Zwischenbericht: Research Project on Sebaceous Adenitis (SA) Dr. Ina Pfeiffer Institute of Veterinary Medicine University of Göttingen

Größe: px
Ab Seite anzeigen:

Download "Zwischenbericht: Research Project on Sebaceous Adenitis (SA) Dr. Ina Pfeiffer Institute of Veterinary Medicine University of Göttingen"

Transkript

1 Zwischenbericht: Research Project on Sebaceous Adenitis (SA) Dr. Ina Pfeiffer Institute of Veterinary Medicine University of Göttingen

2 SA betroffene Akita Photograph: Joop & Astrid Ouwerkerk Photograph: Lotte Lekholm

3 Zur Anatomie der Talgdrüse Photo by Mewes Photo by Reichler

4 RNA-Status: Überblick Untersuchungen zur Genexpression im Blut und Biopsien bei SA-positiven und SA-negativen Akitas DNA RNA Protein Geneexpression

5 RNA-Status: Biopsie Untersuchungen zur Genexpression in Biopsien bei SA-positiven und SA-negativen Akitas Inhalt: 1. RNA- Extraktion : Biopsie - Methode - Ergebnisse 2. Differential-Display: RNA- Biopsie - Methode - Ergebnisse

6 RNA-Status: Biopsie Untersuchungen zur Genexpression in Biopsien bei SA-positiven und SA-negativen Akitas 1. RNA- Extraktion : Biopsie -Methode

7 RNA-status: Biopsie Untersuchungen zur Genexpression in Biopsien bei SA-positiven und SA-negativen Akitas 1. RNA- Extraktion : Biopsie -Methode? Biopsie RNA

8 RNA-Status: Biopsie Untersuchungen zur Genexpression in Biopsien bei SA-positiven und SA-negativen Akitas 1. RNA- Extraktion : Biopsie -Methode Neue Vorgehensweise 20 unterschiedliche Extraktionsschritte Biopsie Fetthaltiges Gewebe) Haut (30mg) wurde in kleine Fragmente zerschnitten RNA

9 RNA-Status: Biopsie Untersuchungen zur Genexpression in Biopsien bei SA-positiven und SA-negativen Akitas 2. Differential-Display: RNA- Biopsie - Methode - Ergebnisse RNA = RNAsen cdna

10 itel: Untersuchungen zur Genxpression in Biopsien bei A-positiven und SAegativen Akitas 2. Differential-Display: RNA- Biopsie - Methode - Ergebnisse RNA-Status:Biopsie RNA aus Biopsie

11 RNA-status: Biopsie Untersuchungen zur Genexpression in Biopsien bei SA-positiven und SA-negativen Akitas 2. Differential-Display: RNA- Biopsie - Methode - Ergebnisse PCR

12 RNA-Status: Biopsie Untersuchungen zur Genexpression in Biopsien bei SA-positiven und SA-negativen Akitas 2. Differential-Display: RNA- Biopsie - Methode - Ergebnisse PCR Auftrennung mittels Elektrophorese

13 RNA-Status: Biopsie Untersuchungen zur Genexpression in Biopsien bei SA-positiven und SA-negativen Akitas 2. Differential-Display: RNA- Biopsie - Methode - Ergebnisse 24 verschiedene Elektrophorese Gele Auftrennung mittels Elektrophorese Silberfärbung

14 RNA-status: Biopsie Legende: + - SA positiv SA negativ Gemeinsame Banden Banden-Unterschiede

15 RNA-status: Biopsie Untersuchungen zur Genexpression in Biopsien bei SA-positiven und SA-negativen Akitas Zusammenfassung: - 18 informative Banden - Die informativen Banden wurden extrahiert - Nach einer erfolgreichen Reamplifikation sollen die PCR- Produkte sequenziert werden.

