aus dem Leibniz-Institut für Neurobiologie Magdeburg

Größe: px
Ab Seite anzeigen:

Download "aus dem Leibniz-Institut für Neurobiologie Magdeburg"

Transkript

1 Rolle und mögliche Interaktion der präsynaptischen Gerüstproteine Bassoon und RIM1/2 bei der Rekrutierung von spannungsabhängigen Calciumkanälen in die Aktive Zone aus dem Leibniz-Institut für Neurobiologie Magdeburg Der Medizinischen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. med. vorgelegt von Benjamin Hendrik Berinson aus Berlin

2 Als Dissertation genehmigt von der Medizinischen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 12. März 2019 Vorsitzender des Promotionsorgans: Prof. Dr. Dr. h.c. J. Schüttler Gutachterin: Prof. Dr. Anna Fejtová Gutachter: PD Dr. Martin Heine

3 Inhaltsverzeichnis ZUSAMMENFASSUNG... 1 ABSTRACT EINLEITUNG GRUNDLAGEN NEURONALER KOMMUNIKATION ÜBER SYNAPSEN DIE FUNKTION DER PRÄSYNAPSE Aufbau der Vesikel und die Anordnung in der Präsynapse Der synaptische Vesikel Zyklus DIE CYTOMATRIX DER AKTIVEN ZONE (CAZ) RIM Das Multitalent der Aktiven Zone Bsn und Pclo Die großen Gerüstproteine RIM-BP VGCC PRÄSYNAPTISCHER CALCIUM EINSTROM POSITIONAL PRIMING VON VGCC IN DER PRÄSYNAPSE ZIELSETZUNG DER ARBEIT MATERIAL UND METHODEN MATERIALEN Molekularbiologische Reagenzien und Kits Pharmakologische Reagenzien Kulturmedien und Reagenzien für die Zellkultur Lösungen zur Immunohistochemie- bzw. live-imaging Experimente Stammlösungen Bakterienkulturen und Kulturmedien für die Bakterienanzucht Zelllinien Antikörper METHODEN Präparation der Deckgläschen Erstellen der Glia-Cokultur Präparation der primären Maus Hippocampus Kulturen Virusproduktion/Infektion Live Mikroskopie Analyse der live Bilder Immunhistochemische Färbungen und Mikroskopie Transformation Hitzeschock-kompetenter Escherichia Coli XL10 Gold Plasmidaufreinigung zur Gewinnung großer Menge DNA mithilfe des NucleoBond Kits Primerdesign Mauslinien Statistische Analyse ERGEBNISSE GRUNDLAGEN DER VERWENDETEN KO-MODELLE CHARAKTERISIERUNG DES SLICK-MAUSMODELLS CHARAKTERISIERUNG DES EMX1-MAUSMODELLS CHARAKTERISIERUNG DES CALCIUMSENSORS UND DER STIMULATION LIVE IMAGING UND REDUKTION DES CALCIUMEINSTROMS IN DEN EMX1-KULTUREN CHARAKTERISIERUNG DER MAUSLINIEN BSN2 LOX/LOX, RIM1/2 LOX/LOX UND BSN2 LOX/LOX MIT RIM1/2 LOX/LOX EIN VERLUST VON RIM1/2 VERMINDERT DEN CALCIUMEINSTROMS ERHÖHTER CALCIUMEINSTROM, WENN EIN VERLUST VON BSN VORLIEGT REDUKTION DES CALCIUMEINSTROMS IN SYNAPSEN OHNE BSN UND RIM1/2 (TKO)... 49

4 4. DISKUSSION EVALUATION DER MAUSKULTUREN CALCIUM LIVE-BILDGEBUNG LITERATURVERZEICHNIS ABKÜRZUNGEN... 66

5 Zusammenfassung Hintergrund und Ziele Die Kommunikation im Gehirn beruht auf der Signalübertragung an Synapsen. Diese Signalübertragung basiert auf einer Depolarisation in der Präsynapse, woraufhin Calcium (Ca) durch spannungsabhängige Calciumkanäle (VGCC) einströmt und eine Ausschüttung von Neurotransmittern, die in synaptischen Vesikeln gespeichert sind, auslöst. Es gibt zwei präsynaptisch lokalisierte Subtypen der VGCC, den N- und den P/Q-Typ. Die Lokalisation der VGCC in enger räumlicher Nähe zu den Vesikeln, das sogenannte positional priming, ist von größter Wichtigkeit um eine synchrone und adäquate Transmitterausschüttung zu gewährleisten. Es konnten drei präsynaptische Moleküle ausgemacht werden, die u.a. für diesen Prozess verantwortlich sind: RIM1/2 und Bassoon. Für RIM1/2 wurde gezeigt, dass sie die beiden präsynaptisch vorkommenden Subtypen der VGCC in die Aktive Zone rekrutieren können, wohingegen Bassoon spezifisch den P/Q-Typ rekrutiert. Das Ziel dieser Arbeit war es, die Rolle und mögliche Interaktionen der drei Proteine auf die Rekrutierung der VGCC zu klären. Methoden Hierfür wurden primäre Maushippocampusneuronenkulturen verschiedener Knockout- Strategien präpariert und auf Verwendbarkeit evaluiert. Die verwendeten Hauptstrategien waren einerseits das EMX1-Cre-Modell, in dem das Knockout (KO) für die drei angesprochenen Proteine aufgrund des EMX1-Promotors nur in exzitatorischen Synapsen des Telencephalons erfolgt und andererseits verschiedene Cre/lox-Modelle in denen die Cre-Recombinase intrinsisch nicht exprimiert wurde. In den letzteren führte das Einbringen der Cre-Recombinase bzw. des Kontroll-Konstrukts Cre-Recombinase per lentiviralem Vektor zu einer Deletion von nur Bassoon, von nur RIM1/2 oder von allen drei Proteinen. Folgend wurden die Kulturen entweder immunhistochemisch gefärbt und analysiert oder es wurde, erneut per lentiviraler Infektion, ein Calciumsensor eingebracht. Dieser war an Synaptophysin, ein Protein, welches in der Membran der synaptischen Vesikel lokalisiert ist, gekoppelt (SyGCaMP5G). Mit diesen Kulturen konnte darauffolgend Calcium-live-Bildgebung durchgeführt werden und somit der Calciumeinstrom in die Präsynapse analysiert werden 1

6 Ergebnisse und Beobachtungen Es wurde in der Vergangenheit gezeigt, dass ein RIM1/2-KO den Calciumeinstrom um ca. 50% senkt. Wir konnten diese Daten mit einer anderen Herangehensweise replizieren und aufgrund einer höheren Sensitivität unseres Ansatzes sogar eine Reduktion von ca. 57% zeigen. Der Effekt von einem Bassoon-KO auf den Ca- Einstrom war bis dato unbekannt. Erstaunlicherweise konnten wir eine Erhöhung des einströmenden Ca von 41% feststellen. Ein Verlust aller drei Proteine führte zu einer Reduktion des Einstroms um 60% gegenüber WT-Kulturen, dies war jedoch keine signifikante Reduktion im Vergleich zum RIM1/2-KO. Weiterhin konnten wir zeigen, dass die KO-Strategie der EMX1-Mäusen prinzipiell gut funktionierte, jedoch für die live-bildegbungsexperimente nicht nutzbar waren. Schlussfolgerungen Aus diesen Ergebnissen lässt sich schlussfolgern, dass der Verlust von Bassoon mit einem erhöhten Calciumeinstrom einhergeht, wohingegen die Erklärung dieses Phänotyps jedoch noch vollkommen ungeklärt ist. Weiterhin kann man aus den Daten ableiten, dass die Rekrutierung von VGCC in die Aktive Zone durch Bassoon direkt oder indirekt RIM1/2 abhängig ist. 2

