Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Größe: px
Ab Seite anzeigen:

Download "Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60"

Transkript

1 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt in der Embryogenese des Säugetieres. Die Entwicklung des Trophoblasten hängt von der Expression verschiedener Proteine des Zytoskeletts ab. Zu den ersten Genen, die in Trophoblastzellen differenziell exprimiert werden, gehören die Keratine (Jackson et al. 98, Jackson et al. 98). Mit degenerierten Primern ist es gelungen, eine partielle DN-Sequenz von 349 bp Länge des Cytokeratin-8-Gens des Kaninchens zu identifizieren. Die neue partielle Kodonsequenz wurde mit dem Verweis Y993 in der Genank Datenbank veröffentlicht. Die Homologie zur humanen Sequenz beträgt 87 % (bb. 3.). Kaninchen: cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 6 Mensch: 8 cagattgaggagagcaccacagtggtcaccacacagtctgctgaggttggagctgctgag 86 Kaninchen: 6 acaacactcacggagctgcggcgcaccttccagtctttggagatcgacctggagtccatg Mensch: 86 acgacgctcacagagctgagacgtacagtccagtccttggagatcgacctggactccatg 9 Kaninchen: aagaacctgaagatcagcttggagaacagcctgcgggacgtggagacgcgctacgccatg 8 Mensch: 9 agaaatctgaaggccagcttggagaacagcctgagggaggtggaggcccgctacgcccta 98 Kaninchen: 8 cagatggagcagctcaacggcgtgctgctgcacctggagtccgagctggcgcagacccgg 4 Mensch: 98 cagatggagcagctcaacgggatcctgctgcaccttgagtcagagctggcacagacccgg 4 Kaninchen: 4 gccgagggacagcgccaggcccaggagtacgaagccctgctgaacatcaaggtcaagctg 3 Mensch: 4 gcagagggacagcgccaggcccaggagtatgaggccctgctgaacatcaaggtcaagctg Kaninchen: 3 gaggctgaaatcgccacctaccgccgcctgctggaagatggcgaggact 349 Mensch: gaggctgagatcgccacctaccgccgcctgctggaagatggcgaggact 5 bb. 3. lignment der neu identifizierten Cytokeratin-8-Kaninchensequenz mit der humanen Sequenz. Mit Hilfe der semiquantitativen RT-PCR konnte im Trophoblasten im Vergleich zum Embryoblasten ein im Durchschnitt 3,4fach stärkeres Signal für Cytokeratin 8 nachgewiesen werden (bb. 3.). Die statistische uswertung ergab ein p<,. Vergleichbare Studien an Kaninchenblastozysten existieren nicht. In der Mausblastozyste wurden mittels RT-PCR (auf β- ktin bezogen) im Trophoblasten 7fach höhere Cytokeratin-8-Transkripte als im Embryoblasten gefunden (rison und Schultz 996).

2 Ergebnisse 7 M W M W bb. 3. R epräse nta tive Darstellung de r Ergebniss e d er PCR für ß-ktin () und Cytokeratin 8 (). Im Trophoblasten konnte eine im Durchschnitt 3,4fach höhere mrn Menge an Cytokeratin 8 gegenüber der inneren Zellmasse festgestellt werden (p=,6). M = Längenmarker, = Embryoblast, = Trophoblast; W = Wasserprobe. 3. Untersuchung 6 Tage alter lastozysten nach Exposition mit en PC 3.. Xenobiotika-metabolisierende Enzyme ls Vertreter fremdstoffmetabolisierender Enzyme wurden in der vorliegenden rbeit d ie Cytochrom P45 Monooxygenasen und Genbatterie ausgewählt. Ihre Expression kann durch hr-liganden induziert werden (Nebert und Gonzalez 987, Shen et al. 994). Desweiteren wurde die Glutathion-S-Transferase π untersucht. Sie ist kein klassisches hr-zielgen, kann aber hr-unabhängig durch PC induziert werden (oki et al. 99, Matsumoto et al. 999). -, ng/ml und damit zwei typische Gene der hr- Nach einer vierstündigen Exposition mit den drei koplan aren PC 77, 6 und 69 einer Konzentratio n von, ng/ml Kulturmedium für jedes Kongener konnte für CYP im Embryoblasten eine im Durchschnitt,4fach erhöhte mrn-menge im Vergleich zur - Kontrolle ermittelt werden. In einem der insgesamt drei Expositionsversuche wurde sogar ein nstieg um % beobachtet, der mit einem p<,5 statistische Signifikanz aufwies. Im Trophoblasten zeigten sich dagegen keine Veränderungen der relativen Transkriptmenge (bb. 3.3 ). Die Transkripte für CYP waren in beiden Zelllinien im Mittel um,7 bzw.,6 erhöht. Hier konnte für den nstieg der Transkriptmenge im Embryoblasten ein p<,5 ermittelt werden (bb. 3.3 ) Für die Glutathion-S-Transferase π wurden nur geringe, nicht signifikante Veränderungen gefunden (bb. 3.3 C).

3 Ergebnisse 8 CYP CYP *.,5,5 C GST pi bb. 3.3 Ergebnisse der densitometrischen uswertung der PCR für CYP (), CYP () und GST π (C) nach Exposition ohne () und mit, ng er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. Nach PC- Exposition konnte für CYP im Embryoblasten eine signifikant erhöhte Transkriptmenge im Vergleich zur Kontrollgruppe ermittelt werden (*p<,5). - µg/ml Um ussagen über eine eventuelle Konzentrationsabhängigkeit der beobachteten Veränderungen treffen zu können, wurden 6 Tage alte Kaninchenblastozysten mit µg/kongener/ml Kulturmedium für 4 Stunden exponiert. Es zeigte sich erneut ein nstieg der Transkriptmenge für CYP im Embryoblasten, diesmal um,6 (bb. 3.4 ). Der Unterschied zur Kontrollgruppe war statistisch signifikant. Gleichfalls wurde eine Induktion des CYP im Embryoblasten um,8 und im Trophoblasten um,3 festgestellt (bb. 3.4 ). Der statistische Vergleich ergab für alle drei Versuche einen so geringen Standardfehler, dass für die Induktion von CYP in beiden Zelllinien gegenüber der Kontrolle ein p<, berechnet werden konnte. Wiederum keine nennenswerten Unterschiede waren für die GST π zu ermitteln (bb. 3.4 C) CYP CYP * ** 3 *

4 Ergebnisse C GST pi bb. 3.4 Ergebnisse der densitometrischen uswertung der PCR für CYP (), CYP () und GST π (C) nach Exposition ohne () und mit µg er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. Nach PC-Exposition konnte für CYP im Embryoblasten und CYP in beiden Zelllinien eine signifikant erhöhte Transkriptmenge im Vergelich zur Kontrollgruppe ermittelt werden (*p<,5, **p<,). 3.. Hypoxia Inducible Factor-α HIF-α wurde als Hypoxie-induzierter Transkriptionsfaktor in die Untersuchungen einbezogen, da e PC hypoxischen Stress verursachen können (Hassoun et al., Hennig et al., Oakley et al. 996). Mit Primern basierend auf der humanen HIF-α-mRN ist es gelungen, die bis dahin unbekannte vollständige mrn des Kaninchens zu sequenzieren ( Genank Eintrag Y7379). Sie enthält 47 bp und die Homologie zur humanen HIF-αmRN beträgt 93%. ls mplikon für die semiquantitative PCR wurde ein Fragment von 73 bp ausgewählt. Der Sequenzvergleich dieses Fragmentes zur humanen HIF-α-Sequenz ist in der bbildung 3.7 dargestellt. -, ng/ml Nach Exposition von, ng der en Kongenere konnte in beiden Zelllinien der lastozyste eine leichte jedoch nicht signifikante Reduzierung des mplifikates beobachtet werden (bb. 3.5).,5,5 HIF-alpha bb. 3.5 Ergebnisse der densitometrischen uswertung der PCR für HIF-α nach Exposition ohne () und mit, ng er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an.

5 Ergebnisse - µg/ml Die Exposition mit µg er PC ergab gegenüber der Kontrolle einen signifikanten bfall der HIF-α-mRN auf,7 im Embryoblasten. Die HIF-α-Transkripte im Trophoblasten waren unverändert (bb. 3.6).,5,5 HIF-alpha * bb. 3.6 Ergebnisse der densitometrischen uswertung der PCR für HIF-α nach Exposition ohne () und mit µg er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. Im Embryoblasten konnte ein im Vergleich zur Kontrollgruppe signifikanter bfall der HIF-α-Transkripte ermittelt werden (*p<,5).

