Hintergrund (I) Induktion von Stoffwechselerkrankungen durch Veränderungen des intra uterinen Milieus. Warner und Ozanne, 2010, Biochem J

Größe: px
Ab Seite anzeigen:

Download "Hintergrund (I) Induktion von Stoffwechselerkrankungen durch Veränderungen des intra uterinen Milieus. Warner und Ozanne, 2010, Biochem J"

Transkript

1 Untersuchungen zum Einfluss hochkalorisch fettreicher Ernährung in der Perinatalzeit auf Epigenetische Veränderungen in der Nachkommenschaft im Modell der Gastric inhibitory polypeptide receptor knock out (GIPR-/-) Maus Michael Kruse Abteilung Klinische Ernährung Deutsches Institut für Ernährungsforschung Potsdam-Rehbrücke Ernährung Juni 2012, Nürnberg

2 Hintergrund (I) Induktion von Stoffwechselerkrankungen durch Veränderungen des intra uterinen Milieus Warner und Ozanne, 2010, Biochem J

3 Hintergrund (I) Hyperkalorische Ernährung und Fetale Programmierung Eine mütterliche hyperkalorische Ernährung induziert die Entwicklung eines Metabolischen Sydroms in den Nachkommen. Eine hochkalorisch fettreiche Nahrung (HFN) wird für die Übertragung westlicher Ernährungsgewohnheiten auf Tiermodelle benutzt. Auswirkungen auf die Nachkommen: Adipositas, Insulinresistenz, Hypertonie, Hepatosteatose. (Samuelsson et al., 2008, Hypertesion; Bruce et al., 2009, Hepatology).

4 Hintergrund (II) Gastric Inhibitory Polypeptide (GIP)/ GIP-Rezeptor Freisetzung der Inkretine - Glucagon-like peptide-1 (GLP-1) und - Gastric inhibitory polypeptide (GIP) nach Nahrungsaufnahme. modifiziert nach: Baggio und Drucker, 2007, Gastroenterology.

5 Hintergrund (II) Gastric Inhibitory Polypeptide (GIP)/ GIP-Rezeptor Gastric Inhibitory Polypeptide (GIP) beeinflusst den Lipidstoffwechsel in Adipozyten: - steigert die Aktivität der Lipoproteinlipase in Adipozyten (Knapper et al., 1995, J Nutr). - verstärkt die Aufnahme von Fettsäuren in Adipozyten (Beck und Max, 1983, Regul Pept). GIP-Rezeptor knock out Mäuse (GIPR KO): Protektion vor Adipositas nach Exposition mit fetthaltiger Nahrung Höhere Adiponektin-Konzentration, verbesserte periphere Fettsäureoxidation (Miyawaki et al., 2002, Nat Med; Naitoh et al., 2008, Biochem Biophys Res Commun)

6 Fragestellung und Methodik der Pilotstudie Fragestellung: Sind GIPR KO Mäuse weiterhin vor der Entwicklung einer Adipositas durch eine HFN geschützt, wenn sie während der Schwangerschaft und Säuglingszeit über die Mutter bereits dieser HFN ausgesetzt waren? WT Geburt Entwöhnung, 3. Woche HF (60% Fett), 25. Woche 45 Wochen 23 Wochen Kontrollnahrung 20 Wochen Hochfett-Nahrung WT C-HF GIPR KO KO C-HF GIPR KO KO HF-HF Wildtyp (WT) und GIP Rezeptor Knock Out (GIPR KO) Mäuse, n = 5 13, C57BL/6

7 KO HF-HF zeigen keine signifikante Veränderung des Körpergewichts im Vergleich zu KO C-HF Gewichtsverlauf mit Kontroll-Nahrung Gewichtsverlauf mit HF-Nahrung 60 Körpergewicht (g) Körpergewicht (g) HFN Alter (Wochen) Alter (Wochen) WT C-HF KO C-HF KO HF-HF P<0.05, P<0.01

8 KO HF-HF haben einen höheren Körperfettanteil als KO C-HF Körperfettanteil Köperfett (%) WT C-HF KO C-HF KO HF-HF Kontroll-Nahrung 6 Wochen HF 18 Wochen HF Alter (Wochen) P<0.05, P<0.01, P<0.005

9 Geringere Energieaufnahme in KO HF-HF als in KO C-HF Kumulative Energieaufnahme (HF-Nahrung) WT C-HF 40 KO C-HF 35 KO HF-HF (kcal/gkg) Alter (Woche) P<0.01, P<0.005

10 Erhöhte Genexpression inflammatorischer Zytokine in KO HF-HF Genexpression inflammatorischer Zytokine im Fettgewebe WT C-HF KO C-HF Relative Expression KO HF-HF TNF-alpha MCP-1 MIF-1alpha F4/80 P<0.05

11 Ziele des Forschungsvorhabens Es soll untersucht werden: 1) Epigenetische Histon- und/ oder DNA-Modifikationen im Fettgewebe von GIPR KO Mäusen ( Mechanismus der Protektion vor nahrungsinduzierter Adipositas). 2) Ob eine mütterliche HFN in der Peripartalzeit in GIPR KO Mäusen Veränderungen in den Histon- und/ oder DNA-Modifikationen induziert und 3) ob diese durch eine Re-Exposition mit der gleichen HFN nochmals modifiziert werden. 4) Gezielt Expressionsmuster von Genen der Nahrungsaufnahme im Hypothalamus.

12 Arbeitsprogramm Aufbau der Studie Adaptation Schwangerschaft Säuglingsperiode 2 Wochen 3 Wochen 3 Wochen 20 Wochen WT Ciu-C WT Ciu-HF KO Ciu-C KO Ciu-HF Kreuzung mit männl. GIPR+/- WT GIPR-/- WT HFiu-C WT HFiu-HF KO HFiu-C KO HFiu-HF WT weibl. GIPR+/- GIPR-/- weibl. GIPR+/- Geburt Kontrollnahrung Hochfettnahrung

13 Arbeitsprogramm Gewichtsbestimmungen und kumulative Nahrungsaufnahme: Wöchentlich bis zum Endpunkt der Studie (23. Lebenswoche). Körperfettanteil: 13. Lebenswoche und am Studienendpunkt (23. Lebenswoche) mittels Kernspinresonanzspektroskopie (NMR). Energieumsatz: 22. Lebenswoche mittels indirekter Kalorimetrie. Glukose- (GTT) und Insulin- (ITT) Toleranztest: 20. bzw. 21. Lebenswoche. Plasma Metabolite: Glukose, Insulin, Triglyceride, freie Fettsäuren. Genexpression im Hypothalamus: Analyse anorexigener (POMC, CART, CRH) und orexigener Neuropeptide (MCH, AGRP, NPY, CNR1) mittels quantitativer real time PCR.