7 Abstract Background and goals The communication in the brain relies on signal transduction via synapses. This is based on a depolarisation at the presynapse, followed by an influx of calcium-ions (Ca) through voltage-gated Calcium channels (VGCC) and a release of neurotransmitter, which is stored in synaptic vesicles. There are two subtypes of the VGCC located in the presynapse, the N-type and the PQ-type. The localisation of the VGCC in close vicinity to the vesicles, the so called positional priming, is of great importance, since the synchronous and adequate release of neurotransmitter relies on it. Three presynaptic molecules of crucial importance for this process could be identified: RIM1/2 and Bassoon. For RIM1/2 it was shown, that they could recruit both synaptic subtypes of the VGCC to the active zone, whereas Bassoon can only recruit specifically P/Q-type channels. The aim of this thesis was to shed light on the role of these three proteins and possibly their interaction in recruiting VGCC to the active zone. Methods To address this question, primary mouse hippocampal neurone cultures of different knockout strategies were prepared and evaluated for applicability. The two main strategies were on the one hand the EMX1-Cre-Model, which resulted, due to the EMX1-promotor, in a knockout (KO) for the three mentioned proteins only in excitatory synapses of the forebrain, and on the other hand a Cre/lox system, where the Cre-Recombinase was not expressed intrinsically. In the latter, the KO was achieved by introducing the Cre-recombinase or its inactive counterpart Cre-recombinase, via a lentiviral vector. This led to a loss of RIM1/2 and/or Bassoon. Subsequently the cultures were either immunohistochemically stained and analysed or, again via lentiviral infection, a calciumsensor coupled to a protein located in the membrane of the synaptic vesicle, synaptophysin, was introduced (SyGCaMP5G). Afterwards the latter cultures could be used for calcium-live imaging to assess the calcium influx. Results and observations In the past it was shown, that a RIM1/2-KO led to a decrease in calcium influx by around 50%. We could verify this data with a different, more sensitive, approach, so that we could show an even greater reduction of the calcium influx of around 57%. The effect of a loss of Bassoon was up to date unknown. Surprisingly, we could see an increase of the inflowing calcium by 41%. Furthermore, a loss of the three proteins 3

8 altogether led to a reduction of around 60%, when compared with wild type cultures. This effect though was not significantly lower than the reduction in the RIM1/2-KO. Furthermore, we could show that the knockout strategy underlying the EMX1-KO mice worked well, but was not applicable for the ca-live imaging. Conclusion One can deduce from these results, that the loss of Bassoon leads to a higher calcium influx, although the explanation for this is still completely unknown and should be object of further studies. Furthermore, the interpretation of the data leads to the concept that the recruitment of VGCC via Bassoon might be directly or indirectly depending on RIM1/2. 4

9 1 Einleitung 1.1 Grundlagen neuronaler Kommunikation über Synapsen Das Gehirn ist die zentrale Schnittstelle für die Verarbeitung und das Bewusstwerden von Sinneseindrücken. Es ist der Sitz von Gedanken und Gefühlen und es ist essenziell für das Gedächtnis und Lernen. Die einwandfreie Funktion des Gehirns basiert auf der Übertragung von Informationen zwischen den einzelnen Neuronen. Der Ort an dem die schnelle und gut regulierte Informationsübertragung stattfindet ist die Synapse. Sie besteht aus einem Teil, an dem die Information in Form eines elektrischen Potentials (Aktionspotential) ankommt, der Präsynapse, einem synaptischen Spalt und einer Postsynapse (Gray 1963). Die Synapsen werden von Gliazellen umgeben, die sie u.a. stützen und isolieren, jedoch noch viele weitere Funktionen übernehmen. Als chemischer Vermittler zwischen der Prä- und Postsynapse dienen die Neurotransmitter (NT), die in synaptischen Vesikeln (SV) gespeichert sind. Diese werden durch einen hochkomplexen und streng regulierten Mechanismus bei einem ankommenden Aktionspotential (AP) aus der Präsynapse in den synaptischen Spalt entlassen und bewirken nach der Diffusion zur Postsynapse und Bindung an die entsprechenden Rezeptoren eine Antwort. Diese kann z.b. einen Ioneneinstrom generieren (ionotroper Rezeptor) oder eine sekundäre Botenstoffkaskade auslösen (metabotroper Rezeptor). Wenn ein Aktionspotential die Präsynapse erreicht, wird die Membran depolarisiert und dadurch spannungsabhängige Calcium-Kanäle ( voltage-gated Calcium channel, VGCC) aktiviert. Calcium-Ionen strömen, dem Konzentrationsgradienten folgend, in das präsynaptischen Bouton ein und werden von einem Protein, Synaptotagmin 1 (Stg1), das als Calciumsensor fungiert, gebunden. Dadurch wird die Exozytose der bereits fusionsbereiten synaptischen Vesikel eingeleitet, die mit der präsynaptischen Plasmamembran fusionieren und somit die NT in den synaptische Spalt entlassen. Diese gesamten Vorgänge finden an einem kleinen, aber hochkomplexen und proteinreichen Abschnitt der Präsynapse statt, der sogenannten Aktiven Zone (AZ) (Couteaux et al. 1970, Phillips et al. 2001). Abseits der AZ findet die Wiederaufnahme, die Endocytose, der vorher ausgeschütteten NT statt (Sudhof 2004). Das Gegenstück zur AZ auf der postsynaptischen Seite ist die sogenannte postsynaptische Dichte. Auch hier wird ein hochkomplexes und dichtes Proteinnetzwerk, bestehend aus den NT Rezeptoren, Ionenkanälen, sowie Struktur- und 5

10 Gerüstproteinen, beschrieben, um die ankommenden Signale adäquat weiterleiten zu können (Vessey et al. 2007). 1.2 Die Funktion der Präsynapse Aufbau der Vesikel und die Anordnung in der Präsynapse Wie bereits oben beschrieben, lässt sich erahnen, dass sich viele wichtige Prozesse gleichzeitig in der Präsynapse abspielen um eine reibungslose und streng regulierte neuronale Übertragung sicherzustellen. Sehr wichtige Bestandteile der neuronalen Übertragung sind die SV. Sie sind kleine Organellen ( 30-40nm Durchmesser), deren Aufgabe es ist NT in sich zu lagern, bei einem Aktionspotential mit der Plasmamembran zu fusionieren und ihren Inhalt in den synaptischen Spalt zu entlassen (Sudhof 2013). SV bestehen aus 50% Protein und 50% Lipiden und stehen mit einer Vielzahl von Proteinen in Interaktion. Zu den SV-Proteinen gehören unter anderem Synaptotagmin 1&2, Protonen-Pumpen, die einen elektrochemischen Gradienten für die NT-Wiederaufnahme aufbauen, NT-Transporter, Rab3, welches an Rab3-interacting molecule 1α/2α (RIM) bindet sowie Synaptobrevin 1&2, die wichtig für die Formierung des sogenannten SNARE-Komplexes (soluble N-ethylmaleimide sensitive factor attachment receptor) sind (Dittman et al. 2009). SV sind je nach Ausschüttungswahrscheinlichkeit in sogenannten Pools organisiert. B Abbildung 1: Anordnung der SV in der Präsynapse A zeigt ein elektromikroksopisches Bild einer Synapse. Klar zu erkennen sind die SV mit ihrer teilweise engen Lage zur AZ, deren Enden mit den oberen Pfeilen gekennzeichnet sind. Die Pfeile auf der Postsynapse zeigen das Ende der postsynaptischen Dichte (Stevens 1997). B zeigt eine schematische Darstellung der Pools. Die Größe der Flächen soll die Größe der Pools repräsentieren (Alabi et al. 2012). Es werden drei Pools in der Literatur beschrieben: der fusionsbereite Pool (Ready Releasable Pool, RRP), der Recycling Pool (RP) und der Resting Pool (Alabi et al. 2012). Im RRP befinden sich im Durchschnitt 5-10 Vesikel und somit der kleinste 6

11 Anteil (1-2%) der SV einer Präsynapse (Chamberland et al. 2016). Diese sind bereits docked and primed, angedockt und vorbereitet, um bei einem ankommen AP sofort mit der Plasmamembran der AZ fusionieren können und somit schnell den NT entlassen können (Rizzoli et al. 2005). Docking bedeutet, dass die SV sehr nah (zwischen 0-30 nm) an die Membran der AZ herangebracht werden. Priming beschreibt einen Prozess, bei dem die Vesikel bereits anfänglich mit den SNARE-Proteinen assoziiert werden und somit nur noch die Calcium-Ionen nach Stimulation einströmen und an Synaptotagmin- 1 binden müssen, um eine Fusion der SV mit der präsynaptischen Membran zu bewirken. In der Vergangenheit wurden diese beiden Prozesse als zwei unabhängige Abläufe angesehen. Da diese beiden Prozesse aber eine Vielzahl an gleicher Proteine benötigen und Hand in Hand gehen, ist man von dieser Ansichtsweise heutzutage abgerückt (Siksou et al. 2009, Gundelfinger et al. 2012). Eine zentrale Rolle im Prozess der Rekrutierung, Lokalisierung und Fusionsvorbereitung der Vesikel spielen insbesondere Bassoon (Bsn) und RIM1/2 (Deng et al. 2011, Davydova et al. 2014). Der RRP kann bereits durch geringe Stimulation entleert werden. Ca 5-20% aller Vesikel befinden sich im RP. Sie stehen nicht im Kontakt mit der Plasmamembran und werden bei mittlerer Stimulation zur Unterstützung des schnell entleerten RRP ausgeschüttet. Der Resting Pool macht das Gros der synaptischen Vesikel aus. Er wird nicht bei physiologischen Stimulationen ausgeschüttet und seine Aufgaben verbleiben weitgehend ungeklärt (Alabi et al. 2012). Nichtsdestotrotz zeigten neuere Erkenntnisse, dass durch Aktivierung verschiedener Proteinkaskaden die Vesikel dieses Pools mobilisiert werden können (Denker et al. 2009, Kim et al. 2010) Der synaptische Vesikel Zyklus Ein synaptisches Vesikel durchläuft mehrere Phasen, von der Exocytose bei Stimulation, über die Endocytose, dem Wiederauffüllen mit NT und der Vorbereitung auf eine erneute Ausschüttung. All diese Vorgänge sind komplex reguliert und benötigen verschiedenste Protein-Protein Interaktionen. Wie oben bereits kurz beschrieben, beinhaltet die Membran der SV eine ATP-abhängige Protonenpumpe, die den elektrochemischen Gradienten zur Aufnahme von NT durch aktiven Transport generiert (Maycox et al. 1988). Der ph im Vesikelinneren wird unter Verbrauch von ATP ins Saure verschoben. Zum Transport der verschiedenen NT in die Vesikel, wurden bisher sieben verschiedene Transporter von vier unterschiedlichen 7