16 RNA-Status: Blut Untersuchungen zur Genexpression im Blut bei SA-positiven und SA-negativen Akitas Inhalt: 1. RNA- Extraktion : Blut - Methoden 2. Differential-Display: RNA- Blut - Methoden - Resultate

17 RNA-Status: Blut Untersuchungen zur Genexpression im Blut bei SA-positiven und SA-negativen Akitas 1. RNA- Extraktion : Blut - Methoden

18 1. RNA- Extraktion : Blut - Methoden RNA-Status: Blut Untersuchungen zur Genexpression im Blut bei SA-positiven und SA-negativen Akitas Neue Vorgehensweise 21unterschiedliche Extraktionsschritte Blut Blut (200µl) wurden aufgeschlossen RNA

19 RNA-Status: Blut Untersuchungen zur Genexpression im Blut bei SA-positiven und SA-negativen Akitas 2. Differential-Display: RNA- Blut - Methode RNA = RNAsen 60min cdna

20 2. Differential-Display: RNA- Blut - Methode RNA-status Untersuchungen zur Genexpression im Blut bei SA-positiven und SAnegativen Akitas RNA aus Blut

21 2. Differential-Display: RNA- Blut - Methode RNA-Status Untersuchungen zur Genexpression im Blut bei SA-positiven und SA-negativen Akitas PCR

22 2. Differential-Display: RNA- Blut - Methode RNA-Status:Blut Untersuchungen zur Genexpression im Blut bei SA-positiven und SA-negativen Akitas PCR Auftrennung mittels Elektrophorese

23 RNA-status: Blood Untersuchungen zur Genexpression im Blut bei SA-positiven und SA-negativen Akitas 2. Differential-Display: RNA- Blut - Methode 16 verschiedene Elektrophorese Gele Auftrennung mittels Elektrophorese Silberfärbung

24 Zusammenfassung: RNA-Status: Blut Untersuchungen zur Genexpression im Blut bei SA-positiven und SA-negativen Akitas - 12 informative Banden - Die unterschiedlichen Banden wurden extrahiert - Nach einer erfolgreichen Reamplifikation sollen die PCR- Produkte sequenziert werden.

25 RNA-Status Blut: Ergebnisse Legende: + SA positiv - SA negativ Gemeinsame Bande Banden- Unterschiede Spezial Bande

26 Zusammenfassung: RNA-Status Untersuchungen zur Genexpression im Blut und Biopsien bei SA-positiven und SA-negativen Akitas 1. Es konnten insgesamt 30 Genexpressions- Unterschiede im Blut und in Biopsien festgestellt werden 2. Um diese Unterschiede anhand einer umfangreicheren Stichprobe zu prüfen, werden dringend SA-positive und SA-negative Akitas als Spender benötigt. 3. Ausgehend von dem vorliegenden Probenmaterial konnte ein signifikanter Genexpressionsunterschied (RNA) aus Blut von SA-positiven Akitas gegnüber gesunden Akitas ermittelt werden.

27 Thank You!

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Inaugural-Dissertation zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen

Mehr

DNA Isolierung. Praktikum Dr. László Kredics

DNA Isolierung. Praktikum Dr. László Kredics Isolierung Praktikum Dr. László Kredics Aufgabe: Isolierung von Plasmid aus Bakterienzellen Plasmid : pbluescript Vektor, Gröβe: 2960 Bps 1. 1,5 ml Bakterienkultur in Eppendorf-Röhrchen pipettieren, 2

Mehr

peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben.

peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben. peqgold TriFast FL Methode für die gleichzeitige Extraktion von RNA, DNA und Proteinen aus flüssigen Proben. Best.-Nr. 30-2110 100 ml 30-2120 200 ml 30-2130 500 ml Lagerung: Lichtgeschützt bei 4 C für

Mehr

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens

Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens 6 Entwicklung und Anwendung von Methoden zur Differenzierung von Funktionen und Strukturen bakterieller Populationen des Bodens Von der Gemeinsamen Naturwissenschaftlichen Fakultät der Technischen Universität

Mehr

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in

Mehr

Probe und Probenmenge Wassermenge Auftragspuffermenge 5 µl Kaninchenmuskelextrakt 50 µl 100 µl

Probe und Probenmenge Wassermenge Auftragspuffermenge 5 µl Kaninchenmuskelextrakt 50 µl 100 µl Arbeitsgruppe D 6 Clara Dees Susanne Duncker Anja Hartmann Kristin Hofmann Kurs 3: Proteinanalysen Im heutigen Kurs extrahierten wir zum einen Proteine aus verschiedenen Geweben eines Kaninchens und führten

Mehr

Datasheet. TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe

Datasheet. TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe TriFaster Maximo Aufreinigung von DNA, RNA und Protein aus einer Probe Features: - Extraktion von RNA, DNA und Proteinen aus der gleichen Probe - Für kleine und große Mengen von Probe - Gleichzeitiges

Mehr

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Vorbereitung Lehrer Für jede Arbeitsgruppe werden 550 µl InstaGene-Matrix aliquotiert! Das Tube wird mit IG beschriftet!

