Programm Demenz-Prävention

Größe: px
Ab Seite anzeigen:

Download "Programm Demenz-Prävention"

Transkript

1 Programm Demenz-Prävention Mehr Lebensqualität durch individuelle Maßnahmen im Frühstadium der Erkrankung Ministère de la Santé Villa Louvigny/Allée Marconi L-2120 Luxembourg Tel / Zeichnung Carlo Schneider

2 Warum Demenzprävention?

3 Krankheitsverlauf Krankheit und Hirnleistungsverlust beginnen lange vor der Demenz kompensiert leichte kognitive Beeinträchtigung Demenz Zeitpunkt des unwiederbringlichen " Verlust gesund krank dement Dauer! ca.. 30 Jahre "! ca. 9 Jahre "

4 Frühe Diagnose Frühe Diagnose erlaubt rechtzeitige Therapie Vos et al., 2013 The Lancet Neurology % Anteil der Patienten mit Demenz nach Diagnosestellung im Jahr 0 100% 50% 0%! Jahre nach Diagnosestellung "

5 S3 Leitlinie (August 2015) Begriffe rund um MCI, unklare Definition MCI mild cognitive impairment (=LKB/LKS) LKB leichte kognitive Beeinträchtigung LKS leichte kognitive Störung MCI-AD MCI mit Alzheimer als Ursache (NIA-AA) PDAD prodromal MCI-AD + Biomarker (IWG) präklinisch Biomarker, keine kognitive Beeintr. Die Begriffe sind nicht immer eindeutig definiert und werden oft breiter als hier angegeben verwendet S3: Die zugrunde liegende Ursache von MCI kann eine beginnende neurodegenerative Demenz sein, ist es aber nicht in jedem Fall. Andere häufige mögliche Ursachen sind: - vaskuläre Läsionen, - depressive Episoden, - Medikamentennebenwirkungen - Alkoholabusus oder -abhängigkeit.

6 Diagnose Am Anfang und Ende steht immer der klinische Eindruck IWG NIA-AA Schwerpunkt bessere Diagnostik durch Biomarker Praxisnähe Kernkriterien nach NIA-AA (S3 Version) Diagnosewunsch des Patienten kein Screening. Sorge um veränderte geistige Leistungsfähigkeit Relativ zur Vergangenheit Liegt ein objektivierbarer Verlust vor? Zielwert ca. 1-1,5 SD unter dem Alters/Bildungsschnitt Beeinträchtigung einer oder mehr kognitiver Domänen Gedächtnis, exekutive Funktion (Problemlösungstest,...), Aufmerksamkeit (einfache/geteilte,...), Sprache (Namen, Wortfluss, Verständnis), episodisches Gedächtnis (FCSRT, WMSR,...) Improvisierte Tests führen zu geringer Sensitivität

7 Diagnose Am Anfang und Ende steht immer der klinische Eindruck Kernkriterien nach NIA-AA (S3 Version) Bewahrung der Unabhängigkeit Komplexe Aktivitäten Kleinere Probleme wie Bezahlen von Rechnungen, Einkaufen etc. sprechen nicht dagegen; In der Beurteilung schwierig, aber absolut notwendig angesehen Nicht dement PDP erlaubt sehr milde Demenz Einschätzung Ursache hauptsächlich AD bzw. vaskuläre kognitive Beeinträchtigung Progredient?

8 Diagnose Am Anfang und Ende steht immer der klinische Eindruck Neuropsychologische Testung Es gibt weder geeignete Kurztests, noch eine exakte Festlegung der Testung. S3 Auszug: Ausführliche neuropsychologische Tests sollten bei fraglicher oder leichtgradiger Demenz eingesetzt werden. Die Auswahl der Verfahren richtet sich nach dem Einzelfall. Im Rahmen der vertieften neuropsychologischen Früh- und Differenzialdiagnostik unter Zuhilfenahme von standardisierten Instrumenten u.a. Lernen und Gedächtnis, Orientierung, Raumkognition, Aufmerksamkeit, Praxie, Sprache und Handlungsplanung. Die unmittelbare Durchführung von ausführlichen Tests kann durch besonders geschultes Personal erfolgen. Die Interpretation der Testergebnisse erfordert neben genauer Kenntnis der angewendeten Verfahren theoretisches Wissen über kognitive Funktionen und die Anwendung und Interpretation von Normwerten.

9 Bessere Diagnose durch Biomarker Am Anfang und Ende steht immer der klinische Eindruck Liquor Andere Erkrankungen (z.b. entzündliche Prozesse) identifizieren/ ausschließen. Unterstützt die Diagnosestellung, insbesondere der Alzheimer-Krankheit. Aß42, Tau oder ptau.

10 Bessere Diagnose durch Biomarker Am Anfang und Ende steht immer der klinische Eindruck Liquor Andere Erkrankungen (z.b. entzündliche Prozesse) identifizieren/ ausschließen. Unterstützt die Diagnosestellung, insbesondere der Alzheimer-Krankheit. Aß42, Tau oder ptau. MRT Hirnatrophie kann ein unterstützendes Signal sein. Schlechte Differenzierung der neurodegenerativen Erkrankungen. FDG-PET / SPECT FDG-PET und HMPAO-SPECT Differenzialdiagnostik von Demenzen (AD, FTD, VD). Ein regelhafter Einsatz nicht empfohlen. Amyloid PET Im Gesamtkontext des klinischen Befundes und anderer Biomarker interpretieren. Sehr frühes Signal. Nur Alzheimer. Gene Risiko ApoE4, Mutationen nur bei familiärem Hintergrund

11 Risiko steigt mit der Zahl der Risikofaktoren Individuelle Risikofaktoren bestimmen das persönliche Erkrankungsrisiko Anzahl der Risikofaktoren und Demenzrisiko nach Kivipelto 2005

12 Risikofaktoren & Interventionen Risikofaktoren & Interventionen sind sehr gut bekannt Med. Risikofaktoren Ernährung Körperliche Aktivität Geistige & soziale Aktivierung Optimierte Medikation Weitere Beispiele Cholesterin Management Diabetes Blutdruck Mittelmeerdiät Examples Omega-3 Fette B Vitamine Überw. Körperl. Aktivität Examples Aktivitätsprogr. Sitzender Lebensstil Gruppenaktivität Physical fitness Examples Kognitives Training Neue Herausforderungen Doppelnutzen Physical fitness Examples Anti-Cholinerge Effekte Depression Schalfqualität & -dauer Physical fitness Examples Vorbereitung auf den Fall der Fälle Angehörigenarbeit

13 Wie Aufnahme in das pdp?

14 Erster klinischer Eindruck Kognitive Testung PDP Aufnahme

15 Erster klinischer Eindruck Kognitive Testung Klinischer Gesamteindruck PDP Aufnahme

16 Erster klinischer Eindruck Kognitive Testung Erhärtung Diagnose optional z.b. Biomarker Klinischer Gesamteindruck PDP Aufnahme

17 Erster klinischer Eindruck Kognitive Testung Erhärtung Diagnose optional z.b. Biomarker Klinischer Gesamteindruck PDP Aufnahme nein Keine Teilnahme- empfehlung Hauptursache: Alzheimer vaskuläre kog. Beeintr. Mischform ja Teilnahme/Überweisung