14 Arbeitsprogramm DNA-Methylierung und Histon-Modifizierung im Fettgewebe DNA-Methylierung: Analyse von > sog. CpG-Inseln auf deren Methylierungsstatus mit Hilfe von Illumina Micro- Array-Chips. (Kooperation: Genome Analysis Center, Helmholtz Zentrum München). Histon-Modifizierung: Histon H3: Azetylierung Lysin an Position 9, 18; Mono-, Di- und Trimethylierung Lysin an Position 9 (Western-Blot). Chromatin-Immunpräzipitation (ChIP) gegen die Histon-Modifizierungen und Analyse mittels qrt- PCR auf Veränderungen in der Expression von Promotoren der inflammatorischen Gene MCP-1, MIP-1α, TNF-α, IL-6, und IL-8. (Qui, 2006, Nature)

15 Vielen Dank and die Deutsche Gesellschaft für Ernährungsmedizin e.v. (DGEM) für die Unterstützung dieses Forschungsvorhabens!

16

1 Physiologische Grundlagen

1 Physiologische Grundlagen y y y y y y y y y. Kærperzusammensetzung Grundlagen. Kærperzusammensetzung n Die Hauptkompartimente des Kærpers sind der intra- und der extrazellulåre Raum IZR und EZR) s. Abb. ). Alle Nåhrstoffe und Sauerstoff

Mehr

5 Zusammenfassung und Schlussfolgerung

5 Zusammenfassung und Schlussfolgerung 5 Zusammenfassung und Schlussfolgerung Einleitung In der Schwangerschaft vollziehen sich Veränderungen des Kohlenhydratstoffwechsels im Sinne einer Insulinresistenz sowie eines Anstieges der Blutfettwerte.

Mehr

Pathogenese der Tumor - Kachexie

Pathogenese der Tumor - Kachexie Pathogenese der Tumor - Kachexie Ernährung 2007 Innsbruck R. Meier Med. Universitätsklinik tsklinik Abt. Gastroenterologie Liestal Tumor-Kachexie ist häufigh Prävalenz ist ungefähr 50-80% leicht 50% mässig

Mehr

Neue Diabetestherapien. Pharmakologie WS 06/07

Neue Diabetestherapien. Pharmakologie WS 06/07 Neue Diabetestherapien Pharmakologie WS 06/07 Zimt: Allgemeines Chinesischer Zimt (Cinnamomum cassia) Wirksamer Ceylon-Zimt (Cinnamomum ceylanicum) Zimt: Toxikologie Einsatz in weiten Teilen der Lebensmittelindustrie

Mehr

Gene, Hormone und Bakterien

Gene, Hormone und Bakterien Gene, Hormone und Bakterien Pathogenese der Adipositas Vanessa Stadlbauer-Köllner Medizinische Universitätsklinik Graz Linz, 23. Jänner 2010 Adipositas Body-mass-index über 30 Genetik, Hormone, Darmflora

Mehr

Hypokalorische Diäten. low Fat, low Carb, high protein oder VLCD? Problem : langfristige Gewichtsreduktion

Hypokalorische Diäten. low Fat, low Carb, high protein oder VLCD? Problem : langfristige Gewichtsreduktion Hypokalorische Diäten low Fat, low Carb, high protein oder VLCD? Problem : langfristige Gewichtsreduktion Gewichtsverlust nach Behandlung mit VLCD oder hypokalorischer Mischkost Gewichtsverlust (kg) (2373)

Mehr

Projektskizze: Studie/ Auswertung/ Publikation

Projektskizze: Studie/ Auswertung/ Publikation Projektskizze: Studie/ Auswertung/ Publikation Name: PD Dr. Dr. Robert Bals, CAPNetz C11 Datum: 30. 8. 2007 Institution(en)/Autor(en): Klinikum der Universität Marburg Klinik für Innere Medizin mit Schwerpunkt

Mehr

5 Zusammenfassung und Diskussion

5 Zusammenfassung und Diskussion 5 Zusammenfassung und Diskussion Die Ergebnisse der vorliegenden Untersuchungen zeigen, dass es durch Einsatz neuartiger niedermolekularer und hochselektiver Aktivatoren der Insulin-, Somatostatinund Antagonisten

Mehr

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3

Mehr

Energiehaushalt. Cem Ekmekcioglu Valentin Leibetseder. Institut für Physiologie, MUW

Energiehaushalt. Cem Ekmekcioglu Valentin Leibetseder. Institut für Physiologie, MUW Energiehaushalt Cem Ekmekcioglu Valentin Leibetseder Institut für Physiologie, MUW Vorlesung unter: http://www.meduniwien.ac.at/umweltphysiologie/links.htm Energiehaushalt Die Energie im Organismus wird

Mehr

Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen

Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen Quelle: scientopia.org Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen 30. Januar 2014 ChrisEna Spilker Intelligenz Charakter Gedächtnis Plas5zität beruht auf der chemischen Zwiesprache

Mehr

Adipositas - Umwelt, Gene, beides? 3. Ostschweizer Adipositassymposium 22. Mai 2014

Adipositas - Umwelt, Gene, beides? 3. Ostschweizer Adipositassymposium 22. Mai 2014 Adipositas - Umwelt, Gene, beides? 3. Ostschweizer Adipositassymposium 22. Mai 2014 Stefan Bilz Ostschweizer Adipositaszentrum & Klinik für Endokrinologie, Diabetologie, Osteologie und Stoffwechselkrankheiten

Mehr

Meine Moleküle, meine Gene und ich

Meine Moleküle, meine Gene und ich vb Meine Moleküle, meine Gene und ich Ziel des Trainings ist die Leistungssteigerung Funktionelle Anpassung Strukturelle Anpassung Organe, Gewebe, Zellen, Moleküle, Gene, Metabolismus Mechanistische Basis

Mehr

Geschlechtsperspektiven in der Medizin - Gesundheits- und fachpolitische Herausforderungen nach Erkenntnissen bei Diabetes

Geschlechtsperspektiven in der Medizin - Gesundheits- und fachpolitische Herausforderungen nach Erkenntnissen bei Diabetes fröhlich aber auch gesund? Geschlechtsperspektiven in der Medizin - Gesundheits- und fachpolitische Herausforderungen nach Erkenntnissen bei Diabetes Petra-Maria Schumm-Draeger Städtisches Klinikum München

Mehr

Fette und ihre Funktionen. Müssen Fette sein?

