GmbH, München PEQLAB Biotechnologie GMBH, Erlangen Sarstedt AG & Co, Nümbrecht Sarstedt AG & Co, Nümbrecht Sarstedt AG & Co, Nümbrecht Greiner Bio-One GmbH, Frickenhausen Sarstedt AG & Co, Nümbrecht TPP Techno Plastic Products AG, Trasadingen, Schweiz 3.3 Chemikalien und Reagenzien 1,4-Dithiothreitol (DTT) Acrylamid-Bis (40%) Lösung, 19:1 Ammoniumpersulfat (APS) Bambanker-Kryokonservierungsmittel Bromphenolblau Cycloheximid Dinatriumhydrogenphosphat (Na 2 HPO 4 x 12 H 2 O) Ethanol, absolute Glycerol Glycin Roche Diagnostics GmbH, Mannheim Bio-Rad Laboratories GmbH, München Sigma-Aldrich Corporation, St. Louis, MO, USA Wako Chemicals GmbH, Neuss Serva Elecrophoresis GmbH, Heidelberg Sigma-Aldrich Corporation, St. Louis, MO, USA Merck KGaA, Darmstadt Merck KGaA, Darmstadt Merck KGaA, Darmstadt Sigma-Aldrich Corporation, St. Louis, MO, USA

30 Material 26 HRP-Substrat Immobilon Western Super Signal West Femto Kaliumchlorid (KCl) Kaliumdihydrogenphosphat (KH 2 PO 4 ) L-Glutamin (10 mg/ml) Lipofectamin 2000 Methanol Methanol LC-MS Chromasolv N,N,N,N -Tetramethylethylendiamin (TEMED) Natriumchlorid (NaCl) Natriumhydogenphosphat-Monohydrat (NaH 2 PO 4 x H 2 O) PCR Nukleotid Mix (dntp) Prestained Protein Marker, Broad Range Rekombinantes humanes IFN-γ Saccharose Sodiumdodecylsulfat (SDS) TGF-β Inhibitor, SB Titriplex III (EDTA) Tris (hydroxymethyl)-aminomethan Tris-HCl Trockenmilchpulver Trypanblau (0,4%) Trypsin-EDTA (1x) Millipore, Billerica, MA, USA Thermo Fisher Scientific, Waltham, MS, USA Merck KGaA, Darmstadt Merck KGaA, Darmstadt PAA Laboratories GmbH, Cölbe Invitrogen, Darmstadt Merck KGaA, Darmstadt Sigma-Aldrich Corporation, St. Louis, MO, USA Sigma-Aldrich Corporation, St. Louis, MO, USA Merck KGaA, Darmstadt Merck KGaA, Darmstadt Roche Diagnostics GmbH, Mannheim New England Biolabs, Ipswich, MA, USA PeproTech GmbH, Hamburg Merck KGaA, Darmstadt Merck KGaA, Darmstadt Sigma-Aldrich Corporation, St. Louis MO, USA Merck KGaA, Darmstadt Bio-Rad Laboratories GmbH, München Sigma-Aldrich Corporation, St. Louis, MO, USA Sigma-Aldrich Corporation, St. Louis, MO, USA Sigma-Aldrich Corporation, St. Louis, MO, USA PAA Laboratories GmbH, Cölbe

31 Material 27 Tween-20 β-mercaptoethanol Serva Elecrophoresis GmbH, Heidelberg Sigma-Aldrich Corporation, St. Louis, MO, USA 3.4 Puffer und Lösungen Blockpuffer (5%) Blotpuffer Cycloheximid, Stammlösung Elektrophoresepuffer (5x) Lysispuffer (Western-Blot) 5 g Trockenmilchpulver, 100 ml T-TBS Puffer 3 g Tris, 14,4 g Glycin, 200 ml Methanol, ad 1 l A. dest. 1 g Cycloheximid, ad 1 ml A. dest. 15 g Tris, 72 g Glycin, 5 g SDS, ad 1 l A. dest., ph8,3 3,94 g Tris HCl, 40 ml Glycerol, 8 g SDS, 20 ml DTT (1 M), Bromphenolblau, ad 200 ml A. dest., ph 7,8 PBS-Puffer 80 g NaCl, 2 g KCl, 11,5 g Na 2 HPO 4 12xH 2 O, 2 g KH 2 PO 4, ad 1 l A. dest., ph 7,2 Sammelgelpuffer 30 g Tris, ad 500 ml A. dest. ph 6,8 SPG-Puffer 75 g Saccharose, 2,47 g Na 2 HPO 4, 0,36 g NaH 2 PO 4, 0,72 g L-Glutaminsäure, ad 1 l A. dest., ph 7,3 TBS-Puffer (10x) 24,2 g Tris, 80 g NaCl, ad 1 l A. dest., ph 7,6 Trenngelpuffer 90,5 g Tris, ad 500 ml A. dest., ph 8,8 T-TBS Puffer 100 ml TBS-Puffer (10x), 1 ml Tween-20, ad 1 l A. dest. 3.5 Zelllinien Tabelle 3.1: In dieser Arbeit verwendete Zelllinien Name Ursprung Nummer Vertrieb A549 Lungenkarzinom ACC 107 DSMZ, Braunschweig HEp-2 Epidermoides Larynxkarzinom CCL-23 ATCC, Manassas, USA

32 Material Medien und Medienzusätze Sofern nicht anders angegeben, stammen die hier aufgeführten Medien und -zusätze von der Fa. PAA Laboratories GmbH, Cölbe Dauerkulturmedium DMEM mit Glucose (4,5 g/l) und L-Glutamin, versetzt mit 10% FKS, 20 µg/ml Gentamycin, 33,2 mm HEPES-Puffer Transfektionsmedium Versuchsmedium 1 Versuchsmedium 2 Opti-MEM I (Invitrogen, Darmstadt) RPMI 1640 ohne L-Glutamin, versetzt mit 5% FKS, 0,1 mg/ml L-Glutamin, 1x NEAA RPMI 1640 ohne L-Glutamin, versetzt mit 0,1 mg/ml L-Glutamin, 1x NEAA 3.7 Enzyme und Kits IMAGEN Chlamydia Kit LightCycler FastStart DNA Master SYBR Green I MICROBEnriche Kit MICROBExpress Kit Mykoplasmen-Test, Venor GeM NucleoSpin RNA II Reverse Transkriptase, RevertAid Premium Reverse Transkriptase, Transcriptor RNase-Inhibitor, Protector RNase-Inhibitor, RiboLock Oxoid, Cambridgeshire, Großbritannien Roche Diagnostics GmbH, Mannheim Ambion, Austin, TX, USA Ambion, Austin, TX, USA Minerva Biolab, Berlin Macherey Nagel GmbH & Co. KG, Düren Fermentas, St. Leon-Rot Roche Diagnostics GmbH, Mannheim Roche Diagnostics GmbH, Mannheim Fermentas, St. Leon-Rot 3.8 Oligonukleotide Primer für die cdna Synthese Die Random Hexamer Primer p(dn)6 zur cdna Synthese wurden von der Fa. Roche Diagnostics GmbH, Mannheim bezogen

33 Material Primer für die quantitative RT-PCR Alle Primer wurden als Lyophilisat von der Fa. TIB MOLBIOL, Berlin bezogen. Nach Herstellerangaben wurden diese zu einer Arbeitskonzentration von 20 µm mit RNase-freiem H 2 O gelöst. Tabelle 3.2: In dieser Arbeit verwendete Primerpaare für humane Sequenzen Primerpaar Sequenz 5 >3 IDO 18S rrna SOCS1 SOCS3 IP10 Forward GCGCTGTTGGAAATAGCTTC Reverse TTTGGGTCTTCCCAGAACC Forward TCAAGAACGAAAGTCGGAGG Reverse GGACATCTAAGGGCATCACA Forward TTTTTCGCCCTTAGCGTGAA Reverse GCCATCCAGGTGAAAGCG Forward GAAGATCCCCCTGGTGTTGA Reverse TCCCGACAGAGATGCTGAAGA Forward AGGAACCTCCAGTCTCAGCA Reverse CAAAATTGGCTTGCAGGAAT Tabelle 3.3: In dieser Arbeit verwendete Primerpaare für chlamydiale Sequenzen Primerpaar Sequenz 5 >3 AhpC AspC AtpE DnaK Euo IncA Forward AGGAAGCCCCTGATTTTGTT Reverse CAATGTCATCCACGGAACAG Forward ACCTCCCGCCATCTCTTTAT Reverse GTCAGAGCGGAGAAACGAAC Forward CGAATCTTAATGCCGATGGT Reverse CCTGCTTGGCTTAGAGCAAC Forward CCTGCGGTTACCATCGTAGT Reverse GAAGTCCTGAGCTTGCTTCG Forward TCCCTTACGCTCTCCTCGTA Reverse GACGCGCTGGGAAATAGATA Forward TTGTTCTGCGCTACGTCAAG Reverse TTGTTGGTGGAGGTGTTTCA

34 Material 30 Primerpaar Sequenz 5 >3 IncB IncC Pyk RpoA Tal Tuf TyrB Forward AGCCGCAGCCCTAATCTTAT Reverse CCGCAAGCAGCAATAATACA Forward AGCTGTGCTTGGATTTACGG Reverse TTGTTCTGCGCTACGTCAAG Forward AGCTTGCGGATGGAATTATG Reverse ATGCAGTTTCCCCTGACAAC Forward TGATCTGGGTTAACGGCTTC Reverse GCAATCGAAGGGGTTATTGA Forward TAGTTTGGGGAATCCGACAG Reverse TCCTCCCATAGCTTCGAAAA Forward ACTACGCTAACAGCGGCAAT Reverse CGGCGCCTGTAATCATATTT Forward ATAAGCGTCCCGAAAAGGTT Reverse AAAAACCAGCTCACGCATCT sirna für RNA-Interferenz Analysen Die im Folgenden aufgeführten sirnas der Fa. Invitrogen, Darmstadt wurden für RNA-Interferenz Experimente verwendet. Das Lyophilisat wurde mit DEPC-Wasser zu einer Arbeitskonzentration von 20 µm gelöst. Für Kontroll-Experimente wurde die stealth RNAi negativ control mit niedrigem GC-Gehalt (Invitrogen, Darmstadt) verwendet. Tabelle 3.4: In dieser Arbeit verwendete sirnas sirna (RNA)-Sequenz 5 >3 HIF-1α Stealth RNAi CCAGCCGCUGGAGACACAAUCAUAU AUAUGAUUGUGUCUCCAGCGGCUGG

35 Material Antikörper Antikörper für Western Blot Analysen Tabelle 3.5: In dieser Arbeit verwendete Primärantikörper für Western Blot Analysen Name Herkunft Hersteller Klonalität Verdünnung Anti-β-Aktin Anti-CPAF Kaninchen Cell Signaling Technology, MA, USA Kaninchen Aus dem Institut für Biochemie, Universität zu Lübeck polyklon 1:2000 polyklon 1:1000 Anti-E-Cadherin Maus BD Bioscience, Heidelberg Anti-HIF-1α Maus BD Bioscience, Heidelberg monoklon 1:2000 monoklon 1:500 Anti-IDO Maus Chemicon, MA,USA monoklon 1:1000 Anti-phospho- STAT1 (Tyr701) Anti-phospho- STAT1 (Ser727) Kaninchen Cell Signaling Technology, MA, USA Kaninchen Cell Signaling Technology, MA, USA polyklon 1:1000 polyklon 1:1000 Tabelle 3.6: In dieser Arbeit verwendete Sekundärantikörper für Western Blot Analysen Name Herkunft Hersteller Klonalität Verdünnung Anti-Kaninchen, HRP konjugiert Ziege Cell Signaling Technology, MA, USA polyklon 1:4000 Anti-Maus, HRP konjugiert Pferd Cell Signaling Technology, MA, USA polyklon 1:4000

36 Material Antikörper für Immunfluoreszenzfärbungen Tabelle 3.7: In dieser Arbeit verwendete Primärantikörper für Immunfluoreszenzfärbungen Name Herkunft Hersteller Klonalität Verdünnung Anti- Chlamydien-LPS Maus Prof. H. Brade, FZ Borstel polyklon 1:50 Anti-α-SMA Maus Sigma-Aldrich, MO, USA monoklon 1:400 Anti-IncA Kaninchen Eurogentec, Köln polyklon 1:3000 Tabelle 3.8: In dieser Arbeit verwendete Sekundärantikörper für Immunfluoreszenzfärbungen Name Herkunft Hersteller Klonalität Verdünnung Anti- Kaninchen, FITC konjugiert Ziege Invitrogen, Darmstadt polyklon 1:100 Anti-Maus, DyLight549 konjugiert Esel Jackson ImmunoResearch, West Grove, PA, USA polyklon 1:100 Anti-Maus, FITC konjugiert Kaninchen Dako Deutschland GmbH, Hamburg polyklon 1: Software Adobe Photoshop CS2 AxioVision Rel. 4.5 Bio1D BZ Analyzer Software Image J LightCycler Data Analysis Microsoft Office 2007 Adobe Systems Inc., San Jose, CA, USA Carl Zeiss MikroImaging, Göttingen Vilber Lourmat GmbH, Eberhardzell Keyence, Osaka, Japan National Institutes of Health, USA Roche Diagnostics GmbH, Mannheim Microsoft Cooperation, Redmond, USA

37 Methoden 33 4 Methoden 4.1 Zellkultur Kultivierung von Zelllinien Die in dieser Arbeit verwendeten Zelllinien sind epitheliale Adhäsionszellen. Die Kultivierung erfolgte mit Dauerkulturmedium in 175 cm 2 Zellkulturflaschen im Inkubator bei 37 C und 5% CO 2. Die Zellen wurden alle 3-4 Tage mit Hilfe von Trypsin/EDTA von der Zellkulturflasche gelöst. Danach wurden die Zellen entweder in einem Verhältnis von 1:8-1:10 auf eine neue Zellkulturflasche verteilt oder die Zellzahl wurde bestimmt (Abschnitt 4.1.2). Folgende Zellzahlen wurden in die Versuchsbedingungen eingesetzt: Tabelle 4.1: Zellkulturbedingungen in den durchgeführten Versuchen Versuche Zellkulturplatte Zellen Volumen Medium 6-Loch 2,5x10 5 HEp-2/A549 5 ml Versuchsmedium 1 Persistenzversuche Wiederanzucht 24-Loch 3x10 5 HEp-2 1 ml Dauerkulturmedium Transfektionsexperimente 6-Loch 2,5x10 5 A549 2 ml Versuchsmedium 2 Live-Cell Imaging 9,6 cm 2 Zellkulturschale 2x10 5 A549 2 ml Versuchsmedium 1 Metabolom- Analysen Transkriptom- Analysen 6-Loch 2,5x10 5 HEp-2 5 ml Versuchsmedium 1 (7 h), Wechsel auf Versuchsmedium 2 6-Loch 2,5x10 5 HEp-2 5 ml Versuchsmedium 1 Zur Induktion der Persistenz wurde zu den ausgesäten Zellen 10 U/ml IFN-γ gegeben. Die Zellen wurden im Inkubator ohne Sauerstoffregulation (im weiteren Verlauf Normoxie genannt) oder in einer Hypoxiekammer mit eingestellter Sauerstoffkonzentration von 2% (im weiteren Verlauf Hypoxie genannt) bis zur Infektion (Abschnitt 4.3.2) für 24 h inkubiert. Optional wurde, bei

38 Methoden 34 Sauerstoffkonzentrationen abweichend von 2%, ein Brutschrank mit Sauerstoffregulation genutzt. Wöchentlich wurden die Zellkulturen mittels PCR auf eine mögliche Mykoplasmenkontamination getestet Bestimmung der Zellzahl Um die Zellzahl zu bestimmen, wurden 10 µl Zellsuspension mit 80 µl PBS-Puffer und 10 µl Trypanblau verdünnt. 10 µl dieser 1:10 Verdünnung wurden in eine Neubauer-Zählkammer mit einer Tiefe von 0,1 mm pipettiert. 4 Großquadrate wurden bei 10-facher Vergrößerung ausgezählt. Intakte Zellen wiesen dabei keine Färbung auf, wohingegen tote Zellen blau erschienen, da der saure Farbstoff Trypanblau durch die Zellmembran von abgestorbenen Zellen diffundiert. Die Formel zur Berechnung der Zellzahl lautet: gezählte Zellzahl Verdünnungsfaktor Volumen 10 Zellen ml = Anzahl gezählter Großquadrate Konservierung von Zelllinien Die Zellen einer vollbewachsenen Zellkulturflasche wurden mittels einer Trypsin/EDTA-Lösung gelöst und bei 200 x g für 5 min zentrifugiert. Der Überstand wurde verworfen. Das Zellpellet wurde in 1 ml Bambanker- Kryokonservierungsmittel aufgenommen und in einer Styropor-Schachtel bei -80 C bis zum nächsten Tag eingefroren. Danach wurden die Zellen in Stickstoff gelagert. Zum Auftauen der Zellen wurde ein 37 C warmes Wasserbad verwendet. Da DMSO in der Suspension enthalten ist, wurde dieses mit 10 ml warmen Dauerkulturmedium verdünnt. Die Zellen wurden bei 200 x g für 5 min zentrifugiert und das Medium verworfen. Die Zellen wurden in frisches Dauerkulturmedium auf eine neue Zellkulturflasche verteilt.

39 Methoden Präparation von humanem Lungengewebe Das verwendete humane Lungengewebe stammte von Patienten, bei denen im Rahmen einer Lungenresektion Gewebe entnommen wurde (Klinik für Chirurgie des UK-SH, Campus Lübeck, Prof. Dr. med. P. Kujath und Mitarbeiter). Vor der Operation stimmten die Patienten einer Nutzung des Gewebes, welches für die pathologische Begutachtung nicht benötigt wurde, zu. Ein Ethikantrag der Sektion Medizin der Universität zu Lübeck (Az ) zur Nutzung des Lungengewebes liegt vor. Tumorfreies Gewebe wurde vom Institut für Pathologie ausgewählt und bis zur Verarbeitung bei 4 C gelagert. Unter sterilen Bedingungen wurden mg große Stücke mit Hilfe einer chirurgischen Schere zugeschnitten. Jeweils ein Stück wurde in einem Loch einer 24-Lochplatte mit 1 ml Versuchsmedium 1 inkubiert. Direkt im Anschluss erfolgte die Infektion (Abschnitt 4.3.3). 4.3 Infektionsbiologische Methoden Herstellung eines Infektionsstocks von C. pneumoniae Zwölf 6-Lochplatten mit je 8x10 5 HEp-2 Zellen pro Loch wurden ausgesät. Nach 24 h Inkubation bei Normoxie wurde das Medium verworfen und 2 ml Dauerkulturmedium, versetzt mit 1 µg/ml Cycloheximid, zugegeben. Die Zellen wurden mit C. pneumoniae (10 IFUs/Zelle) durch Zentrifugation bei 700 x g und 30 C für 1 h infiziert und für 72 h bei Normoxie inkubiert. Die infizierten Zellen wurden mit einem Zellschaber vom Plattenboden abgelöst und 10 min mit Glasschrot auf einem Rüttler aufgeschlossen. Die Zellbestandteile wurden für 5 min bei 200 x g und 4 C abzentrifugiert. Der Überstand, welcher die Chlamydien enthielt, wurde weitere 90 min bei x g und 4 C zentrifugiert. Das entstandene Chlamydien- Pellet wurde in 2 ml SPG-Puffer gelöst und in 20 µl Aliquots bei -80 C gelagert. Zur Bestimmung des Chlamydien-Gehalts wurde eine 1:2 Verdünnungsreihe in mit HEp-2 Zellen bewachsenen Löchern einer 24-Lochplatte durchgeführt und die Chlamydien-Einschlüsse ausgezählt (Abschnitt 4.3.7).