18 Überweisungsformular behandelnder Arzt Diagnose Alzheimer Vaskuläre kognitive Beeintr. Altersdemenz Altersvergesslichkeit Andere Demenz Diagnosen Wenn weitere Demenz Diagnosen, bitte angeben: Demenz bereits vorhanden? Kognitive Tests CERAD, DemTect, CDR, MMSE, FCSRT, WMSr, weitere? " neuropsychologische Testung Diagnostische Biomarker Aß40, Aß42, Tau, ptau, Kernspin, CT, PET, weitere? " Labor + (Neuro)Radiologie Erbliche Form Verdacht? Bestätigt? " Anamnese

19 Gesundheit, soweit diese Informationen gut vom Patienten erfragt werden können, ist keine Angabe erforderlich. Allergien / Unverträglichkeiten / Krankheiten / Medikament / Implantate / Gesamt-Cholesterin LDL-HDL / Blutdruck. Besondere Informationen welche für die Demenzprävention wichtig sein könnten? Kann der Patient seinem Alter entsprechend aus medizinischer Sicht an Übungen zur körperlichen Fitness teilnehmen? Empfehlen Sie bestimmte Interventionen zur Demenzprävention für diesen Patienten? Möchten Sie bestimmte Aspekte mit pdp besprechen und bitten um einen Rückruf?

20 Kosten Werden die Kosten für die Diagnose von pdp übernommen? Das pdp kann nur die Kosten für Interventionen des Programms tragen. Die neuropsychologische Testung muss vom Patient selber getragen werden, in besonderen wirtschaftlichen Härtefällen können Patienten eine Erstattung der Kosten für die Neuropsychologische Testung formlos beim pdp beantragen. Der Antrag muss vor der Testung genehmigt sein. Was kostet pdp für den Patienten? Die Teilnahme am pdp und den damit verbundenen Interventionen sind für den Patienten kostenlos. Das pdp wird aus Mitteln des Gesundheitsministeriums finanziert. Zeichnung Carlo Schneider

21 Übersicht Einschlusskriterien Am Anfang und Ende steht immer der klinische Eindruck Erkrankung - Alzheimer - Vaskuläre kognitive Beeinträchtigung - Mischform Erkrankungsgrad Typisch MCI, auch sehr milde Demenz, nach Rückfrage präklinisch. Einschlusskriterien - Diagnose mit ausführlicher neuropsychologischer Testung - Teilnahmefähigkeit & -Wunsch - Teilnahmeempfehlung des Arztes - Biomarker aktuell nicht vorgeschrieben Ausschlusskriterien - MMSE < 26 - CDR > 1 - Fehlendes Einverständnis - Keine Sozialversicherung in Luxemburg

22 Programm Demenz-Prävention Mehr Lebensqualität durch individuelle Maßnahmen im Frühstadium der Erkrankung Koordinator Prof. T. Hartmann Ministère de la Santé Villa Louvigny/Allée Marconi L-2120 Luxembourg Tel / Zeichnung Carlo Schneider

Alzheimer Demenz. Demenz - Definition. - Neueste Forschungsergebnisse - Neuropathologie der Demenz n=1050. Alzheimer Krankheit: Neuropathologie

Alzheimer Demenz. Demenz - Definition. - Neueste Forschungsergebnisse - Neuropathologie der Demenz n=1050. Alzheimer Krankheit: Neuropathologie Demenz - Definition Alzheimer Demenz - Neueste Forschungsergebnisse - Beeinträchtigung von geistigen (kognitiven) Funktionen (z.b. Gedächtnis, Sprache, Orientierung) dadurch bedingte deutliche Beeinträchtigung

Mehr

Von kardiovaskulären Risikofaktoren zu Demenz. Brennpunkt Demenz, Köln 06.11.2010

Von kardiovaskulären Risikofaktoren zu Demenz. Brennpunkt Demenz, Köln 06.11.2010 Von kardiovaskulären Risikofaktoren zu Demenz Brennpunkt Demenz, Köln 06.11.2010 Stationär Heime / Krankenhaus konsiliarisch tagesklinische Versorgung Gedächtnissprechstunden Memory Clinics Gerontopsychiatrische

Mehr

Demenz Strategien für eine gemeinsame Versorgung

Demenz Strategien für eine gemeinsame Versorgung Demenz Strategien für eine gemeinsame Versorgung Demenz in der ambulanten Versorgung Gereon Nelles, Köln Demenz 1.3 Mo. 60% Alzheimer Demenz 733 000 Demenzkranke erhalten Leistungen (408,000 ambulant,

Mehr

Minimal Cognitive Impairment leichte kognitive Störung. Claus-W. Wallesch BDH-Klinik Elzach

Minimal Cognitive Impairment leichte kognitive Störung. Claus-W. Wallesch BDH-Klinik Elzach Minimal Cognitive Impairment leichte kognitive Störung Claus-W. Wallesch BDH-Klinik Elzach claus.wallesch@neuroklinik-elzach.de Häufigste Frage in Memory Clinic: Liegt eine zu Demenz führende Erkrankung

Mehr

Leichte kognitive Beeinträchtigung (mild cognitive impairment) und Differentialdiagnosen

Leichte kognitive Beeinträchtigung (mild cognitive impairment) und Differentialdiagnosen Leichte kognitive Beeinträchtigung (mild cognitive impairment) und Differentialdiagnosen Thomas Duning Andreas Johnen Klinik für Allgemeine Neurologie Department für Neurologie Westfälische Wilhelms-Universität

Mehr

MRT zur Früherkennung einer Alzheimer-Demenz

MRT zur Früherkennung einer Alzheimer-Demenz MRT zur Früherkennung einer Alzheimer- Ergebnisbericht Recherche Datum der Suche: 10.08.2011 PICO-Fragestellung: Population: Personen ohne Alzheimer- (AD) Intervention: MRT zur Früherkennung von Alzheimer-

Mehr

Jüngere Menschen mit Demenz Medizinische Aspekte. in absoluten Zahlen. Altersgruppe zwischen 45 und 64 Jahren in Deutschland: ca.

Jüngere Menschen mit Demenz Medizinische Aspekte. in absoluten Zahlen. Altersgruppe zwischen 45 und 64 Jahren in Deutschland: ca. Prävalenz und Inzidenz präseniler en Jüngere Menschen mit Medizinische Aspekte Priv.Doz. Dr. med. Katharina Bürger Alzheimer Gedächtniszentrum Klinik und Poliklinik für Psychiatrie und Psychotherapie LudwigMaximiliansUniversität

Mehr

Symposium Dement, depressiv oder beides? - Problemstellung -

Symposium Dement, depressiv oder beides? - Problemstellung - Symposium 1.7.2014 Dement, depressiv oder beides? - Problemstellung - Katja Werheid Klinische Gerontopsychologie Institut für Psychologie, Humboldt-Universität zu Berlin katja.werheid@hu-berlin.de Agenda

Mehr

DGPPN Kongress , Berlin Presse Round Table

DGPPN Kongress , Berlin Presse Round Table DGPPN Kongress 2009 24.11-28.11.09, Berlin Presse Round Table Psychische Störungen und Erkrankungen in der Lebensspanne. Neue Wege in Forschung und Versorgung Demenz: Herausforderung für unsere Gesellschaft.