Mehr

Plasmidpräparation aus Bakterien Inhalt

Plasmidpräparation aus Bakterien Inhalt Inhalt Einleitung... 2 Materialien... 4 Gewinnung der Bakterien... 6 Zerstörung der Bakterien... 7 Trennung von Plasmid-DNA und genomischer DNA... 8 Reinigung der Plasmid-DNA... 10 Elution der gereinigten

Mehr

AdnaTest ER/PR-Detect

AdnaTest ER/PR-Detect PCR-Expressionsanalyse der Östrogen- und Progesteron- Hormonrezeptoren in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-532 Inhaltsverzeichnis Bestellinformation... 3 Anwendungszweck...

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

Spleissen Dezember 2009 Elmar Schiebel, ZMBH

Spleissen Dezember 2009 Elmar Schiebel, ZMBH Spleissen Dezember 2009 Elmar Schiebel, ZMBH Bis 1970s: Eine Gen besteht aus einem Stück doppelsträngiger DNA. Dieses einfache Bild wurde 1977 durch die Entdeckung von Richard J. Roberts (Cold Spring Harbor

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

Mycoplasma gallisepticum

Mycoplasma gallisepticum BACTOTYPE PCR Amplification Kit Mycoplasma gallisepticum Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

Borrelia burgdorferi s.l.

Borrelia burgdorferi s.l. BACTOTYPE PCR Amplification Kit Borrelia burgdorferi s.l. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis

Mehr

"Gentechnik II - Identifizierungsmethoden" (Biologie Sek. II)

Gentechnik II - Identifizierungsmethoden (Biologie Sek. II) Inhalt und Einsatz im Unterricht "Gentechnik II - Identifizierungsmethoden" (Biologie Sek. II) Diese DVD behandelt das Unterrichtsthema "Gentechnik" für die Sekundarstufe II. Das DVD-Hauptmenü bietet folgende

Mehr

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik Ruprecht Kuner Abteilung Molekulare Genomanalyse DKFZ Heidelberg Vortragsübersicht Folie 1 1. Was ist ein Biochip / Microarray?

Mehr

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik Ruprecht Kuner Abteilung Molekulare Genomanalyse DKFZ Heidelberg Vortragsübersicht Folie 1 1. Was ist ein Biochip? 2. Zielmoleküle

Mehr

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

Leistungskatalog. Core Facilities. Juli 2014. Seite 1 von 6

Leistungskatalog. Core Facilities. Juli 2014. Seite 1 von 6 Leistungskatalog Core Facilities Juli 2014 Seite 1 von 6 Inhalt 1 Core Facilities... 3 1.1 Core Facility: Genomics für Globale Genanalysen... 3 1.1.1 Next Generation Sequencing - DNA... 3 1.1.2 Next Generation

Mehr

PCR basierte- Detektionstechniken

PCR basierte- Detektionstechniken PCR basierte- Detektionstechniken Warum überhaupt? Forensische Analysen: Vaterschaftstests, Kriminalistik Mikrobielle Gemeinschaften: Biofilme, medizinische Mikrobiologie 2 Warum überhaupt? minimale Mengen

Mehr

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus

Etablierung, Validierung und praktische Anwendung einer multiplex real-time RT-PCR zum Nachweis des Rabbit Haemorrhagic Disease Virus Aus dem Institut für Virologie der Tierärztlichen Hochschule Hannover und dem Institut für Virusdiagnostik des Friedrich-Loeffler-Instituts, Insel Riems Etablierung, Validierung und praktische Anwendung

Mehr

ÖGP / IAP-Austria Frühjahrstagung

ÖGP / IAP-Austria Frühjahrstagung ÖGP / IAP-Austria Frühjahrstagung Molekulares Testing in der Tumorpathologie Tipps, Tricks & Troubleshooting Silke Jäger Pathologie Feldkirch Martina Wild Pathologie Graz Aufschlüsselung intrazellulärer