40 Methoden Infektion von Zelllinien mit C. pneumoniae Das entsprechende Zellmedium wurde zur Infektion mit 0,1 µg/ml Cycloheximid versetzt. Die dadurch erzielte Hemmung der Proteinsynthese der Zelle begünstigt die Infektion mit C. pneumoniae. HEp-2 Zellen wurden für die Persistenzversuche mit einer Infektionsdosis von 2 IFUs pro Zelle in Versuchsmedium 1 infiziert. Dies entspricht einer Infektionsrate von ca. 20% unter Normoxie und 70-80% unter Hypoxie. Für die Metabolom-Analysen wurden HEp-2 Zellen mit 5,6 IFUs pro Zelle in Versuchsmedium 2 infiziert, was einer Infektionsrate unter Normoxie von 10% und unter Hypoxie von 60-70% entspricht. Für die Transkriptom-Analysen wurden die HEp-2 Zellen mit 20 IFUs pro Zelle in Versuchsmedium 1 infiziert, was einer Infektionsrate von 50-70% unter Normoxie entspricht. A549 Zellen für Persistenzund Transfektionsexperimente wurden mit 3 IFUs pro Zelle in Versuchsmedium 1 infiziert. Dies entspricht einer Infektionsrate von 10% unter Normoxie und 60-70% unter Hypoxie. Nach der Zugabe von C. pneumoniae in das Medium, folgte eine Zentrifugation für 1 h (700 x g, 30 C). Anschließend wurden die Platten bei Normoxie oder Hypoxie inkubiert. Nach einer Inkubation von 72 hpi, wurde das Medium gewechselt Infektion von humanem Lungengewebe Zu den Gewebestücken wurde 0,1 µg/ml Cycloheximid ins Versuchsmedium 1 gegeben. Auf ein Lungenstück wurden 1x10 6 IFUs pipettiert. Die Inkubation erfolgte unter Normoxie oder Hypoxie für 24 h Reaktivierung persistenter C. pneumoniae durch Tryptophan Das IFN-γ haltige Medium wurde 24 hpi unter Normoxie verworfen und frisches Medium mit einem Tryptophangehalt von 10 µg/ml zugegeben. Danach wurden die Zellen für weitere 48 h bei Normoxie inkubiert und anschließend der Chlamydiengehalt durch Wiederanzucht bestimmt (Abschnitt 4.3.6).

41 Methoden Reaktivierungs-Modell von C. pneumoniae durch Hypoxie Die Persistenz von C. pneumoniae wurde mit 10 U/ml IFN-γ induziert (Abschnitt 4.1.1). Die Persistenz wurde über 144 h unter Normoxie beibehalten. Für Reaktivierungs-Versuche wurden die persistent infizierten Zellen nach 48 h in Hypoxie überführt und für weitere 48 h und 96 h inkubiert. Zur Kontrolle wurden persistent infizierte Zellen parallel weiter unter Normoxie inkubiert. Das Medium wurde alle 3 Tage durch frisches Versuchsmedium 1, versetzt mit 10 U/ml IFN-γ, ausgetauscht. Anschließend erfolgte eine Wiederanzucht von C. pneumoniae (Abschnitt 4.3.6) oder RNA-Isolation (Abschnitt 4.6.1) Wiederanzucht Zu dem Medium der Zellen einer 24-Lochplatte (Abschnitt 4.1.1) wurde 1 µg/ml Cycloheximid hinzupipettiert. Die infizierten Zellen, von denen die Wiederanzucht erfolgen sollte, wurden im Medium mit Hilfe eines Zellschabers vom Boden der Zellkulturplatte abgeschabt und suspendiert. 2 ml der Suspension wurden in ein 10 ml Röhrchen mit 1 ml Glasschrot überführt. Für 5 min wurden die Zellen auf einem Rüttler aufgeschlossen und die Chlamydien freigesetzt. Mit 250 µl der Suspension wurde ein Loch der 24-Lochplatte infiziert. Weitere 250 µl wurden aus dem ersten Loch entnommen, um das nächste Loch zu infizieren. Dieses wurde über 6 Löcher fortgeführt und es entstand eine Verdünnungsreihe von 1:5. Anschließend wurde die 24-Lochplatte 1 h (700 x g, 30 C) zentrifugiert. Nach einer Inkubation für 72 h unter Normoxie wurde das Medium von den Zellen abgenommen und die Zellen mit Methanol bei -20 C fixiert. Die Chlamydien wurden mit dem indirekten Immunfluoreszenztest (IFT) (Abschnitt 4.4.2) nachgewiesen und ausgezählt (Abschnitt 4.3.7), um so die Wiederanzuchtsrate zu bestimmen.

42 Methoden Quantifizierung des Chlamydien-Gehalts Die Einschlüsse von Chlamydien wurden mit dem indirekten IFT (Abschnitt 4.4.2) angefärbt und wie im Folgenden beschrieben ausgezählt. Zehn Gesichtsfelder eines Loches der Verdünnungsreihe wurden am Fluoreszenzmikroskop bei 40-facher Vergrößerung ausgezählt. Dafür wurde das Loch indem die Einschlusskörper vereinzelt vorlagen ausgewählt. Anhand der Verdünnungsreihe war bekannt, wie viel µl der Chlamydien-Suspension eingesetzt wurden. Unter Einbeziehung der Größe eines Gesichtsfelds (0,139 mm 2 ) und der Fläche eines Lochs einer 24-Lochplatte (200 mm 2 ), ergibt sich folgende Formel zur Bestimmung des Chlamydien-Gehalts: Gezählte Einschlüsse 200 mm IFUs µl = Gezählte Gesichtfelder Eingesetzte µl 0,139 mm 4.4 Mikroskopie Direkter Immunfluoreszenztest von C. pneumoniae Zur Bestimmung der Infektionsrate und zur Analyse der Morphologie von Zellen und chlamydialen Einschlüssen wurde der direkte IFT genutzt. Hierfür wurden Deckgläser, die mit Zellen bewachsen waren, in eine 24-Lochplatte überführt und mit Methanol bei -20 C fixiert. Das Methanol wurde anschließend verworfen und die Deckgläser bei 37 C getrocknet. Vor der Verwendung des IMAGEN Chlamydia Kits wurde dem Antikörper 1 ml PBS-Puffer zugefügt. Die Zellen wurden mit 10 µl des verdünnten Antikörpers gefärbt und bei 37 C inkubiert. Die Deckgläser wurden dann mit PBS-Puffer gewaschen und mit einem Tropfen Mountain Fluid auf einem Objektträger, mit der bewachsenen Seite nach unten, gelegt. Zur Fixierung der Deckgläser wurde Nagellack verwendet. Die Präparate konnten im Fluoreszenzmikroskop betrachtet werden. Zelluläre Bestandteile wurden rot und chlamydiale Einschlusskörper grün dargestellt.

43 Methoden Indirekter Immunfluoreszenztest von C. pneumoniae Der indirekte IFT wurde in einer 24-Lochplatte durchgeführt. Das Medium der Zellen wurde verworfen und die Zellen mit Methanol bei -20 C fixiert. Anschließend wurde das Methanol verworfen und die Zellen einmal mit PBS-Puffer gespült. Zu den Zellen wurden 250 µl eines Anti-Chlamydien-LPS-Antikörpers gegeben und die Zellen mit dem Antikörper für 45 min bei 37 C inkubiert. Danach wurde der Antikörper abgenommen und die Zellen zweimal mit PBS-Puffer gewaschen. Es folgte eine weitere Inkubation mit dem entsprechenden FITC konjugierten Sekundärantikörper für 30 min. Der Sekundärantikörper wurde verworfen und die Zellen zweimal mit PBS-Puffer gewaschen. Am Fluoreszenzmikroskop konnte die Infektionsrate bestimmt werden (Abschnitt 4.3.7) Indirekte Immunfluoreszenzfärbung von α-smooth muscle actin Mit Zellen bewachsene Deckgläser wurden entsprechend zum direkten IFT (Abschnitt 4.4.1) fixiert und anschließend 3 x 2 min mit PBS + 0,1% Tween-20 gewaschen. Der Anti-α-smooth muscle actin (α-sma) Antikörper und der Anti-IncA Antikörper wurden in PBS-Puffer + 0,1% Tween-20 verdünnt. 250 µl dieser Primärantikörper wurden auf ein Deckglas pipettiert und für 90 min bei RT auf einem Taumelschüttler inkubiert. Anschließend wurden die Antikörper verworfen und die Zellen 3 x 2 min mit PBS-Puffer + 0,1% Tween-20 gewaschen. Die entsprechenden Sekundärantikörper wurden in PBS-Puffer + 0,1% Tween-20 verdünnt und 250 µl auf die Zellen gegeben. Dunkel abgedeckt erfolgte eine Inkubation für 90 min bei RT auf einem Taumelschüttler. Die Deckgläser wurden 3 x 2 min mit PBS-Puffer gewaschen. Die Fixierung der Deckgläser auf einem Objektträger erfolgte entsprechend zum direkten IFT (Abschnitt 4.4.1). Die Zellen wurden am Fluoreszenzmikroskop fotografiert und mit der BZ Analyzer Software ausgewertet. Chlamydien-Einschlusskörper wurden dabei grün und α-sma rot dargestellt. Dazu wurde die Intensität von je 100 Pixel von 5 Zellen bei 3 biologischen Replikaten gemessen. Bei der Analyse von infizierten Proben wurden nur Zellen die einen chlamydialen Einschlusskörper enthielten analysiert.

44 Methoden Live Cell Imaging Um die Migration von infizierten Zellen zu analysieren, wurden diese direkt nach der Infektion in den Inkubator des Mikroskops gestellt. Mit dem 20-fachem Objektiv wurden in einem Intervall von 30 min 96 Bilder aufgenommen. Anschließend wurden diese Bilder zu einem Zeitraffer mit 5 Bildern pro Sekunde zusammengefügt. Die Auswertung der Migration erfolgte mit dem Chemotaxis and Migration Tool von ImageJ. Dabei wurde die durchschnittliche Distanz [µm] die eine Zelle migrierte in 10 Zellen zwischen 12 und 24 hpi sowie zwischen 36 und 48 hpi bestimmt. 4.5 Proteinbiochemische Methoden Probengewinnung Die Probenaufarbeitung erfolgte aus einem Loch einer 6-Lochplatte. Es wurden Proteine aus der frühen Phase (4 hpi), der mittleren Phase (24 hpi) und der späten Phase (48 hpi) sowie 96 hpi gewonnen. Die folgenden Schritte wurden für Proben die unter Hypoxie bebrütet wurden in der Hypoxiekammer durchgeführt. Das Medium wurde von den Zellen abgenommen und unverzüglich 300 µl Lysispuffer zugegeben. Die Zellen wurden mit einer Pipettenspitze homogenisiert und in ein gekühltes Reaktionsgefäß überführt. Die Lagerung der Proben erfolgte bei -20 C SDS-PAGE Zur Auftrennung von Proteinen nach ihrer Molekularmasse wurde die diskontinuierliche Sodiumdodecylsulfat-Polyacrylamidgelelektrophorese (SDS-PAGE) nach Laemmli verwendet [63]. Es wurde ein 10%iges Trenngel mit einem 4%igem Sammelgel in einer Größe von 8 x 7,3 cm gegossen (Tabelle 4.2). Die auspolymerisierten Gele wurden in eine vertikale Elektrophoresekammer eingesetzt und mit Elektrophoresepuffer übergossen. Die Proteine wurden bei 95 C für 5 min denaturiert und anschließend 30 µl Probe ins Gel aufgetragen. Als Größenstandard dienten 7 µl eines Molekulargewichtsmarkers. Die Migration der Proteine durch das Sammelgel erfolgte bei einer Spannung von 70 V für 15 min. Im Trenngel wurden die Proteine nach ihrer Molekularmasse bei einer Spannung von 200 V für 55 min aufgetrennt.

45 Methoden 41 Tabelle 4.2: Zusammensetzung des Sammel- und Trenngels Trenngel (10%) Sammelgel (4%) H 2 O 2,45 ml 3,2 ml Trenngelpuffer 1,25 ml - Sammelgelpuffer - 1,25 ml Acrylamid/Bisacrylamid 1,25 ml 0,5 ml 10% SDS-Lösung 50 µl 50 µl TEMED 2,5 µl 5 µl 10% APS-Lösung 25 µl 25 µl Western Blot Analyse Um spezifische Proteine nachzuweisen, wurden die aufgetrennten Proteine der SDS-PAGE auf eine Nitrozellulose-Membran übertragen. In dieser Arbeit wurde dafür ein Nass-Blot verwendet. In einer horizontalen Blotapparatur erfolgte der Transfer der Proteine aus der SDS-PAGE auf eine Nitrocellulosemembran für 1,5 h bei 75 V unter ständiger Kühlung durch Eisblöcke. Anschließend wurden unspezifische Bindungsstellen der Membran mit Blockpuffer für 1 h bei Raumtemperatur (RT) blockiert. Über Nacht wurde die Membran bei 4 C und leichtem Schwenken mit dem Primärantikörper (Abschnitt 3.9.1) in der entsprechenden Verdünnung im Blockpuffer inkubiert. Am nächsten Tag wurde die Membran 2 x 15 min mit T-TBS gewaschen. Der Sekundärantikörper wurde in Blockpuffer verdünnt und für 1 h bei RT mit der Membran inkubiert. Es folgte ein erneutes Waschen für 2 x 15 min mit T-TBS. Die verwendeten Sekundärantikörper sind mit einer Meerrettichperoxidase (horseradish peroxidase, HRP) gekoppelt. Durch Zugabe des Luminol-haltigen Substrats nach Herstellerangaben wurde das Luminol oxidiert und die Lumineszenz konnte im Chemilumineszenz-Imager detektiert werden. Dargestellt wurde jeweils ein repräsentatives Ergebnis der Replikate der Western Blot Analysen. Die Bandenintensität der Replikate der Western Blot Analysen wurde mit der Software Bio1D ausgewertet. Die Proteinmenge wurde gegen das Housekeeping-Protein β-aktin normalisiert. Die Bande mit der stärksten Intensität wurde als 100% definiert.

46 Methoden Molekularbiologische Methoden RNA-Isolation Zur Isolation von total-rna wurde das NucleoSpin RNA II Kit verwendet. Der RNA-Lysispuffer wurde im Verhältnis 1:100 mit β-mercaptoethanol versetzt. Zur Isolierung von RNA aus Zellkulturen wurden Zellen eines Lochs einer 6-Lochplatte mit 350 µl RNA-Lysispuffer lysiert. Um humanes Lungengewebe zu lysieren, wurde ein Stück Lunge in 600 µl RNA-Lysispuffer in ein Precellys Kryoröhrchen gegeben. Bei 6500 rpm für 15 sec im Gewebehomogenisator, wurde das Gewebe homogenisiert. Die weitere Durchführung erfolgte nach den Angaben des Herstellers Reverse Transkription RNA wurde mit Hilfe der reversen Transkription in cdna umgeschrieben. Tabelle 4.3: Pipettierschema der reversen Transkription mit Roche und Fermentas Volumen Endkonzentration Reagenzien Roche Fermentas Roche Fermentas RNase-freies H 2 O 6,0 µl 5,5 µl Reaktionspuffer (5x) 4,0 µl 4,0 µl 1x 1x dntp Mix 2,0 µl 2,0 µl 1 mm 1 mm Random Hexamer Primer 2,0 µl 2,0 µl 0,04 U/µl 0,04 U/ml RNase-Inhibitor 0,5 µl 0,5µl 50 U 2 U Reverse Transkriptase 0,5 µl 1,0 µl 20 U 10 U RNA 5,0 µl 5,0 µl Die Reaktion erfolgte im Thermocycler mit den folgenden Programmen:

47 Methoden 43 Tabelle 4.4: Temperaturprofil der reversen Transkription Temperatur Dauer (Roche) Dauer (Fermentas) Hybridisierung 25 C 10 min 10 min Reverse Transkription 50 C 60 min 30 min Inaktivierung des Enzyms 85 C 5 min 5 min Kühlung 4 C Die Lagerung der Proben erfolgte bei -20 C Quantitative RT-PCR Die hier verwendete quantitative reverse-transkriptase-pcr (RT-PCR) wurde mit dem Fluoreszenzfarbstoff SYBR-Green in Glas-Kapillaren durchgeführt. Die aus der reversen Transkription entstandene cdna (Abschnitt 4.6.2) wurde mit den in Abschnitt aufgeführten Primer analysiert. Tabelle 4.5: Pipettierschema der quantitative RT-PCR Reagenz Volumen Endkonzentration H 2 O 12,6 µl MgCl 2 2,4 µl 4,0 mm Forward Primer (20 µm) 0,5 µl 0,5 µm Reverse Primer (20 µm) 0,5 µl 0,5 µm LightCycler FastStart Reaktionsmix SYBR-Green 2,0 µl 1x cdna 2,0 µl Zuvor wurde dem Lightcycler FastStart Reaktionsmix 10 µl LightCycler FastStart Enzym zugegeben. Die Amplifizierung erfolgte im LightCycler bei folgendem Temperaturprofil:

48 Methoden 44 Tabelle 4.6: Temperaturprofil der quantitativen RT-PCR Temperatur Dauer Zyklen Initiale Denaturierung 95 C 10 min Denaturierung 95 C 10 sec Primerhybridisierung 60 C 5 sec 45 Elongation 72 C 10 sec Die Auswertung der Daten erfolgte mit dem Programm LightCycler Data Analysis. Die Daten wurden entsprechend der mrna Menge des Housekeeping-Gens 18S rrna normalisiert. Die Probe mit der stärksten Expression wurde als 100% definiert. Bei der Analyse von chlamydialen Genen wurde gegen die Expression des chlamydialen Elongationsfaktors Tuf (thermo unstable elongation factor) normalisiert, der zuvor als geeignetes Housekeeping Gen beschrieben wurde [75] RNA-Interferenz Analysen In dieser Arbeit wurde HIF-1α in A549 Zellen mittels RNA-Interferenz inhibiert. Dazu wurde je ein Ansatz von 250 µl Optimem Medium mit 5 µl Lipofectamin oder 5 µl der HIF-1α sirna (20 µm) versetzt. Beide Ansätze wurden 5 min bei RT inkubiert und anschließend zusammen pipettiert. Dieses Gemisch wurde in ein kurz zuvor angesetztes Loch einer 6-Lochplatte mit A549 Zellen und 2 ml Versuchsmedium 2 gegeben. Der Ansatz wurde für 5 h bei Hypoxie inkubiert. Anschließend wurde das Medium in der Hypoxiekammer verworfen und mit 5 ml Versuchsmedium 1 und z.t. mit 10 U/ml IFN-γ versetzt. Alle Ansätze wurden parallel mit einer Kontroll-siRNA durchgeführt.