Mehr

Kognition, Bewegung und Demenz: Was wissen wir bis heute? Auguste Deter, 51

Kognition, Bewegung und Demenz: Was wissen wir bis heute? Auguste Deter, 51 Kognition, Bewegung und Demenz: Was wissen wir bis heute? Brigitte Stemmer Centre de Recherche, Institut universitaire de gériatrie de Montréal, Psychology, Brock University, St. Catharines, & McGill Center

Mehr

Demenz: Kognitives Screeningund Behandlung. Prof. Dr. phil Helmut Hildebrandt Klinikum Bremen-Ost, Neurologie Universität Oldenburg, Psychologie

Demenz: Kognitives Screeningund Behandlung. Prof. Dr. phil Helmut Hildebrandt Klinikum Bremen-Ost, Neurologie Universität Oldenburg, Psychologie Demenz: Kognitives Screeningund Behandlung Prof. Dr. phil Helmut Hildebrandt Klinikum Bremen-Ost, Neurologie Universität Oldenburg, Psychologie Demenzen nach DSM IV/ICD10 Definiert durch erheblichen und

Mehr

Neuropsychologische Differenzialdiagnostik bei Demenz

Neuropsychologische Differenzialdiagnostik bei Demenz Neuropsychologische Differenzialdiagnostik bei Demenz Fortbildung DGN-Kongress Mannheim AG Kognitive Neurologie Dr. Anne Ebert Allgemeine Differenzialdiagnosen bei Demenz: Vorbestehende Intelligenzminderung

Mehr

Zwischen Bangen und Hoffen: Demenz und Alzheimer. demenz 2015 1

Zwischen Bangen und Hoffen: Demenz und Alzheimer. demenz 2015 1 Zwischen Bangen und Hoffen: Demenz und Alzheimer demenz 2015 1 Inhalt Was versteht man unter Demenz? Symptome und Krankheitsverlauf Formen von Demenz Demenz Diagnostik, neue (Bio)-Marker Folgen von Demenz

Mehr

Neuropsychologische Untersuchungen in der Praxis: Wann sind welche Tests sinnvoll?

Neuropsychologische Untersuchungen in der Praxis: Wann sind welche Tests sinnvoll? Neuropsychologische Untersuchungen in der Praxis: Wann sind welche Tests sinnvoll? Sophia Reul Klinik für Allgemeine Neurologie Department für Neurologie Westfälische Wilhelms-Universität Münster Welche

Mehr

Tutorium Klinische Psychologie II. Spezielle Störungsbilder II: Demenzielle Störungen Eine Übersicht

Tutorium Klinische Psychologie II. Spezielle Störungsbilder II: Demenzielle Störungen Eine Übersicht Tutorium Klinische Psychologie II Spezielle Störungsbilder II: Demenzielle Störungen Eine Übersicht Demenzielle Störungen Eine Übersicht Anna Felnhofer anna.felnhofer@univie.ac.at Inhalt 1) Begriffliche

Mehr

3. Burgenländische PsySoMed Tagung 9. Oktober 2010, Eisenstadt

3. Burgenländische PsySoMed Tagung 9. Oktober 2010, Eisenstadt 3. Burgenländische PsySoMed Tagung 9. Oktober 2010, Eisenstadt Altern ist kein Schicksal? Zur Plastizität des alternden Gehirns unter besonderer Berücksichtigung der Demenzprävention Prof. Dr. med. Johannes

Mehr

Dr. Martin Conzelmann 1

Dr. Martin Conzelmann 1 Demenz? Was ist Demenz und was kann man dagegen tun? Dr. Martin Conzelmann 17. Februar 2011 Erstbeschreibung einer Alzheimer- Demenz Am 25. November 1901 begegnete Alzheimer der Patientin, die ihn berühmt

Mehr

Demenz und Alzheimer. Praktische Hinweise zur Diagnostik. Remscheider Gespräche 24.06.2004 Dr. Bernd Heidrich

Demenz und Alzheimer. Praktische Hinweise zur Diagnostik. Remscheider Gespräche 24.06.2004 Dr. Bernd Heidrich Demenz und Alzheimer Praktische Hinweise zur Diagnostik Remscheider Gespräche 24.06.2004 Dr. Bernd Heidrich Praktische Hinweise zur Diagnostik Demenz und Alzheimer Was ist eine Demenz? Was ist Alzheimer?

Mehr

Demenz: Diagnostik und Therapie im klinischen Alltag

Demenz: Diagnostik und Therapie im klinischen Alltag Demenz: Diagnostik und Therapie im klinischen Alltag Thomas Duning Klinik für Allgemeine Neurologie Department für Neurologie Westfälische Wilhelms-Universität Münster Therapie der Demenzerkrankungen MMST

Mehr

Molekulare Bildgebung von Morbus Alzheimer

Molekulare Bildgebung von Morbus Alzheimer Molekulare Bildgebung von Morbus Alzheimer Dr. Ludger Dinkelborg - Piramal Imaging - Düsseldorf 24 June 2014 Übersicht Einführung in die molekulare Bildgebung Morbus Alzheimer (MA) als Herausforderung

Mehr

Diagnose Demenz Bedeutung und Optionen

Diagnose Demenz Bedeutung und Optionen Diagnose Demenz Bedeutung und Optionen Quelle: UCLA Center for Cognitive Neuroscience Quelle: BMBF Prof. Dr. med. Markus Donix Universitäts-Gedächtnisambulanz 08.12.2016 Fallbeispiel Herr S., 61 J. Universitäts

Mehr

Aktuelles zur Prävention der Demenz Sprache

Aktuelles zur Prävention der Demenz Sprache DEMENZ IM BLICK 5. Dezember 2014, Düsseldorf Neurodegeneration kognitiv relevanter Hirnareale Vergleich Alzheimerkrankheit /Gesundheit Aktuelles zur Prävention der Demenz Sprache Wolfgang Maier Utako Barnikol

Mehr

Seltene Demenzen. Posteriore Corticale Atrophie. lic. phil. Gregor Steiger-Bächler 01-04-2011. Neuropsychologie-Basel

Seltene Demenzen. Posteriore Corticale Atrophie. lic. phil. Gregor Steiger-Bächler 01-04-2011. Neuropsychologie-Basel Seltene Demenzen Posteriore Corticale Atrophie lic. phil. Gregor Steiger-Bächler Posteriore corticale atrophie Merkmale: Schleichender Beginn, oft in der 5. oder 6. Dekade, langsam progredienter Verlauf

Mehr

Demenz- eine Krankheit verstehen

Demenz- eine Krankheit verstehen Demenz- eine Krankheit verstehen Stefanie Auer ALZHEIMERHILFE Integra 2008 Alois Alzheimer (1864-1915) 1915) Neurologe, Psychiater 1901: Begegnung mit Auguste D. 1906: Vorstellung einer geistigen Erkrankung

Mehr

Über den aktuellen Stand der Demenzforschung. Prof. Dr. phil. Andreas U. Monsch Leiter Memory Clinic Universitäre Altersmedizin Basel

Über den aktuellen Stand der Demenzforschung. Prof. Dr. phil. Andreas U. Monsch Leiter Memory Clinic Universitäre Altersmedizin Basel Über den aktuellen Stand der Demenzforschung Prof. Dr. phil. Andreas U. Monsch Leiter Memory Clinic Universitäre Altersmedizin Basel 3 Themen 1. Prävention 2. Diagnostik 3. Therapie 1. Prävention Mögliche

Mehr

(Früh-)Diagnostik der Demenz. Prof. Dr. Andreas Fellgiebel Universitätsmedizin Mainz Klinik für Psychiatrie und Psychotherapie 20.11.

