DNA-Fingerprint. (Syn. DNA Profiling)

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "DNA-Fingerprint. (Syn. DNA Profiling)"

Transkript

1 DNA-Fingerprint (Syn. DNA Profiling) Dient dazu Individuen genetisch zu unterscheiden Dazu braucht man genetischen Polymorphismus (Bsp. Blutgruppen-Polymorphismus/Landsteiner). Als Polymorphismus ( Vielgestaltigkeit ) bezeichnet man das Auftreten einer oder mehrerer Genvarianten (sprich: eines oder mehrerer Allele) innerhalb einer Population. Definitionsgemäß muss die Auftretenshäufigkeit der Genvariante (die Allelfrequenz) über 1% sein, andernfalls ist es eine Mutation. 1

2 DNA-Fingerprint (Syn. DNA Profiling) Dieses Verfahren erzeugt für das Genom eines Individuums ein spezifisches DNA- Fragmentmuster. Diese Muster bezeichnet man als: Genetischer Fingerabdruck 2

3 Verwendung des Fingerprints Vaterschaftstest (allg. Abstammungsverhältnisse) ng DNA reichen: aus 1-2 µl Blut aus Spuren von Samenflüssigkeit aus Haarwurzel(n) Forensische Analysen Diagnostik von Gendefekten Reinheitsüberwachung von Zelllinien Identifizierung von Spender und Empfängerzellen bei Knochenmarkstransplantationen Eiigkeitsbestimmung von Zwillingen 3

4 DNA-Fingerprint Es gibt drei Methoden genetischer Fingerprints: RFLP (Restriktionsfragment-Längenpolymorphismus) VNTRPs (Variable number of tandem repeats Polymorphismus) STRPs (Short tandem repeats Polymorphismus) Verwendete Methoden zur Bandenvisualisierung: PCR Southern Blot 4

5 Restriktionsfragment- Längenpolymorphismus (RFLP) spezielle Klasse von DNA-Sequenz Polymorphismen lokal auftretende DNA-Sequenz Veränderungen durch: einzelne Basenaustausche DNA Umlagerungen DNA Insertionen DNA Deletionen RFLP, wenn durch Basenaustausch die Erkennungsstelle für ein Restriktionsenzym betroffen ist 5

6 Restriktionsenzym Es gibt etwa 600 Werden aus Bakterien gewonnen, daher ihre Namensgebung als Bsp. EcoRI aus E. Coli Bakterien Sie erkennen meist Palindrome (OTTO) mit 4, 6 oder 8 Basenpaaren Der Schnitt kann gerade sein (engl. blunt ends, deut. stumpfe oder glatte Enden, z. B. SmaI). CCCIGGG GGGICCC Der Schnitt kann auch versetzt sein (engl. sticky ends, deut. klebrige Enden, z. B. EcoRI). GIAATTC CTTAAIG Klebrige Enden sind leichter ligierbar (mittels Ligase zu verbinden). 6

7 RFLP verursacht Auftreten oder Verschwinden von Schnittstellen Schneiden der genomischen DNA führt also zu: verkürzten DNA-Fragmenten verlängerten DNA-Fragmenten Veränderung des Fragmentmusters der geschnittenen genom. DNA nach Gelelektrophorese Verwendbar als genetische Marker (Vererbung nach Mendel) Heterozygote Individuen besitzen das mutierte (RFLP) und das normale Gen 7

8 RFLP Analyse mittels PCR Die Chromosomen A und B unterscheiden sich in der Schnittstelle T. Mittels PCR wird jetzt die DNA amplifiziert und mit einem Enzym geschnitten (bei T). Bei Individuen AA keine Restriktionsschnittstelle Bei Individuen AB, trägt ein Allel die Schnittstelle T, das andere nicht. Bei Individuen BB tragen beide Allele die Schnittstelle T. Menge an DNA entsprechend!!! PCR dient nur der DNA-Anreicherung 8

9 VNTRPs (Variable number of tandem repeats Polymorphismus) Verschiedene Individuen einer Population besitzen an bestimmten Stellen im Genom unterschiedlich viel tandemartig wiederholte Minisatelliten: Repetitive Sequenz-Satelliten DNA! z.b. kommt eine Nukleotidfolge ( Nukleotide) bei einem Individuum 15-mal, beim anderen 22-mal vor. Enzyme schneiden zwar bei allen an denselben Stellen, aber dazwischen liegen unterschiedlich viele Tandemrepeats. 9

10 VNTRPs mittels PCR a.) DNA mit unterschiedlich vielen Tandemrepeats b.) PCR mittels individuell gesetzter Primer c.) Gelelektrophorese liefert unterschiedlich lange DNA Fragmente aufgrund der unterschiedlich vielen repetitiven Sequenzen Vorteil: durch PCR wird DNA angereichert. Schneiden der DNA ist nicht nötig!!! 10