12 Aufnahmesystemen ausfindig gemacht. Glutamat wird von drei unterschiedlich exprimierten Vesikulären Glutamat Transportern 1-3 (VGlut1-VGlut3) und alle Monoamine (Katecholamine, Serotonin, Histamin) werden von zwei Transportern aufgenommen. Für GABA und Glycin wurde ein Transporter identifiziert, ebenso ein Transporter für Acetylcholin (Übersichtsartikel in (Sudhof 2004)). Die mit NT beladenen Vesikel werden durch verschiedenste Protein Interaktionen nah an die AZ gebracht und dort auf die Ausschüttung vorbereitet. Dadurch wird sichergestellt, dass der NT innerhalb von sehr kurzer Zeit ( 100µs) in den synaptischen Spalt entlassen werden kann (Sudhof 2004). In diesen Prozess sind unter anderem die SNARE Proteine SNAP25, Syntaxin 1, Synaptobrevin sowie Munc18-1, Munc13 und Syntaptotagmin 1 verwickelt. Dieser SNARE-Komplex ist ein sehr stabiles Konstrukt und ist essenziell wichtig für die Membranfusion (Rizo et al. 2008). Weiterhin kann RIM über seine Zinkfinger-Domäne (ZnF-Domäne) mit Munc13 interagieren und ist dementsprechend auch ein wichtiger Teil dieses hochregulierten Prozesses (Deng et al. 2011). Wenn nun ein Aktionspotential am präsynaptischen Bouton zu einer Depolarisation der Membran führt, werden VGCC aktiviert und Ca 2+ -Ionen strömen in die AZ ein. Synaptotagmin-1 steht in Kontakt zu der Membran des SV, der AZ und dem SNARE- Komplex. Es bindet die Ca 2+ -Ionen mit der C 2 B-Domäne und leitet wahrscheinlich durch elektrostatische Veränderungen die Fusion der beiden Membranen ein. Bei der Regulation und Dissoziation der SNARE-Komplexe spielen NSF und SNAP (Soluble NSF Attachment Protein) eine wichtige Rolle. Sie spalten mit ihrer ATPase Aktivität die Bindung des Komplexes auf und ermöglichen somit eine Wiederverwendung für den nächsten Exocytosevorgang (Sudhof et al. 2009). 8

13 Abbildung 2: Membranfusion zwischen der Präsynapse und SV. Hier wird schematisch der letzte Schritt der Exocytose gezeigt, die Membranfusion. Das SV ist bereits angedockt und auf die Exocytose vorbereitet worden und der SNARE-Komplex ist miteinander assoziiert. Die Ca 2+ -Ionen sind durch den VGCC (aus Übersichtsgründen hier nicht dargestellt) in die AZ eingeströmt und von Synaptotagmin-1 gebunden. Dies führt wie im Text beschrieben zu einer elektrostatischen Verlagerung (nicht dargestellt) und somit zur Fusion der beiden Membrane und zur Ausschüttung des NT (nicht dargestellt) (modifiziert aus Rizo et al. (2008)) Neben der Exocytose und der damit einhergehende Transmitterausschüttung ist die Endocytose essenziell. Durch sie wird sichergestellt, dass die Vesikelpools nach Ausschüttung wieder aufgefüllt werden und somit immer genügend Vesikel für die Übertragung von Informationen bereitstehen. In der Literatur werden drei Endocytose Mechanismen beschrieben: die Clathrin-vermittelte Endocytose, die bulk-endocytose (Massen-Endocytose) und die kiss-and-run Endocytose (Übersichtsartikel in (Saheki et al. 2012)). Nach erfolgreicher Endocytose wird das SV wie oben beschrieben wieder angesäuert, mit NT beladen und für eine weitere Exocytose bereitgestellt. 1.3 Die Cytomatrix der Aktiven Zone (CAZ) Wie bereits beschrieben handelt es sich bei der AZ um ein proteinreiches Geflecht, das für vielfältige Aufgaben in der Präsynapse zuständig ist. Als Hauptaufgaben der CAZ lassen sich unter anderem die Organisation der Transmitterausschüttung, das bereits beschriebene docking und priming, die Rekrutierung von VGCC und die Endocytose, identifizieren. Zu der CAZ gehören Proteine der folgenden Proteinfamilien: RIMs, Bsn und sein strukturähnlicher Verwandter Piccolo (Pclo), RIM-binding Proteine (RIM-BPs), CAST/ELKS Proteine, Liprin α und Munc-13 Proteine (Übersichtsartikel in: (Gundelfinger et al. 2012). Aufgrund der Relevanz für meine wissenschaftliche Arbeit werde ich mich hier im speziellen auf RIMs, Bsn und ferner RIM-BPs beziehen. 9

14 1.3.1 RIM Das Multitalent der Aktiven Zone Insbesondere RIM spielt eine essenzielle Rolle in der AZ, da es mit sehr vielen Proteinen, sowie mit VGCC und den vesikulären Proteinen Rab3 und Synaptotagmin-1 interagiert. Durch alternatives Spleißen von 4 RIM-Genen (RIM1-4) werden verschiedene RIM-Isoformen codiert: zwei große Formen, RIM1α, RIM2α, β, γ und zwei kleinere Isoformen RIM3γ und RIM4γ. RIM1α und RIM2α bestehen aus einem N-terminalen ZnF-Domäne, die GTP-abhängig Rab3a bindet, einer zentralen PDZ- und C 2 A-Domäne, sowie C-Terminal eine C 2 B-Domäne. Die PDZ-Domäne bindet die VGCC und die C 2 B-Domäne bindet unter anderem Liprin α. Die β-formen besitzen anstatt der N-Terminalen ZnF-Domäne eine β-spezifische Sequenz, gefolgt von den Abschnitten wie bei den α-formen. Die γ-formen bestehen nur aus der C 2 B-Sequenz (Wang et al. 1997, Wang et al. 2003). Abbildung 3: Aufbau und Bindungspartner von RIMs sowie RIM-BP Schematische Darstellung der Bindungsdomänen und einige Interaktionspartner der RIM-Isoformen. Insbesondere anzumerken sind die VGCC als Interaktionspartner der PDZ-Domäne von RIM1/2 und auch deren Interaktion mit dem RIM-BP (Sudhof 2012). Die N-terminale ZnF-Domäne steht in Kontakt mit der C 2 A-Domäne von Munc13-1. Die ZnF-Domäne umgebenden α-helices binden GTP-abhängig u.a. an Rab3 (s. Abb. 3). Es wurde gezeigt, dass durch die Bindung an Munc13 ein RIM/Munc13- Heterodimer gebildet wird. Dieses spielt mit der Bindung an Rab3 eine wichtige Rolle im priming -Prozess der synaptischen Vesikel. Die Deletion von RIM1 und RIM2 aus der Held schen Calyx resultierte in einer drastischen Reduktion von NT Ausschüttung, dem RRP sowie den angedockten Vesikeln (Dulubova et al. 2005, Lu et al. 2006, Deng et al. 2011, Han et al. 2011). Die zentrale PDZ-Domäne im RIM kann unter anderem an N- und P/Q-Typ VGCC binden und diese zur AZ rekrutieren (s. Abb. 3), aber sie 10