(Früh-)Diagnostik der Demenz. Prof. Dr. Andreas Fellgiebel Universitätsmedizin Mainz Klinik für Psychiatrie und Psychotherapie 20.11. (Früh-)Diagnostik der Demenz Prof. Dr. Andreas Fellgiebel Universitätsmedizin Mainz Klinik für Psychiatrie und Psychotherapie 20.11.2013 Altersspezifische Häufigkeit der Demenz 15%

Mehr

Freiheitsbeschränkung durch Medikation. C. Miller

Freiheitsbeschränkung durch Medikation. C. Miller Freiheitsbeschränkung durch Medikation C. Miller Aufgabe des HeimAufG Schutz der persönlichen Freiheit von Menschen, die aufgrund des Alters, einer Behinderung oder einer Krankheit der Pflege oder Betreuung

Mehr

AVWS Diagnostik aus sprachtherapeutischer Sicht

AVWS Diagnostik aus sprachtherapeutischer Sicht AVWS Diagnostik aus sprachtherapeutischer Sicht Birke Peter, Klinische Sprechwissenschaftlerin Klinik und Poliklinik für Hals-, Nasen-, Ohrenheilkunde Universitätsmedizin Leipzig Direktor: Univ.-Prof.

Mehr

Einsamkeit: Ein Risikofaktor für Lebensqualität und Gesundheit?

Einsamkeit: Ein Risikofaktor für Lebensqualität und Gesundheit? Einsamkeit: Ein Risikofaktor für Lebensqualität und Gesundheit? Prof. Dr. Gerhard W. Eschweiler Universitätsklinik für Psychiatrie und Psychotherapie Tübingen Gesundheitskonferenz Böblingen 15.5.2013 Wunsch

Mehr

Positionsbestimmung: Wo stehen wir in puncto Demenzforschung?

Positionsbestimmung: Wo stehen wir in puncto Demenzforschung? Positionsbestimmung: Wo stehen wir in puncto Demenzforschung? Eske Christiane Gertje, M. Sc. Universitätsklinik für Neurologie, European Medical School Oldenburg Groningen Inhalt 1. Demenz in der Gesellschaft

Mehr

Zusammenhänge zwischen Übergewicht / Gewichtszunahme und Stoffwechselerkrankungen

Zusammenhänge zwischen Übergewicht / Gewichtszunahme und Stoffwechselerkrankungen Zusammenhänge zwischen Übergewicht / Gewichtszunahme und Stoffwechselerkrankungen Robert A. Ritzel Klinik für Endokrinologie, Diabetologie und Suchtmedizin Nuklearmedizin Klinikum Schwabing Städtisches

Mehr

Demenz Gestern heute morgen? G. Gatterer Geriatriezentrum am Wienerwald Abteilung für Psychosoziale Rehabilitation

Demenz Gestern heute morgen? G. Gatterer Geriatriezentrum am Wienerwald Abteilung für Psychosoziale Rehabilitation Demenz Gestern heute morgen? G. Gatterer Geriatriezentrum am Wienerwald Abteilung für Psychosoziale Rehabilitation Was ist eine Demenz? Gedächtnisstörung Weitere kognitive Störung Schreitet fort Hirnorganische

Mehr

Depressive Störungen bei Frauen und Männern mit koronarer Herzerkrankung: Behandlungsraten und Einstellungen zu antidepressiver Therapie

Depressive Störungen bei Frauen und Männern mit koronarer Herzerkrankung: Behandlungsraten und Einstellungen zu antidepressiver Therapie Depressive Störungen bei Frauen und Männern mit koronarer Herzerkrankung: Behandlungsraten und Einstellungen zu antidepressiver Therapie N. Rieckmann, V. Arolt, W. Haverkamp, P. Martus, A. Ströhle, J.

Mehr

Lüner Infotag zur Demenz Demenz: nur Honig im Kopf? Wie entsteht/was ist eine Demenz? Kann ich vorbeugen? Wie kann ich helfen?

Lüner Infotag zur Demenz Demenz: nur Honig im Kopf? Wie entsteht/was ist eine Demenz? Kann ich vorbeugen? Wie kann ich helfen? Lüner Infotag zur Demenz Demenz: nur Honig im Kopf? Wie entsteht/was ist eine Demenz? Kann ich vorbeugen? Wie kann ich helfen? demenz 2015 1 Inhalt Was versteht man unter Demenz? Symptome und Krankheitsverlauf

Mehr

Demenztherapie: Was bringt die Zukunft?

Demenztherapie: Was bringt die Zukunft? Demenztherapie: Was bringt die Zukunft? G. Lueg Klinik für Allgemeine Neurologie Department für Neurologie Westfälische Wilhelms-Universität Münster Alzheimer Demenz (AD) Heute >1.5 Mio. Deutsche mit Demenz

Mehr

Demenz Strategien für eine gemeinsame Versorgung. Arbeitsgruppe 1: Diagnose Demenz: Wie sage ich es meinem Patienten?

Demenz Strategien für eine gemeinsame Versorgung. Arbeitsgruppe 1: Diagnose Demenz: Wie sage ich es meinem Patienten? Kooperationstagung zum Thema Demenz Strategien für eine gemeinsame Versorgung Arbeitsgruppe 1: Diagnose Demenz: Wie sage ich es meinem Patienten? t 25.09.2010 Kooperationstagung Demenz 1 Fallbeispiel 1

Mehr

Depression und Demenz: Interdependenzen, Diagnostik und Behandlung

Depression und Demenz: Interdependenzen, Diagnostik und Behandlung Deutsches Zentrum für Altersfragen, 8.5.2014 Depression und Demenz: Interdependenzen, Diagnostik und Behandlung Prof. Dr. Katja Werheid Klinische Gerontopsychologie Humboldt-Universität zu Berlin Demenzrisiko

Mehr

Sport und Bewegung für das Alter und im Alter wie körperliche Aktivität zu Gesundheit, Wohlbefinden und Lebensqualität im Alter beiträgt

Sport und Bewegung für das Alter und im Alter wie körperliche Aktivität zu Gesundheit, Wohlbefinden und Lebensqualität im Alter beiträgt Sport und Bewegung für das Alter und im Alter wie körperliche Aktivität zu Gesundheit, Wohlbefinden und Lebensqualität im Alter beiträgt Dr. Christoph Rott 2. Seniorensport-Kongress Aktiv älter werden

Mehr

Krankheitsbild - Demenz

Krankheitsbild - Demenz Duisburger Gespräche Herausforderung Demenz Krankheitsbild - Demenz Klinik für f r Altersmedizin / Geriatrie Juli 2004 - Dr. Wolfrid Schröer Was bedeutet Demenz? Verlust der Geistes- und Verstandesfähigkeiten