11 Southern Blot Wird vor allem verwendet, wenn extrem wenig DNA vorhanden ist Bei DNA Fingerprints notwendig, weil sonst viel zu viele Fragmente am Gel wären (EtBr Färbung würde überlappende Banden geben) Nachteile: Gefahr durch Radioaktivität:Phosphor-32 Dauer: 2 Tage 11

12 VNTRPs mittels Southern Blot b.) zeigt 6 verschiedene Chromosomen, die mittels den Enzymen H1 und H3 an denselben Stellen geschnitten werden. Dazwischen liegen unterschiedl. viele Tandemrepeats Auftragen aufs Gel, Blotten, Hybridisieren, Röntgenfilm (Southern Blot)! a.) das Chromosom E besitzt nur 3 Tandemrepeats und damit liefert es geschnitten das kürzerste DNA Fragment. Wahrscheinlichkeit, dass 2 versch. Personen, das gleiche Bandenmuster haben ist nur sehr gering (Gerichtsmedizin) H1 = Hinfl 1 H3 = HaeIII 12

13 STRPs (Short tandem repeats Polymorphismus) Verschiedene Individuen einer Population besitzen an bestimmten Stellen im Genom unterschiedlich viele tandemartig wiederholte Mikrosatelliten: Wiederholungen 2-4bp (gatagatagatagatagatagata) (vgl. VNTRPs bp) Bzgl. dieser STRPs sind so gut wie alle Individuen einer Population heterozygot und daher untereinander verschieden. Wird daher für kommerzielle Tests verwendet. 13

14 DNA Fingerprint mittels VNTRPs-Vaterschaftstest Abb. zeigt Vaterschaftstest. Die Pfleile zeigen an, wo sich das Profil des Kindes von jenem des V2 unterscheidet, damit kommt V2 nicht als Vater in Frage. Technik: DNA der Probanden wird mit Enzymen geschnitten, auf Agarosegel aufgetrennt, auf Trägerfolie geblottet und mittels bestimmter radioaktiv markierter Sonde(n) hybridisiert und sichtbar gemacht. Nicht radioaktiv nicht möglich, da viel zu viele Fragmente vorhanden sein würden (Überlappung). 14

15 Familienzugehörigkeit???? Wie sind die Eltern und die Kinder verwandt? Wie können sie die Verwandtschaft erklären? 15

16 DNA-Fingerprint-Diskussion Sollte man DNA Proben von Freigesprochenen aufbewahren?? Was halten sie von einer nationalen DNA-Datenbank?? DNA Analysen sind in der Lage über Gendefekte, Funktionsstörungen und Krankheiten Auskunft zu geben. Sinnvoll in der Präimplantationsdiagnostik?? -Genet. Defekt in Embryos -Alter der Eltern -Geschlechtswunsch für Embryos -Bsp. Großbritanien-IVF um erkranktes Kind zu retten (PGD (Preimplantation Genetic Diagnosis) um passendes befruchtetes Ei zu implantieren) Sinnvoll für Versicherungen?? -Ausschluß von chronisch Erkrankten? -höhere Raten für chronisch Erkrankte? Sinnvoll für Arbeitgeber?? -Krankenstand 16

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats Das humane Genom satellites and single repeats protein coding & non-protein coding mobile (transposable) DNA elements Alle Genome sind individuell, selbst jene eineiiger Zwillinge! 1 Variationen im humanen

Mehr

MOLEKULARBIOLOGISCHE METHODEN

MOLEKULARBIOLOGISCHE METHODEN 45 MOLEKULARBIOLOGISCHE METHODEN Die Technik der DNA-Rekombination, auch als Gentechnik bezeichnet, erlaubt die Isolierung von DNA-Abschnitten (genomische oder cdna), deren Sequenzbestimmung, Modifikation

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

PCR basierte- Detektionstechniken

PCR basierte- Detektionstechniken PCR basierte- Detektionstechniken Warum überhaupt? Forensische Analysen: Vaterschaftstests, Kriminalistik Mikrobielle Gemeinschaften: Biofilme, medizinische Mikrobiologie 2 Warum überhaupt? minimale Mengen

Mehr

1.3 Begründe kurz, ob mit Hilfe der fünf in der vereinfachten ID-Card verwendeten Marker aus Aufgabe 1.1 das Geschlecht mit bestimmt werden kann.