6 Ergebnisse Kaninchen: gccgaggaagaactatgaacataaagtctgccacctggaaggtacttcactgtacaggcc 6 Mensch: 84 gccgaggaagaactatgaacataaagtctgcaacatggaaggtattgcactgcacaggcc 873 Kaninchen: 6 atattcatgtatatgataccaacagtaaccagtcccagtgcggatataagaaacctccca Mensch: 874 acattcacgtatatgataccaacagtaaccaacctcagtgtgggtataagaaaccaccta 933 Kaninchen: tgacatgcttggtgctgatttgtgaacccattcctcatccatcaaatattgaaattcctt 8 Mensch: 934 tgacctgcttggtgctgatttgtgaacccattcctcacccatcaaatattgaaattcctt 993 Kaninchen: 8 tagacagcaagacgtttctcagtcgacacagcctggatatgaaattttcttactgtgatg 4 Mensch: 994 tagatagcaagactttcctcagtcgacacagcctggatatgaaattttcttattgtgatg 53 Kaninchen: 4 aaagaattactgaattgatgggatatgaaccagaagaacttttgggccgttcaatttatg 3 Mensch: 54 aaagaattaccgaattgatgggatatgagccagaagaacttttaggccgctcaatttatg 3 Kaninchen: 3 aatattaccatgctttggactctgatcatctgaccaaaactcatcatgatatgtttacta 36 Mensch: 4 aatattatcatgctttggactctgatcatctgaccaaaactcatcatgatatgtttacta 73 Kaninchen: 36 aaggacaagtcaccacaggacagtataggatgcttgccaaaagaggtggatatgtctggg 4 Mensch: 74 aaggacaagtcaccacaggacagtacaggatgcttgccaaaagaggtggatatgtctggg 33 Kaninchen: 4 ttgaaactcaagcaacggtcatatataataccaagaactctcaaccgcagtgcattgtgt 48 Mensch: 34 ttgaaactcaagcaactgtcatatataacaccaagaattctcaaccacagtgcattgtat 93 Kaninchen: 48 gtgtcaattatgttgtgagtggtattattcagcacgacttgattttctcccttcaacaaa 54 Mensch: 94 gtgtgaattacgttgtgagtggtattattcagcacgacttgattttctcccttcaacaaa 353 Kaninchen: 54 cagaatgtgtcctcaaaccagttgaatcttcagatatgaaaatgactcagctgttcacca 6 Mensch: 354 cagaatgtgtccttaaaccggttgaatcttcagatatgaaaatgactcagctattcacca 43 Kaninchen: 6 aagtggaatcagcagatacaagtagtctctttgacaaactgaagaaggagcctgatgctt 66 Mensch: 44 aagttgaatcagaagatacaagtagcctctttgacaaacttaagaaggaacctgatgctt 473 Kaninchen: 66 taactctgctggccccagctgctggagacacaatcatatctttagattttggcagcaacg 7 Mensch: 474 taactttgctggccccagccgctggagacacaatcatatctttagattttggcagcaacg 533 Kaninchen: 7 acacagaaac 73 Mensch: 534 acacagaaac 543 bb. 3.7 lignment des für die PCR ausgewählten 73 bp Fragmentes der neu identifizierten HIF-α- Kaninchensequenz mit der humanen HIF-α-Sequenz.

7 Ergebnisse 3..3 Vascular Endothelial Growth Factor und Vascular Endothelial Growth Factor Receptor Die Primer für VEGF wurden anhand der teilweise bekannten Nukleotidsequenzen des Kaninchens und des Menschen gelegt. Dabei konnte ein neuer Teil der Kaninchensequenz von 36 bp ermittelt werden, der am 4. Februar 3 unter dem Verweis Y96796 in der Genank Datenbank veröffentlicht wurde. Der Sequenzvergleich des erhaltenen mplifikates ergab eine 9% Homologie zum humanen VEGF (bb.3.8). Die Primer für VEGFR konnten vollständig basierend auf der Kaninchensequenz synthetisiert werden. Kaninchen: cttgctgctctacctccaccatgccaagtggtcccaggctgcacccatggcagaagaagg 6 Mensch : 39 cttgctgctctacctccaccatgccaagtggtcccaggctgcacccatggcagaaggagg 98 Kaninchen: 6 agacaataaaccccacgaagtggtgaagttcatggaagtctaccggcgcagctactgcca Mensch: 99 agggcagaatcatcacgaagtggtgaagttcatggatgtctatcagcgcagctactgcca 58 Kaninchen: gccgatcgagaccttggtggacatcttccaggagtaccctgatgagatcgagtacatatt 8 Mensch: 59 tccaatcgagaccctggtggacatcttccaggagtaccctgatgagatcgagtacatctt 8 Kaninchen: 8 caagccttcctgcgtgcctctggtgcgctgtgggggctgctgcaatgatgaaagcctgga 4 Mensch: 9 caagccatcctgtgtgcccctgatgcgatgcgggggctgctgcaatgacgagggcctgga 78 Kaninchen: 4 gtgtgtgcccaccgaggagttcaacgtcaccatgcagatcatgcggatcaaacctcacca 3 Mensch: 79 gtgtgtgcccactgaggagtccaacatcaccatgcagattatgcggatcaaacctcacca 338 Kaninchen: 3 gggccagcacataggggagatgagcttcctacagcacaacaaatgtgaatgcagaccaaa 36 Mensch: 339 aggccagcacataggagagatgagcttcctacagcacaacaaatgtgaatgcagaccaaa 398 Kaninchen: 36 g 36 Mensch: 399 g 399 bb. 3.8 lignment der VEGF Kaninchensequenz mit der humanen VEGF-Sequenz. Der neu identifizierte nteil von 36 bp ist grau markiert. -, ng/ml Für VEGF waren in beiden Zelllinien keine Veränderungen zu beobachten (bb. 3.9 ). VEGFR-Transkripte waren im Trophoblasten signifikant gegenüber der -Kontrolle um,5 erhöht, im Embryoblasten dagegen unverändert (bb. 3.9 ).

8 Ergebnisse 3 VEGF VEGFR * bb. 3.9 Ergebnisse der densitometrischen uswertung der PCR für VEGF () und VEGFR () nach Exposition ohne () und mit, ng er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. Für VEGFR konnte im Vergleich zur Kontrollgruppe ein signifikanter nstieg im Trophoblasten ermittelt werden (*p<,5). - µg/ml uch die Exposition mit µg er PC wirkte sich nicht auf die VEGF- mrn aus (bb. 3. ). Für VEGFR zeigte sich hier ein verstärktes, jedoch nicht signifikant erhöhtes Signal in der Embryoblasten-cDN mit einem nstieg um,7 während die VEGFR-Transkripte im Trophoblasten unverändert blieben (bb. 3. ). VEGF VEGFR bb. 3. Ergebnisse der densitometrischen uswertung der PCR für VEGF () und VEGFR () nach Exposition ohne () und mit µg er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an.

9 Ergebnisse Matrix-Metalloprotease und Tissue Inhibitor of Metalloproteinases ls Vertreter der während der Implantation aktivierten Matrix-Metalloproteasen wurde in der vorliegenden rbeit die Typ IV-Kollagenase Matrix Metalloproteinase (MMP-, auch Gelatinase ) gewählt. Die MMP- weist ein besonders hohes Substratspektrum auf (imes und Quigley 995) und scheint an der frühen Phase der Dezidualisierung und Neovaskularisation beteiligt zu sein (Das et al. 997a). Gleichermaßen wurde ihr spezifischer Inhibitor Tissue Inhibitor of Metalloproteinases (TIMP-) untersucht. Die Nukleotidsequenzen von MMP- und TIMP- waren für das Kaninchen bekannt, sodass spezifische Primer gelegt werden konnten. Die mplifikate wurden durch Sequenzierungen bestätigt. -, ng/ml Die MMP--Expression war nach Exposition mit, ng der en Kongenere im Trophoblasten um,58 reduziert; im Embryoblasten war kein Unterschied festzustellen (bb. 3. ). Für TIMP- konnten mit den Faktoren,97 für den Embryoblasten und, für den Trophoblasten keine Effekte beobachtet werden (bb. 3. ). MMP- TIMP-,5,5,5,5 bb. 3. Ergebnisse der densitometrischen uswertung der PCR für MMP- () und TIMP- () nach Exposition ohne () und mit, ng er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. - µg/ml Nach Exposition mit µg der drei en Kongenere sank das MMP--Transkript im Trophoblasten nicht, wie erwartet, weiter ab, sondern war mit einem Faktor von,95 beinahe unverändert gegenüber der Kontrollgruppe. Es konnte jedoch ein nicht signifikanter leichter bfall der MMP--mRN des Embryoblasten auf,8 ermittelt werden (bb. 3. ). uch für TIMP- wurde im Embryoblasten eine verminderte Transkriptmenge (,65) gesehen. Im Vergleich zur -Kontrolle war diese Reduktion statistisch signifikant. Die TrophoblastenmRN für TIMP- war mit einem Faktor von, eher unverändert (bb. 3. ).