Mehr

Der demente Patientwas wir nicht wissen, aber wissen sollten

Der demente Patientwas wir nicht wissen, aber wissen sollten Der demente Patientwas wir nicht wissen, aber wissen sollten Lebenserwartung http://www.demografieportal.de/shareddocs/informieren/de/statistiken/deutschland/anteil_ueber65_ueber80.html Heute Intensivstation,

Mehr

Am liebsten geistig fit bis ins hohe Alter

Am liebsten geistig fit bis ins hohe Alter Am liebsten geistig fit bis ins hohe Alter Prof. Dr. Andreas Fellgiebel Universitätsmedizin Mainz Klinik für Psychiatrie und Das Nachlassen der geistigen Leistungsfähigkeit im Alter ist normal und führt

Mehr

Depression, Burnout. und stationäre ärztliche Versorgung von Erkrankten. Burnout I Depression Volkskrankheit Nr. 1? 1. Oktober 2014, Braunschweig

Depression, Burnout. und stationäre ärztliche Versorgung von Erkrankten. Burnout I Depression Volkskrankheit Nr. 1? 1. Oktober 2014, Braunschweig Burnout I Depression Volkskrankheit Nr. 1? 1. Oktober 2014, Braunschweig Depression, Burnout und stationäre ärztliche Versorgung von Erkrankten Privatdozent Dr. med. Alexander Diehl M.A. Arzt für Psychiatrie

Mehr

Definition der Demenz. Alltagsrelevante Abnahme von Gedächtnis und anderen kognitiven Funktionen, die länger als 6 Monate besteht.

Definition der Demenz. Alltagsrelevante Abnahme von Gedächtnis und anderen kognitiven Funktionen, die länger als 6 Monate besteht. Definition der Demenz Alltagsrelevante Abnahme von Gedächtnis und anderen kognitiven Funktionen, die länger als 6 Monate besteht. Klinik der Demenz 1. Störung kognitiver Funktionen Gedächtnis ("er vergisst

Mehr

Kognitives Altern. Dr.Dr.Reiner Beck Heuser, I., Anghelescu, I. Kognitives Altern und Demenz-Erkrankungen. Uni-Med.,2003

Kognitives Altern. Dr.Dr.Reiner Beck Heuser, I., Anghelescu, I. Kognitives Altern und Demenz-Erkrankungen. Uni-Med.,2003 Dr.Dr.Reiner Beck Heuser, I., Anghelescu, I. Kognitives Altern und Demenz-Erkrankungen. Uni-Med.,2003 1 Neurodegenerative Erkrankungen Mehrere kognitive Funktionen betroffen Der kognitiv-mnestische Leistungsabbau

Mehr

Sport bei Demenz?! Effekte regelmäßiger körperlicher Aktivität. Dr. phil. K. Menzel Gesundheitszentrum Redtel Bismarckstr Stendal

Sport bei Demenz?! Effekte regelmäßiger körperlicher Aktivität. Dr. phil. K. Menzel Gesundheitszentrum Redtel Bismarckstr Stendal Sport bei Demenz?! Effekte regelmäßiger körperlicher Aktivität Dr. phil. K. Menzel Gesundheitszentrum Redtel Bismarckstr. 12-14 39576 Stendal Gliederung 1. Was ist eine Demenz? 2. Ursachen der Erkrankung?

Mehr

Neuronale Bildgebung bei der Alzheimer Krankheit. Stefan J. Teipel

Neuronale Bildgebung bei der Alzheimer Krankheit. Stefan J. Teipel Neuronale Bildgebung bei der Alzheimer Krankheit Stefan J. Teipel Klinik für Psychiatrie und Psychotherapie der Universität Rostock Deutsches Zentrum für Neurodegenerative Erkrankungen (DZNE), Rostock

Mehr

Diabetische Polyneuropathie Diagnose nach Leitlinien

Diabetische Polyneuropathie Diagnose nach Leitlinien AG-Fuß Rheinland-Pfalz/Saarland in der Arbeitsgemeinschaft Diabetologie und Endokrinologie (ADE) Rheinland-Pfalz e.v. Landesgruppe Rheinland-Pfalz der Deutschen Diabetes Gesellschaft Diabetische Polyneuropathie

Mehr

Vergesslichkeit im Alter: Was kann ich dagegen tun? Univ. Prof. Prim. Dr. Andreas Kampfl Abteilung für Neurologie KH der Barmherzigen Schwestern Ried

Vergesslichkeit im Alter: Was kann ich dagegen tun? Univ. Prof. Prim. Dr. Andreas Kampfl Abteilung für Neurologie KH der Barmherzigen Schwestern Ried Vergesslichkeit im Alter: Was kann ich dagegen tun? Univ. Prof. Prim. Dr. Andreas Kampfl Abteilung für Neurologie KH der Barmherzigen Schwestern Ried Altersvergesslichkeit oder Demenz? Vergesslichkeit:

Mehr

Ab welchen Werten wird s brenzlig?

Ab welchen Werten wird s brenzlig? Was Sie über Cholesterin wissen sollten Ab welchen Werten wird s brenzlig?»wenn das Cholesterin über 200 mg/dl beträgt, dann ist bereits das Risiko für die Gefäße erhöht.wenn das Cholesterin etwa 250 mg/dl

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

Psychische Gesundheit. Claudia Hornberg / Claudia Bürmann

Psychische Gesundheit. Claudia Hornberg / Claudia Bürmann Psychische Gesundheit Claudia Hornberg / Claudia Bürmann Geschlechterspezifische Aspekte in der Psychischen Versorgung (I) Zunahme der Aufmerksamkeit für geschlechterspezifische Aspekte vielfältige Gründe,

Mehr

Greater occipital nerve block using local anaesthetics alone or with triamcinolone for transformed migraine: a randomised comparative study

Greater occipital nerve block using local anaesthetics alone or with triamcinolone for transformed migraine: a randomised comparative study Greater occipital nerve block using local anaesthetics alone or with triamcinolone for transformed migraine: a randomised comparative study A. Ashkenazi, R. Matro, J.W. Shaw, M.A. Abbas, S.D. Silberstein

Mehr

Experten-Statement. Prof. Dr. med. Frank Jessen

Experten-Statement. Prof. Dr. med. Frank Jessen Experten-Statement Prof. Dr. med. Frank Jessen Direktor der Klinik und Poliklinik für Psychiatrie und Psychotherapie, Uniklinik Köln, Mitglied der Leitlinien-Steuerungsgruppe und Leitlinienkoordination

Mehr

Psychische Risiken des Alterns Wie altern wir gesund?