Fette und ihre Funktionen. Müssen Fette sein? Fette und ihre Funktionen Müssen Fette sein? Ja! Fette sind: Wichtiger Bestandteil unserer täglichen Nahrung Energieträger Nummer 1 Quelle für essentielle n Vehikel für die Aufnahme fettlöslicher Vitamine

Mehr

Risikofaktor Metabolisches Syndrom

Risikofaktor Metabolisches Syndrom Risikofaktor Metabolisches Syndrom Prim. Univ.-Prof. Dr. Bernhard Ludvik 1.Medizinische Abteilung mit Diabetologie, Endokrinologie und Department für Nephrologie Krankenanstalt Rudolfstiftung Übergewicht

Mehr

Metabolic disorders: Nutrition during pregnancy affects offspring

Metabolic disorders: Nutrition during pregnancy affects offspring Übergewicht und Diabetes: Programmierung in der Schwangerschaft Metabolic disorders: Nutrition during pregnancy affects offspring Hausen, Anne Christine; Brüning, Jens C. Max-Planck-Institut für Stoffwechselforschung,

Mehr

Von Anfang an gesund ins Leben!? Ernährung bei Gestationsdiabetes und Präeklampsie Aktuelle Empfehlungen für die Praxis

Von Anfang an gesund ins Leben!? Ernährung bei Gestationsdiabetes und Präeklampsie Aktuelle Empfehlungen für die Praxis Von Anfang an gesund ins Leben!? Ernährung bei Gestationsdiabetes und Präeklampsie Aktuelle Empfehlungen für die Praxis PD Dr. Frauke von Versen-Höynck, MSc Mütterlicher Diabetes mellitus während der Schwangerschaft

Mehr

Zusammenhänge zwischen Übergewicht / Gewichtszunahme und Stoffwechselerkrankungen

Zusammenhänge zwischen Übergewicht / Gewichtszunahme und Stoffwechselerkrankungen Zusammenhänge zwischen Übergewicht / Gewichtszunahme und Stoffwechselerkrankungen Robert A. Ritzel Klinik für Endokrinologie, Diabetologie und Suchtmedizin Nuklearmedizin Klinikum Schwabing Städtisches

Mehr

Toxische Metalle und Mineralstoffe welche Wechselwirkungen sind klinisch relevant?

Toxische Metalle und Mineralstoffe welche Wechselwirkungen sind klinisch relevant? Toxische Metalle und Mineralstoffe welche Wechselwirkungen sind klinisch relevant? Dr. rer. nat. Katrin Huesker, IMD Berlin Mineralstoffe Toxische Metalle oxidativer Stress Tumorgenese Osteoporose Histaminintoleranz

Mehr

Gesättigte freie Fettsäuren beeinflussen die Glukosetoleranz, die Gehirnaktivität und das Bewegungsverhalten - Eine translationale Studie -

Gesättigte freie Fettsäuren beeinflussen die Glukosetoleranz, die Gehirnaktivität und das Bewegungsverhalten - Eine translationale Studie - Gesättigte freie Fettsäuren beeinflussen die Glukosetoleranz, die Gehirnaktivität und das Bewegungsverhalten - Eine translationale Studie - Anita M. Hennige Universitätsklinikum Tübingen Innere Medizin

Mehr

Pathophysiologie von Hunger und Sättigung

Pathophysiologie von Hunger und Sättigung Pathophysiologie von Hunger und Sättigung Felix Langer Obergurgl 2008 Marx J, Science 2003, 299: 846-49 Cellular warriors at the battle of the bulge Marx J, Science 2003 Badman MK, Science, 2005; 307,

Mehr

UNDERSTANDING WEIGHT GAIN AT MENOPAUSE

UNDERSTANDING WEIGHT GAIN AT MENOPAUSE Hormone therapy and cognition Victor W. Henderson, 2012 UNDERSTANDING WEIGHT GAIN AT MENOPAUSE Gewichtszunahme in der Menopause Schlüsselfragen Gewichtszunahme ist eines der wichtigsten Gesundheitsprobleme

Mehr

Lsd1 weist Stammzellen im Mausembryo den richtigen Weg

Lsd1 weist Stammzellen im Mausembryo den richtigen Weg Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/lsd1-weist-stammzellen-immausembryo-den-richtigen-weg/ Lsd1 weist Stammzellen im Mausembryo den richtigen Weg Die

Mehr

Mangelernährung bei chronischer Inflamation Gibt es Krankheitsspezifika? Tumorerkrankungen

Mangelernährung bei chronischer Inflamation Gibt es Krankheitsspezifika? Tumorerkrankungen Mangelernährung bei chronischer Inflamation Gibt es Krankheitsspezifika? Tumorerkrankungen http://www.duden.de/_media_/full/b/blume-201100280001.jpg Dr. rer. nat. Melanie Ferschke 1992 1997 Studium der

Mehr

Was gibt es Neues in der Adipositastherapie?

Was gibt es Neues in der Adipositastherapie? Kurzfassung des Vortrages von Dr. A. Römpler, Bad Rothenfelde Was gibt es Neues in der Adipositastherapie? Die Leitlinie der Deutschen Adipositas-Gesellschaft nennt als Basis-Therapie-Module neben ernährungsspezifischen

Mehr

Das Transketolase Protein TKTL1 ist in Ovarialkarzinomen überexprimiert

Das Transketolase Protein TKTL1 ist in Ovarialkarzinomen überexprimiert Földi M 1., zur Hausen A 2., Jäger M 1., Bau L 1., Kretz O 3., Watermann D 1., Gitsch G 1., Stickeler E 1., Coy JF 4. Das Transketolase Protein TKTL1 ist in Ovarialkarzinomen überexprimiert 1 Universitäts-Frauenklinik

Mehr

ADBW didact. Diabetes mellitus Forum 2016 Orale Antidiabetica Dr. Bettina Born Reutlingen

ADBW didact. Diabetes mellitus Forum 2016 Orale Antidiabetica Dr. Bettina Born Reutlingen Diabetes mellitus Forum 2016 Orale Antidiabetica Dr. Bettina Born Reutlingen In Deutschland haben ~ 7,6 10 % der Bevölkerung einen Diabetes mellitus 6,4 Mio. Diabetiker ( 7,6% der Gesamtbevölkerung) Typ

Mehr

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt

Mehr

Erkennen der Mangelernährung bei alten Menschen

Erkennen der Mangelernährung bei alten Menschen AUGSBURGER ERNÄHRUNGSGESPRÄCH 11.02.2015 Erkennen der Mangelernährung bei alten Menschen Susanne Nau Ernährungswissenschaftlerin Ernährungsteam Prävalenz der Mangelernährung Augsburger Ernährungsgespräch

Mehr

Nicht nur Medikamente, was gibt es Neues in der Therapie der Depression?