10 Ergebnisse 5 MMP- TIMP-,5,5,5,5 * bb. 3. Ergebnisse der densitometrischen uswertung der PCR für MMP- () und TIMP- () nach Exposition ohne () und mit µg er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. Für TIMP- war der bfall im Embryoblasten im Vergelich zur Kontrollgruppe statistisch signifikant (*p<,5) Cyclooxygenase- Die Cyclooxygenase- ist das schrittbestimmende Enzym der Synthese von Prostaglandinen aus rachidonsäure. Sie kann durch PC induziert werden. -, ng/ml Die relative Transkriptmenge der COX- war nach Exposition mit, ng/ml der en PC in beiden Zelllinien der lastozysten erhöht (bb. 3.3). Im Embryoblasten wurde eine Zunahme um,4 und im Trophoblasten um, ermittelt.,5,5,5 COX- bb. 3.3 Ergebnisse der densitometrischen uswertung der PCR für COX- nach Exposition ohne () und mit, ng er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. - µg/ml Nach 4stündiger Exposition mit µg er PC zeigte sich im Embryoblasten ein nstieg der Transkripte um, im Vergleich zur -Kontrolle (bb. 3.4). Diese Differenz erwies sich mit einem p<,5 als signifikant. Im Trophoblasten war dagegen ein leichter bfall auf,77 zu beobachten.

11 Ergebnisse 6,5,5,5 COX- * bb. 3.4 Ergebnisse der densitometrischen uswertung der PCR für COX- nach Exposition ohne () und mit µg er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. Der nstieg im Embryoblasten war gegenüber der Kontrolle signifikant erhöht ( *p<,5). Repräsentative Elektrophorese-Daten der Transkripte nach Exposition mit en PCs werden auf den Seiten 3 und 33 in der bbildung 3.5 dargestellt. lle statistisch berechneten Mittelwerte werden anschließend in bschnitt 3.4 tabellarisch zusammengefasst.

12 Ergebnisse Untersuchung 6 Tage alter lastozysten nach Exposition mit nicht en PC 3.3. Xenobiotika-metabolisierende Enzyme Zur Untersuchung des Einflusses nicht er PC auf die Transkription wurden 6 Tage alte Kaninchenblastozysten für vier Stunden mit einem Gemisch der nicht en Kongenere 8, 5,, 8, 38, 53 und 8 in einer Konzentration von jeweils, ng bzw. µg/kongener/ml Kulturmedium exponiert. -, ng Die Exposition mit nicht en PC zeigte für die ausgewählten Enzyme gleichsinnige Veränderungen zu den beobachteten Effekten, die durch die en Kongenere verursacht wurden. uch hier wurde für das CYP eine Erhöhung der relativen Transkripte auf,4 im Embryoblasten festgestellt. Im Trophoblasten blieb ein deutlicher Effekt wiederum aus (bb. 3.5 ). Für CYP wurde eine erhöhte mrn-menge in beiden Zelllinien um jeweils,4 ermittelt (bb. 3.5 ). Die GST π war nach Exposition nahezu unverändert (bb. 3.5 C). CYP CYP nicht nicht.5.5 C GST pi nicht bb. 3.5 Ergebnisse der densitometrischen uswertung der PCR für CYP (), CYP () und GST π (C) nach Exposition ohne () und mit, ng nicht er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. - µg/ml Nach vierstündiger Exposition mit µg nicht er PC zeigte sich für CYP ein im Vergleich zur -Kontrolle signifikant erhöhtes PCR-Signal um,4, während die Transkripte im Trophoblasten unverändert blieben (bb. 3.6 ). CYP war in beiden Zelllinien verglichen mit der Kontrolle signifikant erhöht (bb. 3.6 ) und für die GSTπ-Transkripte

13 Ergebnisse 8 konnte ein geringer nicht signifikanter bfall in Embryo- und Trophoblast beobachtet werden (bb. 3.6 C). CYP CYP 4 3 * 4 3 * * nicht nicht.5.5 C GST pi nicht bb. 3.6 Ergebnisse der densitometrischen uswertung der PCR für CYP (), CYP () und GST π (C) nach Exposition ohne () und mit µg nicht er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. Nach PC-Exposition konnte für CYP im Embryoblasten und für CYP in beiden Zelllinien eine im Vergelich zur Kontrollgruppe signifikant erhöhte Transkriptmenge ermittelt werden (*p<,5) Hypoxia Inducible Factor-α -, ng/ml Für HIF-α konnte nach Exposition mit nicht en Kongeneren einer Konzentration von, ng/ml ein leicht vermindertes Signal im Embryoblasten ermittelt werden, während im Trophoblasten keine Veränderungen zu sehen waren (bb. 3.7).,5,5 HIF-alpha bb. 3.7 Ergebnisse der densitometrischen uswertung der PCR für HIF-α nach Exposition ohne () und mit, ng nicht er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. nicht - µg/ml uch nach Exposition mit µg/ml der nicht en Kongenere waren die HIF-α- Transkripte im Embryoblasten leicht verringert. Im Gegensatz zur Exposition mit µg er

14 Ergebnisse 9 PC konnte hier jedoch kein signifikanter Unterschied zur -Kontrolle ermittelt werden. Zusätzlich wurde eine geringe Erhöhung des PCR-Signals im Trophoblasten gefunden (bb. 3.8).,5,5 HIF-alpha bb. 3.8 Ergebnisse der densitometrischen uswertung der PCR für HIF-α nach Exposition ohne () und mit µg nicht er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an nicht Vascular Endothelial Growth Factor und Vascular Endothelial Growth Factor Receptor -, ng/ml uch die Exposition mit nicht en PC hatte bei, ng pro Kongener keinen Effekt auf die VEGF-Transkripte (bb. 3.9 ). Für VEGFR konnte in beiden Zelllinien ein nstieg ermittelt werden, dessen uswertung gegenüber der Kontrollgruppe für den Trophoblasten eine Signifikanz mit einem p<, ergab (bb. 3.9 ). VEGF VEGFR.5 ** nicht nicht bb. 3.9 Ergebnisse der densitometrischen uswertung der PCR für VEGF () und VEGFR () nach Exposition ohne () und mit, ng nicht er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. Für VEGFR konnte im Trophoblasten im Vergleich zur Kontrollgruppe ein signifikanter nstieg ermittelt werden (**p<,).

15 Ergebnisse 3 - µg/ml Nach Exposition mit µg/ml der sieben nicht en Kongenere konnten erneut keine Veränderung bei VEGF beobachtet werden (bb. 3. ). Die VEGFR-Transkripte waren hier in beiden Zelllinien um,44 bzw.,7 nicht signifikant erhöht (bb. 3. ). VEGF VEGFR nicht nicht bb. 3. Ergebnisse der densitometrischen uswertung der PCR für VEGF () und VEGFR () nach Exposition ohne () und mit µg nicht-er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an Matrix-Metalloprotease und Tissue Inhibitor of Metalloproteinases -, ng/ml Nach ehandlung mit, ng/ml/kongener der nicht en PC, konnte für die Transkripte der Matrix-Metalloprotease im Trophoblasten ein bfall auf,7 gegenüber der Kontrolle ermittelt werden. Im Embryoblasten erschienen die Transkripte nicht verändert (bb. 3. ). Für TIMP- wurde im Trophoblasten ein geringer bfall auf,8 beobachtet. Kein Effekt wurde im Embryoblasten gefunden (bb. 3. ). MMP- TIMP-,5,5,5,5 nicht nicht bb. 3. Ergebnisse der densitometrischen uswertung der PCR für MMP- () und TIMP- () nach Exposition ohne () und mit, ng nicht er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an.

16 Ergebnisse 3 - µg/ml Die Exposition mit µg/ml/kongener der nicht en PC resultierte in gegenüber den Ergebnissen der geringeren Konzentration unerwarteten Veränderungen. Für MMP- konnte nun im Embryoblasten ein bfall der Transkripte auf,7 ermittelt werden, während die Transkripte im Trophoblasten unverändert waren (bb. 3. ). TIMP- war vermindert im Embryoblasten (,66) und im Trophoblasten gegenüber der Kontrolle signifikant um,3 erhöht (bb. 3. ) MMP- TIMP-,5,5 **,5,5 nicht nicht bb. 3. Ergebnisse der densitometrischen uswertung der PCR für MMP- () und TIMP- () nach Exposition ohne () und mit µg nicht er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. Für TIMP- konnte im Vergleich zur Kontrollgruppe im Trophoblasten ein signifikanter nstieg ermittelt werden (**p<,) Cyclooxygenase- -, ng/ml Nach Exposition der lastozysten mit, ng/ml/kongener des Gemisches der nicht-en PC waren die Transkripte für die Cyclooxygenase- im Trophoblasten signifikant um fast das dreifache (,9) gegenüber der -Kontrolle erhöht (bb. 3.3). Diese Induktion fiel höher aus als bei den en Kongeneren. Im Embryoblasten zeigten sich keine nennenswerten Veränderungen. 4 3 COX- ** nicht bb. 3.3 Ergebnisse der densitometrischen uswertung der PCR für COX- nach Exposition ohne () und mit, ng nicht-er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. Für den Trophoblasten konnte im Vergelich zur Kontrollgruppe ein signifikanter nstieg ermittelt werden (**p<,).