15 interagiert auch mit ELKS (Wang et al. 2002, Kaeser et al. 2011). Neure Studien legen nahe, dass die C-terminale Domänen an der Ca 2+ -Abhängigkeit und Synchronisierung der NT-Ausschüttung beteiligt ist (Kaeser et al. 2011). Ebenso konnte RIMs Relevanz in der Kurz- und Langzeitplastizität gezeigt werden (Castillo et al. 2002, Schoch et al. 2002) Bsn und Pclo Die großen Gerüstproteine Bsn und Pclo sind die beiden größten CAZ-Proteine mit 420 kda und 550kDa. Sie sind strukturell eng miteinander verwandte Gerüstproteine der AZ, insbesondere teilen sie zehn hoch konservierte Abschnitte, die Pclo-Bsn-Homologiedomänen (tom Dieck et al. 1998, Fenster et al. 2000). Ihre multi-domän-struktur lässt sie an vielen Prozessen in der Präsynapse modulierend eingreifen. Diese Interaktionen beinhalten Aufbau des AZ-Gerüst, Rekrutierung von VGCC, Präsynapsen-Zellkern- Kommunikation und Endocytose (Gundelfinger et al. 2015). Bsn ist bei dem Zusammenbau der AZ und bei der Ausbildung neuer Synapsen, der Synaptogenese, beteiligt. Früher gab es die These, dass die CAZ-Bestandteile in einem einzigen Vorläufer Vesikel entstehen und zur Präsynapse transportiert werden. Neuere Studien konnten zeigen, dass es drei Vorläufer Vesikel mit unterschiedlichen CAZ- Bausteinen gibt: Pclo-Bsn-ELKS/CAST, RIM-Neurexin-CASK zusammen mit entweder VGCC oder Munc13. Weiterhin konnte gezeigt werden, dass Bsn und Pclo essenziell sind um ELKS/CAST als Vesikel aus dem Golgi-Apparat ausschleusen und zur AZ transportiert werden kann (Tao-Cheng 2007, Fairless et al. 2008, Maas et al. 2012). Eine weitere Rolle von Bsn, nicht aber Pclo, beim Transport von Bausteinen der Synapse wurde von Fejtova et al. (2009) identifiziert. Hier konnte gezeigt werden, dass Bsn direkt mit Dynein leichten Ketten interagiert und somit als eine Art Adapter für den retrograden Transport dient. Die Störung dieser Interaktion behinderte die Verteilung von Bsn und Pclo zwischen den Synapsen. Weiterhin zeigen Mausmutanten, die durch Deletion eines Teils von Exon 4 und des gesamten Exon 5 des Bsn Gens erzeugt wurden, spontane epileptische Anfälle an denen 50% in den ersten 6 Monaten versterben. An Synapsen ist eine Einschränkung der Exocytose von SV zu beobachten. Vesikel sind in physiologischer Anzahl an der AZ angedockt, können jedoch nicht fusionieren und den in ihnen enthaltenen NT in den synaptischen Spalt entlassen. Weiterhin zeigen sich erhöhte Pclo-Level und ein 11

16 vergrößertes Cortex- und Hippocampusvolumen, sowie ein pathologisches basales Cortexaktivitätsmuster. Erstaunlicherweise war die Ultrastruktur der Synapsen der Bsn- Mutanten-Mäusen weitestgehend unauffällig, ebenso wie bei Pclo-Mutanten-Mäusen (Altrock et al. 2003, Angenstein et al. 2008, Mukherjee et al. 2010, Gundelfinger et al. 2015). In einer neueren Studie konnte ein neuer Signalweg ausfindig gemacht werden, in dem Bsn und Pclo eine Schlüsselrolle zufällt. CtBP1 (C-terminal binding protein), ein transkriptionaler Co-Repressor, findet sich in erhöhter Konzentration sowohl im Nucleus als auch in der Präsynapse. Er spielt eine wichtige Rolle in der aktivitätsabhängigen Modulierung der Genexpression in Neuronen. Es konnte gezeigt werden, dass die beiden CtBP1-Pools miteinander in Kontakt stehen und Bsn sowie Pclo über direkte Interaktionen mit CtBP1 dieses an der Präsynapse verankern. Dies geschieht über die wechselnden NAD + /NADH-Level bei unterschiedlicher synaptischen Aktivität, welche dadurch an den Zellkern vermittelt wird und somit in die Genexpression eingreifen kann (Ivanova et al. 2015). Weiterhin interagiert Bsn über die SH3I-Domäne des RIM-BPs mit einem Subtyp der VGCC (Ca v 2.1) und rekrutiert diesen in die Nähe des SV um eine suffiziente Kopplung des Calcium-Einstroms und der NT-Ausschüttung zu gewährleisten (Davydova et al. 2014) RIM-BP RIM-BP sind große Multidomänen Proteine, die in Säugetieren von drei Genen codiert werden (RBP1-RBP3). RBP1 und RBP2 sind ausschließlich im Gehirn in den Synapsen zu finden und werden nicht in der Peripherie exprimiert, wohingegen RBP3 extrakraniell exprimiert wird. Als Interaktionsdomänen sind eine zentral gelegene und zwei C-terminale SH3-Domäne zu nennen, die ihnen u. a. Interaktionen mit RIM und mit der α1-untereinheit von VGCC ermöglichen. Sie können N-, P/Q-, aber auch L- VGCC binden. (s. Abb. 3) (Wang et al. 2000, Mittelstaedt et al. 2007). Die letztgenannte Gruppe der Kanäle sind, im Gegensatz zu den ersten beiden, postsynaptisch vorzufinden. Es konnte gezeigt werden, dass RIM-BP an der Kopplung von RIM und den VGCC maßgeblich beteiligt ist (Hibino et al. 2002, Kaeser et al. 2011). In neueren Publikationen konnte gezeigt werden, dass RIM-BP2 eine wichtige Rolle für die Colokalisierung von VGCC der Klasse Ca v 2.1 mit Bsn spielt und somit 12

17 der Verlust von RIM-BP2 zu einer verminderten NT-Ausschüttungswahrscheinlichkeit führt (Grauel et al. 2016). Eine andere Publikation konnte zeigen, dass RIM und RIM-BP überlappende Funktionsbereiche aufweisen, insbesondere in Bezug auf die Rekrutierung von VGCC, NT-Ausschüttung und das Vorbereiten von SV. Zusätzlich wird durch eine Deletion von RIM und RIM-BP die postsynaptische Funktion behindert (Acuna et al. 2016). 1.4 VGCC Präsynaptischer Calcium Einstrom VGCC spielen eine große Rolle in der Umwandlung von Spannungsänderungen an Plasmamembranen in einen Ca 2+ -Ionen-Einstrom, der dann, je nach Zelle und Umgebung, viele physiologische Antworten erzeugen kann. Das einströmende Calcium fungiert als second messenger. Es gibt 3 verschiedene Familien von Calcium-Kanälen, die insgesamt 10 Untergruppen ausmachen. Die einzelnen Untergruppen unterscheiden sich in der α1-untereinheit (s Abb. 4), die den eigentlichen Kanal für die Ca 2+ -Ionen ausmacht. Diese unterschiedlichen Einheiten entscheiden maßgeblich über die Fähigkeiten und Kinetik der verschiedenen Kanäle. Die Mitglieder der Familie der Ca v 1 (Ca v 1.1- Ca v 1.4), welche alle als L-Typ bezeichnet werden, liegen postsynaptisch und sind so z.b. für die Sekretion von Drüsen, Regulierung von Genexpression und Kontraktion von bestimmten Muskelzellen, wie die des Herzens, zuständig sowie für die Signaltransduktion beim Sehen. Die Ca v 2-Familie gliedert sich in Ca v 2.1 (N-Typ), Ca v 2.2 (P/Q-Typ) und Ca v 2.3 (R-Typ). Sie sind allesamt für die synaptische Übertragung zuständig. Dieser Abschnitt wird sich insbesondere mit den P/Q- und N- Typ VGCC beschäftigen. Die Ca v 3-Famile gliedert sich in 3 Untergruppen (alle als T- Typ bezeichnet) und kommen ebenfalls in Herzmuskelzellen und z.b. im Thalamus vor. Ihnen fällt dort die Aufgabe als Schrittmacher und für repetitive Erregung zu (Übersichtsartikel: (Catterall 2011). 13

18 Abbildung 4: Schematische Darstellung eines VGCC Hier wird ein Calcium-Kanal gezeigt. In hellgrün ist die α1-untereinheit dargestellt, die bei den oben genannten Untergruppen der Kanäle unterschiedlich ist und ihnen somit unterschiedliche Fähigkeiten, bezüglich Kinetik des Calcium-Einstroms und benötigte Spannungsunterschiede. Zusätzlich sind hier einige mögliche Reaktionen der Zellen auf das Öffnen der Calciumkanäle und dem damit verbundenen Ca 2+ Einstrom gezeigt (Catterall 2011). Der Aufbau von Calcium-Kanälen ist, insbesondere im Gehirn, Teil wissenschaftlicher Diskussionen. Die Existenz bzw. physiologische Relevanz der γ-untereinheit ist noch nicht abschließend geklärt. Immunopräzipitation von N- und P/Q-Kanälen konnten in den frühen 90er Jahren keine γ-untereinheit ausfindig machen, wohingegen Letts et al. (1998) die Existenz einer neuen γ-untereinheit nachweisen konnten. Diese neuartigen Untereinheiten (transmembrane AMPA receptor modulators (TARPs)) modulieren die Spannungsbahängigkeit von Ca v 2.1 in nicht-neuronalen Zellen. Allerdings sind sie die Hauptmodulatoren von Glutamat-Rezeptoren in der Postsynapse. Daher ist es nicht abschließen geklärt ob sie auch in der Präsynapse vorkommen und wenn doch, welche physiologische Rolle sie dort spielen (Übersichtsartikel: (Catterall 2011). Die porenformende Untereinheit (α1) besteht aus 6 transmembranen α-helices (s1-s6) und einem membranassoziierten Abschnitt zwischen S5 und S6. Der S4-Abschnitt (s. 14