Mehr

AdnaTest EMT-2/StemCell Add-on ProstateDetect

AdnaTest EMT-2/StemCell Add-on ProstateDetect AdnaTest EMT-2/StemCell Add-on ProstateDetect RT-PCR-Nachweis von Prostatakrebs-assoziierter Genexpression in angereicherten Tumorzellen Nur für Forschungszwecke Gebrauchsanweisung T-1-537-PP Inhaltsverzeichnis

Mehr

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl. Molekulare Mechanismen der Signaltransduktion 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.com/modul-mms bisheriges Modell auxin auxin AXR1 auxin response AXR1 potentieller

Mehr

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein DNA-Extraktion Photometrie Polymerase-Kettenreaktion (PCR) Restriktionsanalyse Agarose-Gelelektrophorese Polyacrylamid-Gelelektrophorese

Mehr

Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32

Mehr

Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch

Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch (Fotos vom 6. März 2013 Molekularbiologisches Praktikum 12 G-Kurs Biologie Herr Korne - am KOMM Homburg/Saar unter Anleitung von Frau Dr. Amoroso)

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

Reagenzien Isolierung von Nukleinsäuren

Reagenzien Isolierung von Nukleinsäuren Aufbewahrung bei Raumtemperatur Anwendung Isolierung ultrareiner Plasmid-DNA aus Bakterienkulturen von 1 ml bis 800 ml. Die Plasmid-DNA eignet sich für Manuelle und automatisierte Sequenzierung mit Fluoreszenzfarbstoffen

Mehr

AdnaTest ColonCancerDetect

AdnaTest ColonCancerDetect AdnaTest ColonCancerDetect RT-PCR-Nachweis von Darmkrebs-assoziierter Genexpression in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-505 Inhaltsverzeichnis Bestellinformation...

Mehr

Quiz zum Praktikum Tierartendifferenzierung

Quiz zum Praktikum Tierartendifferenzierung Quiz zum Praktikum Tierartendifferenzierung Frage 1: Aus welcher DNA wurden am Praktikumstag die Abschnitte für die Tierartenbestimmung untersucht? A. DNA aus dem Zellkern B. Mitochondriale DNA C. Plasmid-DNA

Mehr

Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden

Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden Forschungszentrum Karlsruhe Technik und Umwelt Wissenschaftliche Berichte FZKA 6087 Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden Stefanie

Mehr

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien 36 4. ERGEBNISSE 4.1. Immunglobulin Gentranskripte in Hodgkinzelllinien Mit Hilfe der RT PCR untersuchten wir die Expression umgelagerter Ig Gene in den Hodgkinzelllinien L1236, L428, L591 und KM-H2 sowie

Mehr

DNA/RNA- Isolierung. DNA/RNA-Isolierung. PCR- Reagenzien. Geldokumentation. Labor- Plastik/ Geräte. Elektrophorese. Thermocycler. developing you.

DNA/RNA- Isolierung. DNA/RNA-Isolierung. PCR- Reagenzien. Geldokumentation. Labor- Plastik/ Geräte. Elektrophorese. Thermocycler. developing you. DNA/RNA-Isolierung DNA/RNA- Isolierung PCR- Reagenzien Elektrophorese Labor- Plastik/ Geräte Geldokumentation Thermocycler developing you. DNA/RNA-Isolierung DNA/RNA-Isolierung Inhalt Isolierung genomischer

Mehr

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Gruppe 8 Susanne Duncker und Friedrich Hahn Einleitung und Aufgabenstellung Ziel dieses Versuchs ist es, das Gen für ein bestimmtes

Mehr

TrayCell Faseroptische Ultra-Mikro-Messzelle für die UV/Vis-basierte Bioanalytik. Hellma. Where precision becomes an art.

TrayCell Faseroptische Ultra-Mikro-Messzelle für die UV/Vis-basierte Bioanalytik. Hellma. Where precision becomes an art. Hellma. Where precision becomes an art. TrayCell Faseroptische Ultra-Mikro-Messzelle für die UV/Vis-basierte Bioanalytik 2008 by Hellma www.hellma-worldwide.com Die TrayCell Einzigartig. Präzise. Flexibel.