17 Ergebnisse 3 - µg/ml Die Erhöhung der PC-Konzentration auf µg/ml/kongener resultierte in einem nstieg der COX--Transkripte im Embryoblasten um,33 (bb. 3.4). Ein statistisch signifikanter Unterschied zwischen beiden Gruppen konnte nicht festgestellt werden. Im Gegensatz zur beschriebenen Induktion nach, ng PC waren die Transkripte im Trophoblasten nun unverändert gegenüber der -Kontrolle.,5,5 COX- nicht bb. 3.4 Ergebnisse der densitometrischen uswertung der PCR für COX- nach Exposition ohne () und mit µg nicht-er PC. Schwarze Säulen kennzeichnen den Embryoblasten (), weiße den Trophoblasten (). Die Fehlerbalken geben den Standardfehler des Mittelwertes an. Repräsentative Elektrophosese-Daten der Transkripte nach Exposition mit nicht en PCs werden auf den Seiten 34 und 35 in bbildung 3.6 dargestellt. lle statistisch berechneten Mittelwerte werden anschließend in bschnitt 3.4 tabellarisch zusammengefasst.

18 Ergebnisse 33 Embryoblast Trophoblast ß-ktin CYP CYP GST π HIF-α VEGF M, ng µg W M, ng µg W

19 Ergebnisse 34 Embryoblast Trophoblast ß-ktin VEGFR MMP- TIMP- COX- M, ng µg W M, ng µg W bb. 3.5 Gelelektrophoresen nach Exposition mit, ng und µg er PC. Die linke Reihe zeigt die Ergebnisse im Embryoblasten, in der rechten Reihe sind die Ergebnisse im Trophoblasten dargestellt. M = Längenmarker, = Kontrollgruppe, W = Wasserprobe

20 Ergebnisse 35 Embryoblast Trophoblast ß-ktin CYP CYP GST π HIF-α VEGF M, ng µg W M, ng µg W

21 Ergebnisse 36 Embryoblast Trophoblast ß-ktin VEGFR MMP- TIMP- COX- M, ng µg W M, ng µg W bb. 3.6 Gelelektrophoresen nach Exposition mit, ng und µg nicht er PC. Die linke Reihe zeigt die Ergebnisse im Embryoblasten, in der rechten Reihe sind die Ergebnisse im Trophoblasten dargestellt. M = Längenmarker, = Kontrollgruppe, W = Wasserprobe

22 Ergebnisse Tabellarische Übersicht - e PC, ng/ml µg/ml Embryoblast Trophoblast Embryoblast Trophoblast CYP,36 ±,6,97 ±,3,63 ±,4*,98 ±, CYP,74 ±,4*,55 ±,3,77 ±,3**,3 ±,8* GST π,4 ±,9,96 ±,6,99 ±,5,84 ±, HIF-α,67 ±,8,89 ±,7,65 ±,7*, ±,7 VEGF,95 ±,4,3 ±,8, ±,,95 ±,8 VEGFR, ±,9,48 ±,6*,66 ±,9, ±, MMP-, ±,3,58 ±,7,76 ±,6,95 ±, TIMP-,97 ±,6, ±,,65 ±,*, ±, COX-,36 ±,5,97 ±,33, ±,7*,77 ±,5 Tab. 3.: Zusammenfassung der densitometrischen PCR-uswertung nach Exposition mit en PC. Dargestellt sind Mittelwerte ± Standardfehler des Mittelwertes (* p<,5; ** p<,). - nicht-e PC, ng/ml µg/ml Embryoblast Trophoblast Embryoblast Trophoblast CYP,37 ±,8,9 ±,3,43 ±,3*,99 ±,4 CYP,39 ±,6,38 ±,,3 ±,*,33 ±,3* GST π,4 ±,9,97 ±,5,9 ±,8,83 ±,7 HIF-α,8 ±,8,99 ±,,8 ±,,6 ±, VEGF,93 ±,9,93 ±,,6 ±,9,99 ±,5 VEGFR, ±,6,68 ±,3**,44 ±,3,7 ±,7 MMP-,7 ±,5,69 ±,,66 ±,7, ±,6 TIMP-, ±,8,84 ±,7,66 ±,9,3 ±,6** COX-,33 ±,,88 ±,9**,5 ±,5,3 ±,4 Tab. 3.: Zusammenfassung der densitometrischen PCR-uswertung nach Exposition mit nichten PC. Dargestellt sind Mittelwerte ± Standardfehler des Mittelwertes (* p<,5; ** p<,).

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien 36 4. ERGEBNISSE 4.1. Immunglobulin Gentranskripte in Hodgkinzelllinien Mit Hilfe der RT PCR untersuchten wir die Expression umgelagerter Ig Gene in den Hodgkinzelllinien L1236, L428, L591 und KM-H2 sowie

Mehr

3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34

3 Ergebnisse. 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC. 3.1.1 Nachweis auf RNA-Ebene. Ergebnisse 34 Ergebnisse 34 3 Ergebnisse 3.1 Nachweis der Expression des y + -Systems in Keratinozyten und HDMEC 3.1.1 Nachweis auf RNA-Ebene Zum Nachweis der Transkription des y + -Systems in kutanen Zellen, wurden

Mehr

meta ortho ortho meta 3

meta ortho ortho meta 3 1 1. Einleitung 1.1 Polychlorierte Biphenyle 1.1.1 Struktur und Eigenschaften Polychlorierte Biphenyle (PCB) gehören zur Stoffklasse der halogenierten aromatischen Kohlenwasserstoffe und bilden eine Gruppe

Mehr

Veränderungen der Transkription in Embryoblast und Trophoblast der Kaninchenblastozyste nach Exposition mit polychlorierten Biphenylen

Veränderungen der Transkription in Embryoblast und Trophoblast der Kaninchenblastozyste nach Exposition mit polychlorierten Biphenylen Aus dem Institut für Anatomie und Zellbiologie an der Martin-Luther-Universität Halle-Wittenberg (Direktor: Prof. Dr. med. Dr. agr. Bernd Fischer) Veränderungen der Transkription in Embryoblast und Trophoblast

Mehr

3.2.1 Neurogeneserate der magnetfeldbehandelten Tiere aus restriktiver Haltung

3.2.1 Neurogeneserate der magnetfeldbehandelten Tiere aus restriktiver Haltung Eigene Untersuchungen 25 3.2 Ergebnisse 3.2.1 Neurogeneserate der magnetfeldbehandelten Tiere aus restriktiver Haltung Untersucht wurde, ob die Magnetfeldbehandlung mit 1, 8, 12, 29 und 5 Hz einen Einfluss

Mehr

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Inaugural-Dissertation zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen

Mehr

Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen

Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen Dr. rer. nat. Jasmin Wellbrock und Prof. Dr. Walter Fiedler Projektbericht an die Alfred & Angelika Gutermuth Stiftung Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen

Mehr

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch Forschungsbericht über das Projekt Einfluss der TLR3-Aktivierung des retinalen Pigmentepithels auf das Verhalten von Makrophagen, gefördert durch die DOG im Rahmen der Forschungsförderung innovativer wissenschaftlicher

Mehr

Tabelle 28: ph-werte des Harns aller Tiere über den gesamten Zeitraum.