49 Methoden Inhibition von TGF-β A549 Zellen wurden ausgesät (Abschnitt 4.1.1) und nach 24 h Inkubation unter Normoxie und Hypoxie infiziert (Abschnitt 4.3.2). Der TGF-ß Inhibitor SB wurde zu einer Arbeitskonzentration von 26 mm in DMSO gelöst. Vor der Verwendung wurde die Suspension 1:10 mit Versuchsmedium 1 verdünnt. Das Medium wurde 4 hpi mit 5 µm SB versetzt und die Zellen für weitere 44 h bei Normoxie oder Hypoxie inkubiert. Anschließend wurden die Proteine der Zelle für Western Blot Analysen gewonnen (Abschnitt 4.5.1) Transkriptom-Analysen Um hohe Ausbeuten an chlamydialer mrna zu erhalten, wurden zwei verschiedene Aufreinigungsverfahren verglichen Aufreinigung 1 Für die Analyse des chlamydialen Transkriptoms wurden 6 Löcher einer 6-Lochplatte pro Probe für die RNA-Isolation eingesetzt (Abschnitt 4.6.1). Um die humane RNA aus der total-rna abzureichern, wurde das MICROBEnrich Kit nach Herstellerangaben verwendet. Die erhaltene RNA konnte direkt in das MICROBExpress Kit eingesetzt werden, um chlamydiale rrna zu entfernen. Dieses Kit wurde ebenfalls nach Herstellerangaben durchgeführt. Die RNA wurde in 30 µl RNase-freiem H 2 O gelöst. Der RNA-Gehalt sowie die Reinheit wurden im NanoDrop bestimmt Aufreinigung 2 Vor der Durchführung einer total-rna-isolation erfolgte eine Separation von humanen und chlamydialen Bestandteilen mittels Differentialzentrifugation. Dazu wurden infizierte Zellen von zehn 6-Lochplatten für eine Probe mit einem Zellschaber vom Plattenboden abgelöst und die Zellen 2 min mit Glasschrot aufgeschlossen. Die zellulären Bestandteile wurden bei 200 x g und 4 C für 5 min abzentrifugiert. Der Überstand wurde in der Ultrazentrifuge bei x g und 4 C für 1 h zentrifugiert. Das entstandene Chlamydien-Pellet wurde in 600 µl RNA-Lysispuffer, versetzt mit β-mercaptoethanol (1:100), lysiert und in die

50 Methoden 46 total-rna-isolation eingesetzt (Abschnitt 4.6.1). Die weitere Aufreinigung erfolgte entsprechend (Abschnitt ) BioAnalyzer Die Durchführung und Auswertung der Proben am BioAnalyzer erfolgte durch die Fa. GATC Biotech AG, Konstanz RNA-Sequenzierung Die RNA-Sequenzierung besteht aus der c-dna Synthese und der Sequenzierung am HiSeq2000 und wurde von der Fa. GATC Biotech AG, Konstanz durchgeführt. Pro Probe wurden Sequenzen mit einer Länge von 100 bp auf dem HiSeq2000 (Illumina) im 3fach-Ansatz sequenziert. Die bioinformatische Auswertung des Transkriptoms wurde von der Arbeitsgruppe Prof. Dr. T. Rattei des Departments für Computational Systems Biology, Universität Wien durchgeführt. 4.7 Metabolom-Analysen Aufarbeitung von Metaboliten für das FT/ICR-MS Das Medium wurde 7 h nach Aussaat der HEp-2 Zellen (Abschnitt 4.1.1) abgenommen und die Zellen mit 1 ml Versuchsmedium 2 gewaschen. Danach wurden 5 ml Versuchsmedium 2 auf die Zellen gegeben. Zu den Zellen wurden 10 U/ml IFN-γ gegeben und diese für weitere 17 h bei Normoxie oder Hypoxie bebrütet. Die Infektion der Zellen erfolgte entsprechend zu Abschnitt Das Medium wurde 24 hpi von den Zellen abgenommen. Der Zellrasen wurde sofort mit 1 ml eiskaltem Methanol bedeckt, welches direkt wieder verworfen wurde. Dieser Schritt diente dem Quenchen der Proben, wodurch der Metabolismus der Zelle gestoppt wurde. Die Zellen wurden nun in 1 ml eines eiskalten Methanol:H 2 O Gemischs (50:50) mit einem Zellschaber von der Platte gelöst und in ein Reaktionsgefäß überführt. In einem gekühlten Ultraschallbad wurden die Zellen und Chlamydien für 30 min aufgeschlossen, wobei bevorzugt hydrophile Metabolite vom Lösungsmittel aufgenommen wurden. Die Zellbestandteile wurden für 5 min bei 2000 x g abzentrifugiert und der Überstand bei -80 C gelagert. Zu dem Zellpellet wurde 1 ml Methanol gegeben und die Zellsuspension erneut für 30 min im

51 Methoden 47 Ultraschallbad behandelt. Dabei wurden hauptsächlich Metabolite mittlerer Polarität extrahiert. Nach einer weiteren 5 minütigen Zentrifugation bei 2000 x g wurde der Überstand zu dem ersten Überstand gegeben und bei -80 C gelagert. Die Proben wurden zur weiteren Analyse ins Helmholtz Zentrum München gesendet. Alle weiteren Methoden und Analysen wurden in Kooperation mit Constanze Müller der Arbeitsgruppe von PD Dr. Ph. Schmitt-Kopplin am Helmholtz Zentrum München, Abteilung Analytische BioGeoChemie durchgeführt Analyse der Metabolite Das Lösungsmittel, welches die extrahierten Metabolite der Zellen enthielt, wurde direkt in das ESI FT/ICR-MS (Elektrospray Ionisation Fouriertransformation- Ionenzyklotronresonanz-Massenspektrometer) bei positiver und negativer Polarität injiziert. Dafür wurden die Proben 1:50 (positive Polarität) bzw. 1:20 (negative Polarität) mit Methanol verdünnt. Bei positiver Polarität ionisieren bevorzugt basische Metabolite, wohingegen bei negativer Polarität saure Metabolite ionisieren. Durch das starke 12 Tesla Magnetfeld wurde eine Ultra-hohe Auflösung (>300000) und Massengenauigkeit (<100 ppb) erzielt. Die Spektren wurden in einer Massenbreite von m/z (positive Polarität) bzw m/z (negative Polarität) analysiert Auswertung der relevanten Massen Mittels der Hauptkomponentenanalyse (principal componant analysis, PCA) erfolgte eine Vereinfachung der Datenmatrix. Dabei wurden Proben, die eine ähnliche Stoffwechselsituation aufwiesen, nach zwei grundsätzlichen Komponenten zusammengruppiert. In dieser non-supervised Methode wurde dem System nicht mitgeteilt, welche Proben sich unterscheiden sollen und welche nicht. Anschließend wurde eine Partial Least Squares Diskriminanzanalyse (PLS-DA) für die Datenmatrix aufgebaut. Mit dieser supervized multivarianten Methode konnten Metaboliten, welche sich am stärksten in den vorher definierten Gruppen unterschieden (variable importance in the projection (VIP) > 1), bestimmt werden. Die Analyse erfolgte separat für den positiven als auch negativen Breitbandmodus und die erhaltenen Massen wurden für weitere Analysen extrahiert. Zur Annotierung und Translation in biochemische Stoffwechselwege wurde die Software MassTRIX,

52 Methoden 48 mit einem Fehler von 1 ppm, verwendet. Die annotierten Massen der infizierten Zellen unter Normoxie und Hypoxie wurden mittels des Wilcoxon-Mann-Whitney Test (non parametrischer Test) auf signifikante Unterschiede in ihrer Signalintensität analysiert. P-Werte von 0,05 wurden als statistisch signifikant angesehen. Zusätzlich wurden die statistisch signifikanten Massen der nicht-infizierten Zellen in Normoxie und Hypoxie identifiziert und mit denen der infizierten Zellen abgeglichen. Bei gleichem Verhältnis der Massen in den beiden Konditionen untereinander, wurden die Massen aus dem Datenset entfernt. Auf diese Weise wurden nur die für die Infektion relevanten Massen analysiert. 4.8 Statistik Die Daten wurden als Mittelwert ± Standardfehler angegeben. Für die statistische Auswertung wurde ein Student s t-test (einseitig, ungepaart) angewandt. P-Werte von 0,05 wurden als statistisch signifikant angesehen.

53 Ergebnisse 49 5 Ergebnisse 5.1 Untersuchungen der IFN-γ induzierten Persistenz von C. pneumoniae unter Hypoxie Aufhebung der Persistenzbildung von C. pneumoniae durch Hypoxie Die Sauerstoffverfügbarkeit in der Lunge nimmt gegenüber der atmosphärischen Luft entlang der Bronchien ab. Bei reduzierter Ventilation von Lungenzellen oder bei Entzündungsreaktionen sinkt die Sauerstoffkonzentration weiter. Auf Grund der obligat intrazellulären Lebensweise von C. pneumoniae, müssen sich diese an geringe Sauerstoffverhältnisse anpassen. Zuvor konnte gezeigt werden, dass C. pneumoniae unter Hypoxie ein schnelleres Wachstum und größere Einschlusskörper aufweist als unter Normoxie. In dieser Arbeit sollte der Einfluss von Hypoxie auf die Persistenz von C. pneumoniae analysiert werden. Dazu wurden HEp-2 Zellen 24 h vor der Infektion mit 10 U/ml IFN-γ behandelt, unter Normoxie und Hypoxie inkubiert sowie mit C. pneumoniae infiziert. Zuerst wurde die Morphologie der Einschlusskörper im direkten IFT analysiert (Abbildung 5.1). Charakteristisch für die Persistenz sind kleine Einschlusskörper. Diese waren in C. pneumoniae infizierten Zellen mit IFN-γ unter normoxischen Bedingungen zu finden. Dagegen führte eine Infektion unter Hypoxie zu größeren Einschlusskörpern, die vergleichbar mit denen der Kontrolle waren. IFN-γ hatte demnach keinen Einfluss auf die Morphologie der Einschlusskörper unter Hypoxie.

54 Ergebnisse 50 Abbildung 5.1: C. pneumoniae Einschlusskörper nach IFN-γ Behandlung unter Normoxie und Hypoxie. Im direkten IFT waren unter Normoxie und Hypoxie in den Kontrollen die kein IFN-γ enthielten große Einschlusskörper (grün) in HEp-2 Zellen (rot) zu detektieren (48 hpi). Durch IFN-γ Behandlung (10 U/ml) lagen kleine Einschlusskörper unter Normoxie vor, wohingegen unter Hypoxie große Einschlusskörper zu detektieren waren. Die Abbildung stammt aus einem repräsentativem Experiment von n=3. Eine weitere Eigenschaft der Persistenz ist, dass keine infektiösen EK im Entwicklungszyklus entstehen. Die kleinen Einschlusskörper in IFN-γ behandelten Zellen unter Normoxie wiesen keine Wiederanzucht von C. pneumoniae auf (0 ± 0,2 IFUs/µl) (Abbildung 5.2). Durch das Auswaschen von IFN-γ und der Zugabe von Tryptophan 24 hpi konnte eine Reaktivierung von C. pneumoniae erreicht werden (1,4x103 ± 8,2x102 IFUs/µl). Dies zeigte, dass die Behandlung mit IFN-γ unter Normoxie tatsächlich zur Persistenz und nicht zu einem Absterben von C. pneumoniae führte. In den IFN-γ behandelten Zellen unter Hypoxie zeigte sich hingegen eine hohe Wiederanzuchtsrate von C. pneumoniae (1,4x105 ± 3,9x104 IFUs/µl), die vergleichbar mit dem Wachstum ohne IFN-γ Zugabe unter Normoxie und Hypoxie war.

55 Ergebnisse 51 Abbildung 5.2: Wiederanzucht von C. pneumoniae in HEp-2 Zellen nach IFN-γ Behandlung unter Normoxie und Hypoxie (72 hpi). Eine IFN-γ-Behandlung (10 U/ml) führte unter Normoxie zu keiner Wiederanzucht, wohingegen unter Hypoxie eine hohe Wiederanzuchtsrate erreicht wurde. Eine Wiederanzucht von persistenten C. pneumoniae unter Normoxie konnte durch einen Wechsel auf ein tryptophanhaltiges Medium ohne IFN-γ (24 hpi) erzielt werden (n=3, *p 0,05). Um zu analysieren, bei welchen Sauerstoffkonzentrationen die IFN-γ induzierte Persistenz von C. pneumoniae verhindert wird, wurden ansteigende Sauerstoffkonzentrationen getestet. Im direkten IFT zeigten sich bei 1-2% O 2 in IFN-γ behandelten Zellen große Einschlusskörper, die jedoch bei 3% O 2 nicht mehr sichtbar waren (Abbildung 5.3 A). Eine Wiederanzucht von C. pneumoniae in IFN-γ behandelten Zellen wurde ebenfalls nur bei Konzentrationen 2% O 2 erreicht (Abbildung 5.3 B).

56 Ergebnisse 52 Abbildung 5.3: Persistenzinduktion von C. pneumoniae bei ansteigender Sauerstoffkonzentration in HEp-2 Zellen. (A) Der direkte IFT zeigte große Einschlusskörper von C. pneumoniae (grün) in IFN-γ (10 U/ml) behandelten HEp-2 Zellen (rot) 48 hpi bei 1-2% O 2. Bei 3% O 2 waren keine Einschlusskörper mehr zu erkennen (Die Abbildung stammt aus einem repräsentativem Experiment von n=3). (B) Eine Wiederanzucht von C. pneumoniae infizierten und IFN-γ behandelt Zellen, war bei 1-2% O 2, jedoch nur sehr gering bei Sauerstoffkonzentrationen 3% möglich (n=3) Reaktivierung persistenter C. pneumoniae durch Hypoxie Bisher sind Faktoren, die in vivo zu einer Reaktivierung von persistenten C. pneumoniae führen nicht bekannt. Da Hypoxie die Persistenzinduktion verhinderte, wurde der Einfluss von Hypoxie auf eine bereits persistierende C. pneumoniae-infektion untersucht. Dazu wurden IFN-γ behandelte HEp-2 Zellen für 48 h mit C. pneumoniae unter Normoxie infiziert. Danach wurden die nun persistent infizierten Zellen unter Normoxie oder Hypoxie weiter bebrütet. Nach 48 h und 96 h wurde ein direkter IFT und eine Wiederanzucht durchgeführt. Dabei zeigte sich, dass ein leichter Anstieg der Wiederanzuchtsrate nach 48 h und ein signifikanter Anstieg der Wiederanzuchtsrate nach 96 h hypoxischer Inkubation, im Vergleich zu den persistent infizierten Zellen unter Normoxie, erreicht werden konnte (Abbildung 5.4 A). Die persistent infizierten Zellen unter Normoxie wiesen zu keinem Zeitpunkt eine Wiederanzuchtsrate auf. Im direkten IFT konnte ebenfalls eine Veränderung der Größe der Einschlusskörper zwischen Normoxie und Hypoxie detektiert werden (Abbildung 5.4 B). In der Persistenz-Kontrolle waren keine Einschlüsse sichtbar, wohingegen deren Größe unter hypoxischer Inkubation nach 48 h und verstärkt nach 96 h zunahm.

57 Ergebnisse 53 Abbildung 5.4: Reaktivierung von persistenten C. pneumoniae durch Hypoxie in HEp-2 Zellen. (A) Die Persistenz wurde unter Normoxie durch die Zugabe von IFN-γ (10 U/ml) induziert. Die Zellen wurden 48 hpi für weitere 48 h oder 96 h entweder bei Normoxie (grün) oder Hypoxie (rot) bebrütet. C. pneumoniae infizierte Zellen ohne IFN-γ (blau) dienten als Kontrolle der Infektion. Nach 96 h hypoxischer Inkubation zeigte sich eine hohe Wiederanzucht von C. pneumoniae, wohingegen C. pneumoniae kein Wachstum unter Normoxie aufwies (n=5, *p 0,05 im Vergleich zu Normoxie). (B) Im direkten IFT zeigten sich vergrößerte Einschlusskörper (grün) in IFN-γ behandelten HEp-2 Zellen (rot) nach 96 h Inkubation in Hypoxie (Die Abbildung stammt aus einem repräsentativem Experiment von n=5). 5.2 Analyse von IFN-γ induzierenden Signalwegen unter Hypoxie Beeinflussung der Jak-STAT Signalkaskade durch Hypoxie Die IFN-γ induzierte Persistenz basiert hauptsächlich auf der Aktivität der Jak-STAT Signalkaskade. Um die verminderte Aktivität von IFN-γ unter Hypoxie zu charakterisieren, wurden die Phosphorylierungen von STAT1 am Tyrosin 701 und Serin 727 unter Hypoxie in Western Blot Analysen untersucht. Die

58 Ergebnisse 54 Phosphorylierungen waren verstärkt nach IFN-γ Behandlung sichtbar und werden im Weiteren hier beschrieben. Es zeigte sich unter Normoxie, dass eine Infektion mit C. pneumoniae (4 hpi) zu einer erhöhten Phosphorylierung am Tyrosin gegenüber nicht-infizierten Zellen führte (Abbildung 5.5 A und B). Zudem war die Tyrosin- Phosphorylierung signifikant stärker in infizierten Zellen unter Normoxie als in infizierten Zellen unter Hypoxie. Die Phosphorylierung am Serin 727 unterschied sich hingegen nicht zwischen Normoxie und Hypoxie (Abbildung 5.5 A und C). Abbildung 5.5: Western Blot Analysen der Tyrosin 701- und Serin 727-Phosphorylierungen am STAT1 in HEp-2 Zellen (4 hpi). Die Western Blot Analysen (A) und deren densitometrische Auswertung (B/C) zeigten, dass C. pneumoniae infizierte Zellen unter Normoxie eine erhöhte Tyrosin-Phosphorylierung (B) aufwiesen, welche unter Hypoxie signifikant reduziert war. Bei der Serin-Phosphorylierung (C) konnte kein Unterschied zwischen Normoxie und Hypoxie detektiert werden (n=3, *p 0,05). Die Tyrosin-Phosphorylierung war in der mittleren Phase der Infektion (24 hpi) in infizierten und nicht-infizierten Zellen unter Hypoxie gegenüber Normoxie verstärkt (Abbildung 5.6 A und B). Dies war jedoch nicht signifikant. Dahingegen war eine signifikant niedrigere Tyrosin-Phosphorylierung in C. pneumoniae infizierten Zellen,

59 Ergebnisse 55 im Vergleich zu nicht-infizierten Zellen, unter Hypoxie zu detektieren. Die Phosphorylierung am Serin 727 in nicht-infizierten Zellen war stärker unter Hypoxie als unter Normoxie. Die Serin-Phosphorylierung sank jedoch unter Hypoxie in C. pneumoniae infizierten Zellen gegenüber nicht-infizierten Zellen signifikant ab (Abbildung 5.6 A und C). Abbildung 5.6: Western Blot Analysen der Tyrosin 701- und Serin 727-Phosphorylierungen am STAT1 in HEp-2 Zellen (24 hpi). Die Western Blot Analysen (A) und deren densitometrische Auswertung (B/C) zeigten keinen Unterschied zwischen der Tyrosin-Phosphorylierung (B) unter Normoxie und Hypoxie in C. pneumoniae infizierten sowie nicht-infizierten Zellen. Die Serin-Phosphorylierung (C) war unter Hypoxie in nicht infizierten Zellen erhöht. In infizierten Zellen war kein Unterschied zwischen Normoxie und Hypoxie zu detektieren (n=3, *p 0,05). In der späten Phase der Infektion (48 hpi) war die Tyrosin-Phosphorylierung am STAT1 in nicht-infizierten Zellen unter Hypoxie stärker als in nicht infizierten Zellen unter Normoxie (Abbildung 5.7 A und B). Die in nicht-infizierten Zellen erhöhte Phosphorylierung unter Hypoxie war jedoch in infizierten Zellen unter Hypoxie signifikant reduziert und entsprach der unter Normoxie. Die

60 Ergebnisse 56 Serin-Phosphorylierung am STAT1 blieb in infizierten und nicht-infizierten Zellen unter Normoxie und Hypoxie unverändert (Abbildung 5.7 A und C). Abbildung 5.7: Western Blot Analysen der Tyrosin 701- und Serin 727-Phosphorylierungen am STAT1 in HEp-2 Zellen (48 hpi). Die Western Blot Analysen (A) und deren densitometrische Auswertung (B/C) zeigten eine erhöhte Tyrosin-Phosphorylierung (B) in nicht-infizierten Zellen unter Hypoxie. In infizierten Zellen war kein Unterschied zwischen Normoxie und Hypoxie zu detektieren. Bei der Serin-Phosphorylierung (C) konnte kein Unterschied zwischen Normoxie und Hypoxie detektiert werden (n=3, *p 0,05).

61 Ergebnisse Beeinflussung der IDO Expression durch Hypoxie Über die IFN-γ-induzierte Jak-STAT Signalkaskade werden Gene, die in ihrem Promotor das GAS Element tragen, exprimiert. Das Enzym IDO trägt dieses Element und wandelt, nach Induktion durch IFN-γ, Tryptophan zu N-Formylkynurenin um, womit es zur Persistenzinduktion von C. pneumoniae beiträgt. Die Expression von IDO wurde auf Gen- und Protein-Ebene analysiert. IDO war nur in Zellen nach IFN-γ Behandlung zu detektieren. Deshalb wurden nur die IFN-γ behandelten Proben für die densitometrische Auswertung der Western Blot Analysen herangezogen und hier weiter beschrieben. In der frühen Phase der Infektion (4 hpi) war die Genexpression von IDO in nicht-infizierten wie auch in C. pneumoniae infizierten Zellen unter Normoxie signifikant stärker als unter Hypoxie (Abbildung 5.8 A). Zudem zeigte sich unter Normoxie in infizierten Zellen gegenüber nicht-infizierten Zellen eine signifikant erhöhte Genexpression von IDO. Übereinstimmend zu der Genexpression zeigten auch die Western Blot Analysen, dass die Proteinexpression von IDO in C. pneumoniae infizierten und nicht-infizierten Zellen unter Normoxie signifikant stärker war als unter Hypoxie (Abbildung 5.8 B und C).