1.3 Begründe kurz, ob mit Hilfe der fünf in der vereinfachten ID-Card verwendeten Marker aus Aufgabe 1.1 das Geschlecht mit bestimmt werden kann. Übungsaufgaben zum DNA-Fingerprinter 1/6 1. In der EU wird die Einführung einer ID-Card (Nachfolger des Personalausweises, Entwurf s. Abb. 1) diskutiert, die neben Foto, äußeren Merkmalen und Fingerabdruck

Mehr

Gentechnologie: Isolierung und Charakterisierung von DNA

Gentechnologie: Isolierung und Charakterisierung von DNA Genetisches Grundpraktikum 9. Kurstag 23.06.2005 Gentechnologie: Isolierung und Charakterisierung von DNA Lerninhalte: Klonierung, Plasmid, Polylinker ( multiple cloning site ), Restriktionsendonuklease,

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 7 (11.07-15.07.) Methoden und Techniken II 1. Sie bekommen

Mehr

Was ist ein genetischer Fingerabdruck?

Was ist ein genetischer Fingerabdruck? Was ist ein genetischer Fingerabdruck? Genetischer Fingerabdruck od. DNA-Fingerprint ist ein molekularbiologisches Verfahren zur individuellen Identifizierung von Lebewesen Der genetische Fingerabdruck

Mehr

Gentechnik/Gentechnologie

Gentechnik/Gentechnologie Gentechnik/Gentechnologie Bei zelltechnischen Verfahren werden Gene wenn überhaupt, dann nur im Gesamtverband, also als ganzes Genom verschoben oder kombiniert. Bei Gentechnologischen Verfahren wird in

Mehr

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Versuch 1: Restriktionsenzyme als molekulare Werkzeuge Versuchsinhalt Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Zwei

Mehr

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher

Mehr

Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem

Mehr

Vaterschaftsanalyse mittels genetischem Fingerabdruck

Vaterschaftsanalyse mittels genetischem Fingerabdruck Vaterschaftsanalyse mittels genetischem Fingerabdruck Klassenstufe Oberthemen Unterthemen Anforderungsniveau Durchführungsniveau Vorlauf Vorbereitung Durchführung SII Moderne Genetik Sequenzanalyse Genetischer

Mehr

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen

Mehr

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung

Mehr

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?

Mehr

Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf

Mehr

AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig

AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig Restriktionsenzyme Füllen Sie den Lückentext aus. PCR 1a Mit dem folgenden Quiz können Sie Ihr Wissen zum Thema PCR überprüfen. Klicken Sie jeweils die richtige Antwort an. PCR 1b Mit dem folgenden Quiz

Mehr

Genetischer Fingerabdruck. DNA-Identifikation durch Vergleich von Restriktionsprofilen Best.- Nr

Genetischer Fingerabdruck. DNA-Identifikation durch Vergleich von Restriktionsprofilen Best.- Nr Genetischer Fingerabdruck DNA-Identifikation durch Vergleich von Restriktionsprofilen Best.- Nr. 201.3053 Inhalt des Sets DNA-Proben A: DNA vom Tatort mit Restriktionsenzym 1 B. DNA vom Tatort mit Restriktionsenzym

Mehr

Genetische Fingerabdrücke: Vaterschaft und Mord

Genetische Fingerabdrücke: Vaterschaft und Mord Genetische Fingerabdrücke: Vaterschaft und Mord Seit 1892 werden Fingerabdrücke zur Identifizierung benutzt. Sogar eineiige Zwillinge haben unterschiedliche Abdrücke. Der Fall des US-Footballstars OJ Simpson

Mehr

2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24

2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 IV. Ergebnisse 90 2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 Die Konstruktion einer isogenen Toxinmutante des Stx2-produzierenden EHEC- Stamm O157:H7 86-24

Mehr

"Gentechnik II - Identifizierungsmethoden" (Biologie Sek. II)

Gentechnik II - Identifizierungsmethoden (Biologie Sek. II) Inhalt und Einsatz im Unterricht "Gentechnik II - Identifizierungsmethoden" (Biologie Sek. II) Diese DVD behandelt das Unterrichtsthema "Gentechnik" für die Sekundarstufe II. Das DVD-Hauptmenü bietet folgende

Mehr

Merkmal "Amelogenin" ist geschlechtsspezifisch, für eine zusätzliche Kontrolle des Ergebnisses.

Merkmal Amelogenin ist geschlechtsspezifisch, für eine zusätzliche Kontrolle des Ergebnisses. Vaterschaftstest 1. Methode Ausgangspunkt Ausgangspunkt der Untersuchung ist die Erstellung des genetischen Profils ("Fingerprints"), der bei jedem Mensch einzigartig ist. Hierfür werden sogenannte STR

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie)

ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie) ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie) Als Erbkrankheit werden Erkrankungen und Besonderheiten bezeichnet, die entweder durch ein Gen (monogen)

Mehr

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Gruppe 8 Susanne Duncker und Friedrich Hahn Einleitung und Aufgabenstellung Ziel dieses Versuchs ist es, das Gen für ein bestimmtes