Nicht nur Medikamente, was gibt es Neues in der Therapie der Depression? Nicht nur Medikamente, was gibt es Neues in der Therapie der Depression? Prof. Dr. med. Undine Lang Ordinaria und Klinikdirektorin Erwachsenen-Psychiatrische Klinik EPK Depressionen sind der häufigste

Mehr

Infertilität - Diagnostik. Dr. med. M. Goeckenjan, Klinik und Poliklinik für Frauenheilkunde und Geburtshilfe, Universitätsklinikum, Dresden

Infertilität - Diagnostik. Dr. med. M. Goeckenjan, Klinik und Poliklinik für Frauenheilkunde und Geburtshilfe, Universitätsklinikum, Dresden Infertilität - Diagnostik Dr. med. M. Goeckenjan, Klinik und Poliklinik für Frauenheilkunde und Geburtshilfe, Universitätsklinikum, Dresden Konzeption und Kontrazeption... I Beim Mensch ständige Konzeptionsbereitschaft

Mehr

Medizinische Fakultät. der Universität Duisburg-Essen

Medizinische Fakultät. der Universität Duisburg-Essen Medizinische Fakultät der Universität Duisburg-Essen Aus der Klinik für Psychiatrie und Psychotherapie des Kindes- und Jugendalters und der Klinik für Kinder- und Jugendpsychiatrie und -psychotherapie

Mehr

Nutzen und Sicherheit von DPP-4-Inhibitoren und GLP-1-Analoga bei Typ2-Diabetes. Carsten Otto, Bahnhofstraße 98, Gräfelfing www.ip-graefelfing.

Nutzen und Sicherheit von DPP-4-Inhibitoren und GLP-1-Analoga bei Typ2-Diabetes. Carsten Otto, Bahnhofstraße 98, Gräfelfing www.ip-graefelfing. Nutzen und Sicherheit von DPP-4-Inhibitoren und GLP-1-Analoga bei Typ2-Diabetes Carsten Otto, Bahnhofstraße 98, Gräfelfing www.ip-graefelfing.de Transparenzerklärung des Referenten Ich habe in den letzten

Mehr

A. Sak, S. Grehl, M. Engelhard, A. Wierlemann, HP. Kaelberlah, P. Erichsen, C. Pöttgen, M. Groneberg, M. Stuschke

A. Sak, S. Grehl, M. Engelhard, A. Wierlemann, HP. Kaelberlah, P. Erichsen, C. Pöttgen, M. Groneberg, M. Stuschke γ-h2ax Foci Induktion in Lymphocten des peripheren Bluts von Tumorpatienten: in vivo und in vitro Interaktion von Cisplatin mit Doppelstrangbruch-Signalen ionisierender Strahlen A. Sak, S. Grehl, M. Engelhard,

Mehr

Linagliptin (Trajenta )

Linagliptin (Trajenta ) Linagliptin (Trajenta ) Die Arzneistoffklasse der Dipeptidyl-Peptidase-4-Inhibitoren (DPP-4- Inhibitoren) ist noch relativ jung. Sitagliptin (Januvia, Xelevia ) war 2007 das erste Gliptin, das zugelassen

Mehr

Teil 2: Sättigungspotenzial von Fett aus Lebensmitteln

Teil 2: Sättigungspotenzial von Fett aus Lebensmitteln DLG-Expertenwissen 8/2015 Teil 2: Sättigungspotenzial von Fett aus Lebensmitteln www.dlg.org - 2 - DLG-Expertenwissen 8/2015: Sättigungspotenzial von Fett aus Lebensmitteln 1. Einleitung Die Anzahl übergewichtiger

Mehr

Das Konzept der Eiweißspeicherkrankheiten aus der Sicht der AGE-RAGE-Hypothese

Das Konzept der Eiweißspeicherkrankheiten aus der Sicht der AGE-RAGE-Hypothese Das Konzept der Eiweißspeicherkrankheiten aus der Sicht der AGE-RAGE-Hypothese Akademische Feier Max-Planck-Institut für Herz- und Lungenforschung, Bad Nauheim, 29. September 2007 Angelika Bierhaus University

Mehr

Hebamme sein zwischen Eminenz und Evidenz. PD Dr.med.Luigi Raio Chefarzt-Stellvertreter Geburtshilfe Universitätsfrauenklinik Bern

Hebamme sein zwischen Eminenz und Evidenz. PD Dr.med.Luigi Raio Chefarzt-Stellvertreter Geburtshilfe Universitätsfrauenklinik Bern Hebamme sein zwischen Eminenz und Evidenz PD Dr.med.Luigi Raio Chefarzt-Stellvertreter Geburtshilfe Universitätsfrauenklinik Bern Demographie und andere Probleme Rolle der Frau in der Gesellschaft Rolle

Mehr

Prävention einer Leptinresistenz durch Blockade der Angiotensin II (AT 1 )-Rezeptoren im Rahmen einer Diät induzierten Adipositas bei Ratten

Prävention einer Leptinresistenz durch Blockade der Angiotensin II (AT 1 )-Rezeptoren im Rahmen einer Diät induzierten Adipositas bei Ratten Aus dem Institut für experimentelle und klinische Pharmakologie und Toxikologie der Universität zu Lübeck Direktor: Prof. Dr. med. Markus Schwaninger Prävention einer Leptinresistenz durch Blockade der

Mehr

Krankheit Störung des körperlichen, seelischen und sozialen Wohlbefindens

Krankheit Störung des körperlichen, seelischen und sozialen Wohlbefindens Globaler Wandel Krankheiten aufgrund von Lebensstil, Umweltveränderungen und gesellschaftlichem Wandel Prof. Dr. Wolfgang Wurst Was ist Krankheit? Körper Geist Seele Krankheit Störung des körperlichen,

Mehr

Übergewicht, mitochondrialen Erkrankungen, Osteoporose

Übergewicht, mitochondrialen Erkrankungen, Osteoporose Übergewicht, mitochondrialen Erkrankungen, Osteoporose Grundanforderung und Extra-Anforderung Die Genetik der Obesität 2. Fettleibigkeit ist die chronische, übermäßigen Aufsammlung von Fettgewebe. Energieaufnahme