62 Ergebnisse 58 Abbildung 5.8: Expressionsanalysen von IDO in HEp-2 Zellen (4 hpi). (A) Quantitative RT-PCR Analysen wiesen unter Normoxie und Hypoxie eine höhere Genexpression von IDO sowohl in C. pneumoniae infizierten als auch in nicht-infizierten Zellen nach (n=3, *p 0,05, ***p 0,001). Die Western Blot Analysen (B) und deren densitometrische Auswertung (C) zeigten ebenfalls, dass unter Hypoxie eine signifikant niedrigere IDO Proteinexpression als unter Normoxie vorlag (n=3, ***p 0,001). In der mittleren Phase des Entwicklungszyklus (24 hpi) war die Genexpression von IDO in C. pneumoniae infizierten und nicht-infizierten Zellen zwischen Normoxie und Hypoxie vergleichbar (Abbildung 5.9 A). Lediglich eine Infektion unter Normoxie führte gegenüber nicht-infizierten Zellen zu einer signifikanten Reduktion der Genexpression. Hingegen verblieb die Proteinexpression von IDO unverändert.

63 Ergebnisse 59 Hier lag weiterhin eine niedrigere Proteinkonzentration von IDO unter Hypoxie als unter Normoxie in C. pneumoniae infizierten und nicht-infizierten Zellen vor (Abbildung 5.9 B und C). Daneben war die Proteinkonzentration von IDO unter Normoxie in infizierten Zellen, im Vergleich zu nicht-infizierten Zellen, signifikant erhöht. Abbildung 5.9: Expressionsanalysen von IDO in HEp-2 Zellen (24 hpi). (A) Quantitative RT-PCR Analysen wiesen keinen Unterschied in der Genexpression von IDO zwischen Normoxie und Hypoxie auf (n=3, *p 0,05). Die Western Blot Analysen (B) und deren densitometrische Auswertung (C) zeigten eine erniedrigte IDO Proteinexpression in C. pneumoniae infizierten und nicht-infizierten Zellen unter Hypoxie (n=3, **p 0,005, ***p 0,001).

64 Ergebnisse 60 Interessanterweise kehrte sich das Verhältnis der IDO Genexpression zu der Proteinexpression in der späten Phase der Infektion (48 hpi) um. So lag eine signifikant höhere Genexpression unter Hypoxie gegenüber Normoxie in C. pneumoniae infizierten und nicht-infizierten Zellen vor (Abbildung 5.10 A). Im Gegensatz dazu blieb die Proteinexpression von IDO weiterhin signifikant unter Hypoxie gegenüber Normoxie in C. pneumoniae infizierten und nicht-infizierten Zellen erniedrigt (Abbildung 5.10 B und C). Abbildung 5.10: Expressionsanalysen von IDO in HEp-2 Zellen (48 hpi). (A) Quantitative RT-PCR Analysen wiesen eine erhöhte Genexpression von IDO in C. pneumoniae infizierten und nicht-infizierten Zellen unter Hypoxie auf (n=3, **p 0,005, ***p 0,001). Die Western Blot Analysen (B) und die densitometrische Auswertung (C) wiesen hingegen eine reduzierte IDO Proteinexpression in infizierten und nicht-infizierten Zellen unter Hypoxie auf (n=3, **p 0,005).

65 Ergebnisse Beeinflussung weiterer IFN-γ regulierter Proteine durch Hypoxie Um die Analysen nicht nur auf die Mediatoren der Jak-STAT Signalkaskade zu beschränken, wurden Proteine deren Expression über die Jak-STAT Signalkaskade reguliert werden mittels quantitativer RT-PCR analysiert. Das IFN-γ induzierbare Protein 10 (IP-10) ist ein Chemokin, welches eine ISRE-Sequenz in seiner Promotorregion trägt [81]. Dadurch war IP-10 in den IFN-γ behandelten Zellen zu detektieren und wird diesbezüglich hier weiter beschrieben. IP-10 zeigte 4 hpi eine signifikant niedrigere Genexpression unter Hypoxie gegenüber Normoxie sowohl in C. pneumoniae infizierten als auch in nicht-infizierten Zellen (Abbildung 5.11 A). Interessanterweise fand im weiteren Verlauf der Infektion (24 hpi und 48 hpi) eine Gegenregulation von IP-10 statt. Daher lag in C. pneumoniae infizierten und nicht-infizierten Zellen eine signifikant reduziert Genexpression von IP-10 unter Normoxie gegenüber Hypoxie vor (Abbildung 5.11 B und C).

66 Ergebnisse 62 Abbildung 5.11: Quantitative RT-PCR von IP-10 in HEp-2 Zellen. (A) Die Genexpression von IP-10 war 4 hpi sowohl in nicht-infizierten als auch in C. pneumoniaeinfizierten Zellen unter Hypoxie signifikant reduziert. Eine erhöhte Genexpression lag 24 hpi (B) und 48 hpi (C) in nicht-infizierten und C. pneumoniae infizierten Zellen unter Hypoxie vor (n=3, *p 0,05, ***p 0,001).

67 Ergebnisse 63 Weiterhin wurde die Expression der über die Jak-STAT Signalkaskade regulierten Gene SOCS1 und SOCS3 analysiert. Eine Aktivierung der Expression wurde nur in IFN-γ behandelten Zellen detektiert, weshalb sich die folgenden Analysen auf IFN-γ behandelte Zellen beziehen. Eine Induktion der SOCS1 Expression durch IFN-γ zeigte sich ausschließlich 4 hpi und von SOCS3 4 hpi und 24 hpi, weshalb spätere Zeitpunkte nicht dargestellt wurden. Es zeigte sich, dass die Expression von SOCS1 (Abbildung 5.12) und SOCS3 (Abbildung 5.13 A) 4 hpi unter Normoxie in C. pneumoniae infizierten Zellen, im Vergleich zu nicht-infizierten Zellen signifikant erhöht war. Dagegen war eine signifikant niedrigere Expression in infizierten Zellen unter Hypoxie, gegenüber infizierten Zellen unter Normoxie, zu detektieren. Diese entsprach der Expression von nicht-infizierten Zellen. SOCS3 wies in nicht-infizierten und infizierten Zellen 24 hpi eine erniedrigte Genexpression unter Hypoxie gegenüber Normoxie auf (Abbildung 5.13 B). Abbildung 5.12: Quantitative RT-PCR von SOCS1 in HEp-2 Zellen. (A) In C. pneumoniae infizierten Zellen lag 4 hpi eine signifikant höhere Genexpression von SOCS1 unter Normoxie gegenüber Hypoxie vor (n=3, *p 0,05, ***p 0,001).

68 Ergebnisse 64 Abbildung 5.13: Quantitative RT-PCR von SOCS3 in HEp-2 Zellen. (A) Die Genexpression von SOCS3 war in infizierten Zellen 4 hpi unter Hypoxie gegenüber Normoxie reduziert. (B) Die Genexpression von SOCS3 war in C. pneumoniae infizierten und nicht-infizierten Zellen 24 hpi unter Hypoxie gegenüber Normoxie reduziert (n=3, *p 0,05, **p 0,005, ***p 0,001).

69 Ergebnisse Analyse von IL-6 unter Hypoxie Die erste Barriere gegen eine C. pneumoniae-infektion stellen die Epithelzellen der Atemwege dar. Eine Infektion führt zur Sekretion von proinflammatorischen Zytokinen. Hier sollte untersucht werden, ob das proinflammatorische Zytokin IL-6 während einer aktiven Infektion sowie in der Persistenz und der Reaktivierung exprimiert wird. Zusätzlich sollte dabei der Einfluss von Hypoxie untersucht werden. Dazu wurde das humane Lungengewebs-Modell und das Reaktivierungs-Modell genutzt. Es zeigte sich, dass eine akute Infektion (24 hpi) von humanem Lungengewebe eine signifikante IL-6 Expression unabhängig von der Sauerstoffkonzentration herbeiführte (Abbildung 5.14). Abbildung 5.14: Quantitative RT-PCR von IL-6 in C. pneumoniae infiziertem humanen Lungengewebe (24 hpi). Eine C. pneumoniae-infektion führte zu einer signifikant erhöhten IL-6 Expression unter Normoxie und Hypoxie (n=3, **p 0,005, ***p 0,001). Weiterhin wurde die IL-6 Expression in dem Reaktivierungs-Modell von Epithelzellen untersucht. In diesem Modell lag unter Normoxie eine persistente C. pneumoniae-infektion vor, wohingegen unter Hypoxie (96 h) eine zuvor persistente Infektion reaktiviert wurde. Eine C. pneumoniae-infektion führte unter Normoxie und Hypoxie, im Vergleich zu den nicht-infizierten, IFN-γ behandelten Zellen, zu einem signifikanten Anstieg der IL-6 Expression (Abbildung 5.15). Jedoch war die IL-6 Expression in infizierten Zellen geringer unter Hypoxie als unter Normoxie. IFN-γ führte bei nicht-infizierten Zellen ebenfalls zu einer erhöhten IL-6 Expression unter Normoxie und Hypoxie. Die IFN-γ induzierte IL-6 Expression in nicht-infizierten Zellen war hier ebenfalls unter Normoxie stärker als unter Hypoxie.

70 Ergebnisse 66 Abbildung 5.15: Quantitative RT-PCR von IL-6 in dem Reaktivierungs-Modell von C. pneumoniae infizierten HEp-2 Zellen. IFN-γ (10 U/ml) führte in nicht-infizierten Zellen zu einer Aktivierung der IL-6 Expression. Eine C. pneumoniae-infektion von IFN-γ stimulierten Zellen wies eine signifikant erhöhte IL-6 Expression gegenüber nicht-infizierten, IFN-γ stimulierten Zellen auf. Die induzierte IL-6 Expression war in nicht-infizierten, IFN-γ behandelten Zellen sowie in C. pneumoniae infizierten, IFN-γ behandelten Zellen unter Normoxie stärker als unter Hypoxie (n=3, *p 0,05, **p 0,005, ***p 0,001). 5.4 Einfluss von C. pneumoniae auf Differenzierungsprozesse von Epithelzellen Umbauprozesse (Remodeling) von Epithelzellen sind charakteristisch für das Fortschreiten von chronischen Atemwegserkrankungen wie der COPD. Ob eine C. pneumoniae Infektion zu einem Umbau von Lungenepithelzellen (A549) führte, sollte im folgenden Abschnitt untersucht werden. Anhand der Expression von E-Cadherin und α-sma sowie der Beweglichkeit von Epithelzellen, kann ein Umbauprozess charakterisiert werden Einfluss von C. pneumoniae auf E-Cadherin Um den Effekt einer C. pneumoniae-infektion auf das Remodeling von Lungenepithelzellen zu untersuchen, wurden A549 Zellen mit C. pneumoniae infiziert, sowie mit IFN-γ behandelt und unter Normoxie oder Hypoxie inkubiert. Mittels Western Blot Analysen wurde E-Cadherin untersucht. E-Cadherin ist hauptsächlich in Epithelzellen nachzuweisen und wird beim Zellumbau vermindert exprimiert. C. pneumoniae infizierte Zellen (48 hpi) wiesen im Vergleich zu nicht-infizierten Zellen eine signifikant verminderte Proteinexpression von

71 Ergebnisse 67 E-Cadherin auf (Abbildung 5.16 A und B). Dieser Abbau war unabhängig davon, ob eine akute oder persistente C. pneumoniae-infektion vorlag sowie unabhängig von der Sauerstoffkonzentration. Abbildung 5.16: Western Blot Analysen von E-Cadherin in A549 Zellen (48 hpi). Die Western Blot Analyse (A) und deren densitometrische Auswertung (B) ergaben, dass eine C. pneumoniae-infektion, unabhängig der IFN-γ Stimulation oder Sauerstoffkonzentration, zu einem Abbau von E-Cadherin führten (n=3, *p 0,05, ***p 0,001). Eine signifikant reduzierte Proteinexpression von E-Cadherin war unter Hypoxie gegenüber Normoxie in C. pneumoniae infizierten Zellen ohne IFN-γ Stimulation 96 hpi zu detektieren (Abbildung 5.17). Interessanterweise war auch in den nicht-infizierten, IFN-γ behandelten Zellen unter Normoxie eine geringere Expression von E-Cadherin zu verzeichnen. Diese Reduktion war bei einer persistenten Infektion stärker ausgeprägt. Die alleinige Zugabe von IFN-γ zu hypoxischen Zellen hatte wiederum keinen Einfluss auf die E-Cadherin Expression.

72 Ergebnisse 68 Abbildung 5.17: Western Blot Analysen von E-Cadherin in A549 Zellen (96 hpi). Die Western Blot Analysen (A) und deren densitometrische Auswertung (B) zeigten eine reduzierte E-Cadherin Expression in C. pneumoniae infizierten Zellen unter Hypoxie. Unter Normoxie führte IFN-γ (10 U/ml) zu einem Abbau von E-Cadherin, wobei der Abbau bei zusätzlicher C. pneumoniae- Infektion verstärkt war (n=3, *p 0,05, ***p 0,001) Einfluss von C. pneumoniae auf α-smooth muscle actin (α-sma) Eine Expression von α-sma ist in Zellen mit mesenchymalem Phänotyp zu finden, tritt jedoch nur schwach in Epithelzellen auf. α-sma wurde mittels Fluoreszenzfärbung nachgewiesen und dessen Intensität wurde ausgewertet. Die Fluoreszenz von infizierten Zellen unter Normoxie war stärker als von nicht-infizierten Zellen (Abbildung 5.18 A und B). Dabei machte es keinen Unterschied ob eine akute oder persistente C. pneumoniae-infektion vorlag. Unter Hypoxie war die Fluoreszenzintensität der α-sma Expression in infizierten Zellen ohne IFN-γ Behandlung verglichen mit einer normoxischen Infektion weiter erhöht.

73 Ergebnisse 69 Abbildung 5.18: Fluoreszenzfärbung von α-sma in A549 Zellen (72 hpi). (A) α-sma (rot) und C. pneumoniae Einschlusskörper (grün) wurden mittels Fluoreszenzfärbung in A549 Zellen detektiert. (B) Die Intensitätsauswertung der Fluoreszenz zeigte, dass α-sma in infizierten Zellen unter Normoxie, unabhängig von IFN-γ, erhöht war. Ein signifikanter Anstieg der α-sma Fluoreszenzintensität war in C. pneumoniae infizierten Zellen ohne IFN-γ Stimulation unter Hypoxie gegenüber Normoxie zu verzeichnen (n=3, *p 0,05, **p 0,005).

74 Ergebnisse Migrationsanalyse von C. pneumoniae infizierten Zellen Ein Charakteristikum von Zellen mit mesenchymalen Phänotyp ist eine erhöhte Beweglichkeit. Um zu untersuchen, ob C. pneumoniae infizierte Zellen ebenfalls stärker migrieren als nicht-infizierte Zellen, wurde deren Beweglichkeit mittels Live-Cell Imaging analysiert (Abbildung 5.19). Dabei zeigte sich, dass unter Normoxie zwischen hpi infizierte Zellen eine 3,5-fache und zwischen hpi eine 1,8-fache größere Distanz migrierten, als nicht-infizierte Zellen. Abbildung 5.19: Migrationsanalyse von C. pneumoniae infizierten A549 Zellen unter Normoxie. C. pneumoniae infizierte und nicht-infizierte Zellen wurden mittels Live-Cell Imaging aufgenommen und deren Beweglichkeit analysiert. Zwischen hpi und hpi migrierten infizierte Zellen eine größere Distanz als nicht-infizierte Zellen (n=3, ***p 0,001) TGF-β unabhängige C. pneumoniae vermittelte Remodelingprozesse TGF-β (transforming growth factor-β) ist der am besten beschriebene Mediator des Remodelings in Lungenepithelzellen. In dieser Arbeit sollte untersucht werden, ob das durch C. pneumoniae induzierte Remodeling abhängig von diesem Zytokin ist. Es zeigte sich, dass eine Inhibition der Signalübertragung von TGF-β durch den Inhibitor SB keine Auswirkungen auf den Abbau von E-Cadherin durch eine Infektion (48 hpi) hatte (Abbildung 5.20 A und B). Daher zeigten die Bandenintensitäten der Western Blot Analysen, weder unter Normoxie noch unter Hypoxie, einen Unterschied zwischen Inhibitor-behandelten und nicht-behandelten Zellen.

75 Ergebnisse 71 Abbildung 5.20: Western Blot Analysen der Inhibition der TGF-β Signaltransduktion durch SB in C. pneumoniae infizierten A549 Zellen. Die Western Blot Analysen (A) und die densitometrische Auswertung (B) zeigten, dass weder unter Normoxie noch unter Hypoxie der Inhibitor SB (5 µm) einen Einfluss auf den Abbau von E-Cadherin durch C. pneumoniae (48 hpi) hatte (n=3) Beteiligung von HIF-1 an C. pneumoniae vermittelten Remodelingprozessen Da viele Funktionen der Zelle unter hypoxischen Bedingungen über den Transkriptionsfaktor HIF-1 reguliert werden, wurde untersucht ob HIF-1 ebenfalls bei dem ausgeprägtem Abbau von E-Cadherin in infizierten Zellen unter Hypoxie eine Rolle spielt. Dazu wurde die Untereinheit HIF-1α mittels RNA-Interferenz unter Hypoxie inhibiert und der Abbau von E-Cadherin untersucht. Der Erfolg der Inhibition konnte im Western Blot dargestellt werden (Abbildung 5.21 A). Es zeigte sich 48 hpi ein signifikanter Anstieg der E-Cadherin Expression durch die sirna in nicht-infizierten, IFN-γ behandelten Zellen (Abbildung 5.21 A und B). Die sirna hatte hingegen keinen Einfluss auf den Abbau von E-Cadherin in C. pneumoniae infizierten Zellen.

76 Ergebnisse 72 Abbildung 5.21: Western Blot Analysen von E-Cadherin in A549 Zellen unter Hypoxie mit sirna gegen HIF-1α (48 hpi). (A) Die Western Blot Analysen zeigten, dass HIF-1α durch die sirna herunterreguliert wurde. (B) Die densitometrische Auswertung von E-Cadherin ergab, dass Zellen mit einer Inhibition von HIF-1α eine unveränderte Expression von E-Cadherin gegenüber Zellen die mit der Kontroll-siRNA behandelt wurden aufwiesen. Nur in nicht-infizierten, IFN-γ behandelten Zellen konnte ein signifikanter Anstieg der Expression durch eine HIF-1α Inhibition detektiert werden (n=3, ***p 0,001). Auch 96 hpi konnte HIF-1α mittels sirna signifikant inhibiert werden (Abbildung 5.22 A). RNA-Interferenz von HIF-1α führte, im Vergleich zu den Zellen die mit der Kontroll-siRNA behandelt wurden, in allen Konditionen zu einer erniedrigten Expression von E-Cadherin (Abbildung 5.22 A und B). Nur in C. pneumoniae infizierten Zellen war die Reduktion von E-Cadherin durch die sirna nicht signifikant.

77 Ergebnisse 73 Abbildung 5.22: Western Blot Analysen von E-Cadherin in A549 Zellen unter Hypoxie mit sirna gegen HIF-1α (96 hpi). (A) Die Western Blot Analysen zeigte, dass HIF-1α durch die sirna herunterreguliert wurde. (B) Die densitometrische Auswertung von E-Cadherin zeigte, dass eine signifikant reduzierte Expression von E-Cadherin in Zellen die mit der sirna gegen HIF-1α behandelt wurden vorlag. Nur C. pneumoniae infizierte Zellen ohne IFN-γ Stimulation zeigten keinen signifikanten Unterschied (n=3, *p 0,05, ***p 0,001). Da zuvor beschrieben wurde, dass CPAF in der späten Phase der Infektion HIF-1α degradiert, wurde die Expression von CPAF in infizierten Zellen (48 hpi) unter Normoxie und Hypoxie analysiert. Die Expression von CPAF war hoch in infizierten Zellen unter Hypoxie, die mit oder ohne IFN-γ stimuliert wurden. Dagegen konnte keine Expression von CPAF in infizierten Zellen unter Normoxie detektiert werden (Abbildung 5.23).