Mehr

Versuch 8. Plasmid - Isolierung

Versuch 8. Plasmid - Isolierung Versuch 8 Plasmid - Isolierung Protokollant: E-mail: Studiengang: Gruppen-Nr: Semester: Betreuer: Max Mustermann max@quantentunnel.de X X X C. Weindel & M. Schwarz Wird benotet?: Einleitung Ein Plasmid

Mehr

Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung

Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung In Zusammenarbeit mit Katharina Mumm, Alexander Prange Gewinnung des Hefe - Bakterienisolates

Mehr

Genetik Praktikumsklausur SS2005

Genetik Praktikumsklausur SS2005 Genetik Praktikumsklausur SS2005 1. Aufgabe: Der Genotyp AbaB wird geselbstet, dabei werden 256 Nachkommen gebildet. Davon erhalten 16 Pflanzen den Genotyp ABAB a) gekoppelt b) nicht gekoppelt c) teilweise

Mehr

PCR. Inhalt. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR?

PCR. Inhalt. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Inhalt Was ist? Eine Definition Optimierung Anwendungsgebiete - in der Gentechnologie - in der Diagnostik Zusammenfassung von Christian Jogler (Abteilung für Mol. & Med. Virologie) Was ist? Eine Definition

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

Quiz zum Praktikum Tierartendifferenzierung

Quiz zum Praktikum Tierartendifferenzierung Quiz zum Praktikum Tierartendifferenzierung Frage 1: Aus welcher DNA wurden am Praktikumstag die Abschnitte für die Tierartenbestimmung untersucht? A. DNA aus dem Zellkern B. Mitochondriale DNA C. Plasmid-DNA

Mehr

FWU Schule und Unterricht. Der genetische Fingerabdruck. FWU das Medieninstitut der Länder

FWU Schule und Unterricht. Der genetische Fingerabdruck. FWU das Medieninstitut der Länder FWU Schule und Unterricht VHS 42 10515 / DVD 46 10515 19 min, Farbe Der genetische Fingerabdruck FWU das Medieninstitut der Länder 00 Lernziele Die Schüler lernen die Organisation des Erbguts kennen (Gene,

Mehr

Molekularbiologische / gentechnische Methoden

Molekularbiologische / gentechnische Methoden Molekularbiologische / gentechnische Methoden MPM 1 Wie lässt sich ein spezifisches Gen/Genprodukt molekular analysieren? Fundamentales Problem: Komplexität biologischer Systeme MPM 2 Ein Ausschnitt aus

Mehr

Chromosomendarstellung und -identifizierung

Chromosomendarstellung und -identifizierung Chromosomendarstellung und -identifizierung Bei den 46 Chromosomen des Menschen unterscheidet man 22 homologe Autosomenpaare und 2 Geschlechtschromosomen, das homologe XX-Paar im weiblichen und das nicht-homologe

Mehr

Bei Einbeziehung von neun Allelen in den Vergleich ergibt sich eine Mutation in 38 Generationen (350:9); das entspricht ca. 770 Jahren.

Bei Einbeziehung von neun Allelen in den Vergleich ergibt sich eine Mutation in 38 Generationen (350:9); das entspricht ca. 770 Jahren. 336 DNA Genealogie Das Muster genetischer Variationen im Erbgut einer Person - zu gleichen Teilen von Mutter und Vater ererbt - definiert seine genetische Identität unveränderlich. Neben seiner Identität

Mehr

Molekulargenetische Experimente IV: Plasmidpräparation

Molekulargenetische Experimente IV: Plasmidpräparation Molekulargenetische Experimente IV: Plasmidpräparation Plasmide sind kleine, ringförmige DNA-Moleküle in Bakterien, die in der Lage sind, sich selbst mit Hilfe von Enzymen zu replizieren. Gene, die auf

Mehr

Sinnvoller Umgang mit DNA-Tests

Sinnvoller Umgang mit DNA-Tests Sinnvoller Umgang mit DNA-Tests - Eine Zuchtmethode - - Kleine Hundepopulation - Helga Eichelberg Welpenstatistik Eingetragene Welpen 2006 2005 2004 Pinscher 384 237 246 ca. 80 Würfe Zwerge 197 250 251

Mehr

Protokoll zur Übung PCR

Protokoll zur Übung PCR Protokoll zur Übung PCR im Rahmen des Praktikums Labor an der TU Wien Durchgeführt bei Ao.Univ.Prof. Mag. Dr.rer.nat. Robert Mach Verfasser des Protokolls: Gwendolin Korinek 0625083 & Daniel Bomze 0726183

Mehr

Inhaltsverzeichnis. Polymerase Chain Reaction Theoretischer Hintergrund - 2 -

Inhaltsverzeichnis. Polymerase Chain Reaction Theoretischer Hintergrund - 2 - Inhaltsverzeichnis 1 Theoretischer Hintergrund - 2-1.1 Die Komponenten der PCR - 2-1.2 Das Verfahren der PCR - 3-1.3 Die Gelelektrophorese - 5-2 Material und Methoden - 6-3 Ergebnisse - 7-3.1 Ergebnisse