Mehr

Energie Metabolismus: Integration und Organ Spezialisierung

Energie Metabolismus: Integration und Organ Spezialisierung Energie Metabolismus: Integration und Organ Spezialisierung 1. Hauptwege und Strategien im Energiemetabolismus 2. Organspezialisierung 3. Metabolische Homeostase: Regulation von Apetit, Energieverbrauch

Mehr

Galaktose-Wirkung bei der Zuckerkrankheit (Diabetes mellitus Typ 2)

Galaktose-Wirkung bei der Zuckerkrankheit (Diabetes mellitus Typ 2) Galaktose-Wirkung bei der Zuckerkrankheit (Diabetes mellitus Typ 2) Es gibt vier verschiedene Arten von Zuckerkrankheiten: 1. Diabetes mellitus Typ 1: Zerstörung der ß-Zellen des Pankreas, daher keine

Mehr

Papyrus Ebers 1550 v. Christus. Erste Beschreibung der Symptomatik des Diabetes mellitus

Papyrus Ebers 1550 v. Christus. Erste Beschreibung der Symptomatik des Diabetes mellitus Diabetes I Papyrus Ebers 1550 v. Christus Erste Beschreibung der Symptomatik des Diabetes mellitus 1869 Entdeckung der B-Zellen des Pankreas durch Langerhans 1921 Gewinnung von Insulin aus Pankreasgewebe

Mehr

Epigenetik. Bernd Eiben Institut für Labormedizin und Klinische Genetik Rhein Ruhr amedes-group Willy Brandt Platz 4 45127 Essen. Mittwoch, 29.

Epigenetik. Bernd Eiben Institut für Labormedizin und Klinische Genetik Rhein Ruhr amedes-group Willy Brandt Platz 4 45127 Essen. Mittwoch, 29. Epigenetik Bernd Eiben Institut für Labormedizin und Klinische Genetik Rhein Ruhr amedes-group Willy Brandt Platz 4 45127 Essen Umwelt oder Gene was bestimmt unser Sein? in den 60er/ 70er Jahren: Umwelt

Mehr

Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: "Hip or Hype"

Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: Hip or Hype Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: "Hip or Hype" 3. Nationales Biobankensymposium 2014 Berlin, 04.12.2014 Prof. Dr. rer. nat Edgar Dahl RWTH zentralisierte Biomaterialbank

Mehr

Fortbildungskurs Klinische Diabetologie der DDG 8. Oktober2012 Insulin: Biosynthese und Sekretion

Fortbildungskurs Klinische Diabetologie der DDG 8. Oktober2012 Insulin: Biosynthese und Sekretion Fortbildungskurs Klinische Diabetologie der DDG 8. Oktober2012 Insulin: Biosynthese und ekretion Thomas Meissner Universitäts Kinderklinik Düsseldorf DDG Kurs 2012 Gliederung Insulin Insulinbiosynthese

Mehr

β2-microglobulin deficient mice lack CD4-8+cytolytic T cells

β2-microglobulin deficient mice lack CD4-8+cytolytic T cells β2-microglobulin deficient mice lack CD4-8+cytolytic T cells Mäuse mit einem Knock-out bezüglich ß-Microglobulin sind nicht in der Lage CD4-8+ cytotoxische T-Zellen zu bilden Nature,Vol 344, 19. April

Mehr

mi-rna, zirkulierende DNA

mi-rna, zirkulierende DNA Erbsubstanz: Grundlagen und Klinik mi-rna, zirkulierende DNA 26.11.2010 Ingolf Juhasz-Böss Homburg / Saar Klinische Erfahrungen zirkulierende mirna erstmals 2008 im Serum von B-Zell Lymphomen beschrieben

Mehr

Die Bedeutung der Gene für Ernährung und Gesundheit

Die Bedeutung der Gene für Ernährung und Gesundheit Agrar- und Ernährungswissenschaftliche Fakultät Die Bedeutung der Gene für Ernährung und Gesundheit Frank Döring BMBF-Forschergruppe Nahrungsfette und Stoffwechsel Folgen und Ursachen der Fettsucht Umwelt

Mehr

Major Depression, Borderline-Persönlichkeitsstörung und körperliche Erkrankungen - Späte Folgen früher Traumata

Major Depression, Borderline-Persönlichkeitsstörung und körperliche Erkrankungen - Späte Folgen früher Traumata Major Depression, Borderline-Persönlichkeitsstörung und körperliche Erkrankungen - Späte Folgen früher Traumata Dr. med. Kai G. Kahl Universitätsklinikum Schleswig-Holstein, Campus Lübeck Klinik für Psychiatrie

Mehr

Psychosomatik der Posttraumatischen Belastungsstörung. Dr. med. Jürg Haefliger

Psychosomatik der Posttraumatischen Belastungsstörung. Dr. med. Jürg Haefliger Psychosomatik der Posttraumatischen Belastungsstörung Dr. med. Jürg Haefliger Inhalt - Psychosomatik - Posttraumatische Belastungsstörung - Angst - Neurobiologie - Geschlecht - Morbidität - Epigenetik

Mehr

Scuol, 20. Engadiner Fortbildungstage 2014. Von der Forschung in die Praxis koronare Plaques und kardiale Biomarker

Scuol, 20. Engadiner Fortbildungstage 2014. Von der Forschung in die Praxis koronare Plaques und kardiale Biomarker Scuol, 20. Engadiner Fortbildungstage 2014 Von der Forschung in die Praxis koronare Plaques und kardiale Biomarker Christian M. Matter, MD Kardiologie, Universitäres Herzzentrum, USZ, Zürich christian.matter@usz.ch

Mehr

Psychosomatische Aspekte der Fehlernährung

Psychosomatische Aspekte der Fehlernährung Kompetenzfeld Fehlernährung/Metabolisches Syndrom I Sommersemester 2004 Psychosomatische Aspekte der Fehlernährung Dr. med. C. Albus Klinik und Poliklinik für Psychosomatik und Psychotherapie Universität

Mehr

Adipositas. Seminararbeit Pharmakologischer Demonstrationskurs WS06/07

Adipositas. Seminararbeit Pharmakologischer Demonstrationskurs WS06/07 Adipositas Seminararbeit Pharmakologischer Demonstrationskurs WS06/07 Patientenprofil Frau Meyer 39 Jahre 1,73 m 79,5 kg BMI 26,5 W2H 0,81 Herr Meyer 43 Jahre 1,80 m 112,0 kg BMI 34,5 W2H 1,2 Hypertoniker