Tabelle 28: ph-werte des Harns aller Tiere über den gesamten Zeitraum. 4.3. Ergebnisse der Harnuntersuchung 4.3.1. ph- des Harns Der ph- des Harns aller 132 untersuchten Tiere betrug zu Beginn der Untersuchung im Mittel 8,47 und verringerte sich mit Beginn der Vorbereitungsfütterung

Mehr

Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR

Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR Aus dem Institut für Humangenetik der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Genexpressionsanalyse von DNA-Reparaturgenen in primären Fibroblasten von Tumorpatienten mittels Real

Mehr

4.2 Kokulturen Epithelzellen und Makrophagen

4.2 Kokulturen Epithelzellen und Makrophagen Ergebnisse 4.2 Kokulturen Epithelzellen und Makrophagen Nach der eingehenden Untersuchung der einzelnen Zelllinien wurden die Versuche auf Kokulturen aus den A549-Epithelzellen und den Makrophagenzelllinien

Mehr

3 Ergebnisse 3.1 Charakterisierung der untersuchten Melanome

3 Ergebnisse 3.1 Charakterisierung der untersuchten Melanome 3 Ergebnisse 3.1 Charakterisierung der untersuchten Melanome Untersucht wurden insgesamt 26 Melanome, die zwischen 1991 und 1997 in der Universitätsklinik und Poliklinik für Dermatologie und Venerologie

Mehr

3.2 Analyse des Signaltransduktionsweges, über den Hyaluronsäure die Aktivierung des MMP-9-Gens vermittelt

3.2 Analyse des Signaltransduktionsweges, über den Hyaluronsäure die Aktivierung des MMP-9-Gens vermittelt 3.2 Analyse des Signaltransduktionsweges, über den Hyaluronsäure die Aktivierung des MMP-9-Gens vermittelt 3.2.1 Hyaluronsäure vermittelt die transkriptionelle Aktivierung des MMP-9-Gens und nicht die

Mehr

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Es sollten mithilfe des Yeast-Two-Hybrid-Systems Proteine identifiziert werden, die mit der zytoplasmatischen Domäne von CEACAM1-4L aus

Mehr

4.6. MR-tomographische Untersuchung an Leber, Milz und Knochenmark

4.6. MR-tomographische Untersuchung an Leber, Milz und Knochenmark 4.6. MR-tomographische Untersuchung an Leber, Milz und Knochenmark Die folgenden Darstellungen sollen einen Überblick über das Signalverhalten von Leber, Milz und Knochenmark geben. Die Organe wurden zusammen

Mehr

AGES-Webribo. Systematik in Clostridium difficile PCR-Ribotyping. Alexander Indra

AGES-Webribo. Systematik in Clostridium difficile PCR-Ribotyping. Alexander Indra AGES-Webribo Systematik in Clostridium difficile PCR-Ribotyping Alexander Indra AGES-Institut für medizinische Mikrobiologie und Hygiene Wien Nationale Referenzzentrale für Clostridium difficile Clostridium

Mehr

STATISTISCHE MUSTERANALYSE - DARSTELLUNGSVORSCHLAG

STATISTISCHE MUSTERANALYSE - DARSTELLUNGSVORSCHLAG STATISTISCHE MUSTERANALYSE - DARSTELLUNGSVORSCHLAG Statistische Methoden In der vorliegenden fiktiven Musterstudie wurden X Patienten mit XY Syndrom (im folgenden: Gruppe XY) mit Y Patienten eines unauffälligem

Mehr

4. Diskussion. 4.1. Polymerase-Kettenreaktion

4. Diskussion. 4.1. Polymerase-Kettenreaktion 59 4. Diskussion Bei der Therapie maligner Tumoren stellt die Entwicklung von Kreuzresistenz gegen Zytostatika ein ernstzunehmendes Hindernis dar. Im wesentlich verantwortlich für die so genannte Multidrug

Mehr

4.1. Herstellung, Aufreinigung und Nachweis eines CD33-spezifischen IgM-Antikörpers

4.1. Herstellung, Aufreinigung und Nachweis eines CD33-spezifischen IgM-Antikörpers ERGEBNISSE 30 4. Ergebnisse 4.1. Herstellung, Aufreinigung und Nachweis eines CD33-spezifischen IgM-Antikörpers 4.1.1. Herstellung und Aufreinigung des Antikörpers CD33-spezifische IgM-Antikörper wurden

Mehr

Psoriasin is a major Escherichia coli-cidal factor of the female genital tract

Psoriasin is a major Escherichia coli-cidal factor of the female genital tract Psoriasin is a major Escherichia coli-cidal factor of the female genital tract Mildner M, Stichenwirth M, Abtin A, Eckhart L, Sam C, Gläser R, Schröder JM, Gmeiner R, Mlitz V, Pammer J, Geusau A, Tschachler

Mehr

3. Ergebnisse Ergebnisse. 3.1 MDR1-Polymorphismen

3. Ergebnisse Ergebnisse. 3.1 MDR1-Polymorphismen . Ergebnisse. Ergebnisse. MDR-Polymorphismen Im Rahmen der Studie erfolgte die Untersuchung von Polymorphismen mittels PCR und RFLP und deren Auswirkung auf die Pharmakokinetik des P-gp-Substrates Digoxin.

Mehr

SCRIPTUM HIGH PRECISE

SCRIPTUM HIGH PRECISE Nur für Forschungszwecke Datenblatt Artikel BS.50.020 = 20 Reaktionen x 50 µl Artikel BS.50.100 = 100 Reaktionen x 50 µl Artikel BS.50. 500 = 500 Reaktionen x 50 µl Haltbarkeit: 12 Monate Lagerung bei

Mehr

Antiangiogenetische Therapie bei neovaskulärer altersabhängiger Makuladegeneration

Antiangiogenetische Therapie bei neovaskulärer altersabhängiger Makuladegeneration Antiangiogenetische Therapie bei neovaskulärer altersabhängiger Makuladegeneration VEGF Vascular Endothelial growth factor ist ein Protein, welches selektiv an Rezeptoren auf der Oberfläche von Gefäßendothelzellen

Mehr

A. Sak, S. Grehl, M. Engelhard, A. Wierlemann, HP. Kaelberlah, P. Erichsen, C. Pöttgen, M. Groneberg, M. Stuschke

A. Sak, S. Grehl, M. Engelhard, A. Wierlemann, HP. Kaelberlah, P. Erichsen, C. Pöttgen, M. Groneberg, M. Stuschke γ-h2ax Foci Induktion in Lymphocten des peripheren Bluts von Tumorpatienten: in vivo und in vitro Interaktion von Cisplatin mit Doppelstrangbruch-Signalen ionisierender Strahlen A. Sak, S. Grehl, M. Engelhard,

Mehr

Statistische Randnotizen

Statistische Randnotizen Landkreis /Weser Februar 08 Stabsstelle Regionalentwicklung Az.: 12.01.20 Statistische Randnotizen Geburtenziffern im Landkreis /Weser und den anderen Kreisen im Bezirk Hannover Einleitung Kenntnis über

Mehr

4.1 Größe und Zusammensetzung der Toc-Komplexe in Arabidopsis thaliana

4.1 Größe und Zusammensetzung der Toc-Komplexe in Arabidopsis thaliana 4.1 Größe und Zusammensetzung der Toc-Komplexe in Arabidopsis thaliana Der aus Erbse isolierte Toc-Kernkomplex besteht aus den zwei Rezeptorproteinen Toc159 und Toc34, sowie der Translokationspore Toc75

Mehr

Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt.

Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. - 22-4 Ergebnisse 4.1 RT-PCR Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. 4.1.1 Struma nodosa Histologie Fas Fas CD 97

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 7 (11.07-15.07.) Methoden und Techniken II 1. Sie bekommen

Mehr

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr

5.2. Differenzierung und Quantifizierung von Rind und Schwein mittels Real-Time PCR

5.2. Differenzierung und Quantifizierung von Rind und Schwein mittels Real-Time PCR 5.2. Differenzierung und Quantifizierung von Rind und Schwein mittels Real-Time PR Im Laufe der Zeit wurde bei dieser rbeit die Differenzierung und Quantifizierung der DN von Schwein und Rind in den Vordergrund

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

Ein unzureichendes HO-1 Niveau führt zu vermehrter Koagulation, Nekrose und

Ein unzureichendes HO-1 Niveau führt zu vermehrter Koagulation, Nekrose und 6. Heme-Oxygenase und deren Rolle in der Reproduktion Ein unzureichendes HO-1 Niveau führt zu vermehrter Koagulation, Nekrose und anschließender Transplantabstoßung in transplantierten Organen (Mantovani

Mehr

Transcriptomics: Analysis of Microarrays

Transcriptomics: Analysis of Microarrays Transcriptomics: Analysis of Microarrays Dion Whitehead dion@uni-muenster.de Division of Bioinformatics, Westfälische Wilhelms Universität Münster Microarrays Vorlesungsüberblick : 1. Überblick von Microarray

Mehr

Das Paper von heute. Samuel Grimm & Jan Kemna

Das Paper von heute. Samuel Grimm & Jan Kemna Das Paper von heute Samuel Grimm & Jan Kemna Bisheriges Modell Was bereits bekannt war - TIR1 ist an Auxinantwort (Zellteilung, Elongation, Differenzierung) beteiligt, im selben Signalweg wie AXR1 - TIR1

Mehr

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3

Mehr

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene Übung 11 Genregulation bei Prokaryoten Konzepte: Entwicklungs /gewebespezifische Genexpression Coexpression funktional überlappender Gene Positive Genregulation Negative Genregulation cis /trans Regulation