Mehr

SNP-Genotyping Am Beispiel eines Rezeptors fü r den Geschmack Bitter. Novartis Schullabor

SNP-Genotyping Am Beispiel eines Rezeptors fü r den Geschmack Bitter. Novartis Schullabor SNP-Genotyping Am Beispiel eines Rezeptors fü r den Geschmack Bitter Novartis Schullabor 2014 Herausgeber Novartis Pharma AG, CH-4002 Basel Kontaktadresse: Novartis Pharma AG Dr. Gesche Standke Dr. Christiane

Mehr

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Versuch 2: Polymerasekettenreaktion Betreuer: Knut Jahreis Versuchsinhalt Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Zwei verschiedene Plasmide werden als Matrizen für eine Polymerasekettenreaktion

Mehr

Plasmide, Vektoren und Klonierung

Plasmide, Vektoren und Klonierung Biologische Übungen IV, Kurstage 3, 4 Restriktionskartierung eines Plasmids, 27./28.05.2004 Protokollant: Bernhard Schnepf Gruppe A1: Dachs Sven Schnepf Bernhard Thumann Rauno Plasmide, Vektoren und Klonierung

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

Versuchsanleitung. Inhaltsverzeichnis. Restriktionsenzyme. Von Magnus Mauer. VAD_Biologie_Restriktionsenzyme.doc

Versuchsanleitung. Inhaltsverzeichnis. Restriktionsenzyme. Von Magnus Mauer. VAD_Biologie_Restriktionsenzyme.doc Restriktionsenzyme Von Magnus Mauer Inhaltsverzeichnis II Zielsetzung. Seite 02 III Hintergrundinformationen Seite 02 IV Restriktionsenzyme in der Gentechnik (Kopiervorlage für Schüler).... Seite 06 IV

Mehr

Grundlagen der Vererbungslehre

Grundlagen der Vererbungslehre Grundlagen der Vererbungslehre Zucht und Fortpflanzung Unter Zucht verstehen wir die planvolle Verpaarung von Elterntieren, die sich in ihren Rassemerkmalen und Nutzleistungen ergänzen zur Verbesserung

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

Autosomal-dominanter Erbgang

Autosomal-dominanter Erbgang 12 Autosomal-dominanter Erbgang Bearbeitetes Informationsblatt herausgegeben vom Guy s and St. Thomas Hospital, London und dem London IDEAS Genetic Knowledge Park, entsprechend deren Qualitätsstandards.

Mehr

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung Sequenzierung von Thomas Grunwald Abteilung für Med. und Mol. Virologie Sequenzierung Hintergrund Allgemeiner Überblick Funktionsweise der Sequenzierung Sequenzierungsprotokoll Auswertung der Daten Probleme

Mehr

Molekulare Humangenetik: Eine Übersicht über wichtige Begriffe

Molekulare Humangenetik: Eine Übersicht über wichtige Begriffe Molekulare Humangenetik: Eine Übersicht über wichtige Begriffe Allel - ein möglicher Zustand eines genetischen Markers, z. B. unterschiedliche Formen einer DNA-Sequenz, oder verschiedene Mutationen eines

Mehr

Genetische Marker in der Entomologie

Genetische Marker in der Entomologie Genetische Marker in der Entomologie Wien, 19. November 2004 1865 Merkmale werden unabhängig voneinander vererbt 1871 Entdeckung der Nukleinsäuren 1903 Chromosomen sind Träger des Erbguts 1927 Mutationen

Mehr

Experimentelle Phytopathologie

Experimentelle Phytopathologie Experimentelle Phytopathologie Wolfgang Arthofer Wintersemester 2008/09 Institut für Forstentomologie, Forstpathologie und Forstschutz Department für Wald- und Bodenwissenschaften Universität für Bodenkultur,

Mehr

Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt

Mehr

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts

Mehr

3.1.1 Bedeutung und Häufigkeit von DNA-Polymorphismen und ihre Darstellung mittels genetischer Marker: RFLP-Marker, SSLP-Marker und IRS-PCR-Marker

3.1.1 Bedeutung und Häufigkeit von DNA-Polymorphismen und ihre Darstellung mittels genetischer Marker: RFLP-Marker, SSLP-Marker und IRS-PCR-Marker III. Ergebnisse 3.1 Segregationsanalyse von DNA-Polymorphismen 3.1.1 Bedeutung und Häufigkeit von DNA-Polymorphismen und ihre Darstellung mittels genetischer Marker: RFLP-Marker, SSLP-Marker und IRS-PCR-Marker

Mehr

Kapitel 3. Populationsgenetik: Gene und ihre Frequenzen

Kapitel 3. Populationsgenetik: Gene und ihre Frequenzen 701-245-00L Pop - & Evol biol - 25 - Kap. 3: Populationsgenetik Kapitel 3 Populationsgenetik: Gene und ihre Frequenzen 3.1 Populationsgenetik Mikroevolutive Prozesse bilden die Grundlage allen Evolutionsgeschehens.