Mehr

Systemische Mastozytose

Systemische Mastozytose Systemische Mastozytose auf dem 5. Aachener Patienten- und Angehörigensymposium 2014 Aachen, 17.05.2014 Karla Bennemann & Jens Panse Blutbildung dynamischer Prozess täglich > 7 x 10 9 Blutzellen pro kg

Mehr

Referent: Dr. med. Dipl.-Chem. Rüdiger Kock

Referent: Dr. med. Dipl.-Chem. Rüdiger Kock Referent: Dr. med. Dipl.-Chem. Rüdiger Kock Arzt für Laboratoriumsmedizin und Klinischer Chemiker Ärztlicher Leiter der MVZ Laborzentrum Ettlingen GmbH Telefon: 07243-516 373 Fax: 07243 516 393 Email:

Mehr

Einsatz von prandialen GLP-1- Rezeptoragonisten bei der Therapie des Typ-2-Diabetes mellitus. Wirkprinzip und Einsatzmöglichkeiten

Einsatz von prandialen GLP-1- Rezeptoragonisten bei der Therapie des Typ-2-Diabetes mellitus. Wirkprinzip und Einsatzmöglichkeiten Einsatz von prandialen GLP-1- Rezeptoragonisten bei der Therapie des Typ-2-Diabetes mellitus Wirkprinzip und Einsatzmöglichkeiten Diabetes-Prävalenz in Deutschland und weltweit Weltweit wachsendes Problem

Mehr

Herz und Endokrinium. HELIOS Kliniken Schwerin. Praktische Konsequenzen für die Therapie des Diabetes mellitus

Herz und Endokrinium. HELIOS Kliniken Schwerin. Praktische Konsequenzen für die Therapie des Diabetes mellitus HELIOS Kliniken Schwerin Herz und Endokrinium Praktische Konsequenzen für die Therapie des Diabetes mellitus Chefarzt der Abteilung für Allg. Innere Medizin, Endokrinologie/Diabetologie und Rheumatologie

Mehr

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose Aus der Medizinischen Universitätsklinik und Poliklinik Abteilung für Pneumologie der Albert-Ludwigs-Universität Freiburg im Breisgau Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen

Mehr

Übergewicht und Diabetes Welche Rolle spielt das Bauchfett?

Übergewicht und Diabetes Welche Rolle spielt das Bauchfett? Übergewicht und Diabetes Welche Rolle spielt das Bauchfett? Robert A. Ritzel Klinik für Endokrinologie, Diabetologie und Suchtmedizin Nuklearmedizin Klinikum Schwabing Städtisches Klinikum München Erkrankungen

Mehr

POTENTIELL NEUE MEDIKAMENTE IN DER ADIPOSITASMEDIZIN

POTENTIELL NEUE MEDIKAMENTE IN DER ADIPOSITASMEDIZIN POTENTIELL NEUE MEDIKAMENTE IN DER ADIPOSITASMEDIZIN Prof. Dr. med. Bernd Schultes eswiss Medical & Surgical Center ALLGEMEINES ZUR GEWICHTSREDUKTION AKTUELLE ÜBERSICHTSARBEIT Dtsch Arztebl Int 2014 Innerhalb

Mehr

To sleep or not to sleep

To sleep or not to sleep Manfred Hallschmid Institut für Neuroendokrinologie, Universität Lübeck Ernährung, Bewegung, Entspannung alles zu seiner Zeit München, 31. März 2011 To sleep or not to sleep Der Einfluss des Schlafs auf

Mehr

Ernährungsprobleme bei Kindern und Jugendlichen Teil 1 Prävalenz und assoziierte Risiken

Ernährungsprobleme bei Kindern und Jugendlichen Teil 1 Prävalenz und assoziierte Risiken Ernährungsprobleme bei Kindern und Jugendlichen Teil 1 Prävalenz und assoziierte Risiken Mit der heutigen Ausgabe des Maillaiters starten wir eine Serie zu ausgewählten Fragen der Ernährung bei Kindern

Mehr

Warum habe ich Diabetes? Sind die Gene schuld?

Warum habe ich Diabetes? Sind die Gene schuld? Warum habe ich Diabetes? Sind die Gene schuld? Lenka Bosanska medicalxpress.com 17. Welt Diabetes Tag Was sind Gene? Gene bei Diabetes Polygene vs. Monogene Formen Ich und meine Gene - was kann ich tun?

Mehr

Die Adipositas stellt die häufigste

Die Adipositas stellt die häufigste Christine Spitzweg 1 Werner Joba 1 Georg Brabant 2 Armin E. Heufelder 1 Die Adipositas stellt die häufigste Ernährungs- und Stoffwechselstörung westlicher Gesellschaften dar. Sie ist mit einem erhöhten

Mehr

Hormone. Cem Ekmekcioglu

Hormone. Cem Ekmekcioglu Hormone Cem Ekmekcioglu 1 Was sind Hormone? Hormone sind chemische Informationsträger, die klassischerweise in endokrinen Drüsen gebildet und ins Blut sezerniert werden. Über den Blutweg gelangen sie zu

Mehr

Rudolf Schoberberger Zentrum für Public Health Institut für Sozialmedizin Medizinische Universität Wien

Rudolf Schoberberger Zentrum für Public Health Institut für Sozialmedizin Medizinische Universität Wien Rudolf Schoberberger Zentrum für Public Health Institut für Sozialmedizin Medizinische Universität Wien Erhöhung hung des relativen Risikos auf das 3 und mehrfache Diabetes mellitus Hypertonie Dyslipidämie

Mehr

Vitamin D: auch Bedeutung beim Diabetes?

Vitamin D: auch Bedeutung beim Diabetes? Vitamin D: auch Bedeutung beim Diabetes? Armin Steinmetz St.Nikolaus-Stiftshospital Akad. Lehrkrankenhaus der Uni. Bonn, Andernach Weimar 23.4.16 Vitamin D Mangel bei deutschen Erwachsenen 1763 Männer

Mehr

Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012

Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012 Hämoglobinopathien - Wann soll was abgeklärt werden? Dr. phil. nat. et sc. med. S. Brunner-Agten SwissMed Lab Bern, Juni 2012 Hämoglobin Hämoglobin Gene h"p://amc- app1.amc.sara.nl/eduwiki/images/d/d8/hb-

Mehr

Genexpressionsregulation

Genexpressionsregulation Genexpressionsregulation Genexpressionsregulation Different tissue types 1 2 3 4 5 6 7 8 Taken from Caron et al., 2001 Verschiedene Ebenen der Genexpressionsregulation Epigenetic mechanisms Transkriptionskontrolle