Mehr

Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign

Mehr

Strategien. ELISA als screening Methode (Einzelseren) Bestätigung der positiven Proben mit PCR oder zweitem Antigen-ELISA

Strategien. ELISA als screening Methode (Einzelseren) Bestätigung der positiven Proben mit PCR oder zweitem Antigen-ELISA Weiterentwicklung diagnostischer Methoden zum Nachweis von BVD C. Egli, C. Schelp, C. Lozano, P. Vaith und L. Schalch Bommeli Diagnostics, Liebefeld-Bern, CH still a company of Einleitung PCR ELISA Sehr

Mehr

Ergebnisse 32. Peptid 1- Peptid 2- Peptid 1- Peptid 2- Sepharose Sepharose Sepharose Sepharose 1/I 1/II 2/I 2/II

Ergebnisse 32. Peptid 1- Peptid 2- Peptid 1- Peptid 2- Sepharose Sepharose Sepharose Sepharose 1/I 1/II 2/I 2/II Ergebnisse 32 4 Ergebnisse 4.1 Nachweis des ORF1-Proteins p40 Das erste offene Leseraster (ORF1) eines L1-Retrotransposons kodiert für ein 40 kd Protein (p40-protein). Dieses Protein hat eine Chaperone-Funktion

Mehr

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase)

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase) Methodensammlung des LAG PCR-Nachweis der 35S-nptII-Übergangssequenz, der pnapin-bayte- Übergangssequenz und des plsc-gens erstellt vom Unterausschuss Methodenentwicklung des LAG Status: verabschiedet

Mehr

Gentechnologie: Isolierung und Charakterisierung von DNA

Gentechnologie: Isolierung und Charakterisierung von DNA Genetisches Grundpraktikum 9. Kurstag 23.06.2005 Gentechnologie: Isolierung und Charakterisierung von DNA Lerninhalte: Klonierung, Plasmid, Polylinker ( multiple cloning site ), Restriktionsendonuklease,

Mehr

Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern.

Plasmidisolierung. Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Plasmidisolierung Mit Plasmiden können Sie Gene in Organismen einschleusen und so deren Eigenschaften verändern. Was können Sie lernen? Sie lernen eine ringförmige DNA, ein Plasmid, zu isolieren. Mit diesem

Mehr

Drosophila melanogaster

Drosophila melanogaster Modul biol113 Zellbiologie Drosophila melanogaster Komponenten der angeborenen Immunabwehr Experimente 1) RT (Reverse Transkriptase)-PCR zum Nachweis einer AMP- Expression nach Infektion 1.1 PCR-Reaktion

Mehr

Nachweis von DNA im Wein

Nachweis von DNA im Wein Abschlussbericht über den Forschungsauftrag Nachweis von DNA im Wein Projektlaufzeit: 01.01.2001 bis 31.03.2003 Prof. Dr. Ralf Kaldenhoff Universität Würzburg Julius-von-Sachs-Institut für Biowissenschaften

Mehr

gültig vom 01.06.2012 bis 14.06.2012

gültig vom 01.06.2012 bis 14.06.2012 Flughafen Tegel (Airport) > S Potsdam H 00:15 Bus 109 ab 00:30 S Charlottenburg Bhf 00:36 S S7 ci 01:05 00:50 täglich 00:20 Bus X9 00:36 S+U Zoologischer Garten Bhf00:52 S S7 ci 01:25 01:05 täglich 04:35

Mehr

4. Diskussion. 4.1. Polymerase-Kettenreaktion

4. Diskussion. 4.1. Polymerase-Kettenreaktion 59 4. Diskussion Bei der Therapie maligner Tumoren stellt die Entwicklung von Kreuzresistenz gegen Zytostatika ein ernstzunehmendes Hindernis dar. Im wesentlich verantwortlich für die so genannte Multidrug

Mehr

Diagnostik der angeborenen Hämoglobinopathien

Diagnostik der angeborenen Hämoglobinopathien Diagnostik der angeborenen Hämoglobinopathien mit Massenspektrometrie Mag. Ostermann Katharina Medical University of Vienna Department of Pediatrics and Adolescent Medicine Research Core Unit Pediatric

Mehr

PRIONTYPE post mortem

PRIONTYPE post mortem Die neue Generation von BSE-Schnelltests Ulrike Krummrei, Claudia Engemann, Thomas Kramer, Jörg Lehmann und Jörg Gabert Labor Diagnostik GmbH Leipzig, Deutscher Platz 5b, 04103 Leipzig TSE-Diagnostik Wieso

Mehr

Zweigbibliofhek Medizin

Zweigbibliofhek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Dissertation finden Sie original in Printform zur Ausleihe in der Zweigbibliofhek Medizin Nähere

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig BACTOTYPE PCR Amplification Kit Chlamydia sp. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen

Mehr

Einführung Laboratoire de Biologie de la Conservation

Einführung Laboratoire de Biologie de la Conservation Einführung Das 1999 gegründete Laboratoire de Biologie de la Conservation (LBC, Labor für Umweltschutzbiologie) ist eine Einheit des Departements für Ökologie und Evolution der Universität Lausanne, die

Mehr

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich?