Mehr

Bernhard-Strigel-Gymnasium Kollegstufe /2011 Leistungskurs:... Biologie Kollegiat:... Tamara Bruno. Facharbeit

Bernhard-Strigel-Gymnasium Kollegstufe /2011 Leistungskurs:... Biologie Kollegiat:... Tamara Bruno. Facharbeit - 1 - Bernhard-Strigel-Gymnasium Kollegstufe... 2009/2011 Memmingen Leistungskurs:... Biologie Kollegiat:... Tamara Bruno Facharbeit Versuch einer Sphagnum-Klassifikation durch Restriktionsverdau Abgegeben

Mehr

ID-Labor GmbH. Der genetische Fingerabdruck und Abstammungsuntersuchungen

ID-Labor GmbH. Der genetische Fingerabdruck und Abstammungsuntersuchungen Der genetische Fingerabdruck und Abstammungsuntersuchungen Genetischer Fingerabdruck Grundlagen DNA-Analyse Gen-Analyse: untersuchte DNA-Bereiche: Short Tandem Repeats (STR), nicht-codierende Regionen

Mehr

Vorbereitung. 4) Durchführungshinweise: 4.1 Prinzip erklären: Ablauf mit Zeitplanung und Gerätschaften 4.2 Pipettieren üben mit Aqua dest.!

Vorbereitung. 4) Durchführungshinweise: 4.1 Prinzip erklären: Ablauf mit Zeitplanung und Gerätschaften 4.2 Pipettieren üben mit Aqua dest.! Vorbereitung 1) am Vortag o.ä.: (wie Versuch 4) 1.1 Arbeitsblätter kopieren / bereitlegen. fertiges (Ergebnis-)Gel überprüfen Vorratslösungen überprüfen: Elektrophorese-Puffer, Aqua dest., Färbelösung

Mehr

Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring. Elisabeth Haring Naturhistorisches Museum Wien

Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring. Elisabeth Haring Naturhistorisches Museum Wien Bärige Genetik: Neue Ergebnisse aus dem Niederösterreichischen Wildtiermonitoring Elisabeth Haring Naturhistorisches Museum Wien Sieben Jahre genetisches Monitoring der niederösterreichisch-steirischen

Mehr

Identifizierung positiver Klone aus einer λ-phagenbibliothek

Identifizierung positiver Klone aus einer λ-phagenbibliothek Identifizierung positiver Klone aus einer λ-phagenbibliothek Betreuer: Elke Muth-Köhne und Nora Cavara Beginn des Versuchs: 9.00 Uhr im Praktikumssaal NBCF 04 Nord 1. Theoretischer Hintergrund 1.1 Screening

Mehr

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht

Mehr

DNA versus RNA. RNA Instabilität

DNA versus RNA. RNA Instabilität DNA versus RNA DNA stellt den eigentlichen Speicher genetischer Information dar, während RNA als Informationsüberträger und katalytisch in der Proteinbiosynthese agiert. Warum dient DNA und nicht RNA als

Mehr

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt USERGUIDE Seite 1 No. 201 Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt Temperierbereich: (RT 13 C) bis 99 C [MTPs: (RT 10 C) bis 70 C], Minimal

Mehr

Können Gene Depressionen haben?

Können Gene Depressionen haben? Können Gene Depressionen haben? DTzt. Chromosomen, Gene und so... Die Sache mit der Vererbung oder warum sieht eine Kuh aus wie eine Kuh? Die kleinste Datenbank Desoxyribonukleinsäure - DNA Speicher für

Mehr

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14 Evolution II Molekulare Variabilität Bachelorkurs Evolutionsbiolgie II WS 2013/14 Molekulare Variabilität 1) rten der molekularen Variabilität und ihre Entstehung (rten der Mutation) 2) Wie kann man molekulare

Mehr

Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren

Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren Stefan-Marcel Loitsch, Christian von Mallinckrodt, Tim Hirche, Thomas OF Wagner Pneumologie und Allergologie, Medizinische Klinik

Mehr

Forensische Genetik. Universitätsklinikum Essen. Institut für Rechtsmedizin. Forensische Spurenanalytik und Abstammungsbegutachtung

Forensische Genetik. Universitätsklinikum Essen. Institut für Rechtsmedizin. Forensische Spurenanalytik und Abstammungsbegutachtung Universitätsklinikum Essen Institut für Rechtsmedizin Forensische Genetik Forensische Spurenanalytik und Abstammungsbegutachtung Prof. Dr. rer. nat. Micaela Poetsch Forensische Spurenanalytik Ziel: Identifikation

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

Rekombinante Wirkstoffe

Rekombinante Wirkstoffe Gentechnik/Biotechnik Rekombinante Wirkstoffe Vorlesung im WS 2010/2011 Prof. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt/Main Dingermann@em.uni-frankfurt.de Die

Mehr

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 1.2.1.1. Molekulare Struktur von NCAM S.