78 Ergebnisse 74 Abbildung 5.23: Western Blot Analysen von CPAF in C. pneumoniae infizierten A549 Zellen (48 hpi). Die Western Blot Analysen (A) und deren densitometrische Auswertung (B) zeigten, dass nur in infizierten Zellen unter Hypoxie und nicht unter Normoxie CPAF nachzuweisen war (n=4, ***p 0,001).

79 Ergebnisse Etablierung von Transkriptom-Analysen Um einen besseren Einblick in die transkriptionelle Regulation von C. pneumoniae unter Normoxie und Hypoxie zu bekommen, sollten Transkriptom Analysen mittels RNA-Sequenzierung etabliert werden. Zum Vergleich auf welche Weise das chlamydiale Transkriptom am besten dargestellt werden kann, wurden zwei verschiedene Aufreinigungs-Methoden analysiert. Die Auswertung der BioAnalyzer Daten zeigte, dass die Abreicherung der humanen rrna bei der Aufreinigung 2 effizienter war, als in der Aufreinigung 1 (Daten nicht dargestellt). Bei der Aufreinigung 2 entfielen noch 6,5% der RNA in der Probe auf die 28S rrna und 0,2% auf die 18S rrna, wohingegen noch 26,3% auf die 28S rrna und 1,1% auf die 18S rrna bei der Aufreinigung 1 zurückfielen. Die RNA wurde in 3 Ansätzen parallel sequenziert. Um eine höhere Anzahl an Sequenzen für die folgenden Auswertungen zu erhalten, wurden die 3 Sequenzierungen zusammen analysiert. Es zeigte sich eine 5x höhere Ausbeute an Reads (vom Sequenzierer gemessene kleine Sequenzstücke) bei der Aufreinigung 2 verglichen zu der Aufreinigung 1 ( vs ) (Abbildung 5.24). Die Reads wurden mit dem chlamydialen und humanen Genom abgeglichen. Nur 5% der Sequenzen von Aufreinigung 1 konnten auf das chlamydiale Genom zugeordnet werden, wohingegen 8% von der Aufreinigung 2 zugeordnet werden konnten. Bei beiden Methoden ging jedoch der größte Teil der Sequenzen auf das humane Genom zurück. Zudem konnte ein Teil der Sequenzen auf keines der beiden Genome zugeordnet werden. Um auszuschließen, dass es sich bei diesen Sequenzen um Kontaminationen, z.b. durch eine Mykoplasmen-Infektion der Zellkultur handelt, wurden die Sequenzen mit den Genomen von Mycoplasma genitalium sowie Mycoplasma hominis verglichen. Die Sequenzen konnten jedoch nicht zu einem der Referenzgenome zugeordnet werden (Daten nicht dargestellt).

80 Ergebnisse 76 Abbildung 5.24: Zuordnung der Sequenzen auf das humane und chlamydiale Genom. Bei der Sequenzierung der Aufreinigung 1 (A) konnten 5% der Reads auf das chlamydiale Genom abgebildet werden und bei der Aufreinigung 2 (B) 8%. Die Reads wurden von 3 Sequenzierungen addiert.

81 Ergebnisse 77 Folgend wurde die Abdeckung des chlamydialen Genoms genauer betrachtet. Es wurde analysiert wie häufig Gene eine bestimmte Abdeckung an Sequenzen aufwiesen (Abbildung 5.25). In der Aufreinigung 1 wies der Großteil der Gene eine Abdeckung < 10 auf. Höhere Abdeckungen (bis zu 120) fanden sich nur noch vereinzelt wieder. Dahingegen zeigte die Aufreinigung 2, dass die meisten Gene eine Abdeckung von ca. 50 aufwiesen. Bei einzelnen Genen konnte eine Abdeckung bis zu 250 nachgewiesen werden. Abbildung 5.25: Häufigkeit der Sequenz-Abdeckung pro Gen. In der Aufreinigung 1 (A) zeigten viele Gene eine geringe Sequenzabdeckung, wohingegen bei der Aufreinigung 2 (B) die Gene im Durchschnitt eine Abdeckung von ca. 50 aufwiesen. Bei weiteren Analysen sollte näher charakterisiert werden, ob die Aufreinigung 1 und 2 einen Einfluss auf das Expressionsprofil der mrna hatte. Dafür wurde mittels einer quantitativen RT-PCR die Expression verschiedenster chlamydialer Gene in den Aufreinigungen mit der Expression in cdna von total-rna verglichen (Abbildung 5.26). Die Mehrzahl der Gene in der Aufreinigung 2 war, verglichen zu der total-rna, erhöht. Dahingegen wiesen die Expressionen der meisten Gene der Aufreinigung 1 eine ähnliche Expression auf wie die total-rna.

82 Ergebnisse 78 Abbildung 5.26: Vergleich der mrna Expression von chlamydialen Genen zwischen verschiedenen RNA-Aufreinigungen. Die Genexpressionen (24 hpi) der Aufreinigung 1 und Aufreinigung 2 wurden mit der Genexpression von total-rna verglichen. Die Aufreinigung 1 ähnelte der Genexpression der total-rna, wohingegen die Aufreinigung 2 erhöhte Expressionen aufwies (n=1).

83 Ergebnisse Etablierung von Metabolom-Analysen Um weitere Einsichten zu dem erhöhten Wachstum sowie der aufgehobenen Persistenzinduktion unter Hypoxie zu erhalten, wurde eine Metabolom-Analyse in Kooperation mit Constanze Müller aus der AG Schmitt-Kopplin, Abteilung Analytische BioGeoChemie des Helmholtz Zentrums München, durchgeführt. Dazu wurden HEp-2 Zellen mit und ohne C. pneumoniae-infektion sowie mit und ohne IFN-γ Stimulation unter Normoxie und Hypoxie analysiert Hauptkomponentenanalyse Um einen ersten visuellen Überblick über die Proben-Separation zu erhalten, wurde eine Hauptkomponentenanalyse der Massen, gemessen bei positiver Polarität im FT/ICR-MS, durchgeführt. Zur besseren Darstellung wurden die normoxischen von den hypoxischen Konditionen getrennt analysiert. Unter Normoxie zeigte sich, dass die 10 Replikate einer Kondition jeweils eine Gruppe bildeten (Abbildung 5.27 A). Dabei unterschieden sich die Replikate der akut infizierten Zellen sowie der IFN-γ behandelten Zellen unter Normoxie von den beiden anderen Konditionen. Lediglich die Replikate der nicht-infizierten Zellen überschnitten sich mit denen der persistenten Infektion. Unter Hypoxie bildeten die 10 Replikate einer Kondition ebenfalls jeweils eine Gruppe, wobei die verschiedenen Konditionen eindeutig voneinander separiert werden konnten (Abbildung 5.27 B).

84 Ergebnisse 80 Abbildung 5.27: Hauptkomponentenanalyse des Datensets. Jeweils ein Punkt stellt eine Probe dar. 10 Replikate pro Kondition wurden unter Normoxie (A) und Hypoxie (B) analysiert. Dabei zeigte sich unter Normoxie und Hypoxie, dass die Replikate einer Kondition jeweils eine Gruppe bildeten. Unter Normoxie waren die IFN-γ stimulierten, nicht-infizierten und C. pneumoniae infizierten Zellen getrennt voneinander darzustellen, wohingegen die nicht-infizierten und C. pneumoniae infizierten Zellen nicht voneinander separierten. Unter Hypoxie separierten die Konditionen voneinander (n=10).

85 Ergebnisse Unterschiede der Metabolite in infizierten Zellen unter Normoxie und Hypoxie Die für die Infektion relevanten Metabolite, welche sich bei einer Infektion unter Normoxie und Hypoxie unterschieden, wurden annotiert und in die Datenbank KEGG (Kyoto Encyclopedia of Genes and Genomes) geladen, um eine Übersicht der veränderten Stoffwechselwegen zu erhalten. In C. pneumoniae infizierten Zellen ohne IFN-γ Behandlung waren in allen Stoffwechselwegen Metabolite zu detektieren, die unter Normoxie höher waren als unter Hypoxie. Ebenfalls waren Metabolite in einigen Stoffwechselwegen zu detektieren die signifikant höher unter Hypoxie als unter Normoxie waren. Diese fanden sich vor allem im Lipid-Metabolismus wieder. Während einer Infektion unter Normoxie mit IFN-γ Stimulation wurden ebenfalls in allen Stoffwechselwegen Metabolite mit erhöhter Konzentration zu Hypoxie gefunden. Dahingegen waren nur 3 Metabolite, die zum Aminosäure-Metabolismus gehörten, unter Hypoxie erhöht. Tabelle 5.1: Übersicht über die Veränderung der Stoffwechselwege der Infektion relevanter Metabolite. Analysiert wurde wie viele Metabolite in dem jeweiligen Stoffwechselweg erhöht in der entsprechenden Kondition vorlagen. Cpn Cpn + IFN-γ Metabolismus von 20% O 2 > 2% O 2 20% O 2 < 2% O 2 20% O 2 > 2% O 2 20% O 2 < 2% O 2 Kohlenhydraten Energie Lipiden Aminosäuren Nukleotiden Glykanen Kofaktoren + Vitaminen

86 Ergebnisse 82 Zur Validierung dieser Methode sollte Tryptophan herangezogen werden. Tryptophan wird von IFN-γ induziertem IDO abgebaut und trägt damit zur Persistenzinduktion von C. pneumoniae bei. In ersten Analysen zeigte sich eine verminderte Expression von IDO unter Hypoxie (Abschnitt 5.2.2), weshalb die Vermutung vorlag, dass Tryptophan unter Hypoxie in höherer Konzentration vorliegen müsste. Tatsächlich konnte Tryptophan in dieser Metabolom-Analyse als ein für die Infektion relevantes Metabolit in IFN-γ behandelten Zellen detektiert werden. Die Massenintensität von Tryptophan war unter Hypoxie höher als unter Normoxie. Daher wurde die Massenintensität von Tryptophan über das gesamte Datenset analysiert (Abbildung 5.28). Es zeigte sich ein Abbau von Tryptophan in IFN-γ behandelten Zellen. Jedoch war der Abbau signifikant stärker unter Normoxie als unter Hypoxie. Zudem konnte auch in C. pneumoniae infizierten Zellen ein geringerer Abbau detektiert werden. Abbildung 5.28: Massenintensität von Tryptophan in IFN-γ behandelten HEp-2 Zellen. Tryptophan wurde mittels FT/ICR-MS detektiert und dessen Massenintensität dargestellt. Tryptophan wurde verstärkt unter Normoxie in IFN-γ (10 U/ml) behandelten Zellen abgebaut und weniger unter Hypoxie (n=10, * p 0,05, **p 0,005, ***p 0,001).

87 Diskussion 83 6 Diskussion 6.1 Hypoxie verhindert die Persistenzinduktion von C. pneumoniae COPD ist eine chronische Erkrankung der Lunge, die sich in unterschiedlichen Stadien mit dem Bild einer chronischen Bronchitis oder eines Lungenemphysems manifestieren kann. Ursächlich hierfür wird ein chronisch-rezidivierender Entzündungsprozess angenommen. Das vorherrschende Zytokinprofil in der Lunge von COPD-Patienten ist das einer Th1-vermittelten Immunantwort, mit IFN-γ als Hauptakteur [55]. In der Lunge wird IFN-γ zur Abwehr von einer Reihe bakterieller und viraler Infektionen benötigt [107]. Dazu zählen auch Infektionen mit C. pneumoniae. Jedoch führt eine niedrige IFN-γ Konzentration nicht zum Absterben von C. pneumoniae, sondern löst die Persistenz aus [9]. In einer Studie von Knobloch et al. wiesen gerade Th-1 Lymphozyten von Rauchern mit einer COPD eine verminderte Immunantwort und damit eine reduzierte Sekretion von IFN-γ gegen Gram-negative Bakterien auf [60]. Eine unzureichende IFN-γ Konzentration in Patienten mit COPD könnte demnach die Persistenzinduktion von C. pneumoniae begünstigen. Ein wesentliches Charakteristikum in der Pathophysiologie der COPD ist die emphysematöse Lungenschädigungen und Verdickung der Atemwegswände der kleinen Bronchien. Dadurch wird die elastische Rückstellkraft der Lunge von COPD Patienten reduziert, welche zur Ausatmung benötigt wird. Als Folge sinkt die Sauerstoffverfügbarkeit der Lunge durch Lufteinschlüsse (trapped air) [47;48;77]. Weiterhin können Entzündungsprozesse durch den Einstrom von Entzündungszellen zu einer verminderten Sauerstoffverfügbarkeit im Gewebe beitragen [14]. Bisher ist bekannt, dass niedrige Sauerstoffkonzentrationen einen positiven Einfluss auf das Wachstum von C. pneumoniae ausüben. So liegt eine höhere Infektionsrate und ein besseres Wachstum von C. pneumoniae bei niedrigen Sauerstoffkonzentrationen vor [56]. Voraussetzung hierfür ist jedoch die Stabilisierung von HIF-1α, dem zentralen Regulator zur Aufrechterhaltung der Homöostase unter Hypoxie [97]. Unklar war bislang, ob die umgebende Sauerstoffkonzentration auch einen Einfluss auf die IFN-γ vermittelte Persistenz von C. pneumoniae hat. Es konnte in der vorliegenden Arbeit gezeigt werden, dass Hypoxie die IFN-γ induzierte Persistenz von C. pneumoniae verhindert. Dabei entsprach die Morphologie der Inklusion und die Wiederanzuchtsrate von C. pneumoniae mit IFN-γ Behandlung den Kontrollen ohne

88 Diskussion 84 IFN-γ unter Normoxie. Die durch IFN-γ induzierte Immunantwort ist demzufolge bei niedrigen Sauerstoffverhältnissen nicht ausreichend, um das intrazelluläre Wachstum von C. pneumoniae in Epithelzellen zu unterdrücken. Eine reduzierte IFN-γ Aktivität durch eine verminderte Sauerstoffverfügbarkeit in der Lunge könnte auch für andere respiratorische Erreger eine Rolle spielen. So wurde in der Studie von Aberle et al. eine geringe IFN-γ Konzentration mit dem Schweregrad einer Respiratorischen Synzytial-Virus-Infektion (RSV) assoziiert. RSV-Infektionen sind ursächlich für akute Atemwegserkrankungen, die vor allem bei Säuglingen zur Entwicklung von unteren Atemwegserkrankungen (z.b. Bronchitis) führen können. Kinder mit einer niedrigen IFN-γ Konzentration im Blut wiesen einen schwereren Verlauf der Infektion auf, als Kindern mit einer höheren IFN-γ Konzentration [1]. Zudem wurde gezeigt, dass die Replikation und Knospung von RSV von der Aktivität der PKCδ/HIF-1α/NF-κB Signalkaskade abhängig ist [71]. Dadurch könnte eine RSV-Infektion unter Hypoxie begünstigt werden. Hypoxie scheint darüber hinaus eine Vielzahl von Bakterien und Viren hinsichtlich der Pathogenität und des Wachstumsverhalten zu beeinflussen [25]. So wies z.b. Pseudomonas aeruginosa unter Hypoxie eine erhöhte Biofilmproduktion auf; Herpes simplex Viren zeigten ein gesteigertes Wachstum und das Humane Herpesvirus-8 ging von einer latenten in eine lytische Infektion über [2;21;25;122]. In dieser Arbeit zeigte sich, dass schon Sauerstoffkonzentrationen 3% ausreichten, um die Persistenz von C. pneumoniae durch IFN-γ zu induzieren. Bei einem Anstieg der Sauerstoffkonzentration von 2% auf 3% gab es einen starken Abfall der Größe der Einschlusskörper und Wiederanzuchtsrate. Dies könnte bedeuten, dass C. pneumoniae im Peribronchialgewebe, in dem Sauerstoffkonzentrationen von ca. 4-6% vorherrschen [46;64], persistieren und erst im Rahmen von entzündlichen Prozessen die mit einem Absinken der Sauerstoffkonzentration einhergehen erneut replizieren. Im Falle einer unzureichenden Immunantwort des Wirts unterliegen persistente Chlamydien Reaktivierungen. In vitro geschieht die Reaktivierung durch Aufhebung des Persistenzstimulus. In vivo sind hingegen Faktoren welche die Reaktivierung begünstigen, bislang nicht beschrieben. In dieser Arbeit konnte gezeigt werden, dass eine Reduktion der Sauerstoffverfügbarkeit dazu führte, dass persistente C. pneumoniae wieder in den replikativen Entwicklungszyklus eintreten. Es ist anzunehmen, dass unter pathophysiologischen Bedingungen in der Lunge, bei denen

89 Diskussion 85 die Sauerstoffverfügbarkeit abnimmt eine C. pneumoniae-infektion reaktiviert, benachbarte Zellen infiziert und der Entzündungsprozess aufrecht erhalten wird. 6.2 Hypoxie reduziert die Aktivität der Jak-STAT Signalkaskade Ausschlaggebend bei der IFN-γ induzierten Persistenz von C. pneumoniae ist der Tryptophanabbau durch IDO [86]. IDO ist das erste Enzym des Kynurenin- Stoffwechselwegs und spaltet oxidativ den Indolring des Tryptophans, wodurch N-Formylkynurenin entsteht. Die Induktion von IDO erfolgt über die IFN-γ induzierte Jak-STAT Signalkaskade [79]. Nach Bindung von IFN-γ an den Rezeptor findet eine Aktivierung von STAT1 durch Phosphorylierung des Tyrosins 701 und Serin 727 statt [118]. Beide Phosphorylierungen werden für die maximale Aktivität von STAT1 benötigt [118]. In der vorliegenden Arbeit war die IFN-γ induzierte Phosphorylierung am Serin 727 (4 hpi) in infizierten Zellen unter Normoxie und Hypoxie unverändert. Dahingegen war die durch IFN-γ induzierte Phosphorylierung am Tyrosin 701 unter Normoxie in C. pneumoniae infizierten Zellen (4 hpi) höher als in nicht-infizierten Zellen. Da eine erhöhte Tyrosin-Phosphorylierung vorlag, ist anzunehmen, dass C. pneumoniae infizierte Epithelzellen unter Normoxie während der frühen Phase der Infektion eine erhöhte STAT1 Aktivität aufweisen und damit die IFN-γ aktivierte antimikrobielle Antwort verstärken. Damit werden die Befunde von Lad et al. gestützt, in denen eine Chlamydien-Infektion ebenfalls zu einer verstärkten Aktivität einiger Mediatoren der Jak-STAT Signalkaskade führte [62]. Erstaunlicherweise wurde die erhöhte Tyrosin-Phosphorylierung in C. pneumoniae infizierten Zellen durch hypoxische Bedingungen aufgehoben. Daher ist anzunehmen, dass die STAT1 Aktivität in infizierten Zellen unter Hypoxie schwächer ist als unter Normoxie. Diese Vermutung spiegelte sich ebenfalls in der Expression von IFN-γ regulierten Genen wieder (IDO, IP-10, SOCS1, SOCS3), die unter Hypoxie signifikant reduziert vorlagen. Dies lässt darauf schließen, dass die gesamte IFN-γ induzierte Jak-STAT Signalkaskade in der frühen Phase der Infektion unter Hypoxie eine verminderte Aktivität aufwies. Bei der Expression von IDO zeigte sich, dass diese nicht nur in infizierten Zellen sondern auch in nicht-infizierten Zellen unter hypoxischen Bedingungen herunterreguliert war. Roth et al. zeigten zusätzlich eine verminderte Enzymaktivität von IDO bei geringer Sauerstoffverfügbarkeit [96]. Eine geringe IDO Expression in hypoxischen Zellen