Mehr

Behandlung des Diabetes:

Behandlung des Diabetes: Programm und Übersicht Referenten der Veranstaltung: Dr. med. Frank Merfort und Dr. med. Simone van Haag Diabetologische Schwerpunktpraxis Grevenbroich Samstag, 22.10.2011 Praktische Diabetologie im Krankenhaus

Mehr

Übergewicht, mitochondrialen Erkrankungen, Osteoporose

Übergewicht, mitochondrialen Erkrankungen, Osteoporose Genetische Ursachen der menschlichen Krankheiten: Adiposität, Osteoporose, Mitochondriale Krankheiten Grundanforderung und Extra-Anforderung Die Genetik der Obesität 2. Fettleibigkeit ist die chronische,

Mehr

Essentielle Fettsäuren

Essentielle Fettsäuren Beeinflusst die Zufuhr langkettiger omega-3 Fettsäuren die Funktion des Nervensystems im Kindesalter? Univ.-Prof. Dr. med. Dr. med. habil. Berthold Koletzko Dr von Haunersches Kinderspital Klinikum der

Mehr

Jürgen König, Emerging Focus Nutrigenomics, Department of Nutritional Sciences, University of Vienna

Jürgen König, Emerging Focus Nutrigenomics, Department of Nutritional Sciences, University of Vienna Jürgen König, Emerging Focus Nutrigenomics, Department of Nutritional Sciences, University of Vienna Die Macht der Gene ZNS: Verminderung von Appetit und Durst Abnahme geistiger Fähigkeiten Atmungs-

Mehr

Leitfaden für Patienten und Arzthelferinnen: Adipositas als hormonelle Erkrankung: Vorkommen, Diagnostik und Therapie

Leitfaden für Patienten und Arzthelferinnen: Adipositas als hormonelle Erkrankung: Vorkommen, Diagnostik und Therapie Inhaltsverzeichnis Leitfaden für Patienten und Arzthelferinnen: als hormonelle Erkrankung: Vorkommen, Diagnostik und Therapie Definition und Messung... 4 Häufigkeit (Prävalenz)... 6 Normale Regulation

Mehr

Grundlagen der Ernährung. FÜL - Fortbildung 2007. Grundlagen. der. Ernährung. Teil 1. Dr. Hans-Jörg Müller, 11.2007 Seite 1

Grundlagen der Ernährung. FÜL - Fortbildung 2007. Grundlagen. der. Ernährung. Teil 1. Dr. Hans-Jörg Müller, 11.2007 Seite 1 FÜL - Fortbildung 2007 Grundlagen der Ernährung Teil 1 Dr. Hans-Jörg Müller, 11.2007 Seite 1 Was versteht man unter einer guten / gesunden Ernährung? Dr. Hans-Jörg Müller, 11.2007 Seite 2 Was versteht

Mehr

Aktualisierte Leitlinien für pulmonal (arterielle) Hypertonie (PAH): Zielorientierte PAH-Therapie: Treat to T

Aktualisierte Leitlinien für pulmonal (arterielle) Hypertonie (PAH): Zielorientierte PAH-Therapie: Treat to T Aktualisierte Leitlinien für pulmonal (arterielle) Hypertonie (PAH): Zielorientierte PAH-Therapie: Treat to Target ist das Gebot der Stunde Freiburg (2. März 2010) Seit 2009 gelten die neuen Leitlinien

Mehr

Center for Biotechnology, Bielefeld

Center for Biotechnology, Bielefeld Andreas Albersmeier CeBiTec Bielefeld 3. Life Science Conference Analytik Jena Jena 14.05.2014 Center for Biotechnology, Bielefeld sketchup.google.com Genomik Transkriptomik Proteomics Metabolomics Genom

Mehr

Neue Medikamente in der Behandlung des Typ-2-Diabetes

Neue Medikamente in der Behandlung des Typ-2-Diabetes Hegau-Bodensee-Klinikum Radolfzell Diabeteszentrum Neue Medikamente in der Behandlung des Typ-2-Diabetes 9. Diabetikertag in Radolfzell 16. November 2008 Behandlungsmöglichkeiten: Insulinresistenz bessern

Mehr

Das Fettgewebe ein endokrines Organ

Das Fettgewebe ein endokrines Organ Humanmedizin kompakt 2014 DOI 10.1007/s40355-014-0034-9 Springer-Verlag Berlin Heidelberg 2014 Klaus Rüschhoff, Springer Medizin Redaktion B. Al-Nawas, Mainz I. Köttgen, Mainz-Weisenau Punkte sammeln auf...

Mehr

«Ich bin dick weil schon meine Eltern dick waren und deshalb sind auch unsere Kinder dick, Punkt!» Was tun als Pädiater?

«Ich bin dick weil schon meine Eltern dick waren und deshalb sind auch unsere Kinder dick, Punkt!» Was tun als Pädiater? «Ich bin dick weil schon meine Eltern dick waren und deshalb sind auch unsere Kinder dick, Punkt!» Was tun als Pädiater? Anna Lauber-Biason Universität Fribourg Dr. med. Gabor Szinnai Universitäts-Kinderspital

Mehr

Pharmakokinetische Untersuchungen zur Aufnahme von (-)-Linalool und 1,8-Cineol nach Inhalation und dermaler Applikation

Pharmakokinetische Untersuchungen zur Aufnahme von (-)-Linalool und 1,8-Cineol nach Inhalation und dermaler Applikation Pharmakokinetische Untersuchungen zur Aufnahme von (-)-Linalool und 1,8-Cineol nach Inhalation und dermaler Applikation Eva Heuberger Universität des Saarlandes, Pharmazeutische Biologie, 66123 Saarbrücken

Mehr

Bericht über den Workshop der Paul-Martini-Stiftung (PMS) am 9. April 2014 in Berlin

Bericht über den Workshop der Paul-Martini-Stiftung (PMS) am 9. April 2014 in Berlin Bericht über den Workshop der Paul-Martini-Stiftung (PMS) am 9. April 2014 in Berlin Medikamentöse Diabetes Typ 2-Therapie in Deutschland quo vadis? Prof. Dr. Torsten Strohmeyer, Sprecher des Vorstandes

Mehr

Patienteninformation Schwerpunktpraxis Onkologie, 26. November 2008. Ernährung und Krebs. Dr. med. A. Rosenbaum