Psychische Risiken des Alterns Wie altern wir gesund? Psychische Risiken des Alterns Wie altern wir gesund? PD Dr. Peter Häussermann, Köln Gliederung Warum altern wir? Genetik Demographie Prävention von Alterungsprozessen Das sogenannte Altersparadoxon Modelle

Mehr

Alzheimer Demenz: Unser Engagement. Eine Broschüre für Betroffene, Ihre Angehörigen und Interessierte

Alzheimer Demenz: Unser Engagement. Eine Broschüre für Betroffene, Ihre Angehörigen und Interessierte Alzheimer Demenz: Unser Engagement Eine Broschüre für Betroffene, Ihre Angehörigen und Interessierte Wer wir sind und wofür wir stehen Simone Thomsen Im Jahre 1876 gründete Colonel Eli Lilly das heutige

Mehr

Erweiterter Check-Up

Erweiterter Check-Up Erweiterter Check-Up Gemeinschaftspraxis Diabetologische Schwerpunktpraxis Hausärztliche Versorgung Gelbfieberimpfstelle Dr. med. Ottmar Orth Dr. med. Silke Orth Dr. med. Patrick Kudielka Facharzt für

Mehr

Demenzerkrankungen. Thomas Schulze. Psychiatrische Universitätsklinik der Charité im St. Hedwig-Krankenhaus

Demenzerkrankungen. Thomas Schulze. Psychiatrische Universitätsklinik der Charité im St. Hedwig-Krankenhaus Demenzerkrankungen Thomas Schulze Psychiatrische Universitätsklinik der Charité im St. Hedwig-Krankenhaus Ablauf 1. Definition der Demenz 2. Erscheinungsformen der Demenz 3. Häufigkeit von Demenzerkrankungen

Mehr

Lässt sich Alzheimer hinauszögern und damit verhindern?

Lässt sich Alzheimer hinauszögern und damit verhindern? Lässt sich Alzheimer hinauszögern und damit verhindern? Univ.-Prof. Dr. W. D. Oswald Forschungsgruppe Prävention & Demenz der Universität Erlangen-Nürnberg Alois Alzheimer 1864-1915 Leipzig, 1. Juni 29

Mehr

Dr. med. Andrej Pauls

Dr. med. Andrej Pauls Alzheimer-Krankheit eine Einführung Die Alzheimer-Krankheit ist die häufigste Form der Demenz: Beinahe zwei Drittel aller Demenzkranken sind von dieser Diagnose betroffen. Die Patientinnen und Patienten

Mehr

SCREENING / V1. Empfang. Studientitel und Studiennummer. Name:... o männlich o weiblich. o Hispanisch oder Latino. o Nicht hispanisch oder Latino

SCREENING / V1. Empfang. Studientitel und Studiennummer. Name:... o männlich o weiblich. o Hispanisch oder Latino. o Nicht hispanisch oder Latino SCREENING / V1 Empfang Datum Screening Adresse Geschlecht o männlich o weiblich Ethnie o Hispanisch oder Latino o Nicht hispanisch oder Latino Rekrutierungsquelle Patientennummer Rasse o kaukasisch o andere:

Mehr

Braucht jeder Patient eine pharmazeutische Betreuung?

Braucht jeder Patient eine pharmazeutische Betreuung? Braucht jeder Patient eine pharmazeutische Betreuung? Carole Kaufmann, MSc(Pharm) Pharmaceutical Care Research Group & Kantonsspital Baselland, Klinische Pharmazie Das Problem [1] Wiesner C. Dissertation.

Mehr

Das klinische Spektrum der ALS. Albert C. Ludolph, Ulm

Das klinische Spektrum der ALS. Albert C. Ludolph, Ulm Das klinische Spektrum der ALS Albert C. Ludolph, Ulm Die häufigste Motoneuronerkrankung: die amyotrophe Lateralsklerose (ALS) Rasch fortschreitende, erst fokale, sich kontinuierlich ausbreitend, dann

Mehr

Erkennen der Mangelernährung bei alten Menschen

Erkennen der Mangelernährung bei alten Menschen AUGSBURGER ERNÄHRUNGSGESPRÄCH 11.02.2015 Erkennen der Mangelernährung bei alten Menschen Susanne Nau Ernährungswissenschaftlerin Ernährungsteam Prävalenz der Mangelernährung Augsburger Ernährungsgespräch

Mehr

EFL-Testung Allheilmittel beim Zielkonflikt?

EFL-Testung Allheilmittel beim Zielkonflikt? EFL-Testung Allheilmittel beim Zielkonflikt? Dr. S. Jung, Chirurgische Klinik und Poliklinik 16.01.2015 Kosten des Heilverfahrens Daten 2013 - Arbeitsunfälle / Wegeunfälle insg. 1,06 Mio. / 2013 - Aufwendungen

Mehr

WARUM FRAUEN GESÜNDER LEBEN & MÄNNER FRÜHER STERBEN. Inhalt

WARUM FRAUEN GESÜNDER LEBEN & MÄNNER FRÜHER STERBEN. Inhalt Inhalt 15 Zwei Gesundheitskulturen Männer sind anders, Frauen auch 16 Der Begriff Gender Medicine 18 Biologische Gegebenheiten 19 Frauen leben länger 21 Warum Frauen länger leben 22 Gesund oder krank?

Mehr

Depression im Alter. Dr. med. Ch. Alber Dr. med. M. Hafner

Depression im Alter. Dr. med. Ch. Alber Dr. med. M. Hafner Depression im Alter Dr. med. Ch. Alber Dr. med. M. Hafner Definition Depression (ICD 10) Hauptsymptome Gedrückte Stimmung, Freud-und Intressenlosigkeit, verminderter Antrieb und rasche Ermüdbarkeit Weitere

Mehr

Nuklearmedizinische Diagnostik von Demenz-Erkrankungen

Nuklearmedizinische Diagnostik von Demenz-Erkrankungen DGN Jahrestagung 2012, MRTA-Fortbildung VI Nuklearmedizinische Diagnostik von Demenz-Erkrankungen Ralph Buchert Charité Universitätsmedizin Berlin Klinik für Nuklearmedizin U N I V E R S I T Ä T S M E

Mehr

Impressum. Zarenga GmbH, Bonn 2015. Zarenga GmbH, Pfaffenweg 15, 53227 Bonn. Alle Rechte sind vorbehalten.

Impressum. Zarenga GmbH, Bonn 2015. Zarenga GmbH, Pfaffenweg 15, 53227 Bonn. Alle Rechte sind vorbehalten. Demenz Ratgeber Impressum Zarenga GmbH, Bonn 2015 Zarenga GmbH, Pfaffenweg 15, 53227 Bonn Alle Rechte sind vorbehalten. Dieses Buch, einschließlich seiner einzelnen Teile ist urheberrechtlich geschützt.

Mehr

Ergebnisse früherer Studien

Ergebnisse früherer Studien Psychosoziale Belastungen und Gesundheitsstörungen Christian Albus, Alexander Niecke, Kristin Forster, Christina Samel Tagung des Interessenverbandes Contergangeschädigter NRW e.v. Köln, 09. April 2016

Mehr

Kognitive Dysfunktion bei Depression: häufig ein vergessenes Symptom?