90 Diskussion 86 lässt auf eine höhere Konzentration an Tryptophan schließen. Da ein Tryptophanentzug das Wachstum von C. pneumoniae einschränkt und die Persistenz induziert [86], ist eine erhöhte Tryptophankonzentration unter Hypoxie eine mögliche Erklärung, weshalb C. pneumoniae in Hypoxie nicht persistiert. Auch andere Pathogene werden von einem Tryptophanabbau durch IFN-γ induziertes IDO beeinflusst. Dazu zählen Toxoplasmen, Streptokokken, Enterokokken und Staphylokokken [68;69;90;102]. Diese Erreger könnten folglich ebenfalls von einer geringen Sauerstoffverfügbarkeit profitieren. Untersuchungen von Ivanov et al. zum Einfluss von Hypoxie auf die STAT1-Expression zeigten, dass die Expression von STAT1 unter hypoxischen Bedingungen in einem HIF-1 abhängigem Prozess erniedrigt war [53]. HIF-1α wird bei ausreichender Sauerstoffverfügbarkeit durch VHL abgebaut, bleibt jedoch stabil unter Hypoxie und induziert als Transkriptionsfaktor u.a. Gene der Glykolyse, Angiogenese und des Zellüberlebens [103]. Durch hypoxische HIF-1α Stabilisierung oder in VHL-defizienten Zellen zeigte sich eine erhöhte STRA13 (stimulated with retinoic acid 13) Expression, einem Transkriptionsfaktor der bhlh Familie (basic helix-loop-helix). Dieser weist eine Hemmungsaktivität gegenüber STAT1 auf. Eine negative Wirkung von HIF-1 auf die Phosphorylierung von STAT1 am Tyrosin 701 konnte in VHL-defizienten Zellen jedoch nicht nachgewiesen werden [53]. Daher ist anzunehmen, dass die hier gezeigte Reduzierung der Tyrosin-Phosphorylierung durch Hypoxie nicht durch HIF-1 bedingt war. Die Signaltransduktion der Jak-STAT Signalkaskade wird über IFN-γ induzierte SOCS-Proteine reguliert [5]. SOCS-Proteine können mit ihrer SH-2 Domäne Tyrosin-Phosphorylierungen binden, die am IFNGR oder am Jak-Protein zu finden sind. Dadurch inhibieren sie die Aktivität der Jaks, konkurrieren um diese Bindestelle mit STAT1 oder markieren die gebundenen Signalmoleküle zur Degradation durch das Proteasom [123]. In der Forschungsarbeit von Yang et al. wurde bei einer C. pneumoniae-infektion von Mäusen eine erhöhte SOCS1 und SOCS3 Expression im Lungengewebe nachgewiesen, wodurch eine unkontrollierte IFN-γ Signalwirkung verhindert wurde. SOCS1-defiziente Mäuse wiesen zwar eine niedrigere Bakterienlast von C. pneumoniae auf, die mit einer erhöhten IDO Expression in der Lunge einherging, jedoch starben diese Mäuse auf Grund von schwerer Lungenentzündung [125]. Der in der vorliegenden Arbeit beschriebene Effekt der reduzierten IDO Expression unter Hypoxie scheint jedoch SOCS

91 Diskussion 87 unabhängig zu sein, da nach Stimulation mit IFN-γ unter Hypoxie SOCS1 und SOCS3 ebenfalls erniedrigt in infizierten Zellen vorlagen. IDO trägt ein GAS-Element in seiner Promotorregion, wodurch es über die Jak-STAT Signalkaskade induziert wird [18]. Jedoch waren nicht nur über das GAS- Element aktivierte IFN-γ regulierte Gene unter Hypoxie vermindert exprimiert, auch IP-10, welches über eine ISRE-Sequenz aktiviert wird [81], zeigte eine verminderte Expression unter Hypoxie (4 hpi). Da u.a. Typ I Interferone die Transkription von Genen mit einer ISRE-Sequenz induzieren, wäre es möglich, dass auch Typ I Interferone eine geringere Wirkung unter Hypoxie aufweisen. Die reduzierte Expression des Chemokins IP-10 unter Hypoxie könnte zudem Auswirkungen auf die Th1 Lymphozyten Rekrutierung haben, da dieses Chemokin über den C-X-C Chemokinrezeptor Typ 3 (CXCR3) zur Rekrutierung von Th1 Immunzellen führt [13]. Im Gegensatz zu der frühen Phase der Infektion (4 hpi) lag in den späteren Phasen (24 hpi und 48 hpi) kein signifikanter Unterschied zwischen Normoxie und Hypoxie in der IFN-γ induzierten Phosphorylierung des Tyrosins 701 sowie Serins 727 am STAT1 in infizierten Zellen vor. In nicht-infizierten Zellen 48 hpi lag hingegen eine erhöhte Tyrosin-Phosphorylierung am STAT1 unter Hypoxie verglichen zu Normoxie vor. Gleichzeitig mit der gesteigerten Tyrosin-Phosphorylierung am STAT1 unter Hypoxie, war auch die Genexpression von IP-10 und IDO in nicht-infizierten Zellen sowie C. pneumoniae infizierten Zellen unter Hypoxie gesteigert. Vermutlich lag eine kompensatorische Hochregulation der Jak-STAT Signalkaskade zu späten Zeitpunkten der Infektion unter Hypoxie vor. Erstaunlicherweise zeigte die IDO Proteinexpression keine Veränderung und verblieb unter Hypoxie, im Vergleich zu Normoxie, erniedrigt. Ein geringer Proteingehalt von IDO unter Hypoxie könnte zum einen Folge einer erhöhten Degradation des Proteins oder zum anderen einer länger dauernden post-trankriptionellen Modifizierungen von IDO unter Hypoxie sein. Bisher ist jedoch über Modifizierungen, die zur Feinabstimmung der IDO Expression beitragen wenig bekannt. Huck et al. zeigten, dass Stickstoffmonoxid (NO), gebildet durch die induzierbare Stickstoffmonoxid-Synthase (inos) in Epithelzellen, eine Degradation von IDO über das Proteasom begünstigt [49]. Jedoch konnte eine Beteiligung von NO an der reduzierten IDO Expression unter Hypoxie von Roth et al. ausgeschlossen werden, da sich die inos Expression unter Hypoxie nicht veränderte [96].

92 Diskussion Entzündungsvorgänge in persistent infizierten Zellen Der fortschreitende Lungengerüstumbau bei COPD-Patienten ist gekennzeichnet durch chronisch-rezidivierende Entzündungsvorgänge sowie Umbauprozesse. So konnte im Serum von COPD-Patienten eine erhöhte IL-6 Konzentration nachgewiesen werden [28]. Dieser Entzündungsmarker konnte in einer mehrjährigen Studie in Zusammenhang mit einem reduzierten FEV 1 gebracht werden, an dem das Fortschreiten einer COPD gemessen werden kann. Ein schneller Anstieg der IL-6 Sputumkonzentration wurde in Patienten mit hohen Exazerbationsraten und dadurch bedingtem reduzierten FEV 1 nachgewiesen. Patienten mit stabiler Erkrankung wiesen hingegen einen langsameren Anstieg der IL-6 Konzentration auf [26]. Ein Anstieg der IL-6 Expression konnte auch in vitro durch eine C. pneumoniae- Infektion gezeigt werden [29]. In der Regulation der IL-6 Expression ist NF-κB ein wichtiger Regulator [65]. Jedoch war der Nachweis einer C. pneumoniae-infektion in Lungengewebe von Patienten mit einer stabilen COPD Erkrankung (GOLD I-III) nicht mit einer erhöhten Expression von proinflammatorischen Zytokinen und einer Aktivierung des NF-κB Signalwegs verbunden [27]. Aus in vitro Versuchen ist zudem bekannt, dass bei langanhaltender, persistenter C. pneumoniae-infektion, wie sie mutmaßlich bei der COPD vorliegt, keine Wirtszell-Antwort, gemessen an der Sekretion von z.b. IL-8 und IL-11 auftritt [89]. In der vorliegenden Arbeit wurde untersucht, ob eine C. pneumoniae induzierte IL-6 Expression durch Hypoxie beeinflusst wird. Zudem wurde der Einfluss einer persistenten und reaktivierten Infektion durch Hypoxie auf die IL-6 Expression analysiert. Im humanen Lungengewebs-Modell induzierte eine akute C. pneumoniae-infektion die Expression von IL-6. Dabei hatte der Sauerstoffgehalt keinen Einfluss auf die Expression von IL-6. Daneben führte auch eine persistente C. pneumoniae-infektion zu einer vermehrten IL-6 Expression in Lungenepithelzellen. Damit werden die Befunde von Baltch et al. gestützt, in denen keine aktive C. pneumoniae-infektion notwendig war, um die IL-6 Expression zu stimulieren [7]. Interessanterweise führte eine durch Hypoxie reaktivierte C. pneumoniae-infektion zwar zu einer IL-6 Expression, doch war diese vermindert im Gegensatz zu einer persistenten Infektion. Eine in der Lunge erhöhte IL-6 Expression wurde von Pedroza et al. mit der Entstehung der pulmonalen Fibrose in Zusammenhang gebracht [87].

93 Diskussion 89 IL-6 weist in seiner Promotorregion eine IRF-1 Bindungsstelle auf [31]. Vermutlich konnte deshalb in der vorliegenden Arbeit ebenfalls eine erhöhte Expression von IL-6 in IFN-γ behandelten Zellen detektiert werden. Neben IP-10, welches ebenfalls eine IRF-1 Bindungsstelle aufweist, war auch die IFN-γ induzierte Expression von IL-6 unter Hypoxie geringer als unter Normoxie. Dies ist ebenfalls auf die verminderte IFN-γ Wirkung unter Hypoxie zurückzuführen. 6.4 C. pneumoniae vermittelt Umbauprozesse von Epithelzellen Es existieren verschiedene Entstehungsmodelle wie eine C. pneumoniae-infektion chronische Erkrankungen fördert. So wurde angenommen, dass infizierte Epithel- oder Endothelzellen Zytokine exprimieren, die zur Rekrutierung und Aktivierung von Immunzellen führen (Abbildung 6.1). Diese sekretieren weitere Zytokine und Wachstumsfaktoren, welche schließlich bei andauernder Ausschüttung zu Umbauprozessen und Vernarbung des Gewebes führen [104]. Zudem konnte gezeigt werden, dass eine C. pneumoniae-infektion von Makrophagen, die von COPD Patienten stammten, ein Ungleichgewicht von pro- und antiinflammatorischen Zytokinen herbeiführte, welches für die Entstehung von Umbauprozessen verantwortlich gemacht wurde [98].

94 Diskussion 90 Abbildung 6.1: Schematische Darstellung des Einfluss einer Chlamydien-Infektion auf Umbauprozesse von Gewebe. Durch eine Chlamydien-Infektion sekretieren Epithelzellen Zytokine, welche Immunzellen aktivieren. Eine chronische Ausschüttung von Zytokinen durch aktivierte Immunzellen führt zu Umbauprozessen und Vernarbung von Gewebe. Abbildung aus [104]. Ob eine C. pneumoniae-infektion von Epithelzellen tatsächlich Einfluss auf zelluläre Umbauprozesse hat, sollte anhand der Expression von E-Cadherin, α-sma und der Beweglichkeit von Epithelzellen untersucht werden. Es konnte gezeigt werden, dass eine C. pneumoniae-infektion unter Normoxie und Hypoxie die Differenzierung von Lungenepithelzellen induzierte, was gekennzeichnet war durch eine erniedrigte E-Cadherin und eine erhöhte α-sma Expression. E-Cadherin wird hauptsächlich in Epithelzellen exprimiert, wo es mit Cateninen interagiert und Adhärenzverbindungen bildet. Diese verbinden das Aktin zweier Zellen miteinander und bilden so eine dichte, polarisierte Zellschicht, die Barriere- und Transport-Funktionen übernimmt [37]. α-sma ist ein Bestandteil von Stressfasern in Myofibroblasten und daher ein sicherer Marker für die Differenzierung zu Myofibroblasten [23]. Ein Abbau von

95 Diskussion 91 E-Cadherin führt zum Verlust der Zell-Zell-Kontakte und durch die Expression von α-sma weisen die Zellen einen mesenchymalen Charakter auf. Weiterhin verändert sich während eines Remodelingprozess die Zusammensetzung der extrazellulären Matrix (z.b. Kollagen) [33]. Bereits Baumert et al. berichteten, dass eine C. pneumoniae-infektion von Fibroblasten und glatten Muskelzellen zu einer Herunterregulation von Typ I/II Kollagen und Fibronektin führt [8]. Durch verminderte Zellkontakte weisen Zellen mit mesenchymalem Charakter auch eine erhöhte Migrationsaktivität auf. Eine erhöhte Beweglichkeit konnte mittels Live-Cell Imaging bei infizierten Zellen unter Normoxie nachgewiesen werden und bestärken damit den Befund des strukturellen Umbaus der Zelle durch eine C. pneumoniae-infektion. Zuvor wurden niedrige Sauerstoffverhältnisse mit Umbauprozessen in Lungenepithelzellen in Zusammenhang gebracht. Dabei zeigten Zhou et al., dass ab dem achten Tag einer hypoxischen Inkubation Lungenepithelzellen einen mesenchymalen Phänotyp aufwiesen [126]. In der vorliegenden Arbeit konnte jedoch kein Umbau allein durch Hypoxie detektiert werden. Dennoch stehen diese Ergebnisse nicht im Gegensatz zueinander, da in dieser Arbeit frühere Zeitpunkte untersucht wurden. Des Weiteren zeigte sich, dass ein andauernder Stimulus von IFN-γ auf Epithelzellen in einer reduzierten E-Cadherin Expression resultierte. Dieser Effekt konnte jedoch nur unter Normoxie dargestellt werden, da unter Hypoxie die Wirkung von IFN-γ vermindert war. Schon zuvor wurde in einem Mausmodel gezeigt, dass die Überexpression von IFN-γ zu Emphysembildung sowie zu einem COPD-ähnlichen Phänotyp führte [115]. Umbauprozesse die durch IFN-γ induziert werden, könnten auch in anderen Infektionen bei denen eine IFN-γ Reaktion herbeigeführt wird eine Rolle spielen. Um den Mechanismus des Umbauprozesses durch C. pneumoniae zu charakterisieren, wurde die Rolle des am besten beschriebenen Mediators (TGF-β1) des Remodelings in Lungenepithelzellen analysiert. Die Wirkung von TGF-β1 erfolgt über Bindung an die TGF-β Rezeptoren Typ I, woraufhin diese multimere Rezeptormoleküle bilden. Die aktivierten Rezeptoren haben eine Serin/Threonin- Kinaseaktivität und phosphorylieren Rezeptor-regulierte SMAD-Proteine (small mother against decapentaplegic), welche im Zytosol einen Komplex mit Co-SMAD bilden. Der Komplex wandert in den Zellkern und kooperiert mit

96 Diskussion 92 weiteren DNA-Bindungspartnern, um die Expression spezifischer Zielgene zu aktivieren [66;72]. Für die Untersuchungen wurde ein Inhibitor (SB ) eingesetzt, der spezifisch die TGF-β Rezeptoren Typ I, ALK4 (activin receptor-like kinase), ALK5 und ALK7 inhibiert und dadurch die Signalübertragung durch TGF-β1 blockiert. Die weiteren ALKs, die wichtig für die Signalübertragung anderer Mitglieder der TGF-β Superfamilie sind, werden nicht durch SB inhibiert [52]. Es zeigte sich, dass der durch eine C. pneumoniae-infektion herbeigeführte E-Cadherin Abbau nicht durch eine Inhibition der TGF-β1 Signaltransduktion unterbunden werden konnte. Hier liegt somit ein TGF-β1 unabhängiges Ereignis vor. Der Remodelingprozess in dieser Arbeit war während einer Infektion (96 hpi) unter Hypoxie stärker ausgeprägt. Um zu analysieren, ob HIF-1 als zentraler Regulator der Homöostase unter Hypoxie einen Einfluss auf die Umbauprozesse hatte, wurden HIF-1α Inhibitions-Experimente durchgeführt. In der mittleren Phase der Infektion (48 hpi) spielte HIF-1 keine Rolle bei den Umbauprozessen und so zeigten Zellen, die durch RNA-Interferenz kein HIF-1α bildeten, keine Veränderung in ihrem Expressionsprofil von E-Cadherin. Dahingegen kam HIF-1α zu späteren Zeitpunkten (96 hpi) eine protektive Funktion zu. Es schützte vor einer mesenchymalen Differenzierung, denn in Zellen mit HIF-1α Inhibition zeigte sich eine Zunahme des E-Cadherin Abbaus. Allerdings wird HIF-1α in C. pneumoniae infizierten Zellen in der mittleren und späten Phase des Entwicklungszyklus von CPAF degradiert [97]. In infizierten Zellen unter Hypoxie wurde CPAF verstärkt exprimiert. Der verstärkte Abbau von E-Cadherin in infizierten Zellen unter Hypoxie könnte somit durch CPAF verursacht werden, welches direkt mit HIF-1α interagiert. Dadurch könnte in infizierten Zellen unter Hypoxie HIF-1 verursachte Reperaturmechanismen vermieden werden.

97 Diskussion Weiterführende Analysen zu C. pneumoniae Infektionen unter Hypoxie In dieser Arbeit stand die Analyse der IFN-γ induzierten Persistenz im Vordergrund. Um jedoch ein umfassenderes Bild der Wirt-Pathogen Interaktion unter Normoxie und Hypoxie zu bekommen, wurden weitergehende Analysen vorgenommen. Zuerst sollte eine Transkriptom Analyse etabliert werden, um für zukünftige Projekte Einblicke in die Unterschiede der transkriptionellen Regulation von C. pneumoniae unter Normoxie und Hypoxie zu bekommen. Durch die Entstehung von Sequenzierungen der zweiten Generation (next generation sequencing), wie der RNA-Sequenzierung ist es möglich geworden, die gesamten Transkripte einer Zelle (Transkriptom) während einer Entwicklungsphase oder einer physiologischen Kondition zu bestimmen. So bekommt man eine Momentaufnahme der Zelle [114]. Mit dieser quantitativen Methode ist es möglich, die bakterielle Regulation und auch Interaktion mit dem Wirt zu bewerten und zu beschreiben [32]. Der Anteil der mrna einer Zelle geht auf 3-5% der total-rna zurück. Deshalb wird eine Anreicherung der kodierenden RNA empfohlen, um den Anteil der Genabdeckung zu erhöhen [32]. Die Anreicherung von prokaryotischer mrna ist im Gegensatz zu eukaryotischer mrna, bei der die polya-enden der mrna zur Separation genutzt werden können, jedoch schwierig. Eine weitere Limitierung bei der Darstellung des Transkriptoms von C. pneumoniae ist die intrazelluläre Lebensweise, wodurch die bakterielle RNA nur in Kombination mit humaner RNA isoliert werden kann. Es gibt verschiedene Verfahren um die kodierenden RNAs einer Probe anzureichern. Albrecht et al. nutzten für das Transkriptom von C. trachomatis und C. pneumoniae ein Verfahren, um die 5 -Enden der primären Transkripte anzureichern. Dadurch konnten Transkriptionsstartpunkte analysiert werden [3;4]. In dieser Arbeit wurden zwei Methoden zur Reduktion des Gehalts an rrna sowie des humanen Hintergrundes angewendet und die Effizienzen verglichen. Es zeigte sich, dass die Aufreinigung 2 eine höhere Abreicherung des humanen Hintergrunds aufwies. Dadurch konnte eine höhere Anzahl an chlamydialen Reads und eine höhere Genabdeckung erzielt werden. Dagegen war die Abreicherung des humanen Hintergrunds bei der Aufreinigung 1 geringer, wodurch weniger Reads und eine geringere Genabdeckung erreicht wurden. Die Aufreinigung 2 zeigte, dass die meisten Gene eine Abdeckung von ca. 50 aufwiesen.