19 gelbe Markierung in Abbildung 5) ist der Spannungssensor, der die entsprechende Konformationsänderung initiiert, um Calcium-Ionen den Durchtritt ins Zellinnere zu gewähren. Die S5, S6 und membranassoziierter Anteil machen das Poreninnere aus und besitzen 2 Glutamat-Reste, welche den Kanal nur für Calcium-Ionen durchgängig machen (Heinemann et al. 1992). Abbildung 5: Schematische Darstellung der Untereinheiten und Interaktionspartner von VGCC Man sieht die α1-, α2-, β- und γ-untereinheiten eines VGCC. Die α1-untereinheit besteht aus 4 Domänen, die jeweils aus 6 transmembranen α-helices aufgebaut sind, mit jeweils einem herausragenden membranassoziierten Abschnitt. In Gelb markiert sind die S4-Abschnitte, die einen Spannungs-Sensor darstellen. In Orange dargestellt, ist die Synprint-Stelle an der SNARE interagieren kann. Modifizierte Form aus (Catterall 2011). Der intrazelluläre Abschnitt zwischen Domäne II und III enthält eine Synprint-Sequenz (synaptic protein interaction). Diese ist eine Interaktionsstelle mit dem SNARE- Komplex, sowie mit Stg1 (s. Abb. 5). Es konnte gezeigt werden, dass diese Bindung auch die Genexpression moduliert. In Experimenten wurde Syntaxin mit Ca v 2.1 und Ca v 2.2 coexprimiert und eine Reduktion der Calciumkanal-Expression, sowie eine Erhöhung der benötigten Spannung beobachtet. Diese Effekte konnten verhindert werden, wenn anstelle von Syntaxin Snap-25 und Stg1 exprimiert wurden (Bezprozvanny et al. 1995, Wiser et al. 1996, Wiser et al. 1997). 15

20 1.5 Positional Priming von VGCC in der Präsynapse Wie bereits angesprochen, ist es von äußerster Wichtigkeit die VGCC der Präsynapse in unmittelbarer Nähe zu dem SV, dem dort verankerten Calcium-Sensor und dem assoziierten Exozytose-Apparat zu halten, um eine schnelle und zuverlässige Ausschüttung der NT zu erreichen. Um die einströmenden Ionen adäquat binden zu können und somit eine Fusion des SV mit der Plasmamembran der AZ zu erreichen, muss das Calciumsensorprotein, Stg1, in einem bestimmten Radius liegen. Der Raum zwischen dem Calciumkanal und dem Calciumsensor, in der die Calcium-Konzentration hoch genug ist um den Sensor zu aktivieren, wird Domäne genannt. Man geht davon aus, dass sich sogenannte Nanodomänen von Ca 2+ -Ionen um den Calcium-Kanal bilden (in Abbildung 7 durch die blaue Schattierung dargestellt). Dieser Bereich stellt die abnehmende Konzentration der Ionen mit zunehmendem Diffusionsweg dar, der bei Synapsen des Hippocampus ca nm beträgt. Dies entspricht nach einer abschätzenden Formel eine Ca 2+ -Ionen Konzentration von ca. 100µM (Smith et al. 1988). Generell spricht man von einer Nanodomäne, wenn der Abstand zwischen Calciumkanal und Calciumsensor <100nm beträgt. Darüberhinausgehende Strecken werden als Mikrodomäne bezeichnet (Eggermann et al. 2012, Wang et al. 2014). Um diese extreme Nähe zwischen dem Calcium-Kanal und dem SV zu erzeugen, ist die Interaktion verschiedener Proteine, wie z.b. RIMs, RIM-BP, Bsn und Stg1, erforderlich. Neuere Studien haben gezeigt, dass die PDZ-Domäne der RIM-Proteine eine direkte Verbindung mit dem C-Terminal der N- und P/Q-Kanäle eingeht (Kaeser et al. 2011). Weiterhin interagiert RIM indirekt mit den Calcium-Kanälen über das RIM-BP, welches seinerseits direkt mit den N- und P/Q-Kanälen interagiert (Wang et al. 2000, Hibino et al. 2002). Kaeser und Kollegen konnten in Experimenten mit Mauskulturen, denen die PDZ-Domänen enthaltenden RIM-Isoformen fehlen, eine Desynchronisation und Verlangsamung der NT Ausschüttung beobachten. Allerdings veränderten sich die jeweiligen Anteile der N- und P/Q-Kanäle am gesamten Calcium-Einstrom nicht (Han et al. 2011). Nichtsdestotrotz, können durch das Fehlen der PDZ-Calciumkanal- Interaktion die Calciumkanäle vermindert zur AZ rekrutiert werden und somit konnte eine 50%ige Reduktion des Ca 2+ -Ionen Einstroms gemessen werden (s. Abbildung 6) (Kaeser et al. 2011). 16

21 Abbildung 6: Verminderung des Calcium-Einstroms bei Fehlen der PDZ-Domäne in RIM: Hier wird die Erhöhung der Fluoreszenz eines Calcium-sensitiven Farbstoffes in der Präsynapse dargestellt. Die blaue Linie stellt die Kontroll-Kondition dar. In Schwarz sieht man die Fluoreszenzänderung bei einer Mauskultur mit fehlenden RIM1 und RIM2 (cdko). Sie ist um ca. 50% vermindert. In Grün dargestellt ist die Fluoreszenz bei einem Rettungsexperiment bei dem die cdko- Mauskultur genutzt wurde, jedoch das komplette RIM ohne die PDZ-Domäne nachträglich über einen Vektor hinzugefügt wurde. In Braun das gleiche Konstrukt jedoch mit vorhandener PDZ-Domäne. Leicht modifiziert aus (Kaeser et al. 2011) Bsn spielt, wie oben bereits angesprochen, ebenfalls eine wichtige Rolle in der Rekrutierung von VGCC zur AZ. Das große Gerüstprotein interagiert über die SH3I- Domäne der RIM-BP mit der PXXP-Domäne der P/Q-Calciumkanäle und rekrutiert diese spezifisch, ohne die Rekrutierung und Positionierung der N-Kanäle zu beeinflussen (s. Abb. 7). In Bsn-KO-Kulturen konnte gezeigt werden, dass im Gegensatz zu den Kontroll-Kulturen, die Level an RIM-BP und P/Q-Kanälen in der AZ signifikant verringert waren, wohingegen die N-Kanäle unverändert blieben. Ebenso konnte eine starke Interaktion zwischen Bsn, RIM-BP und P/Q-Kanälen in Co- Immunopräzipitationen gezeigt werden. Weiterhin zeigen die Ergebnisse, dass bei einem Mangel an Bsn und somit verbundenem Mangel an Ca v 2.1 vermehrt N-Kanäle zum Ausgleich herangezogen werden (Davydova et al. 2014). 17

22 Abbildung 7: Schematische Darstellung der interagierenden Proteine der CAZ für das Positional Priming Hier wird die indirekte Interaktion von Bsn mit dem P/Q-Calciumkanal über das RIM-BP dargestellt. Ebenso wird die direkte sowie indirekte Interaktion von RIM1/2 mit dem P/Q-Kanal dargestellt (RIM1/2 interagiert, wie im Text beschrieben, mit dem N-Kanal in gleicher Weise). Zusätzlich ist noch die Nanodomäne des Calciums um den Kanal als blaue Markierung dargestellt und der Calciumsensor des Synaptischen Vesikels, Stg1 (Davydova et al. 2014). 18