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Im Unterricht habt ihr bereits einige Methoden und Vorgehensweisen der Molekularbiologie kennengelernt. Aber wo finden diese Methoden im täglichen

Mehr

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans AVID X / 1998 Lawsonia intracellularis Seite -1- Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans 1. ALLGEMEINES

Mehr

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung

Mehr

Kombinierte Verfahren der Bioanalytik inklusive Massenspektrometrie : Grundlagen. Christopher Gerner

Kombinierte Verfahren der Bioanalytik inklusive Massenspektrometrie : Grundlagen. Christopher Gerner Kombinierte Verfahren der Bioanalytik inklusive Massenspektrometrie : Grundlagen Christopher Gerner DNA Idente Kopie in allen Zellen eines Organismus Langlebig (isolierbar aus altem/totem Material) Gut

Mehr

Anlage zur Akkreditierungsurkunde D-PL-13258-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13258-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13258-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 15.03.2012 bis 16.12.2013 Urkundeninhaber: Institut für Rechtsmedizin

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Foto:D.Höwing - im Labor werden die DNA-Abschnitte kopiert

Foto:D.Höwing - im Labor werden die DNA-Abschnitte kopiert Forschung - Genforschung: RZPD - Europas größtes Servicezentrum für funktionelle Genomforschung Das Deutsche Ressourcenzentrum (RZPD) ist Europas größtes Servicezentrum für die funktionelle Genomforschung.

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Zellzyklus- und neuronale Gene in Trichoplax adhaerens S. Sagasser Praktikanten: Patrick Reinke und Jan Kleveman Betreuerin: Karolin von der Chevallerie

Mehr

Eine Arbeitsgemeinschaft der Verlage UTB 8449

Eine Arbeitsgemeinschaft der Verlage UTB 8449 UTB 8449 Eine Arbeitsgemeinschaft der Verlage Böhlau Verlag Köln Weimar Wien Verlag Barbara Budrich Opladen Farmington Hills facultas.wuv Wien Wilhelm Fink München A. Francke Verlag Tübingen und Basel

Mehr

SCRIPTUM HIGH PRECISE

SCRIPTUM HIGH PRECISE Nur für Forschungszwecke Datenblatt Artikel BS.50.020 = 20 Reaktionen x 50 µl Artikel BS.50.100 = 100 Reaktionen x 50 µl Artikel BS.50. 500 = 500 Reaktionen x 50 µl Haltbarkeit: 12 Monate Lagerung bei

Mehr

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr

Zellbiologie: BSc Arbeiten 15/16

Zellbiologie: BSc Arbeiten 15/16 Zellbiologie: BSc Arbeiten 15/16 Lehrstuhl Zellbiologie: Arbeitsgruppen Prof. Benedikt Kost Prof. Georg Kreimer PD Michael Lebert Slot Zeitraum Anzahl Plätze Semester 1 24.08.15 09.10.15 4 Ferien 2 09.11.15

Mehr

Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1

Mehr

Methoden 17. 5% Triton X-100 50 mm EDTA 50 mm Tris-HCl ph 8,0

Methoden 17. 5% Triton X-100 50 mm EDTA 50 mm Tris-HCl ph 8,0 Methoden 17 3. Methoden 3.1 DNA-Präparationen 3.1.1 Isolierung von Plasmid-DNA nach der Rapid-Boiling-Methode (nach Evans and Wahl, 1987) Zur schnellen Isolation von Plasmid-DNA für Restriktions- und PCR-Analysen

Mehr

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt

Mehr

Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich

Mehr

3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34

3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34 Ergebnisse 34 3 Ergebnisse 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC 3.1.1 Nachweis auf RNA-Ebene Zum Nachweis der Transkription des y + -Systems in kutanen Zellen, wurden