Mehr

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 ChromoQuant Das ChromoQuant in vitro Diagnose-Set QF-PCR 1 zur Analyse von häufigen chromosomalen Erkrankungen der Chromosomen 13, 18 und 21 412.001-48u

Mehr

DNA- Rekombinationstechnik. Gentechnik

DNA- Rekombinationstechnik. Gentechnik DNA- Rekombinationstechnik Gentechnik 1 Verwendung von Plasmiden in der Gentechnik Campbell 19.1 2 Die wichtigsten Schritte bei der DNA-Klonierung (Plasmid) Transformation 3 Durch Klonierung kann man DNA-Fragmente

Mehr

Ort: Praktikumsraum der Physiologie MAFO Ebene 0 Raum 222 Süd

Ort: Praktikumsraum der Physiologie MAFO Ebene 0 Raum 222 Süd Ort: Praktikumsraum der Physiologie MAFO Ebene 0 Raum 222 Süd Zeit: 14.15 17.00 Uhr gemäß Gruppenverteilungsplan Leiter: Prof. Dr. J.T. Epplen, Dr. L. Arning, Dr. G. Dekomien, Dr. W. Gerding, Dr. B. Miterski,

Mehr

Molekulare Ökologie/ Populationsgenetik. SoSe 2009

Molekulare Ökologie/ Populationsgenetik. SoSe 2009 Molekulare Ökologie/ Populationsgenetik SoSe 2009 Hinweise zum Praktikum Formales Tagesablauf Gruppenaufteilung, Teilnahmeliste Sicherheitsbelehrung Laborverantwortliche Protokollbögen Labortagebuch Hinweise

Mehr

Die Anwendung der Gentechnologie in der Rechtsmedizin

Die Anwendung der Gentechnologie in der Rechtsmedizin Mai 1998 Nr. 50 Der Verein «Forschung für Leben» informiert: Die Anwendung der Gentechnologie in der Rechtsmedizin Prof. Dr. med. Walter Bär Dr. phil. Adelgunde Kratzer Impressum Der Verein «Forschung

Mehr

Integron und Integrase

Integron und Integrase Integron und Integrase Ein Versuch zum Nachweis von Antibiotikaresistenzen. Ein NUGI-Projekt am Albert-Einstein-Gymnasium, Wiblingen These Der Einsatz von Antibiotika führt zu einer erhöhten Resistenzbildung

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

Mach-mit-Labor. Biochemie Prof. Rita Bernhardt

Mach-mit-Labor. Biochemie Prof. Rita Bernhardt Mach-mit-Labor Biochemie Prof. Rita Bernhardt Das Mach-mit-Labor Das Mach-mit-Labor (Betreiberin Prof. Dr. R. Bernhardt) bietet seit 2002 naturwissenschaftlich interessierten SchülerInnen die Möglichkeit,

Mehr

Nachweis von DNA im Wein

Nachweis von DNA im Wein Abschlussbericht über den Forschungsauftrag Nachweis von DNA im Wein Projektlaufzeit: 01.01.2001 bis 31.03.2003 Prof. Dr. Ralf Kaldenhoff Universität Würzburg Julius-von-Sachs-Institut für Biowissenschaften

Mehr

S E M I N A R A R B E I T. Thema der Arbeit: Identifizierung eines Täterprofils mittels PCR und des genetischen Fingerabdrucks

S E M I N A R A R B E I T. Thema der Arbeit: Identifizierung eines Täterprofils mittels PCR und des genetischen Fingerabdrucks Schyren-Gymnasium Pfaffenhofen Abiturjahrgang 2013/2015 S E M I N A R A R B E I T Rahmenthema des Wissenschaftspropädeutischen Seminars: Forensik Leitfach: Chemie Thema der Arbeit: Identifizierung eines

Mehr

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien 36 4. ERGEBNISSE 4.1. Immunglobulin Gentranskripte in Hodgkinzelllinien Mit Hilfe der RT PCR untersuchten wir die Expression umgelagerter Ig Gene in den Hodgkinzelllinien L1236, L428, L591 und KM-H2 sowie

Mehr

Warum habe ich Diabetes? Sind die Gene schuld?

Warum habe ich Diabetes? Sind die Gene schuld? Warum habe ich Diabetes? Sind die Gene schuld? Lenka Bosanska medicalxpress.com 17. Welt Diabetes Tag Was sind Gene? Gene bei Diabetes Polygene vs. Monogene Formen Ich und meine Gene - was kann ich tun?