23 1.6 Zielsetzung der Arbeit Die großen Gerüstproteine Bsn und RIM1/2 spielen eine essenzielle Rolle in den komplexen Mechanismen und Abläufen in der Präsynapse. Diese reichen von strukturgebenden Eigenschaften, über Interaktionen mit dem Vesikeln und den Vesikelpools bis zum beschriebenen positional priming. Zusätzlich zeigen neueste Publikationen, dass RIM1/2 sowohl P/Q- als auch N-Typ-VGCC zur AZ rekrutieren kann. Vorherige Arbeiten aus unserem Labor konnten dagegen zeigen, dass Bsn spezifisch die P/Q-Subpopulationen rekrutieren kann. Es liegt auf der Hand, dass diese Fähigkeit einen großen Einfluss auf die Aktivität und Plastizität der Synapse haben muss. Die Rolle von RIM1/2, aber insbesondere von Bsn, mit besonderem Hinblick auf deren möglicher Interaktion bei der Rekrutierung der Kanäle ist noch weitestgehend ungeklärt. Daher widmet sich diese Arbeit der weiteren Investigation folgender Punkte: 1.) Welchen Einfluss hat Bassoon im Vergleich zu RIMs über die Rekrutierung der spannungsabhängigen Calciumkanäle auf den Calciumeinstrom in die hippocampale Präsynapse? 2.) Lassen sich Rückschlüsse auf Interaktionen der oben genannten Proteine bezüglich ihrer Einflüsse auf den Calciumeinstrom ziehen? 19

24 2. Material und Methoden 2.1 Materialen Molekularbiologische Reagenzien und Kits Reagenz Hersteller Oligonukleotide (Primer) Invitrogen Desoxynucelosid Triphosphate Set Thermo Scientific (dntps) Phusion High-Fidelity DNA Thermo Scientific Polymerase Restriktionsenzyme Thermo Scientific NucleoBond Xtra Maxi Plus Kit Macherey-Nagel NuceloSpin Gel and PCR Clean Up Kit Macherey-Nagel Cold Fusion Cloning Kit System Biosciences Smart Ladder DNA Eurogentec Tabelle 1: Molekularbiologische Reagenzien und verwendete Kits Pharmakologische Reagenzien Reagenz Wirkmechanismus Konzentration Hersteller 7-nitro-2,3-dioxo-1,4- Kompetetiver 10 µm Tocris dihydroquinoxalin-6- carbonitril (CNQX) AMPA-Rezeptor Antagonist 2-Amino-5- Phosphonopentaoit Säure (APV) Kompetetiver NMDA-Rezeptor Antagonist 50 µm Tocris Ionomycin Ca 2+ Ionophor 5 µm Sigma Aldrich Tabelle 2: Pharmakologische Reagenzien 20

25 2.1.3 Kulturmedien und Reagenzien für die Zellkultur Reagenz Zusammensetzung (Hersteller) HBSS -/- Hank s balanced salt solution, Ca 2+ - und Mg 2+ frei (Gibco) HBSS +/+ Hank s balanced salt solution, Ca 2+ - und Mg 2+ enthalten (Gibco) Poly-L-Lysin 100mg/l Poly-L-Lysin (Sigma) in 100 mm Borsäure (ph 8,4) Trypsin 1 % 10 x Trypsin/EDTA (Invitrogen) in HBSS -/- Glia Medium Dulbecco's Modified Eagle's Medium (DMEM) (Gibco) versetzt mit 1% Penicillin (Gibco), 1% Streptomycin (Gibco), 10% fetales Kälberserum Neurobasal A komplett Neurobasal A medium (Gibco), 2% B27 (Gibco), 4 mm Glutamax (Gibco), 1 mm Natriumpyruvat (Gibco), 1% Penicillin, 1% Streptomycin (Gibco) Neurobasal komplett Neurobasal medium (Gibco), 2% B27 (Gibco), 4 mm Glutamax (Gibco), 1 mm Natriumpyruvat (Gibco), 1% Penicillin, 1% Streptomycin (Gibco) Ausplattierungsmedium DMEM (Gibco) mit 1% Glutamin, 1% Penicillin, 1% Streptomycin (Gibco) Paraffin Paraplast embedding Medium (Fisher) Cytosin β-d- 1.5M Cytosin β-d-arabinofuranosid (Sigma-Aldrich) Arabinofuranosid (Ara C) DNAse DNAse (Roche) Tabelle 3: Medien für die Zellkultur Lösungen zur Immunohistochemie- bzw. live-imaging Experimente Reagenz Zusammensetzung PBS 2,7mM Kcl, 1,5mM KH 2 PO 4, 8mM Na 2 HPO 4 gelöst in H 2 0 bei ph 7,4 Bildgebungspuffer 119 mm NaCl, 2,5 mm KCl, 25 mm Hepes (ph 7,4), 30 mm Glucose, 2 mm MgCl 2, 2 mm CaCl 2 21

26 Blockierungs- und 10% Kälberserum, 0,1% Glycin, 0,3% Triton X-100 in Permeabilisierungspuffer PBS Fixationslösung 4% Paraformaldehyd-, 4% Sucrose- und PBS-Lösung Tabelle 4: Lösungen für die bildgebenden Experimente Stammlösungen Reagenz Zusammensetzung 10 x PBS 1,369 M NaCl, 80,6 mm Na 2 PO 4, 26,8 mm KCl, 14,7 mm K 2 HPO 4, ph 6,82 à Verdünnung auf 1 x PBS resultiert in ph 7,4 50 x TAE 2 M Tris-base, 1 M Essigsäure, 0,05 M EDTA 6 x Agarose- Gelauftragungspuffer 30% (v/v) Glycerin, 50 mm EDTA, 0,25% Bromphenolblau, 0,25% Xylen Cyanol Tabelle 5: verwendete Stammlösungen Bakterienkulturen und Kulturmedien für die Bakterienanzucht Es wurden Bakterien des Stammes Escherichia Coli XL10 Gold (Stratagen) für die Produktion von Plasmid-DNA verwendet. Die Medien und Lösungen, die für die Transformation verwendet wurden, sind in der folgenden Tabelle dargestellt. Reagenz Zusammensetzung SOC-Medium 20 g/l Pepton 140 (Gibco), 5g/l Hefeextrakt (Gibco), 10 mm NaCl, 2,5 mm KCl, 10 mm MgCl 2, 10 mm MgSO 4, 20 mm Glucose LB-Medium 20 g LB Brühenbasis (Intvitrogen) auf 1000 ml H 2 O LB-Agar 15 g Select Agar (Invitrogen) auf 1000 ml LB-Medium Ampicillin-Lösung 50 mg/ml Ampicillin-Natriumsalz in H2O, 2 ml auf 1 l LB- Medium, finale Konzentration: 100 µg/ml Kanamycin-Lösung 25 mg/ml Kanamycinsulfat in H2O, 1 ml auf 1 l LB-Medium, finale Konzentration: 25 µg/ml Tabelle 6: Medien und Reagenzien für die Bakterienkulturen 22

27 2.1.7 Zelllinien Zelllinie HEK293T Tabelle 7: Zelllinie für die Virusproduktion Hersteller ATTC Antikörper Folgende primäre Antikörper kamen bei der immunhistochemischen Färbung von primären hippocampalen Mausneuronen zum Einsatz: Antikörper Antigen Spezie Verdünnung Hersteller Katalognr. Bsn Sap7f ms 1:1000 Enzo Life Science ADI-VAM- PS003-D Synapsin 1/2 gp 1:1000 SySy RIM 1/2 ZnF-Domäne rb 1:2000 SySy RIM1 PDZ- rb 1:1000 SySy Domäne VGlut 1 rb 1:1000 SySy VGat cytoplasmatische gp 1:1000 SySy Domäne Cav 2.1 P/Q-VGCC rb 1:1000 SySy Cav 2.2 N-VGCC rb 1:1000 SySy GluA, Oyster 550 markiert AMPA- Rezeptor ms 1:500 SySy C3 Tabelle 8: Verwendete primäre Antikörper für die fixierten Mausneuronen. Abkürzungen: ms: Mouse (Maus), gp: Guinea Pig (Meerschweinchen), rb: rabbit (Hase), SySy= SynapticSystems (Göttingen), Enzo= Enzo LifeSciences Die sekundären Antikörper mit den fluoreszierenden Farbstoffen Alexa Fluor 488 (1:1000), Cy3 (1:1000) und Cy5 (1:1000) stammen aus Eseln und wurden von Jackson ImmunoResearch erworben. 23