Mehr

Hochdurchsatz HLA-Typisierung mit Next Generation Sequencing und Hamilton Robotics

Hochdurchsatz HLA-Typisierung mit Next Generation Sequencing und Hamilton Robotics Hochdurchsatz HLA-Typisierung mit Next Generation Sequencing und Hamilton Robotics Dr. med. Kaimo Hirv Zentrum für Humangenetik und Laboratoriumsmedizin Dr. Klein & Dr. Rost Lochhamer Str. 29 D-82152 Martinsried

Mehr

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Vorbereitung auf diesen Praktikumsteil: Organisation - Für den Bioinformatik-Teil benötigen Sie pro Gruppe einen Laptop -

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung FRAUNHOFER-INSTITUT FÜR GRENZFLÄCHEN- UND BIOVERFAHRENSTECHNIK IGB NEXT-GENERATION SEQUENCING Von der Probenvorbereitung bis zur bioinformatischen Auswertung »Progress in science depends on new techniques,

Mehr

Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt

Mehr

We help you make your molecules! Emmentaler Wirtschaftszmorge zum Thema Wissenstransfer 12. Juni 2012. ReseaChem GmbH

We help you make your molecules! Emmentaler Wirtschaftszmorge zum Thema Wissenstransfer 12. Juni 2012. ReseaChem GmbH Emmentaler Wirtschaftszmorge zum Thema Wissenstransfer 12. Juni 2012 ReseaChem GmbH Agenda/Prüfpunkte: Eckdaten zur Firma ReseaChem GmbH Arbeitsgebiete ReseaChem GmbH und KTI-Projekte Weitere Zusammenarbeiten/Entwicklungen

Mehr

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 26.06.2015 bis 25.03.2017 Ausstellungsdatum: 26.06.2015 Urkundeninhaber:

Mehr

Anlage zur Akkreditierungsurkunde D PL 13372 01 00

Anlage zur Akkreditierungsurkunde D PL 13372 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13372 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 22.05.2014 bis 25.03.2017 Ausstellungsdatum: 22.05.2014 Urkundeninhaber:

Mehr

Molekularbiologische Methoden

Molekularbiologische Methoden Molekularbiologische Methoden im Lebensmittel-Labor Dr. rer. nat. Armin Pahl LADR GmbH MVZ Dr. Kramer & Kollegen 04152 803-0 www.ladr.de DNA 1866 Gregor Mendel veröffentlicht seine Versuche über Pflanzen-Hybriden,

Mehr

Molekulargenetische Experimente IV: Plasmidpräparation

Molekulargenetische Experimente IV: Plasmidpräparation Molekulargenetische Experimente IV: Plasmidpräparation Plasmide sind kleine, ringförmige DNA-Moleküle in Bakterien, die in der Lage sind, sich selbst mit Hilfe von Enzymen zu replizieren. Gene, die auf

Mehr

EINFLUSS DER ZELLMEMBRAN UND EINIGER ZELLAKTOREN AUF DEN ALTERUNGSPROZESS

EINFLUSS DER ZELLMEMBRAN UND EINIGER ZELLAKTOREN AUF DEN ALTERUNGSPROZESS EINFLUSS DER ZELLMEMBRAN UND EINIGER ZELLAKTOREN AUF DEN ALTERUNGSPROZESS Der Kern steuert die Proteinsynthese durch Synthese der Boten-RNA (mrna) gemäß den von der DNA gelieferten Informationen Die mrna

Mehr

Die Paten)erbarkeit von Gensequenzen - von Biomarkern. Prof. Dr. iur. Dr. rer. pol. Jürgen Ensthaler, TU Berlin

Die Paten)erbarkeit von Gensequenzen - von Biomarkern. Prof. Dr. iur. Dr. rer. pol. Jürgen Ensthaler, TU Berlin Die Paten)erbarkeit von Gensequenzen - von Biomarkern Prof. Dr. iur. Dr. rer. pol. Jürgen Ensthaler, TU Berlin Was sind Biomarker? Defini)on: Ø Es gibt noch keine einheitliche Defini)on für Biomarker.