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

Genetik Praktikumsklausur SS2005

Genetik Praktikumsklausur SS2005 Genetik Praktikumsklausur SS2005 1. Aufgabe: Der Genotyp AbaB wird geselbstet, dabei werden 256 Nachkommen gebildet. Davon erhalten 16 Pflanzen den Genotyp ABAB a) gekoppelt b) nicht gekoppelt c) teilweise

Mehr

Feuchtegehalte von Rohbau - Mauerwerk

Feuchtegehalte von Rohbau - Mauerwerk Feuchtegehalte von Rohbau - Mauerwerk Einleitung Ziegelmauerwerk wird aus absolut trockenen Ziegeln errichtet, dagegen kann in bindemittelgebundenen Vollsteinen produktionsbedingt eine erhebliche Kernfeuchte

Mehr

Strahlen- und chemoinduzierte multiple Medikamentenresistenz bei Kolonkarzinomzellen - differentielles Ansprechen verschiedener biologischer Parameter

Strahlen- und chemoinduzierte multiple Medikamentenresistenz bei Kolonkarzinomzellen - differentielles Ansprechen verschiedener biologischer Parameter Strahlen- und chemoinduzierte multiple Medikamentenresistenz bei Kolonkarzinomzellen - differentielles Ansprechen verschiedener biologischer Parameter Detlef Bartkowiak, Michael Stempfhuber, Thomas Wiegel,

Mehr

Chemotherapie beim metastasierten Kolonkarzinom: Was sollte der Hausarzt wissen? Was kann er tun?

Chemotherapie beim metastasierten Kolonkarzinom: Was sollte der Hausarzt wissen? Was kann er tun? Chemotherapie beim metastasierten Kolonkarzinom: Was sollte der Hausarzt wissen? Was kann er tun? Minisymposium Dickdarmkrebs 26. März 2009 Sabina Schacher Medizinische Onkologie KSW Zytostatika, wichtigste

Mehr

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Bernd Hoffmann, Klaus R. Depner, Horst Schirrmeier & Martin Beer Friedrich-Loeffler-Institut Greifswald-Insel Riems

Mehr

1.3 Begründe kurz, ob mit Hilfe der fünf in der vereinfachten ID-Card verwendeten Marker aus Aufgabe 1.1 das Geschlecht mit bestimmt werden kann.

1.3 Begründe kurz, ob mit Hilfe der fünf in der vereinfachten ID-Card verwendeten Marker aus Aufgabe 1.1 das Geschlecht mit bestimmt werden kann. Übungsaufgaben zum DNA-Fingerprinter 1/6 1. In der EU wird die Einführung einer ID-Card (Nachfolger des Personalausweises, Entwurf s. Abb. 1) diskutiert, die neben Foto, äußeren Merkmalen und Fingerabdruck

Mehr

Gesundheitsökonomische Forschung auf dem Gebiet der Depression: Status Quo und Perspektiven

Gesundheitsökonomische Forschung auf dem Gebiet der Depression: Status Quo und Perspektiven Gesundheitsökonomische Forschung auf dem Gebiet der Depression: Status Quo und Perspektiven Symposium 10 Jahre Depressionsforschung im Kompetenznetz Depression Suizidalität München, 5. November 2009 Prof.

Mehr

Ergebnisse 32. Peptid 1- Peptid 2- Peptid 1- Peptid 2- Sepharose Sepharose Sepharose Sepharose 1/I 1/II 2/I 2/II

Ergebnisse 32. Peptid 1- Peptid 2- Peptid 1- Peptid 2- Sepharose Sepharose Sepharose Sepharose 1/I 1/II 2/I 2/II Ergebnisse 32 4 Ergebnisse 4.1 Nachweis des ORF1-Proteins p40 Das erste offene Leseraster (ORF1) eines L1-Retrotransposons kodiert für ein 40 kd Protein (p40-protein). Dieses Protein hat eine Chaperone-Funktion

Mehr

Untersuchungen zur Wirkung des Ginkgo biloba-extraktts EGb 761 auf die Proteinaggregation in der Huntington-Krankheit

Untersuchungen zur Wirkung des Ginkgo biloba-extraktts EGb 761 auf die Proteinaggregation in der Huntington-Krankheit Untersuchungen zur Wirkung des Ginkgo biloba-extraktts EGb 761 auf die Proteinaggregation in der Huntington-Krankheit Dissertation zur Erlangung des Grades Doktor der Naturwissenschaften am Fachbereich

Mehr

5 Zusammenfassung und Schlussfolgerung

5 Zusammenfassung und Schlussfolgerung 5 Zusammenfassung und Schlussfolgerung Einleitung In der Schwangerschaft vollziehen sich Veränderungen des Kohlenhydratstoffwechsels im Sinne einer Insulinresistenz sowie eines Anstieges der Blutfettwerte.

Mehr

ET 3,87 1,11 4,17 2,31 5,42. ETf 12,68 5,36 12,32 6,99 23,47 MT 10,28 4,06 8,79 5,33 17,83 AA 4,07 1,53 4,04 1,86 6,69. AAf 7,91 3,54 6,78 3,83 13,78

ET 3,87 1,11 4,17 2,31 5,42. ETf 12,68 5,36 12,32 6,99 23,47 MT 10,28 4,06 8,79 5,33 17,83 AA 4,07 1,53 4,04 1,86 6,69. AAf 7,91 3,54 6,78 3,83 13,78 26 3 Ergebnisse 3.1 Quantitative Untersuchung 3.1.1 Darstellung der Messergebnisse Im durchgeführten Zugversuch konnte bei allen verwendeten Materialkombinationen eine Haftkraft am Dentin gemessen und

Mehr

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins ERGEBNISSE 29 4. Ergebnisse 4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd3-igg1-tnf- Fusionsproteins Im vorliegenden Immunzytokin wurden die Domänen CH2/CH3 des humanen Fc-Fragmentes durch

Mehr

Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden

Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden Stammzellenmanipulation Hämatopoietische Stammzellen können gebraucht werden um kranke Zellen mit gesunden zu ersetzen (siehe experiment bestrahlte Maus) Epidermale Stammzellpopulationen können in Kultur

Mehr

Drexler G.A. 1, Derer A 1, Dirks W.G. 2, Hable V. 3, Greubel C. 3, Burgdorfer C. 3, Dollinger G. 3, Du G. 4, Friedl A.A. 1

Drexler G.A. 1, Derer A 1, Dirks W.G. 2, Hable V. 3, Greubel C. 3, Burgdorfer C. 3, Dollinger G. 3, Du G. 4, Friedl A.A. 1 Nutzung von bi-cistronischen Vektoren für die Beobachtung der Rekrutierung von Signal- und Reparaturproteinen an DNA-Schäden nach Ionen- Mikrobestrahlung durch Live-Cell Imaging Drexler G.A. 1, Derer A

Mehr

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl. Molekulare Mechanismen der Signaltransduktion 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.com/modul-mms bisheriges Modell auxin auxin AXR1 auxin response AXR1 potentieller

Mehr

METHODENLEHRE I WS 2013/14 THOMAS SCHÄFER

METHODENLEHRE I WS 2013/14 THOMAS SCHÄFER METHODENLEHRE I WS 2013/14 THOMAS SCHÄFER DAS THEMA: INFERENZSTATISTIK IV INFERENZSTATISTISCHE AUSSAGEN FÜR ZUSAMMENHÄNGE UND UNTERSCHIEDE Inferenzstatistik für Zusammenhänge Inferenzstatistik für Unterschiede

Mehr

8.2 Nicht parametrische Tests Vergleich CT/2D/3D. Abb. 28 Mann-Whitney-U-Test

8.2 Nicht parametrische Tests Vergleich CT/2D/3D. Abb. 28 Mann-Whitney-U-Test 41 8. Interpretationen der Studienergebnisse Im vorliegenden Kapitel werden die Studienergebnisse mit Hilfe des Mann-Whitney-U-Tests auf signifikante Unterschiede untersucht. Hierfür wurden die vorliegenden

Mehr

Ergebnisse 39. 3.1 Patientenkollektiv der Vorstudie und der Nachuntersuchung

Ergebnisse 39. 3.1 Patientenkollektiv der Vorstudie und der Nachuntersuchung Ergebnisse 39 3 Ergebnisse 3.1 Patientenkollektiv der Vorstudie und der 3.1.1 Verbleib Für die Verlaufskontrolle von GBV-C Infektionen bei Dialysepatienten konnten von den 390 Patienten der Vorstudie [Dissertation

Mehr

Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR

Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR Nils Scharke, inano Abstract Die Verwendung neuartiger Seltenerd-Komplexe in Verbindung mit zeitaufgelöster Fluoreszenzmessung liefert

Mehr

Platzhalter für Bild

Platzhalter für Bild Instrumentelle Bioanalytik in der Molekularbiologie Anke Neumann Platzhalter für Bild KIT die Kooperation von Forschungszentrum Karlsruhe GmbH und Universität Karlsruhe (TH) www.kit.edu Motivation und