Mehr

1. Übung: Mendel. Konzepte: Genetische Information. Pro und Eukaryoten. Dominanz/Rezessivität. Mendelsche Gesetze

1. Übung: Mendel. Konzepte: Genetische Information. Pro und Eukaryoten. Dominanz/Rezessivität. Mendelsche Gesetze 1. Übung: Mendel Konzepte: Genetische Information Pro und Eukaryoten Dominanz/Rezessivität Mendelsche Gesetze Spaltungsanalyse Genetische Information 1. Wo und wie liegt sie im Organismus vor? Vergleichen

Mehr

1 Einleitung... 13. 1.1 Staphylokokken... 13. 1.2 Koagulase-negative Staphylokokken... 13. 1.4 MSCRAMM-Proteine... 16. 1.5 LPXTG-Motive...

1 Einleitung... 13. 1.1 Staphylokokken... 13. 1.2 Koagulase-negative Staphylokokken... 13. 1.4 MSCRAMM-Proteine... 16. 1.5 LPXTG-Motive... Inhaltsverzeichnis 1 Einleitung... 13 1.1 Staphylokokken... 13 1.2 Koagulase-negative Staphylokokken... 13 1.3 Staphylococcus saprophyticus... 14 1.4 MSCRAMM-Proteine... 16 1.5 LPXTG-Motive... 16 1.6 Oberflächenassoziierte

Mehr

Das Humangenomprojekt (HGP)

Das Humangenomprojekt (HGP) Sven Cichon 1 Jan Freudenberg 2 Peter Propping 2 Markus M. Nöthen 1 Variabilität im menschlichen Genom Bedeutung für die Krankheitsforschung Zusammenfassung Das Genom des Menschen ist weitgehend sequenziert,

Mehr

Molekulare Spurenanalytik und Abstammungsbegutachtung. Dr. rer. nat. Micaela Poetsch, Institut für Rechtsmedizin, Universitätsklinikum Essen

Molekulare Spurenanalytik und Abstammungsbegutachtung. Dr. rer. nat. Micaela Poetsch, Institut für Rechtsmedizin, Universitätsklinikum Essen Molekulare Spurenanalytik und Abstammungsbegutachtung Spurenanalytik Ziel: Identifikation Also die Zuordnung einer bestimmten Spur zu einer bestimmten Person! Denn Spuren bei einer forensischen Untersuchung

Mehr

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: Einführung Übung Bitte bereiten Sie folgende Probleme vor der Übung am Mittwoch. Die Klausur

Mehr

Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst

Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst Überblick Einleitung und Zielstellung Was ist ein Marker? Analyse mit Mikrosatelliten-Markern

Mehr

Bruder oder Vetter - was verbindet uns mit dem Neandertaler? 1

Bruder oder Vetter - was verbindet uns mit dem Neandertaler? 1 Bruder oder Vetter - was verbindet uns mit dem Neandertaler? 1 BÄRBEL KUNZE 2, Universität Lübeck Erweiterter Bericht von Wolfram Eckloff In ihrem beeindruckenden Vortrag berichtete Frau Dr. Kunze über

Mehr

DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet

Mehr

GeneProfile Der Genetische Fingerabdruck: Verwandtschaftsnachweis mit PCR

GeneProfile Der Genetische Fingerabdruck: Verwandtschaftsnachweis mit PCR GeneProfile Der Genetische Fingerabdruck: Verwandtschaftsnachweis mit PCR Experimentierkit für den Biologieunterricht in der Oberstufe an Gymnasien Lehrerhandbuch Entwickelt in Zusammenarbeit mit dem Oberschulamt

Mehr

Evolutionäre Ökologie

Evolutionäre Ökologie 701-0243-01L Biologie III: Ökologie Evolutionäre Ökologie Was ist das? Rüstzeug: Molekulargenetische Methoden Populationsgenetik Quantitative Genetik Beispiele: Rassen- /Artbildung Koevolution Christoph

Mehr

Vaterschaftsanalyse über DNA-Profile

Vaterschaftsanalyse über DNA-Profile Vaterschaftsanalyse über DNA-Profile I. Einleitung Diese Anleitung erläutert das genetische Verfahren der Vaterschaftsanalyse, so wie es heute zum Einsatz kommt. Im vorliegenden Experimentier-Kit sind

Mehr

Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen

Mehr

Station 1. Aufgaben zu den Mendelschen Regeln

Station 1. Aufgaben zu den Mendelschen Regeln Station 1 Aufgaben zu den Mendelschen Regeln Arbeitsblatt 1 zu Station 1 Aufgabe 1 Formuliere die erste Mendelsche Regel. Aufgabe 2 Erläutere die folgenden Fachbegriffe. Name homozygot heterozygot reinerbig

Mehr