Mehr

3 Ergebnisse. 3.1 Isolierung von leukozytärer Gesamt-RNA

3 Ergebnisse. 3.1 Isolierung von leukozytärer Gesamt-RNA 3 Ergebnisse 3.1 Isolierung von leukozytärer Gesamt-RNA Um Ausgangsmaterial zur Isolierung von CD44-RNA zu erhalten, wurde aus einem Buffy coat (siehe Abschnitt Materialen und Methoden ) der Leukozytenanteil

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin - Status und Zukunft PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin

Mehr

Real-Time PCR von Processed Animal Proteins (PAP) in Futtermittel

Real-Time PCR von Processed Animal Proteins (PAP) in Futtermittel RealTime PCR von Processed Animal Proteins (PAP) in Futtermittel Dr. Sonja Haider ZAM/MIMO ALVA Futtermitteltagung Linz, 17.01.2011 www.ages.at Österreichische Agentur für Gesundheit und Ernährungssicherheit

Mehr

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien

Mehr

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 ChromoQuant Das ChromoQuant in vitro Diagnose-Set QF-PCR 1 zur Analyse von häufigen chromosomalen Erkrankungen der Chromosomen 13, 18 und 21 412.001-48u

Mehr

Medizinische Fakultät Auswertestrategien von Microarrays Einführung

Medizinische Fakultät Auswertestrategien von Microarrays Einführung Medizinische Fakultät Auswertestrategien von Microarrays Einführung PD Dr. Knut Krohn IZKF Leipzig Dr. Markus Eszlinger Med. Klinik III Forschungslabor DNA RNA Hintergrund Charakteristisches Muster der

Mehr

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung Sequenzierung von Thomas Grunwald Abteilung für Med. und Mol. Virologie Sequenzierung Hintergrund Allgemeiner Überblick Funktionsweise der Sequenzierung Sequenzierungsprotokoll Auswertung der Daten Probleme

Mehr

Einführung in die IWK April 2006

Einführung in die IWK April 2006 Einführung in die IWK April 2006 Einführung zum Online-Survey Teil 1 Test Intercultural Communication Competence Inventory -ICCI - Bernd Kupka, M.S./Dr. André Everett (University of Otago, Dunedin, Neuseeland)

Mehr

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C 3 Methoden 3.1 Extraktion der DNA aus den Paraffinschnitten 3.1.1 Extraktions-Kit Das QIAamp DNA Mini Kit- System beruht auf dem Prinzip der Auflösung der Eiweiße mit Proteinase K, DNA Bindung an eine

Mehr

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61 Tier-Biotechnologie Inhaltsverzeichnis Vorwort. 9 Mitarbeiter. 10 Einführung in die Tier-Biotechnologie. 11 Teil I: Zellkultur- und Bioverfahrenstechniken. 23 1 Kultivierung tierischer Zellen. 25 1.1 Voraussetzungen

Mehr

Methodensammlung der Bund-/ Länder Arbeitsgemeinschaft Gentechnik (LAG) Quantitativer Nachweis von Lentiviren (HIV1)-RNA mittels Real time RT-PCR

Methodensammlung der Bund-/ Länder Arbeitsgemeinschaft Gentechnik (LAG) Quantitativer Nachweis von Lentiviren (HIV1)-RNA mittels Real time RT-PCR Methodensammlung der Bund-/ Länder Arbeitsgemeinschaft Gentechnik (LAG) Quantitativer Nachweis von Lentiviren (HIV1)-RNA mittels Real time RT-PCR Erstellt vom Unterausschuss Methodenentwicklung der LAG,

Mehr

2. DNA-Fingerprinting

2. DNA-Fingerprinting Obwohl die Untersuchung von Mikrosatelliteninstabilität und LOH nicht Ziel der vorliegenden Arbeit war, kann es im Rahmen der Vaterschaftsbegutachtung dazu kommen, dass von einem verstorbenen Putativvater

Mehr

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Algorithmische

Mehr

A) 1. Vergleich: Vollständige und limitierte Proteolyse (Beispiel: Albumin), 2. BrCN-Spaltung

A) 1. Vergleich: Vollständige und limitierte Proteolyse (Beispiel: Albumin), 2. BrCN-Spaltung Proteinanalytik I. Versuchsziel A) 1. Vergleich: Vollständige und limitierte Proteolyse (Beispiel: Albumin), 2. BrCN-Spaltung B) Proteolytische Spaltung von Proteinen im SDS-Gel (Erzeugung von Peptiden

Mehr