Mehr

Übungen mit dem Applet Vergleich von zwei Mittelwerten

Übungen mit dem Applet Vergleich von zwei Mittelwerten Vergleich von zwei Mittelwerten 1 Übungen mit dem Applet Vergleich von zwei Mittelwerten 1 Statistischer Hintergrund... 2 1.1 Typische Fragestellungen...2 1.2 Fehler 1. und 2. Art...2 1.3 Kurzbeschreibung

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

RESOLUTION OIV/OENO 427/2010 KRITERIEN FÜR METHODEN ZUR QUANTIFIZIERUNG VON POTENTIELL ALLERGENEN RÜCKSTÄNDEN EIWEISSHALTIGER SCHÖNUNGSMITTEL IM WEIN

RESOLUTION OIV/OENO 427/2010 KRITERIEN FÜR METHODEN ZUR QUANTIFIZIERUNG VON POTENTIELL ALLERGENEN RÜCKSTÄNDEN EIWEISSHALTIGER SCHÖNUNGSMITTEL IM WEIN RESOLUTION OIV/OENO 427/2010 KRITERIEN FÜR METHODEN ZUR QUANTIFIZIERUNG VON POTENTIELL ALLERGENEN RÜCKSTÄNDEN EIWEISSHALTIGER SCHÖNUNGSMITTEL IM WEIN Die GENERALVERSAMMLUNG, unter Berücksichtigung des

Mehr

Inaugural-Dissertation zur Erlangung der medizinischen Doktorwürde des Fachbereichs Humanmedizin der Freien Universität Berlin

Inaugural-Dissertation zur Erlangung der medizinischen Doktorwürde des Fachbereichs Humanmedizin der Freien Universität Berlin Aus dem Institut für Physiologie des Fachbereiches Humanmedizin der Freien Universität Berlin (Zentrum für Weltraummedizin Berlin) Direktor : Prof. Dr. med. Axel R. Pries Der Einfluß einer körperlichen

Mehr

4.1.1. Nachweis von rcar1- und rcar2-mrna in verschiedenen Organen

4.1.1. Nachweis von rcar1- und rcar2-mrna in verschiedenen Organen 50 4. ERGENISSE 4.1. Evaluierung der kompetitiven RT-PCR 4.1.1. Nachweis von rcar1- und rcar2-mrna in verschiedenen Organen Der Nachweis der rcar1- und rcar2-mrna-expression erfolgte mittels RT-PCR. In

Mehr

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?

Mehr

Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert

Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert Aus dem Institut für Funktionelle und Klinische Anatomie der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert

Mehr

Thüringer Landesanstalt für Landwirtschaft. Einfluss der Aufzuchtintensität auf die Lebensleistung und Nutzungsdauer von Milchkühen

Thüringer Landesanstalt für Landwirtschaft. Einfluss der Aufzuchtintensität auf die Lebensleistung und Nutzungsdauer von Milchkühen Thüringer Landesanstalt für Landwirtschaft Einfluss der Aufzuchtintensität auf die Lebensleistung und Nutzungsdauer von Milchkühen Themenblatt-Nr.: 43.31.520/2008 Thüringer Ministerium für Landwirtschaft,

Mehr

Tab. 4.1: Altersverteilung der Gesamtstichprobe BASG SASG BAS SAS UDS SCH AVP Mittelwert Median Standardabweichung 44,36 43,00 11,84

Tab. 4.1: Altersverteilung der Gesamtstichprobe BASG SASG BAS SAS UDS SCH AVP Mittelwert Median Standardabweichung 44,36 43,00 11,84 Im weiteren wird gemäß den allgemeinen statistischen Regeln zufolge bei Vorliegen von p=,5 und

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

Gesunde Gelenke LOOK, FEEL AND LIVE BET TER

Gesunde Gelenke LOOK, FEEL AND LIVE BET TER Gesunde Gelenke LOOK, FEEL AND LIVE BET TER Pycnogenol für gesunde Gelenke Unsere Gelenke ermöglichen uns Bewegung und Aktivität, doch mit zunehmendem Alter degenerieren die Schutzschicht und der polsternde

Mehr

Bei näherer Betrachtung des Diagramms Nr. 3 fällt folgendes auf:

Bei näherer Betrachtung des Diagramms Nr. 3 fällt folgendes auf: 18 3 Ergebnisse In diesem Kapitel werden nun zunächst die Ergebnisse der Korrelationen dargelegt und anschließend die Bedingungen der Gruppenbildung sowie die Ergebnisse der weiteren Analysen. 3.1 Ergebnisse

Mehr

ESBL in Altenheimen: Ergebnisse einer LGL-Studie. Dr. Giuseppe Valenza

ESBL in Altenheimen: Ergebnisse einer LGL-Studie. Dr. Giuseppe Valenza ESBL in Altenheimen: Ergebnisse einer LGL-Studie Dr. Giuseppe Valenza MRE-Prävalenz Deutschland MRSA ESBL Prävalenz in der Allgemeinbevölkerung 1,6-3,1% 1 6,3% (E. coli) 2 Prävalenz in Pflegeheim-Bewohnern

Mehr

Im folgenden werden die Ergebnisse der verschiedenen Untersuchungen miteinander verglichen.

Im folgenden werden die Ergebnisse der verschiedenen Untersuchungen miteinander verglichen. 47 5.2 Vergleich der Ergebnisse Im folgenden werden die Ergebnisse der verschiedenen Untersuchungen miteinander verglichen. 5.2.1 Patienten mit pathologisch verändertem Netzhautbefund Bei 7 von 20 untersuchten

Mehr

Die Rolle Ungarns im internationalen Tourismus TENDENZEN IM WELTTOURISMUS ZWISCHEN 1990 UND Internationaler Touristenankünfte

Die Rolle Ungarns im internationalen Tourismus TENDENZEN IM WELTTOURISMUS ZWISCHEN 1990 UND Internationaler Touristenankünfte Die Rolle Ungarns im internationalen Tourismus TENDENZEN IM WELTTOURISMUS ZWISCHEN 1990 UND 2002 Internationaler Touristenankünfte Nach Angaben der Welttourismusorganisation (WTO) hat sich die Zahl der

Mehr

Lsd1 weist Stammzellen im Mausembryo den richtigen Weg

Lsd1 weist Stammzellen im Mausembryo den richtigen Weg Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/lsd1-weist-stammzellen-immausembryo-den-richtigen-weg/ Lsd1 weist Stammzellen im Mausembryo den richtigen Weg Die

Mehr

F-Praktikum Physik: Photolumineszenz an Halbleiterheterostruktur

F-Praktikum Physik: Photolumineszenz an Halbleiterheterostruktur F-Praktikum Physik: Photolumineszenz an Halbleiterheterostruktur David Riemenschneider & Felix Spanier 31. Januar 2001 1 Inhaltsverzeichnis 1 Einleitung 3 2 Auswertung 3 2.1 Darstellung sämtlicher PL-Spektren................

Mehr

Übungen (HS-2010): Urteilsfehler. Autor: Siegfried Macho

Übungen (HS-2010): Urteilsfehler. Autor: Siegfried Macho Übungen (HS-2010): Urteilsfehler Autor: Siegfried Macho Inhaltsverzeichnis i Inhaltsverzeichnis 1. Übungen zu Kapitel 2 1 Übungen zu Kontingenz- und Kausalurteile 1 Übung 1-1: 1. Übungen zu Kapitel 2 Gegeben:

Mehr

Auswirkungen des Klimawandels auf die großen Flüsse in Deutschland

Auswirkungen des Klimawandels auf die großen Flüsse in Deutschland Auswirkungen des Klimawandels auf die großen Flüsse in Deutschland András Bárdossy Einführung Wie wird die Zukunft? Was soll man tun? Beobachtungen aus der Vergangenheit Wird die Zukunft so wie die Vergangenheit

Mehr

alle # chron.bis 1.Tag 2.Tag 3.Tag 4.Tag einmalig nach Absetzen

alle # chron.bis 1.Tag 2.Tag 3.Tag 4.Tag einmalig nach Absetzen 3. Ergebnisse 3.1 Phenylephrin PE 3.1.1 Systolischer und diastolischer Blutdruck Der systolische Blutdruck fiel in den Ausgangswerten vor PE-Infusion unter chronischer β 1 - Blockade mit Bisoprolol leicht

Mehr

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose Aus der Medizinischen Universitätsklinik und Poliklinik Abteilung für Pneumologie der Albert-Ludwigs-Universität Freiburg im Breisgau Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen

Mehr

Vom His-tag zur ChIP-Analyse

Vom His-tag zur ChIP-Analyse Die verschiedenen Methoden der Affinitätsreinigung von Proteinen Vom His-tag zur ChIP-Analyse Felix Steinbacher Hochschule München BOD8 Hochreine Proteine In vielen Bereichen der Industrie, Medizin und