28 2.2 Methoden Präparation der Deckgläschen Die gesamte Prozedur der Präparation der primären hippocampalen Mausneuronen wurde in angepasster Form nach der Methodik, welche von Kaech et al. (2006) publiziert wurde, durchgeführt. Daher werden diese Techniken hier nur kurz dargestellt. Deckgläschen mit einem Durchmesser von 18 mm (Menzel-Gläser, Braunschweig, Germany) wurden in 70% HNO 3 -Lösung 48 Stunden auf einem Schüttler inkubiert. Danach wurden die Deckgläschen zuerst mehrmals mit sterilem Wasser gewaschen und letztendlich zwei Mal bis zum Sieden erhitzt. Die Deckgläschen wurden luftgetrocknet und im folgenden Schritt bei 200 C 24 h sterilisiert. Je vier Deckgläschen wurden in eine Petrischale gegeben und mit 3 Paraffin-Punkten versehen, damit die Neuronen nicht im direkten Kontakt zur Glia standen, da in diesem Fall kein Mediumaustausch und somit auch keine Nährstoffzirkulation stattfinden würde. Zur verbesserten Adhäsion der Neuronen auf den Gläschen wurden je 100 µl -L-Lysin Lösung (Sigma) (Tab. 3) pro Glas aufgetragen und 12 h im Brutschrank inkubiert. Diese wurde am nächsten Tag mit einer Vakuumpumpe abgesaugt und die Deckgläschen mit Wasser übergossen. Sie wurden dann bis zur Ausplattierung der Neuronen im Inkubator belassen Erstellen der Glia-Cokultur Unter einer Sicherheitswerkbank mit laminarem Luftfluss wurden Mäusejungen (0-1 Tage post partum) nach geltenden Tierschutzbestimmungen dekapitiert, die Gehirne entnommen und in eine Petrischale mit kalter HBSS -/- (Tab. 3) gelegt. Unter einem Mikroskop wurden die beiden Hemisphären vom Rest des Gehirns getrennt. Die Meningen wurden darauffolgend entfernt. Die Hemisphären wurden zerkleinert in ein 50 ml konisches Reaktionsgefäß gegeben und mit 12 ml HBSS -/-, sowie 0,0025% Trypsin und 1% DNase versetzt (Tab. 3). Nach 15 min Inkubationszeit bei 37 C wurde die Lösung in ein neues 50 ml Reaktionsgefäß gegeben und 15 ml Glia Medium (Tab. 3) hinzugefügt. Um ein Zellpellet zu erhalten wurde die Lösung bei 120g 5-10 min zentrifugiert und der Überstand entsorgt. Das Pellet wurde in ml Glia Medium gelöst, dieses auf 75 cm 2 -Flaschen aufgeteilt und auf ein finales Volumen von ml durch Hinzufügen von weiterem Glia Medium gebracht. Die Flaschen wurden über 24

29 Nacht in einem Zellkulturinkubator (37 C, Luftfeuchtigkeit 95% und 5% CO 2 ) verwahrt. Um hoch-qualitative Gliakulturen zu erreichen, wurde das Medium in den Flaschen am nächsten Tag aspiriert und durch frisches Glia Medium ersetzt. Dieses Prozedere wurde alle 2-3 Tage wiederholt. Nachdem die Kultur konfluent war, wurde das Medium aspiriert, folgend mit 2 ml Trypsin bei 37 C für zwei Minuten inkubiert und durch schütteln die Zellen vom Boden der Flasche abgelöst. Die Reaktion des Trypsins wurde durch das Hinzugeben von 5 ml Glia Medium unterbrochen. Zum Konzentrieren der Zellen wurden die Lösungen aus den Flaschen in ein 50 ml Gefäß gegeben und 7 min bei 120g zentrifugiert. Das Pellet wurde in Glia Medium resuspendiert und je 5 ml auf 60 mm durchmessende Petrischalen gegeben. Die Schalen wurden dann bis zum Tag der Präparation der Mäusehippocampi (ca. 5 Tage) inkubiert um eine ausreichende Konfluenz (40% - 70%) der Zellen zu erreichen Präparation der primären Maus Hippocampus Kulturen Die Mäusejungengehirne wurden am 0 bzw. spätestens 1 Tag post partum, wie im vorigen Absatz beschrieben, entnommen, die Hippocampi isoliert und von den Meningen befreit (Kaech et al. 2006, Frischknecht et al. 2008). Die Hippocampi wurden in ein Reaktionsgefäß gegeben, das 450 µl HBSS -/- enthielt und mit zusätzlichen 0,025% Trypsin für 15 min lysiert. Nach der Inkubationszeit wurden die 500 µl Lösung aspiriert und durch 1 ml HBSS -/- ersetzt. Nach diesem Waschvorgang wurde das HBSS -/- durch 1 ml Ausplattierungsmedium ersetzt. Zur mechanischen Zerkleinerung der Hippocampi wurden die Öffnungen von Glaspipetten per Hand durch die Bunsenbrennerflamme auf 2 unterschiedliche Größen zurecht geschmolzen. In dem Reaktionsgefäß wurde nun durch wiederholtes aspirieren und entlassen der Hippocampi mit umgebenden Ausplattierungsmedium, die Gehirnanteile mechanisch zerkleinert. Nachdem mit bloßem Auge keine Anteile mehr zu sehen waren, wurden 10 µl der Lösung mit 10 µl Phenolblau vermischt und in einer Neubauer-Zählkammer die Zelldichte bestimmt. Die jeweiligen Präparate wurden auf eine Zelldichte von Zellen pro Deckgläschen mit Ausplattierungsmedium verdünnt und 100 µl auf die wie oben beschriebenen Deckgläschen aufgebracht. Um eine Zelladhäsion zu ermöglichen wurden die Deckgläschen 1 Stunde bei 37 C inkubiert. In dieser Zeit wurde das Glia Medium aus den Gliakulturen aspiriert und durch 5 ml Neurobasal A komplett Medium ersetzt. Nach der Inkubationszeit wurden je 4 Deckgläschen umgedreht in die 25

30 jeweiligen Petrischalen gegeben und inkubiert. Durch das Umdrehen befand sich nun auf dem Boden der Petrischale die Glia Kultur und durch die 3 Paraffin Punkte getrennt die Seite des Deckgläschens mit der Hippocampuskultur. Um das ungehemmte Gliawachstum zu verhindern wurde am 1 Tag in vitro (DIV) und am 3 DIV AraC jeweils 0,6 µm zum Medium hinzugegeben (finale Konzentration 1,2 µm AraC) (Tab. 3). Die Kulturen wurden dann je nach Prozedere entweder bis sie mindestens 18 DIV erreicht hatten inkubiert oder am 3 DIV viral infiziert. Einmal wöchentlich wurde das Medium gewechselt. Abbildung 8 Eine Glia und Neuronen Ko-Kultur Veranschaulichung der Einbringung der Deckgläschen in die Petrischale mit der Gliakultur. Modifiziert nach Kaech et al. (2006) Virusproduktion/Infektion Die Zellkulturen wurden mit einem modifizierten Calcium-Sensor (SyGCaMP5G) (s. Abb. 13) (Dreosti et al. 2009) infiziert. Zur Erzeugung der Lentiviren wurden HEK293T Zellen (Tab. 7) mithilfe der Calciumphosphat Methode in einem SII-Labor mit drei Vektoren transfiziert: ein Flap-Ubiquitin-Promoter-GFP-WRE (in Zukunft als FUGW) mit dem Zielgen (hier entweder SyGCamP5G, Cre oder ΔCre), ein Verpackungsplasmid pspax2 sowie ein Hüllplasmid pvsvg (Lois et al. 2002). Die HEK293T Zellen wurden inkubiert bis sie eine Konfluenz von ca. 80% hatten. 20 µg DNA pro Flasche der Vektoren FUGW, ppax2, pvsvg wurden im molaren Verhältnis von 4:2:1 in 500 µl CaCl 2 gemischt. Nachfolgend wurden 500 µl einer Lösung, bestehend aus 140mM NaCl, 50 mm HEPES und 1,5 mm Na2PO4, hinzugefügt und 1 min inkubiert. Diese Mixtur wurde zu den HEK-Zellen gegeben und nach 6-8 h die Lösung aspiriert und durch Neurobasal A komplett (Tab. 3) ersetzt. Nach 48 h wurde das Medium in 50 ml Reaktionsgefäßen gesammelt und bei 2000g für 10 min zentrifugiert um ungewollte HEK Zellen zu entfernen. Der Überstand, der die 26