Patienteninformation Schwerpunktpraxis Onkologie, 26. November 2008. Ernährung und Krebs. Dr. med. A. Rosenbaum Patienteninformation Schwerpunktpraxis Onkologie, 26. November 2008 Ernährung und Krebs Dr. med. A. Rosenbaum Ernährungsmedizinerin DGEM/DAEM Fachärztin für Innere Medizin Ernährung und Krebs Prävention:

Mehr

Abstract. Cecilia Gebhart - Swantje Jürgensen

Abstract. Cecilia Gebhart - Swantje Jürgensen Bachelorarbeit Fetale Programmierung Warum wir dicke Kinder haben - ein Erklärungsversuch Cecilia Gebhart, Mühlebachweg 20, 3053 Münchebuchsee, S09171752 Swantje Jürgensen, Technikumstrasse 36, 8400 Winterthur,

Mehr

Arzneimittel im Blickpunkt

Arzneimittel im Blickpunkt Arzneimittel im Blickpunkt Sitagliptin / Exenatide Ausgabe 7 / 2007 In dieser Ausgabe des Studienguckers möchten wir zwei neue Arzneimittel vorstellen, die sich in Deutschland seit kurzem auf dem Markt

Mehr

MODY. Eine wichtige Differentialdiagnose beim Diabetes mellitus und beim Gestationsdiabetes mellitus. Winfried Schmidt. www.molekulargenetik.

MODY. Eine wichtige Differentialdiagnose beim Diabetes mellitus und beim Gestationsdiabetes mellitus. Winfried Schmidt. www.molekulargenetik. MODY Eine wichtige Differentialdiagnose beim Diabetes mellitus und beim Gestationsdiabetes mellitus Winfried Schmidt Maturity Onset Diabetes of the Young (MODY) Früh manifestierender Diabetes Nicht-Insulin

Mehr

Neue Medikamente bei der Behandlung von Typ II Diabetes. Prim. Dr. Ewald Binter Privatklinik Althofen Ärztezentrum St. Veit/Glan

Neue Medikamente bei der Behandlung von Typ II Diabetes. Prim. Dr. Ewald Binter Privatklinik Althofen Ärztezentrum St. Veit/Glan Neue Medikamente bei der Behandlung von Typ II Diabetes Prim. Dr. Ewald Binter Privatklinik Althofen Ärztezentrum St. Veit/Glan Therapie Medikamentöse Maßnahmen Resorptionshemmung Besserung der Insulinwirkung

Mehr

INVESTIGATIONS INTO EARLY AND LATE INSULIN SIGNALING MECHANISM

INVESTIGATIONS INTO EARLY AND LATE INSULIN SIGNALING MECHANISM DISS. ETH Nr. 19672 INVESTIGATIONS INTO EARLY AND LATE INSULIN SIGNALING MECHANISM ABHAN DLUNG zur Erlangung des Titels DOKTOR DER WISSENSCHAFTEN der ETH ZÜRICH vorgelegt von FERDINAND VON MEYENN M.Sc.,

Mehr

DER ENERGIEUMSATZ. Energie verbrauch - Energiebedarf

DER ENERGIEUMSATZ. Energie verbrauch - Energiebedarf DER ENERGIEUMSATZ moo 07/01 Energie verbrauch - Energiebedarf Der Energieumsatz kann mittels Kalorimetrie ermittelt werden. Da die direkte Kalorimetrie messtechnisch sehr aufwändig ist (Messung der Wämeabgabe

Mehr

Diabetes: gesundes Essen im Alter Vorbeugung. Dr. med. J. Lareida Aarau

Diabetes: gesundes Essen im Alter Vorbeugung. Dr. med. J. Lareida Aarau Diabetes: gesundes Essen im Alter Vorbeugung Dr. med. J. Lareida Aarau Adipös (BMI 30 kg/m 2 ) (%) 35 30 Zunehmende Prävalenz der Adipositas weltweit USA 25 England 20 Finnland 15 10 Australien Kuba Schweden

Mehr

Überregionales Adipositas-Symposium

Überregionales Adipositas-Symposium Überregionales Adipositas-Symposium Neue Konzepte und operative Therapien der Adipositas Operative Therapie der Adipositas: Vom Magenband zum Magenschlauch: Ein Überblick über die verschiedenen Operationstechniken

Mehr

Was ist Leptin und wo kommt es vor?

Was ist Leptin und wo kommt es vor? Hunger und Sättigung Warum mein Hirn HUNGER schreit: Teil III» LEPTIN, http://wwwpeakag/blog/hunger-und-sattigung-warum-mein-hirn-hunger-schreit-teil-iii Seite 1 von 8 19082010 Hunger und Sättigung Warum

Mehr

Nutriomic - komplexe Analyse der Interaktion zwischen Ernährungsumwelt und biologischer Individualität

Nutriomic - komplexe Analyse der Interaktion zwischen Ernährungsumwelt und biologischer Individualität Nutriomic - komplexe Analyse der Interaktion zwischen Ernährungsumwelt und biologischer Individualität Frank Döring Biogenese, Technogenese Lebensmittel Ernährungsumwelt Mensch (...om) Gesundheit/ Krankheit

Mehr

Thema des Projekts: Etablierung eines Pankreaskarzinom-Xenograft-Modells als zentrale Ressource

Thema des Projekts: Etablierung eines Pankreaskarzinom-Xenograft-Modells als zentrale Ressource 2. Arbeits- und Ergebnisbericht zum Teilprojekt C1 Thema des Projekts: Etablierung eines Pankreaskarzinom-Xenograft-Modells als zentrale Ressource PD Dr. F. Gansauge, PD Dr. T. Gress*, Prof. Dr. B. Jilge**

Mehr

Energieverbrauch > 5.000 kcal/woche durch Training = mind. 6 Std. intensives Training!!! Ernährung (Essen + Trinken!) der letzten Hauptmahlzeit vor

Energieverbrauch > 5.000 kcal/woche durch Training = mind. 6 Std. intensives Training!!! Ernährung (Essen + Trinken!) der letzten Hauptmahlzeit vor Energieverbrauch > 5.000 kcal/woche durch Training = mind. 6 Std. intensives Training!!! Ernährung (Essen + Trinken!) der letzten Hauptmahlzeit vor der Belastung, unmittelbar vor der Belastung, während

Mehr

Vom metabolischen Syndrom zum vasculären Ereignis

Vom metabolischen Syndrom zum vasculären Ereignis Vom metabolischen Syndrom zum vasculären Ereignis B. Zirm, D. Neuhauser, Abteilung für Innere Medizin LKH Bad Radkersburg Ärztliche ARGE für Lebensstilmedizin Kurzentrum Bad Radkersburg - 1 - Einleitung:

Mehr