Mehr

Untersuchung zur Stressbelastung von Hunden bei der Ausbildung zur Verhaltensanpassung im Schwarzwildgatter

Untersuchung zur Stressbelastung von Hunden bei der Ausbildung zur Verhaltensanpassung im Schwarzwildgatter Untersuchung zur Stressbelastung von Hunden bei der Ausbildung zur Verhaltensanpassung im Schwarzwildgatter E. Schalke, J. Müller, H. Hackbarth Institut für Tierschutz und Verhalten (Heim-,Labortiere und

Mehr

Inaugural - Dissertation zur Erlangung der Zahnmedizinischen Doktorwürde der Charité-Universitätsmedizin Berlin Campus Benjamin Franklin

Inaugural - Dissertation zur Erlangung der Zahnmedizinischen Doktorwürde der Charité-Universitätsmedizin Berlin Campus Benjamin Franklin Charité Universitätsmedizin Berlin Campus Benjamin Franklin Aus der Klinik für Medizinische Klinik IV Geschäftsführender Direktor: Univ. Prof. Dr. med. W. Zidek Abteilung: Nephrologie Identifizierung von

Mehr

Vitamin D: auch Bedeutung beim Diabetes?

Vitamin D: auch Bedeutung beim Diabetes? Vitamin D: auch Bedeutung beim Diabetes? Armin Steinmetz St.Nikolaus-Stiftshospital Akad. Lehrkrankenhaus der Uni. Bonn, Andernach Weimar 23.4.16 Vitamin D Mangel bei deutschen Erwachsenen 1763 Männer

Mehr

3. EIGENE UNTERSUCHUNGEN

3. EIGENE UNTERSUCHUNGEN 3.2. Ergebnisse 3.2.1. Probenentnahme Von 100 Rotfüchsen waren 78 Tiere mit Schildzecken und 41 mit Flöhen befallen. Bei 15 Füchsen konnte weder ein Zecken- noch ein Flohbefall festgestellt werden. Beim

Mehr

Die Laufzeit muss nun ebenfalls in Monaten gerechnet werden und beträgt 25 12 = 300 Monate. Damit liefert die Sparkassenformel (zweiter Teil):

Die Laufzeit muss nun ebenfalls in Monaten gerechnet werden und beträgt 25 12 = 300 Monate. Damit liefert die Sparkassenformel (zweiter Teil): Lösungen zur Mathematikklausur WS 2004/2005 (Versuch 1) 1.1. Hier ist die Rentenformel für gemischte Verzinsung (nachschüssig) zu verwenden: K n = r(12 + 5, 5i p ) qn 1 q 1 = 100(12 + 5, 5 0, 03)1, 0325

Mehr

Zahlungsbilanz und Auslandvermögen im 2. Quartal 2015 (korrigierte Fassung) Übersicht Zahlungsbilanz und Auslandvermögen

Zahlungsbilanz und Auslandvermögen im 2. Quartal 2015 (korrigierte Fassung) Übersicht Zahlungsbilanz und Auslandvermögen Kommunikation Postfach, CH-8022 Zürich Telefon +41 58 631 00 00 communications@snb.ch Zürich, 23. September 2015 Zahlungsbilanz und Auslandvermögen im 2. Quartal 2015 (korrigierte Fassung) In der Zahlungsbilanz

Mehr

Evaluation Des Sozialtraining in der Schule

Evaluation Des Sozialtraining in der Schule Evaluation Des Sozialtraining in der Schule Die erste Evaluation des vorliegenden Trainings fand im Jahr 1996 an vier Bremer Schulen statt. Es nahmen insgesamt 158 Schüler im Alter von acht bis zwölf Jahren,

Mehr

Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm)

Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm) Naturwissenschaft Daniel Knobeloch Sequenzierung und Charakterisierung der Triosephosphat-Isomerase aus Tenebrio molitor (Mehlwurm) Diplomarbeit Bibliografische Information der Deutschen Nationalbibliothek:

Mehr

Laufzeit-Vergleich verschiedener Switching-Technologien im Automatisierungs-Netz

Laufzeit-Vergleich verschiedener Switching-Technologien im Automatisierungs-Netz Ethernet Performance mit Fast Track Switch Laufzeit-Vergleich verschiedener Switching-Technologien im Automatisierungs-Netz In der Automatisierungstechnik können die Laufzeiten der Ethernet-Telegramme

Mehr

Untersuchung der Quartärstruktur

Untersuchung der Quartärstruktur Untersuchung der Quartärstruktur Analyse von Protein-Netzwerken In vitro Hydrodynamische Verfahren (z.b. Gelfiltration) Spektroskopische Verfahren (z.b. FRET) Kreuzvernetzung ( Crosslinking ) Immunologische

Mehr

Kapitel 6: Zweifaktorielle Varianzanalyse

Kapitel 6: Zweifaktorielle Varianzanalyse Kapitel 6: Zweifaktorielle Varianzanalyse Berechnen der Teststärke a priori bzw. Stichprobenumfangsplanung 1 Teststärkebestimmung a posteriori 4 Berechnen der Effektgröße f² aus empirischen Daten und Bestimmung

Mehr

Journal: Journal of Clinical Oncology Publikationsjahr: 2012 Autoren: Paulo M. Hoff, Andreas Hochhaus, Bernhard C. Pestalozzi et al.

Journal: Journal of Clinical Oncology Publikationsjahr: 2012 Autoren: Paulo M. Hoff, Andreas Hochhaus, Bernhard C. Pestalozzi et al. Cediranib Plus FOLFOX/CAPOX Versus Placebo Plus FOLFOX/CAPOX in Patients With Previously Untreated Metastatic Colorectal Cancer: A Randomized, Double Blind, Phase III Study (HORIZON II) Journal: Journal

Mehr

Bruttoinlandsprodukt und Bruttowertschöpfung in Stuttgart und in anderen Großstädten mit 500 000 und mehr Einwohnern 1995 bis 2001

Bruttoinlandsprodukt und Bruttowertschöpfung in Stuttgart und in anderen Großstädten mit 500 000 und mehr Einwohnern 1995 bis 2001 Kurzberichte Statistik und Informationsmanagement, Monatsheft 12/2003 Bruttoinlandsprodukt und Bruttowertschöpfung in Stuttgart und in anderen Großstädten mit 500 000 und mehr Einwohnern 1995 bis 2001

Mehr

Drosophila melanogaster

Drosophila melanogaster Modul biol113 Zellbiologie Drosophila melanogaster Komponenten der angeborenen Immunabwehr Experimente 1) RT (Reverse Transkriptase)-PCR zum Nachweis einer AMP- Expression nach Infektion 1.1 PCR-Reaktion

Mehr

Hintergrund (I) Induktion von Stoffwechselerkrankungen durch Veränderungen des intra uterinen Milieus. Warner und Ozanne, 2010, Biochem J

Hintergrund (I) Induktion von Stoffwechselerkrankungen durch Veränderungen des intra uterinen Milieus. Warner und Ozanne, 2010, Biochem J Untersuchungen zum Einfluss hochkalorisch fettreicher Ernährung in der Perinatalzeit auf Epigenetische Veränderungen in der Nachkommenschaft im Modell der Gastric inhibitory polypeptide receptor knock

Mehr

Abiturprüfung Biologie, Grundkurs

Abiturprüfung Biologie, Grundkurs Seite 1 von 6 biturprüfung 2008 Biologie, rundkurs ufgabenstellung: Thema: Ein Krankheitsbild unterschiedliche rsachen II.1 Werten Sie die Materialien und B hinsichtlich der Risikofaktoren für Diabetes

Mehr

Ergebnisse der Strahlentherapie bei Makuladegeneration

Ergebnisse der Strahlentherapie bei Makuladegeneration Ergebnisse der Strahlentherapie bei Makuladegeneration Frank Zimmermann Klinik für Strahlentherapie und Radioonkologie, Universitätsspital Basel radioonkologiebasel.ch Einteilung der Makuladegeneration

Mehr

2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24

2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 IV. Ergebnisse 90 2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 Die Konstruktion einer isogenen Toxinmutante des Stx2-produzierenden EHEC- Stamm O157:H7 86-24

Mehr

Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt

Mehr

Stress & kognitive Flexibilität (Aufgabenwechsel) Luca Spliethoff

Stress & kognitive Flexibilität (Aufgabenwechsel) Luca Spliethoff Stress & kognitive Flexibilität (Aufgabenwechsel) Dresden, 08.12.2015 Luca Spliethoff Franziska Keßler Gliederung 1. Einleitung: Was ist kognitive Flexibilität? 2. Metaanalyse von Shields et al. (2015)

Mehr