Kognitive Dysfunktion bei Depression: häufig ein vergessenes Symptom? Kognitive Dysfunktion bei Depression: häufig ein vergessenes Symptom? Prof. Dr. med. Gregor Hasler Chefarzt und Extraordinarius Universitätsklinik für Psychiatrie Universität Bern 3. Netzwerktagung Psychische

Mehr

Geriatric Depression Scale (GDS) Nach Sheikh und Yesavage 1986

Geriatric Depression Scale (GDS) Nach Sheikh und Yesavage 1986 Geriatric Depression Scale (GDS) Nach Sheikh und Yesavage 1986 Die Geriatric Depression Scale nach Sheikh und Yesavage 1986 umfasst in der Kurzform 15 Fragen Die kognitive Situation sollte vorher mit Hilfe

Mehr

kranken- und pflegeversicherung Ambulante Vorsorgeleistungen Kuren

kranken- und pflegeversicherung Ambulante Vorsorgeleistungen Kuren kranken- und pflegeversicherung Ambulante Vorsorgeleistungen Kuren Mit dieser Information möchten wir Sie über die ambulanten Vorsorgeleistungen, die im Volksmund auch Badekuren genannt werden, informieren

Mehr

Das EliA System. nn Protokolle, QC- und Rohdaten leicht zugänglich nn Optionaler Anschluss an die Laborsoftware nn Detailliertes QC-Management

Das EliA System. nn Protokolle, QC- und Rohdaten leicht zugänglich nn Optionaler Anschluss an die Laborsoftware nn Detailliertes QC-Management CCP Das EliA System Mehr Zeit für s Wesentliche nn Vollständig automatisiert (echter Walk-away-Modus, Übernachtläufe) nn Einfaches Management des Instruments mit maßgefertigter Software nn Barcode-Lesegerät

Mehr

Vorbeugen Ja oder Nein?

Vorbeugen Ja oder Nein? Vorbeugen Ja oder Nein? Prävention aus der Sicht eines Krankenversicherers SGGP 2015 Thomas D. Szucs Disclaimer Die vorgetragenen Ausführungen, Meinungen und Fakten entsprechen der persönlichen Betrachtungsweise

Mehr

Check-Up. Gemeinschaftspraxis. Diabetologische Schwerpunktpraxis Hausärztliche Versorgung Gelbfieberimpfstelle

Check-Up. Gemeinschaftspraxis. Diabetologische Schwerpunktpraxis Hausärztliche Versorgung Gelbfieberimpfstelle Check-Up Ab dem 35. Lebensjahr alle 2 Jahre Gemeinschaftspraxis Diabetologische Schwerpunktpraxis Hausärztliche Versorgung Gelbfieberimpfstelle Dr. med. Ottmar Orth Dr. med. Silke Orth Dr. med. Patrick

Mehr

Motiviert, wieder zu arbeiten aber nicht motiviert genug, etwas für die eigene Gesundheit zu tun? Sonia Lippke, Bremen

Motiviert, wieder zu arbeiten aber nicht motiviert genug, etwas für die eigene Gesundheit zu tun? Sonia Lippke, Bremen Motiviert, wieder zu arbeiten aber nicht motiviert genug, etwas für die eigene Gesundheit zu tun? Sonia Lippke, Bremen Inhalte 1. Rehabilitation und Rückkehr an den Arbeitsplatz 2. Stufenweise Wiedereingliederung

Mehr

Frontotemporale Demenz. Frontotemporale Demenz Tragödie in der Lebensmitte

Frontotemporale Demenz. Frontotemporale Demenz Tragödie in der Lebensmitte Frontotemporale Demenz Tragödie in der Lebensmitte Berlin (5. November 2009) - Aufgrund zahlreicher Nachfragen von Angehörigen gibt die Deutsche Alzheimer Gesellschaft eine neue Broschüre zum Thema Frontotemporale

Mehr

Anamnese Fragebogen Kinder & Jugendliche

Anamnese Fragebogen Kinder & Jugendliche Anamnese Fragebogen Kinder & Jugendliche Diese Information werden vertraulich behandelt und dienen ausschließlich der aktuellen Behandlung. Bitte mit Druckbuchstaben ausfüllen! Mutter: Vater: Name: Vorname:

Mehr

Präoperative Risikostratifizierung beim betagten Patienten

Präoperative Risikostratifizierung beim betagten Patienten Präoperative Risikostratifizierung beim betagten Patienten Dr. med. S. Beck Oberarzt Klinik für Akutgeriatrie Geriatrischer Konsiliararzt Altersheime der Stadt Zürich Agenda Einige Grundlagen Geriatrisches

Mehr

Ernährung, Bewegung, Motivation. Das A und O bei Adipositas und Typ-2-Diabetes

Ernährung, Bewegung, Motivation. Das A und O bei Adipositas und Typ-2-Diabetes Ernährung, Bewegung, Motivation Das A und O bei Adipositas und Typ-2-Diabetes Theresa van Gemert Institut für Klinische Diabetologie am Deutschen Diabetes-Zentrum Leibniz-Zentrum für Diabetes-Forschung

Mehr

Information. Zahnärztliche Behandlung von Asylbewerbern. Bundeszahnärztekammer, September 2015. Es gilt das gesprochene Wort

Information. Zahnärztliche Behandlung von Asylbewerbern. Bundeszahnärztekammer, September 2015. Es gilt das gesprochene Wort Information Zahnärztliche Behandlung von Asylbewerbern Bundeszahnärztekammer, September 2015 Es gilt das gesprochene Wort Zahnärztliche Behandlung von Asylbewerbern Begriffsbestimmung Das Bundesministerium

Mehr

Altwerden ist immer noch die einzige Möglichkeit, lange zu leben

Altwerden ist immer noch die einzige Möglichkeit, lange zu leben Altwerden ist immer noch die einzige Möglichkeit, lange zu leben (Hugo von Hofmannsthal, 1874-1929) Foto/Quelle: Can Stock Photo Muss Alter zwangsläufig Krankheit bedeuten? Nicht unbedingt Foto/Quelle:

Mehr

Menschen mit Demenz - Krankheitsbilder und Behandlungsoptionen

Menschen mit Demenz - Krankheitsbilder und Behandlungsoptionen 5. Fachveranstaltung der STGAG/PKM und des Spitex Verbandes Thurgau am 14.05.2013 Menschen mit Demenz - Krankheitsbilder und Behandlungsoptionen Dr. med. Jacques-Emmanuel Schaefer Demenz, eine Alterskrankheit...!?

Mehr

Spezielle Probleme bei Diagnostik und Therapie onkologischer Erkrankungen im Alter

Spezielle Probleme bei Diagnostik und Therapie onkologischer Erkrankungen im Alter Spezielle Probleme bei Diagnostik und Therapie onkologischer Erkrankungen im Alter Von Priv.- Doz.Dr. med. K.-M. Koeppen Facharzt für Innere Medizin, Hämatologie, Klinische Geriatrie, geriatrische Frührehabilitaion

Mehr

Alzheimer Ihre Gesundheit - Unser Thema ist ein Service Ihrer niedergelassenen Ärzte und Psychotherapeuten in Bayern

Alzheimer Ihre Gesundheit - Unser Thema ist ein Service Ihrer niedergelassenen Ärzte und Psychotherapeuten in Bayern Patienteninformation Alzheimer Ihre Gesundheit - Unser Thema ist ein Service Ihrer niedergelassenen Ärzte und Psychotherapeuten in Bayern Meine Reise zum Sonnenuntergang des Lebens so begann der wohl prominenteste

Mehr

Eiweiß in der Ernährung welche Empfehlung gilt für wen? Dr.oec.troph. Astrid Tombek

Eiweiß in der Ernährung welche Empfehlung gilt für wen? Dr.oec.troph. Astrid Tombek Eiweiß in der Ernährung welche Empfehlung gilt für wen? Dr.oec.troph. Astrid Tombek Beratungsalltag in der Diabetesberatung Was der Doktor sagt: Sie haben Eiweiß im Urin Essen Sie gesund! Was die Beraterin