98 Diskussion 94 Dies stellte vermutlich den transkriptionellen Hintergrund dar. Dagegen wiesen in der Aufreinigung 1 nicht alle Gene eine Abdeckung auf und vermutlich wurden nur aktivierte Gene dargestellt. Durch eine höhere Anzahl an Sequenzierungen die pro Probe durchgeführt werden, könnte die Anzahl an Sequenzen erhöht werden, so dass die Aufreinigung 1 ebenfalls zur Darstellung des Transkriptoms geeignet wäre. Deutliche Unterschiede zwischen den beiden Aufreinigungs-Methoden zeigten sich bei dem Vergleich der Genexpression in der quantitativen RT-PCR verglichen mit der total-rna, die als Referenzexpression genutzt wurde. Die Aufreinigung 2 wies häufig ein abweichendes Expressionsprofil der analysierten Gene auf, wohingegen die Aufreinigung 1 der total-rna glich. Eine Erklärung dafür könnte die Differentialzentrifugation sein, welche in der Aufreinigung 2 noch vor der RNA-Isolation durchgeführt wurde. Aufgrund der starken Artefakte des Transkriptoms durch die Differentialzentrifugation ist diese Aufreinigung nicht für Transkriptom Analysen zu empfehlen. Zukünftig soll die Aufreinigung 1 genutzt werden, um Veränderungen des chlamydialen Transkriptoms durch eine hypoxische Inkubation zu analysieren. Auch für das Metabolom der Zelle sollte eine Momentaufnahme von verschiedenen Konditionen erstellt werden. Dazu wurde eine Methode durchgeführt, die nicht zielgerichtet (non-targeted) auf eine Hypothese war und schon in vorherigen Studien erfolgreich genutzt wurde, um z.b. den Einfluss von Metaboliten der Darm-Mikrobiota auf die chronisch entzündliche Darmerkrankung Morbus Crohn zu untersuchen [54]. Bei der Durchführung einer Hauptkomponentenanalyse mit den erhaltenen Massen aus dem FT/ICR-MS zeigte sich eine Gruppierung der Replikate und eine Separation der Konditionen voneinander. Dies bestätigte, dass eine hohe Reproduzierbarkeit vorlag und sich die Metabolome der verschiedenen Konditionen stark unterschieden. Nur die Gruppe der persistent infizierten Zellen ließ sich nicht von den nicht-infizierten Zellen unter Normoxie trennen. Der Einfluss von IFN-γ auf das Metabolom wurde demzufolge durch eine persistierende C. pneumoniae-infektion zum Teil aufgehoben und es glich einer nicht-infizierten Zelle. Vermutlich werden daher persistente C. pneumoniae-infektionen nicht richtig vom Wirt erkannt. Die Massen, welche zu der Separation der Konditionen führten und diskriminierend zwischen einer Infektion unter Normoxie und Hypoxie waren, zeigten Veränderungen in einem breitem Spektrum von Signalwegen. Es waren deutliche Unterschiede zwischen einer Infektion ohne IFN-γ in Normoxie und

99 Diskussion 95 Hypoxie sichtbar. Vor allem im Lipid- und Aminosäure-Metabolismus konnten viele unterschiedlich regulierte Metabolite annotiert werden. Es ist bekannt, dass das chlamydiale Genom einige Aminosäuretransporter kodiert, um Zwischenprodukte für ihre unvollständigen Biosynthesewege zu erhalten [57;94;105]. Davon wird der Aminosäure-Metabolismus in C. pneumoniae infizierten-zellen vermutlich beeinflusst. Zudem werden Wirtslipide, wie z.b. Sphingolipide, Phosphatidylcholin, Phosphatidylinositol und Cholesterol, in die Inklusion transloziert. Auch Chlamydien-spezifische verzweigtkettige Fettsäuren werden gebildet und in die Inklusionsmembran eingebaut, womit sie sich vor der phagolysosomalen Fusion schützen [16;39;40;121;124]. Welche Metabolite genau verändert sind und warum Infektionen unter Normoxie und Hypoxie zu diesen Unterschieden führen soll in weiteren Studien im Detail betrachtet werden. Veränderungen im Lipid-Metabolismus waren auch bei dem Vergleich einer persistenten Infektion unter Normoxie und einer aktiven Infektion unter Hypoxie mit IFN-γ Behandlung zu finden. Auffällig waren zudem die starken Veränderungen im Kohlenhydrat-Metabolismus. In diese Kategorie gehören u.a. die Glykolyse, der Zitratzyklus oder auch der Pentosephosphatweg. Schon zuvor wurde beschrieben, dass eine Chlamydien-Infektion mit einem erhöhten Kohlenhydrat-Metabolismus in der Wirtzelle verbunden ist, welches den hohen Energieverbrauch in infizierten Zellen kompensiert [83]. Auch unter hypoxischen Bedingungen konnte ein erhöhter Glukose-Verbrauch in C. pneumoniae infizierten Zellen in der ersten Phase des Entwicklungszyklus detektiert werden [97]. Zudem wurde zuvor in Studien, die u.a. die chlamydialen Gene der Glykolyse oder des Pentosephosphatwegs analysierten, gezeigt, dass diese sich in ihrer Regulation zwischen aktiver und persistenter Infektion unterschieden [35;75]. Dennoch bleibt in weiteren Einzelheiten zu klären, welche Metabolite verantwortlich für den Wechsel zwischen persistenten und aktiven Wachstum bei IFN-γ unter Normoxie und Hypoxie sind. Dazu beitragen könnte z.b. Tryptophan, welches in den IFN-γ behandelten Zellen während einer Infektion unter Hypoxie erhöht detektiert wurde und zur Validierung dieser Methode genutzt werden konnte. Bei der Betrachtung dieses Metabolits über alle analysierten Konditionen, zeigte sich, dass dessen Massenintensität mit der Expression von IDO korrelierte. Daher war ein starker Abbau von Tryptophan in IFN-γ behandelten Zellen unter Normoxie zu detektieren, wohingegen in Zellen unter Hypoxie, in denen die Expression von IDO reduziert war, ein geringerer Abbau nachzuweisen war. Somit

100 Diskussion 96 ließ sich mit dieser Methode die zuvor getätigte Vermutung bestätigen, dass bei einer Infektion unter Hypoxie eine höhere Konzentration an Tryptophan in der Zelle vorliegt. Damit hätte C. pneumoniae einen Wachstumsvorteil unter Hypoxie nach IFN-γ Stimulation. Obwohl diese Metabolom-Analyse nicht zielgerichtet auf eine Hypothese war, konnten zuvor getätigte Annahmen bestätigt und neue Ansatzpunkte gefunden werden, die in Zukunft weiter im Detail betrachtet werden sollen. Bisher wurden dabei jedoch nur die annotierten Metaboliten untersucht. Es ist weiterhin anzustreben, unbekannte Massen zu identifizieren, um eventuell Biomarker oder neue Angriffspunkte für Medikamente zu finden. 6.6 Schlussbetrachtung Aus den vorliegenden Ergebnissen wurde ein Modell entwickelt wie C. pneumoniae und der Einfluss von Hypoxie zu Umbauprozessen und dadurch zur Pathogenese der COPD beitragen könnten (Abbildung 6.2). Es zeigte sich, dass die antichlamydiale Aktivität von IFN-γ nur unter Normoxie auftrat und dort zur Persistenz führte. Bei einem Abfall der Sauerstoffkonzentration lag eine reduzierte IFN-γ Wirkung vor, die mit einer vermindert ablaufenden Jak-STAT Signalkaskade, geringer IDO Expression und dadurch erhöhter Tryptophankonzentration einherging. Dies war ein Stimulus zur Reaktivierung. Eine reaktivierte sowie akute und persistente C. pneumoniae Infektion war durch eine Entzündungsreaktion (IL-6) gekennzeichnet. Zudem wiesen Zellen mit persistenter oder akuter Infektion eine direkte Schädigung von Lungenepithelzellen auf. Die Entzündungsreaktion war jedoch vermehrt während einer persistenten Infektion zu detektieren, wohingegen zelluläre Umbauprozesse besonders stark während einer akuten Infektion unter Hypoxie zu detektieren waren. Daher sind persistente und durch Hypoxie reaktivierte Infektionen, die zu einer akuten Infektion führen, ein besonders starker Stimulus zur Pathogenese der COPD. Die hier etablierten Transkriptom- und Metabolom-Analysen können in Zukunft genutzt werden, um weitere Einblicke über den Einfluss von Hypoxie auf C. pneumoniae zu erhalten.

101 Diskussion 97 Abbildung 6.2: Modell zu C. pneumoniae induzierten Umbauprozessen. (1) C. pneumoniae infiziert Lungenepithelzellen was zu einer akuten Infektion führt. (2) Bei einer abgeschwächten IFN-γ Immunabwehr gelang C. pneumoniae in die Persistenz. (3) Durch Reduktion der Sauerstoffkonzentration im Gewebe gelangen die persistenten C. pneumoniae wieder in ihren aktiven Entwicklungszyklus. Eine persistente Infektion hat einen verstärkten Einfluss auf die IL-6 Expression und auf direkte Umbauprozesse von Epithelzellen. Unter Hypoxie ist der Einfluss einer C. pneumoniae-infektion auf Umbauprozesse verstärkt.

SOCS-Proteine: Die molekulare Feuerwehr bei Entzündungen

SOCS-Proteine: Die molekulare Feuerwehr bei Entzündungen SOCS-Proteine: Die molekulare Feuerwehr bei Entzündungen Edgar Sawatzky, Meike Egert und Maria Stec Es ist Winter. Wieder einmal ist die Hochsaison für Erkältungen angebrochen und infektiöse Viren und


Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose Aus der Medizinischen Universitätsklinik und Poliklinik Abteilung für Pneumologie der Albert-Ludwigs-Universität Freiburg im Breisgau Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen


Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1


Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)


HIV-Infektion und AIDS. Seminar aus funktioneller Pathologie

HIV-Infektion und AIDS. Seminar aus funktioneller Pathologie HIV-Infektion und AIDS Seminar aus funktioneller Pathologie Retroviren des Menschen Lentiviren von Primaten Das Virion des HI-Virus schematisch und elektronenmikroskopisch Virale Gene Bindungssequenzen


2 Materialien. Materialien 15. 2.1 Histondeacetylaseinhibitoren (HDIs) Sigma-Aldrich, Deutschland. 2.2 Zelllinien und Zellkultur.

2 Materialien. Materialien 15. 2.1 Histondeacetylaseinhibitoren (HDIs) Sigma-Aldrich, Deutschland. 2.2 Zelllinien und Zellkultur. Materialien 15 2 Materialien 2.1 Histondeacetylaseinhibitoren (HDIs) Substanz Butyrat Trichostatin A (TSA) Valproat Hersteller Sigma-Aldrich, Sigma-Aldrich, Sigma-Aldrich, 2.2 Zelllinien und Zellkultur


Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch Forschungsbericht über das Projekt Einfluss der TLR3-Aktivierung des retinalen Pigmentepithels auf das Verhalten von Makrophagen, gefördert durch die DOG im Rahmen der Forschungsförderung innovativer wissenschaftlicher


Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus Aus dem Institut für Virologie der Tierärztlichen Hochschule Hannover und dem Institut für Virusdiagnostik des Friedrich-Loeffler-Instituts, Insel Riems Etablierung, Validierung und praktische Anwendung


Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom...

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... Inhaltsverzeichnis Abkürzungsverzeichnis... 7 Inhaltsverzeichnis... 11 Abbildungsverzeichnis... 17 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... 21 1.1.2 Protein-Protein Interaktionen allgemein...


Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen

Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen Dr. rer. nat. Jasmin Wellbrock und Prof. Dr. Walter Fiedler Projektbericht an die Alfred & Angelika Gutermuth Stiftung Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen


4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins ERGEBNISSE 29 4. Ergebnisse 4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd3-igg1-tnf- Fusionsproteins Im vorliegenden Immunzytokin wurden die Domänen CH2/CH3 des humanen Fc-Fragmentes durch


GEBRAUCHSANLEITUNG. Glutatione Agarose Resin

GEBRAUCHSANLEITUNG. Glutatione Agarose Resin GEBRAUCHSANLEITUNG Glutatione Agarose Resin Agarose zur Affinitätsreinigung von GST-Tag-Fusionsproteinen und anderen Glutathion-Bindungsproteinen (Kat.-Nr. 42172) SERVA Electrophoresis GmbH - Carl-Benz-Str.


Die angeborene Immunität in der humanen Lunge

Die angeborene Immunität in der humanen Lunge Aus der Medizinischen Klinik III der Universität zu Lübeck Direktor: Prof. Dr. med. P. Zabel Die angeborene Immunität in der humanen Lunge am Beispiel der Infektion mit Haemophilus influenzae und ihrer


Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig BACTOTYPE PCR Amplification Kit Chlamydia sp. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen


Untersuchungen zur Chemotherapie-Resistenz des malignen testikulären Keimzelltumors

Untersuchungen zur Chemotherapie-Resistenz des malignen testikulären Keimzelltumors Untersuchungen zur Chemotherapie-Resistenz des malignen testikulären Keimzelltumors Dissertation zur Erlangung des akademischen Grades doctor rerum naturalium (Dr. rer. nat.) vorgelegt der Mathematisch-Naturwissenschaftlich-Technischen


Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS

Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Von: Andreas Tschammer, Fachhochschule Aalen-Hochschule f. Technik und Wirtschaft, Fachbereich Chemie, Schwerpunkt Molekulare Biotechnologie Material


1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 Molekulare Struktur von NCAM S.


Chronisch obstruktive Lungenerkrankung (COPD) Pathophysiologie und Diagnostik

Chronisch obstruktive Lungenerkrankung (COPD) Pathophysiologie und Diagnostik Chronisch obstruktive Lungenerkrankung (COPD) Pathophysiologie und Diagnostik PD Dr. Andrea Koch Oberärztin und Leiterin des Schwerpunkts Pneumologie Klinik III für Innere Medizin / Herzzentrum Universität


Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin


Inhaltsverzeichnis. 1 Einleitung... 1

Inhaltsverzeichnis. 1 Einleitung... 1 Inhaltsverzeichnis 1 Einleitung... 1 1.1 G-Protein-gekoppelte Rezeptoren... 3 1.1.1 Klassifizierung und Struktur von G-Protein-gekoppelten Rezeptoren... 6 1.1.2 Purinerge Rezeptoren... 12 1.1.3 Pharmazeutische


Die Entwicklung der Keimbahn. wahrend der Embryogenese von Caenorhabditis elegans

Die Entwicklung der Keimbahn. wahrend der Embryogenese von Caenorhabditis elegans Die Entwicklung der Keimbahn wahrend der Embryogenese von Caenorhabditis elegans Von der Fakultat fur Lebenswissenschaften der Technischen Universitat Carolo-Wilhelmina zu Braunschweig zur Erlangung des


Klinische Aspekte bei Erwachsenen Lungengesunde und Lungenkranke

Klinische Aspekte bei Erwachsenen Lungengesunde und Lungenkranke Klinische Aspekte bei Erwachsenen Lungengesunde und Lungenkranke Prof. Thomas Geiser Universitätsklinik für Pneumologie Inselspital, Bern Tagtäglich...... atmen wir ca 10 000 Liter Luft ein... damit gelangen


Movie dendritic cell migration_iv_8_2. Komponenten und Aufbau des Immunsystems Initiation von Immunantworten. lymphatische Organe

Movie dendritic cell migration_iv_8_2. Komponenten und Aufbau des Immunsystems Initiation von Immunantworten. lymphatische Organe Komponenten und Aufbau des Immunsystems Initiation von Immunantworten lymphatische Organe Erkennungsmechanismen Lymphozytenentwicklung Entstehung und Verlauf adaptiver Immunantworten T-Zellen gelangen


Immunofluoreszenz-Markierung an kultivierten adhärenten Säugerzellen. Formaldehyd-Fixierung

Immunofluoreszenz-Markierung an kultivierten adhärenten Säugerzellen. Formaldehyd-Fixierung Immunofluoreszenz-Markierung an kultivierten adhärenten Säugerzellen Formaldehyd-Fixierung 2 Materialien Pinzetten Für das Handling der Zellen ist es empfehlenswert Pinzetten mit sehr feiner Spitze zu


F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in


aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT

aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT 1 aktualisiert, 10.03.2011, Wera Roth, DE1 WESTERN BLOT 1. Hinweise zu Membranen a. Nitrocellulose b. PVDF (alternativ) 2. Aufbau des Transfers a. Naßblot b. Semi-dry (alternativ) 3. Färben und Dokumentation


Inhalte unseres Vortrages

Inhalte unseres Vortrages Inhalte unseres Vortrages Vorstellung der beiden paper: Germ line transmission of a disrupted ß2 mirkroglobulin gene produced by homologous recombination in embryonic stem cells ß2 Mikroglobulin deficient


Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32

Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32 Inhaltsverzeichnis 1. Einleitung... 9 1.1 Posttranslationale Modifikationen... 10 1.2 N-Glykosylierung... 11 1.3 O-Glykosylierung... 12 1.4 Veränderungen der Glykosylierung bei der Tumorentstehung... 13


Linking Transcription to the Metabolic State

Linking Transcription to the Metabolic State Towards Systems Biology of the Chloroplast under Stress: Linking Transcription to the Metabolic State Dissertation Zur Erlangung des Akademischen Grades Doktor der Naturwissenschaften (Dr. rer. nat.) Fakultat





Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt.

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt. Western Blot Der Western Blot ist eine analytische Methode zum Nachweis bestimmter Proteine in einer Probe. Der Nachweis erfolgt mit spezifischen Antikörpern, die das gesuchte Protein erkennen und daran


Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf


Inhaltsverzeichnis 1. 1 Einleitung 4. 1.1 Proteolyse 4. 1.2 Proteasen und Proteolyse im lysosomalen Kompartiment 5

Inhaltsverzeichnis 1. 1 Einleitung 4. 1.1 Proteolyse 4. 1.2 Proteasen und Proteolyse im lysosomalen Kompartiment 5 Inhaltsverzeichnis 1 Inhaltsverzeichnis 1 Einleitung 4 1.1 Proteolyse 4 1.2 Proteasen und Proteolyse im lysosomalen Kompartiment 5 1.3 Lysosomale Cysteinproteasen der Papainfamilie 7 1.4 Zielstellung der


Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign


Psoriasin is a major Escherichia coli-cidal factor of the female genital tract

Psoriasin is a major Escherichia coli-cidal factor of the female genital tract Psoriasin is a major Escherichia coli-cidal factor of the female genital tract Mildner M, Stichenwirth M, Abtin A, Eckhart L, Sam C, Gläser R, Schröder JM, Gmeiner R, Mlitz V, Pammer J, Geusau A, Tschachler


Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsäsche Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Dissertation finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin Nähere


In vitro funktionelle Tests Gewebekulturen: primäre und langlebende Zelllinien Institut für Immunologie und Biotechnologie Universität Pécs, Medizinische Fakultät Einführung Definition: Eine Zellkultur


Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens 6 Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens Von der Gemeinsamen Naturwissenschaftlichen Fakultät der Technischen Universität


SingleQuant Assay Kit

SingleQuant Assay Kit GEBRAUCHSANLEITUNG SingleQuant Assay Kit Kit für die Proteinkonzentrationsbestimmung (Kat.-Nr. 39226) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 Heidelberg Phone +49-6221-138400, Fax +49-6221-1384010


Komponenten und Aufbau des Immunsystems Initiation von Immunantworten. lymphatische Organe. Erkennungsmechanismen. Lymphozytenentwicklung

Komponenten und Aufbau des Immunsystems Initiation von Immunantworten. lymphatische Organe. Erkennungsmechanismen. Lymphozytenentwicklung Komponenten und Aufbau des Immunsystems Initiation von Immunantworten lymphatische Organe Erkennungsmechanismen Lymphozytenentwicklung Entstehung und Verlauf adaptiver Immunantworten 196 Dendritische Zellen


NF-κB = Nuclear Factor kappab

NF-κB = Nuclear Factor kappab NF-κB = Nuclear Factor kappab 1. Transkriptionsfaktor 2. weitgehend ubiquitär exprimiert 3. durch eine Vielzahl von unterschiedlichen Stimuli induzierbar 4. zentrale Rolle bei der Entstehung und Aufrechterhaltung


Das Paper von heute. Samuel Grimm & Jan Kemna

Das Paper von heute. Samuel Grimm & Jan Kemna Das Paper von heute Samuel Grimm & Jan Kemna Bisheriges Modell Was bereits bekannt war - TIR1 ist an Auxinantwort (Zellteilung, Elongation, Differenzierung) beteiligt, im selben Signalweg wie AXR1 - TIR1


DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die


Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen

Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen DISSERTATION der Fakultät für Chemie und Pharmazie der Eberhard-Karls-Universität


Stand von letzter Woche

Stand von letzter Woche RUB ECR1 AXR1 Stand von letzter Woche E2 U? E1-like AXR1 Repressor ARF1 Proteasom AuxRE Repressor wird sehr schnell abgebaut notwendig für Auxinantwort evtl. Substrat für SCF Identifikation des SCF-Ubiquitin


Apoptose 69. 1. Einleitung 2. Extrinsischer Weg 3. Intrinsischer Weg

Apoptose 69. 1. Einleitung 2. Extrinsischer Weg 3. Intrinsischer Weg Teil III. Signalweg des Zelltodes im Herzen Apoptose 69. 1. Einleitung 2. Extrinsischer Weg 3. Intrinsischer Weg >50% der Neuronen Während der Entwicklung 70. Kontraktionsband Nekrose Retina DNA Abbau


Drexler G.A. 1, Derer A 1, Dirks W.G. 2, Hable V. 3, Greubel C. 3, Burgdorfer C. 3, Dollinger G. 3, Du G. 4, Friedl A.A. 1

Drexler G.A. 1, Derer A 1, Dirks W.G. 2, Hable V. 3, Greubel C. 3, Burgdorfer C. 3, Dollinger G. 3, Du G. 4, Friedl A.A. 1 Nutzung von bi-cistronischen Vektoren für die Beobachtung der Rekrutierung von Signal- und Reparaturproteinen an DNA-Schäden nach Ionen- Mikrobestrahlung durch Live-Cell Imaging Drexler G.A. 1, Derer A


Versuch 5: ELISA (Serumtitration)

Versuch 5: ELISA (Serumtitration) Versuch 5: ELISA (Serumtitration) Lernziele: 1) Definition der Begriffe Antigen, Antikörper, Epitop, Paratop, Affinität, Avidität 2) Monoklonale und polyklonale Antikörper 3) Praktische Durchführung einer


Das Reagenz speziell für die Transfektion von Säugerzellen mit sirna und mirna

Das Reagenz speziell für die Transfektion von Säugerzellen mit sirna und mirna METAFECTENE SI + Das Reagenz speziell für die Transfektion von Säugerzellen mit sirna und mirna Bestellinformationen, MSDS, Publikationen und Anwendungsbeispiele unter Produkt Katalognummer


Molekulargenetischer Nachweis und Genotypisierung von HPV

Molekulargenetischer Nachweis und Genotypisierung von HPV Molekulargenetischer Nachweis und Genotypisierung von HPV Dr. Sabine Sussitz-Rack Institut für Labordiagnostik und Mikrobiologie Vorstand: Prim. Prof. DDr. Pranav Sinha Humanes Papillomavirus HPV HPV ist


Mycoplasma gallisepticum

Mycoplasma gallisepticum BACTOTYPE PCR Amplification Kit Mycoplasma gallisepticum Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis


1.1 Einführung in die Problematik 1 1.2 Zielsetzung 9

1.1 Einführung in die Problematik 1 1.2 Zielsetzung 9 Inhaltsverzeichnis 1. Einleitung 1.1 Einführung in die Problematik 1 1.2 Zielsetzung 9 2. Material und Methoden 2.1 Material 2.1.1 Chemikalien 11 2.1.2 Materialien für die Säulenchromatographie 12 2.1.3


Synthese und Analytik von TmHU, dem Histon-ähnlichen Protein aus Thermotoga maritima, und dessen Einsatz als proteinogenes Gentransfersystem

Synthese und Analytik von TmHU, dem Histon-ähnlichen Protein aus Thermotoga maritima, und dessen Einsatz als proteinogenes Gentransfersystem Synthese und Analytik von TmHU, dem Histon-ähnlichen Protein aus Thermotoga maritima, und dessen Einsatz als proteinogenes Gentransfersystem Dissertation Zur Erlangung des akademischen Grades doctor rerum


Zweigbibliofhek Medizin

Zweigbibliofhek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Dissertation finden Sie original in Printform zur Ausleihe in der Zweigbibliofhek Medizin Nähere


Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers

Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers Praktikum Biochemie Einführung in die Molekularbiologie Bettina Siebers Rekombinante Expression einer Esterase aus Pseudomonas aeruginosa in E. coli Polyacrylamide Gelelektrophorese (PAGE) Denaturierende


AdnaTest ER/PR-Detect

AdnaTest ER/PR-Detect PCR-Expressionsanalyse der Östrogen- und Progesteron- Hormonrezeptoren in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-532 Inhaltsverzeichnis Bestellinformation... 3 Anwendungszweck...


Lungenentzündung noch immer tödlich? Dr. Christian Pox. WAZ-Nachtforum Wenn die Luft wegbleibt...

Lungenentzündung noch immer tödlich? Dr. Christian Pox. WAZ-Nachtforum Wenn die Luft wegbleibt... WAZ-Nachtforum Wenn die Luft wegbleibt... Lungenentzündung noch immer tödlich? Dr. Christian Pox Medizinische Universitätsklinik Knappschaftskrankenhaus Bochum Lungenentzündung Bedeutung In Deutschland:


Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3


2.1.4. Industriell gefertigte Testkits für den Nachweis von IgG- oder IgM- Antikörpern gegen A. phagocytophilum

2.1.4. Industriell gefertigte Testkits für den Nachweis von IgG- oder IgM- Antikörpern gegen A. phagocytophilum 2. Material und Methoden 2.1. Materialverzeichnis 2.1.1. Technische Geräte Brutschrank (Heraeus, Hanau) Fluoreszenzmikroskop mit einer Wellenlänge von 390-420 nm (Zeiss, Jena) Vortex Mixer Reax 2000 (Heidolph,


Seminar Lungensport COPD. Schweregrade, klinisches Bild und Cor Pulmonale. Referentin: Kristin Roelle Dozent: Dr. med. M. Schmitz

Seminar Lungensport COPD. Schweregrade, klinisches Bild und Cor Pulmonale. Referentin: Kristin Roelle Dozent: Dr. med. M. Schmitz Seminar Lungensport COPD Schweregrade, klinisches Bild und Cor Pulmonale Übersicht Definition Übersicht Chronic obstructive pulmonary disease (COPD) Definition Übersicht Chronic obstructive pulmonary disease


Transendotheliale Migration Chlamydia pneumoniae infizierter Monozyten in einem in vitro Modell

Transendotheliale Migration Chlamydia pneumoniae infizierter Monozyten in einem in vitro Modell Aus dem Institut für medizinische Mikrobiologie und Hygiene der Universität zu Lübeck Direktor: Prof. Dr. med. W. Solbach Transendotheliale Migration Chlamydia pneumoniae infizierter Monozyten in einem


Western-Blot Master-Anweisung, letzte Bearb. Feb 2014

Western-Blot Master-Anweisung, letzte Bearb. Feb 2014 Western-Blot Master-Anweisung, letzte Bearb. Feb 2014 Proteintransfer (Handschuhe anziehen!) Behandlung der fertigen Gele: - Befülle 2 Schalen mit Transferpuffer (1 für die Gele, 1 für die Membranen) -


SERVALight EosUltra Western Blot Chemilumineszenz HRP Substrat Kit

SERVALight EosUltra Western Blot Chemilumineszenz HRP Substrat Kit GEBRAUCHSANLEITUNG SERVALight EosUltra Western Blot Chemilumineszenz HRP Substrat Kit (Kat.-Nr. 42586) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 Heidelberg Phone +49-6221-138400, Fax +49-6221-1384010


Proteomic Pathology Quantitative Massenspektrometrie

Proteomic Pathology Quantitative Massenspektrometrie Proteomic Pathology Die pathologische Forschung analysiert die zellulären Vorgänge, die zur Entstehung und Progression von Krankheiten führen. In diesem Zusammenhang werden Zellen und Gewebe zunehmend


Blasenbildung Regionäre, schmerzhafte Lymphknotenschwellung Typisches Krankheitsbild (z. B. Scharlach, Streptokokken- Angina, Lobärpneumonie)

Blasenbildung Regionäre, schmerzhafte Lymphknotenschwellung Typisches Krankheitsbild (z. B. Scharlach, Streptokokken- Angina, Lobärpneumonie) 52 Kapitel Empfehlungen zur Behandlung von Infektionen.1 Atemwegsinfektionen Infektionen der oberen Luftwege sind meist viral bedingt. Der Einsatz von Antibiotika ist nur dann notwendig, wenn eine bakterielle


AdnaTest EMT-2/StemCell Add-on ProstateDetect

AdnaTest EMT-2/StemCell Add-on ProstateDetect AdnaTest EMT-2/StemCell Add-on ProstateDetect RT-PCR-Nachweis von Prostatakrebs-assoziierter Genexpression in angereicherten Tumorzellen Nur für Forschungszwecke Gebrauchsanweisung T-1-537-PP Inhaltsverzeichnis


Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:

Frage 1 A: Wieviele Codone des Universellen genetisches Codes kodieren: Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren: Aminosäuren Translationsstart Translationsstop? B: Welche biochemische Reaktion wird von Aminoazyl-tRNA-Synthetasen katalysiert?


BMP / TGF-ß Receptor. Prof. Dr. Albert Duschl

BMP / TGF-ß Receptor. Prof. Dr. Albert Duschl BMP / TGF-ß Receptor Prof. Dr. Albert Duschl Biologische Regelsysteme Behalten Sie bitte im Gedächtnis, daß biologische Systeme immer wieder vor vergleichbaren Aufgaben stehen, bei denen es darum geht,


Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese

Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die Regulation der enterobakteriellen Kapselbiosynthese Inaugural-Dissertation zur Erlangung der Doktorwürde vorgelegt





Exkurs 4: Oligonucleotide als Antisense Wirkstoffe

Exkurs 4: Oligonucleotide als Antisense Wirkstoffe Exkurs 4: ligonucleotide als Antisense Wirkstoffe Pharmazeutische Biochemie Antisense Wirkstoffe am Markt Fomivirsen (INN) Handelsname Vitravene Einsatz: Lokale Behandlung von Zytomegalie-Virus Infektionen


Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition


RSV-Infektion Mögliche pathogenetische Mechanismen und Labordiagnostik

RSV-Infektion Mögliche pathogenetische Mechanismen und Labordiagnostik RSV-Infektion Mögliche pathogenetische Mechanismen und Labordiagnostik Therese Popow-Kraupp Respiratory Syncytial Virus (RSV) Häufigste Ursache von Infektionen der Atemwege bei Kleinkindern In Europa:


Aus der Klinik für Vögel, Reptilien, Amphibien und Fische der Justus Liebig Universität Gießen. Betreuer: Prof. Dr. E. F. Kaleta

Aus der Klinik für Vögel, Reptilien, Amphibien und Fische der Justus Liebig Universität Gießen. Betreuer: Prof. Dr. E. F. Kaleta Aus der Klinik für Vögel, Reptilien, Amphibien und Fische der Justus Liebig Universität Gießen Betreuer: Prof. Dr. E. F. Kaleta Morphologische und molekularbiologische Untersuchungen (PCR und REA der 5,8S


Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich


Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers

Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers Praktikum Biochemie Einführung in die Molekularbiologie Bettina Siebers (4) Rekombinante Expression einer Esterase aus Pseudomonas aeruginosa in E. coli Proteinreinigung Techniken & Methoden der Proteinreinigung


Kontrolle der Genexpression auf mrna-ebene. Abb. aus Stryer (5th Ed.)

Kontrolle der Genexpression auf mrna-ebene. Abb. aus Stryer (5th Ed.) Kontrolle der Genexpression auf mrna-ebene Abb. aus Stryer (5th Ed.) RNA interference (RNAi) sirna (small interfering RNA) mirna (micro RNA) Abb. aus Stryer (5th Ed.) Transcriptional silencing Inhibition


Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin


Durchflusszytometrische BALF-Diagnostik

Durchflusszytometrische BALF-Diagnostik Durchflusszytometrische BALF-Diagnostik Gliederung 1. Lymphozytenidentifizierung 2. Durchflusszytometrie als Methode 3. Bearbeitung der Proben 4. Typische Befunde und Probleme 5. Blick in die Zukunft Dagmar


DISSERTATION. Genanalyse bei Patienten mit Akuter Intermittierender Porphyrie. Zur Erlangung des akademischen Grades Doctor Medicinae (Dr. med.

DISSERTATION. Genanalyse bei Patienten mit Akuter Intermittierender Porphyrie. Zur Erlangung des akademischen Grades Doctor Medicinae (Dr. med. Aus der Medizinischen Klinik mit Schwerpunkt Onkologie und Hämatologie Charité Campus Mitte Charité Universitätsmedizin Berlin und dem Hämatologisch-Onkologischen Zentrum München DISSERTATION Genanalyse


Inhibition of respiratory syncytial virus infection with intranasal sirna nanoparticles targeting the viral NS1 gene

Inhibition of respiratory syncytial virus infection with intranasal sirna nanoparticles targeting the viral NS1 gene 2006/06/21 Inhibition of respiratory syncytial virus infection with intranasal sirna nanoparticles targeting the viral NS1 gene Zhang W. et al, Nature med. 11, 56-62 62 (2005) Virologie Seminar Stefan


Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden

Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden Stammzellenmanipulation Hämatopoietische Stammzellen können gebraucht werden um kranke Zellen mit gesunden zu ersetzen (siehe experiment bestrahlte Maus) Epidermale Stammzellpopulationen können in Kultur


7. Regulation der Genexpression

7. Regulation der Genexpression 7. Regulation der Genexpression 7.1 Regulation der Enzymaktivität Stoffwechselreaktionen können durch Kontrolle der Aktivität der Enzyme, die diese Reaktionen katalysieren, reguliert werden Feedback-Hemmung


Heterologe Expression einer funktionellen Domäne des nikotinischen Acetylcholinrezeptors

Heterologe Expression einer funktionellen Domäne des nikotinischen Acetylcholinrezeptors Heterologe Expression einer funktionellen Domäne des nikotinischen Acetylcholinrezeptors Inauguraldissertation zur Erlangung der Doktorwürde am Fachbereich Biologie/Chemie/Pharmazie der Freien Universität


Übungsfragen Biochemie 1. Erklären Sie die Begriffe

Übungsfragen Biochemie 1. Erklären Sie die Begriffe Übungsfragen Biochemie 1 Erklären Sie die Begriffe Adsorption Diffusion Dialyse Enantiomere Diastereomere Verseifung Fett Lipid essentielle Fettsäure essentielle Aminosäure Kohlenhydrat Disaccharid Peptid


Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983


Plasmidpräparation aus Bakterien Inhalt

Plasmidpräparation aus Bakterien Inhalt Inhalt Einleitung... 2 Materialien... 4 Gewinnung der Bakterien... 6 Zerstörung der Bakterien... 7 Trennung von Plasmid-DNA und genomischer DNA... 8 Reinigung der Plasmid-DNA... 10 Elution der gereinigten


Forschungszentrum Karlsruhe

Forschungszentrum Karlsruhe Forschungszentrum Karlsruhe in der Helmholtz-Gemelnschaft Wissenschaftliche Berichte FZKA7106 Biochemische Charakterisierung der Isoprensynthase aus der Graupappel (Populus x canescens (Ait.) Sm.) und


Western-Analyse Protein-Elektrophorese ELISA Protein-Chip

Western-Analyse Protein-Elektrophorese ELISA Protein-Chip Western-Analyse Protein-Elektrophorese ELISA Protein-Chip DNA-RNA RNA-Protein Die Struktur der DNA Ebene der Proteinstruktur Die Gruppen der Aminosäuren Darstellung Räumliche R Proteinstrukturen (Röntgen


Proteinanalytik Western Blot, Gelelektrophorese

Proteinanalytik Western Blot, Gelelektrophorese Simon Schuster Proteinanalytik Western Blot, Gelelektrophorese Seminar: Entwicklung Biogener Arzneistoffe Inhalt Aufbau von Proteinen Proteinanalytik Allgemein Arbeitsablauf


Synthese von eukaryotischen RNA-Modifikationen

Synthese von eukaryotischen RNA-Modifikationen Dissertation zur Erlangung des Doktorgrades der Fakultät für Chemie und Pharmazie der Ludwig-Maximilians-Universität München Synthese von eukaryotischen RNA-Modifikationen und Quantifizierung nicht kanonischer


Tierärztliche Hochschule Hannover

Tierärztliche Hochschule Hannover Tierärztliche Hochschule Hannover Beurteilung der Entwicklungskompetenz boviner Oozyten aus Follikeln mit unterschiedlicher Durchblutung der Follikelwand INAUGURAL-DISSERTATION zur Erlangung des Grades


Influenza des Schweines

Influenza des Schweines Influenza des Schweines Historie: - erstmals beobachtet 1918 in USA, China, Ungarn - zeitgleich mit der Pandemie beim Menschen (> 20 Mill. Tote) - Virus-Subtyp H1N1 - Übertragung sehr wahrscheinlich vom


HPV DNA-Chip. PapilloCheck HPV-Screening. DNA-Chip für die Identifizierung von 24 humanen Papillomavirus Typen

HPV DNA-Chip. PapilloCheck HPV-Screening. DNA-Chip für die Identifizierung von 24 humanen Papillomavirus Typen HPV DNA-Chip PapilloCheck HPV-Screening DNA-Chip für die Identifizierung von 24 humanen Papillomavirus Typen PapilloCheck : schnell und zuverlässig PapilloCheck im Überblick Komplettes Kit mit DNA-Arrays


Probe und Probenmenge Wassermenge Auftragspuffermenge 5 µl Kaninchenmuskelextrakt 50 µl 100 µl

Probe und Probenmenge Wassermenge Auftragspuffermenge 5 µl Kaninchenmuskelextrakt 50 µl 100 µl Arbeitsgruppe D 6 Clara Dees Susanne Duncker Anja Hartmann Kristin Hofmann Kurs 3: Proteinanalysen Im heutigen Kurs extrahierten wir zum einen Proteine aus verschiedenen Geweben eines Kaninchens und führten


Lungenerkrankungen. Atemnotsyndrom Lungenemphysem chronische Bronchitis akute Pneumonie Tuberkulose Lungenkarzinom malignes Pleuramesotheliom

Lungenerkrankungen. Atemnotsyndrom Lungenemphysem chronische Bronchitis akute Pneumonie Tuberkulose Lungenkarzinom malignes Pleuramesotheliom Lungenerkrankungen Atemnotsyndrom Lungenemphysem chronische Bronchitis akute Pneumonie Tuberkulose Lungenkarzinom malignes Pleuramesotheliom ARDS: acute respiratory distress syndrome akute, lebensbedrohliche


3 Methoden. Methoden 24. 3.1 Zellkultur. Kultivieren von Zellen

3 Methoden. Methoden 24. 3.1 Zellkultur. Kultivieren von Zellen Methoden 24 3 Methoden 3.1 Zellkultur Kultivieren von Zellen Die Nierenkarzinomzelllinien A498, SN12 und ACHN (Referenzen für die verwendeten Zelllinien siehe unter 2.2) wurden nach Anleitung der American


T-Lymphozyten. T-Lymphozyten erkennen spezifisch nur zell- ständige Antigene (Proteine!) und greifen sie direkt an. verantwortlich.

T-Lymphozyten. T-Lymphozyten erkennen spezifisch nur zell- ständige Antigene (Proteine!) und greifen sie direkt an. verantwortlich. T-Lymphozyten T-Lymphozyten erkennen spezifisch nur zell- ständige Antigene (Proteine!) und greifen sie direkt an. Sie sind für die zellvermittelte Immunität verantwortlich. Antigenerkennung B Zellen erkennen


HER2-Diagnostik. Ein Leitfaden für Brustkrebs-Patientinnen

HER2-Diagnostik. Ein Leitfaden für Brustkrebs-Patientinnen HER2-Diagnostik Ein Leitfaden für Brustkrebs-Patientinnen Was ist HER2? HER2 vielfach auch als erbb2 oder HER2/neu bezeichnet ist ein Eiweiß bzw. Proteinbaustein an der Oberfläche von Zellen (Rezeptor).


Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32