Mehr

MMS Mini Mental Status/Uhrentest

MMS Mini Mental Status/Uhrentest MMS Mini Mental Status/Uhrentest Folstein MF et al. J Psychiatr Res 1975; 12: 189-98. Assessmentinstrumente zur Erfassung von kognitiven Störungen Der MMS wurde 1975 von Folstein und Mitarbeitern als praktische

Mehr

Präsenile Demenzen Thomas Duning Klinik für Allgemeine Neurologie Department für Neurologie Westfälische Wilhelms-Universität Münster

Präsenile Demenzen Thomas Duning Klinik für Allgemeine Neurologie Department für Neurologie Westfälische Wilhelms-Universität Münster Präsenile Demenzen Thomas Duning Klinik für Allgemeine Neurologie Department für Neurologie Westfälische Wilhelms-Universität Münster Präsenile Demenz = Definition Klassische Demenz vom Typ Alzheimer Präsenile

Mehr

Die Einschätzung des deliranten Patienten

Die Einschätzung des deliranten Patienten DIVI Hamburg 3. Dezember 2014 Die Einschätzung des deliranten Patienten Jürgen Maier, Pflegeexperte Neurochirurgische Intensivstation Die Folien wurden teilweise übernommen aus der Schulung Delir Management

Mehr

Empfehlungen zum Umgang mit Frühdiagnostik bei Demenz. Empfehlungen der Deutschen Alzheimer Gesellschaft

Empfehlungen zum Umgang mit Frühdiagnostik bei Demenz. Empfehlungen der Deutschen Alzheimer Gesellschaft Empfehlungen zum Umgang mit Frühdiagnostik bei Demenz Die Demenz-Diagnose Als Demenz bezeichnet die Medizin einen Zustand, bei dem die Leistungs fähigkeit des Gedächtnisses, des Denkvermögens, der Konzentrationsfähigkeit

Mehr

normales Altern II. Demenz und Parkinson Mögliche psychische Änderungen bei Parkinson Parkinson Regionalgruppe Rheine Demenz & Parkinson

normales Altern II. Demenz und Parkinson Mögliche psychische Änderungen bei Parkinson Parkinson Regionalgruppe Rheine Demenz & Parkinson Parkinson Regionalgruppe Rheine..\Videos\Baclofenpumpe\Nach OP\29 01 2008.mpg & Parkinson Neurologische Klinik Parkinson Kompetenznetz Deutschland Franz-Hospital Pablo Pérez González Franz-Hospital Dülmen

Mehr

Sport und Bewegung. Körperliche Aktivität. Das Potenzial körperlicher Aktivität. Das Potenzial körperlicher Aktivität

Sport und Bewegung. Körperliche Aktivität. Das Potenzial körperlicher Aktivität. Das Potenzial körperlicher Aktivität Körperliche Aktivität Fachtagung Psychische Belastungen im Beruf Bad Münstereifel - 27./28. Mai 2010 körperliche Bewegung Sport und Bewegung Gesundheitssport Training Susanne Brandstetter Universitätsklinikum

Mehr

Gerontopsychiatrie. Dr. medic. Ligia Comaniciu Leyendecker

Gerontopsychiatrie. Dr. medic. Ligia Comaniciu Leyendecker Gerontopsychiatrie ligley66@gmail.com ligley66@gmail.com Gerontopsychiatrie 1 / 19 Outline 1 Demenz 2 Demenz bei Alzheimerkrankheit 3 Vaskuläre Demenz 4 Andere Demenzformen 5 Diagnostische Verfahren 6

Mehr

Psychiatrische Bildgebung: mehr als Ausschlussdiagnostik?

Psychiatrische Bildgebung: mehr als Ausschlussdiagnostik? Psychiatrische Bildgebung: mehr als Ausschlussdiagnostik? Prof. Dr. Uwe Herwig Psychiatrische Universitätsklinik Zürich Davos, 7. März 2014 Frau B. Frau B., 28 J., Selbstzuweisung wg. Erschöpfung, Schlafstörungen,

Mehr

Können Klinische Krebsregister einen nützlichen Beitrag zu Patientenaufklärung und -information leisten?

Können Klinische Krebsregister einen nützlichen Beitrag zu Patientenaufklärung und -information leisten? Können Klinische Krebsregister einen nützlichen Beitrag zu Patientenaufklärung und -information leisten? F. Papendorf, F. Ruthotto, G. Wegener, B. Günther, G. Unger, B. Dlugosch, T. Greten 17. Informationstagung

Mehr

Dr.med. + Dr.phil.nat. Urban Wirz Facharzt FMH für Allgemeine Innere Medizin Praxisgemeinschaft Kofmehl-Huus 4553 Subingen

Dr.med. + Dr.phil.nat. Urban Wirz Facharzt FMH für Allgemeine Innere Medizin Praxisgemeinschaft Kofmehl-Huus 4553 Subingen Dr.med. + Dr.phil.nat. Urban Wirz Facharzt FMH für Allgemeine Innere Medizin Praxisgemeinschaft Kofmehl-Huus 4553 Subingen 1. Vorbemerkungen 2. Anmeldung zur Fahreignungsabklärung 3. Voruntersuchung durch

Mehr

Cushing Syndrom. 7. Süddeutscher Hypophysentag. Ch. Berr Medizinische Klinik und Poliklinik IV Ludwig-Maximilians-Universität München

Cushing Syndrom. 7. Süddeutscher Hypophysentag. Ch. Berr Medizinische Klinik und Poliklinik IV Ludwig-Maximilians-Universität München Cushing Syndrom 7. Süddeutscher Hypophysentag Ch. Berr Medizinische Klinik und Poliklinik IV Ludwig-Maximilians-Universität München 1 Campus Innenstadt Campus Innenstadt Was ist das Cushing Syndrom? Kognitive

Mehr

Demenzkampagne Rheinland-Pfalz

Demenzkampagne Rheinland-Pfalz Demenzkampagne Rheinland-Pfalz 1 Abgrenzung zum normalen Altern Vergessen gehört ebenso zum Leben wie erinnern. Beim Altern lassen alle Körperfunktionen nach, auch das Gedächtnis bekommt Lücken. Aber nicht

Mehr

Schicksal Schlaganfall: Jede Minute zählt. Dr. med. Stefan Wolff Leitender Arzt Abteilung für Neurologie Stadtspital Triemli

Schicksal Schlaganfall: Jede Minute zählt. Dr. med. Stefan Wolff Leitender Arzt Abteilung für Neurologie Stadtspital Triemli Schicksal Schlaganfall: Jede Minute zählt Dr. med. Stefan Wolff Leitender Arzt Abteilung für Neurologie Stadtspital Triemli Agenda Was ist überhaupt ein Schlaganfall? Definition Symptome Was tun bei Verdacht

Mehr

Prof. Dr. Dr. Martin HärterH

Prof. Dr. Dr. Martin HärterH Effekte von Shared Decision-Making Forschungsstand zur Adherence Prof. Dr. Dr. Martin HärterH Fachtagung Adherence Berlin 11.12.2009 Definition Adherence ist definiert als das Ausmaß, in welchem das Verhalten

Mehr