31 Lentiviren zur Infektion enthält, wurde in 2 ml Eppendorf Tubes aliquotiert und bei - 80 C bis zur Verwendung gelagert. Zur Infektion der Hippocampuskulturen wurden jeweils 75 µl der entsprechenden vektorenthaltenden Lentiviruslösung (FUGW-Cre, FUGW-ΔCre, FUGW-SyGCaMP5) (Kaeser et al. 2011) (Zhao et al. 2011) im SII-Labor auf die Zellkulturen (3 DIV) aufgebracht, die dafür aus dem Medium genommen und in eine Petrischale verbracht wurden. Diese wurden dann 12 h im Inkubator belassen und darauffolgend wieder in die entsprechenden Nährmedien zurückgebracht. Die Zellkulturen wurden dann bis mindestens 18 DIV inkubiert Live Mikroskopie Die infizierten Hippocampusneuronen wurden ab dem 18 DIV zur Live Mikroskopie herangezogen. Dafür wurden die Deckgläschen aus dem Nährmedium genommen und mit 500 ml Bildgebungspuffer (Tab. 4) in die Ganzfeldstimulationskammer (RC-49MFSH, Warner Instruments) verbracht, die zwei Titandrähte in 10 mm Abstand zueinander zur Applikation von elektrischer Stimuli besaß. Um die physiologisch vorkommende neuronale Spontanaktivität zu unterbinden und um eine überschießende Antwort auf den Stimulus zu verhindern, wurde der Puffer mit 10 µm CNQX und 50 µm APV (Sigma) versetzt (Dreosti et al. 2009). Das invertierte Mikroskop (Zeiss Axio Observer A1) war mit einer EMCCD Kamera (Evolve Delta, Photometrics) ausgestattet. Diese wurde mit VisiView bedient (Visitron Systems GmbH). Bei dem verwendeten Objektiv handelte es sich um ein Plan- Apochromat 63x/1.4 Ölimmersionsobjektiv (Zeiss). Die Lichtquelle war ein Lambda- DG4 (SutterInstruments) mit einem EGFP Filter Setup (ET470/40x, ET525/50m, T495LPXR). Die elektrischen Stimuli wurde von einem Master-8 Stimulator (A.M.P.I., Jerusalem) mit einem nachgeschalteten Isolator A385 von WPI (World Precision Instruments) erzeugt. Mit diesen Maschinen wurden Stimuli von 50mA für 1ms generiert, die in einer Serie von 5, 10 und 20 abgegeben wurden. Zwischen den einzelnen Stimulationsserien lagen 5 s. Die Aufnahmen wurden mit 20Hz bzw. 50Hz akquiriert. Die Änderung der Intensität der Fluoreszenz erlaubt Rückschlüsse auf die Menge des einströmenden Calciums. Es wurden von 2-3 Regionen pro Deckgläschen Bilder akquiriert. Zeitlich lagen zwischen den einzelnen Regionen ca. 3 Minuten, die zur Regenration der Neuronen dienten. Nach einem abgeschlossenen Experiment wurde 27

32 5 µm Ionomycin (Sigma Aldrich) appliziert. Ionomycin wirkt als Ionophor, es kann also Ionen, in diesem Fall Ca 2+, über die Plasmamembran in das Neuron einbringen und führt somit zu einer Sättigung des Calciumsensors. Schlussendlich wurden die Bilder mit ImageJ (NHI, analysiert Analyse der live Bilder Die erhaltenen Bildsequenzen wurden in das Programm ImageJ geladen und analysiert. Um reagierende Synapsen besser darstellen zu können wurden die fünf Bilder vor der Stimulation gemittelt, ebenso wie fünf Bilder während der Stimulation. Diese erhaltenen Bilder wurden mithilfe der Software voneinander subtrahiert. Die nun leicht zu identifizierenden Synapsen wurden von einem 3x3 Pixel ROI (Region of Interest) und dem Befehl in ImageJ Find Maxima umrahmt. Der mittlere Grauwert von ca. 100 dieser ROIs wurde daraufhin über die gesamte Zeit der Bildserie ermittelt und die Werte in Excel (Microsoft) übertragen. Dort wurde dann der ΔF/F 0 -Wert errechnet, wobei F 0 zehn Bildern vor der ersten Stimulation entspricht (Grundfluoreszenz) (Zhao et al. 2011). Das Signal-zu-Rausch-Verhältnis wurde durch den maximalen Grauwert innerhalb von 10 Bildern nach Stimulation in Verhältnis zu der Standardabweichung von F 0 des einzelnen ROIs errechnet. Nur ROIs mit einem Verhältnis von >2 wurden letztendlich für die Analyse herangezogen (Dreosti et al. 2009) Immunhistochemische Färbungen und Mikroskopie Die Zellkulturen wurden mit Fixationslösung (Tab. 4) bei Raumtemperatur (RT) für 5 min fixiert. Um unspezifische Bindungen der Antikörper zu verhindern wurden die Deckgläschen mit 150 µl Blockierungslösung (Tab. 4) für 30 min bei RT inkubiert. Darauffolgend wurden die entsprechenden verdünnten primären Antikörperlösungen über Nacht bei 4 C inkubiert. Die Verdünnung wurde in PBS vorgenommen, welches 3% FKS enthielt (Lazarevic et al. 2011). Am Morgen wurden die überschüssigen Antikörper durch dreimaliges 15 minütiges Waschen mit PBS entfernt. Anschließend wurden die sekundären Antikörper, ebenfalls in 3% FKS verdünnt und 1 h bei RT auf den Deckgläschen inkubiert. Es folgten erneut drei Waschvorgänge. Die Deckgläschen 28

33 wurden anschließend mithilfe von Moviol (Calbiochem) auf Objektträger aufgebracht und mikroskopiert. Die Bilder der Neuronen der verschiedenen Mauskulturen wurden am Zeiss Axio Imager A2 Mikroskop (Zeiss) aufgenommen, das mit einer Cool Snap EZ Kamera (Photometrics) ausgestattet war. Zur Steuerung wurde die VisiView Software verwendet und zur Analyse wurde ImageJ (NIH), sowie die OpenView Software herangezogen (Tsuriel et al. 2006). Es wurden ROIs von 11x11 Pixeln verwendet. Sie wurden semi-automatisch in Regionen mit hoher Intensität der verwendeten Antikörper, Synapsin, VGlut1 und VGat gesetzt und die Fluoreszenzwerte ausgewertet Transformation Hitzeschock-kompetenter Escherichia Coli XL10 Gold Um DNA in ausreichend hoher Konzentration zur Produktion von Viren zu haben wurden Bakterien transformiert, inkubiert und darauffolgend die DNA mithilfe des NucleoBond Kit Xtra Maxi EF Kits (Machery Nagel GmbH & CO KG, Düren, Germany), aufgereinigt. Zur Transformation wurden Hitzeschock-kompetente Escherichia Coli XL10 Gold benutzt. Die bei -80 C gelagerten Bakterien wurden 10 min auf Eis aufgetaut. In die Bakteriensuspension (ca.100 µl) wurde 1 µg des gewünschten Plasmids pipettiert und 10 min auf Eis inkubiert. Nachfolgend wurde die Suspension 45 s bei 42 C im Wasserbad einem sogenannten Hitzeschock unterzogen und sofort wieder 2 min auf Eis abgekühlt. Die Suspension wurde dann in 1 ml auf 37 C vorgewärmtes SOC-Medium gegeben und bei 37 C und 800rpm für 1 h inkubiert. Nach der Inkubationszeit wurden die Bakterien durch eine Zentrifugation von 2 min bei 6000 rpm am Boden des Reaktionsgefäßes pelletiert und 800 µl des Überstandes verworfen. Mit den restlichen 200 µl wurden die Bakterien resuspendiert und eine vorgewärmte LB Agar-Platte, die die mit den Plasmiden korrelierenden Antibiotika enthielten, mit 100 µl beimpft. Die Agarplatte wurde über Nacht bei 37 C inkubiert Plasmidaufreinigung zur Gewinnung großer Menge DNA mithilfe des NucleoBond Kits Die Plasmidaufreinigung wurde mithilfe des NucleoBond Xtra Maxi EF Kits durchgeführt. Das Kit enthält verschiedene Puffer (Tab. 1) und die Aufreinigungssäulen mit Filter und Membran. 29

34 Nach der Transformation der Bakterienkultur wurde eine gewachsene Kolonie der Agarplatte in 500 ml LB-Medium (Tab. 6) mit dem entsprechenden Antibiotikum bei 37 C über Nacht inkubiert. Am nächsten Morgen wurde die Bakterienkultur in ein Zentrifugationsgefäß gegeben und die Bakterien bei 6000g 15 min pelletiert. Überstand wurde verworfen, das Pellet mit 24 ml RES-EF Puffer resuspendiert und mit 24 ml LYS-EF Puffer die Bakterien lysiert. Alle Flüssigkeiten wurden miteinander durch leichtes Schütteln vermischt. Die NucleoBond Xtra Maxi Säule wurde mit 35 ml EQU-EF Puffer equilibriert. Mit dem Hinzufügen von 24 ml NEU-EF Puffer wurde die Bakterienlösung neutralisiert und 5 min auf Eis inkubiert. Folgend wurde das gesamte Volumen nach und nach auf die Filtersäule aufgebracht und durch die Schwerkraft geleert. Mit 10 ml FIL-EF Puffer wurde der Filter erstmalig gewaschen und danach entsorgt. Die Membran wurde mit 90 ml ENDO-EF Puffer zum 2. Mal gewaschen und danach ein letztes Mal mit 45 ml WASH-EF Puffer. Zur Gewinnung der DNA aus der Membran wurde 15 ml ELU-EF Puffer in die Säule gegeben und das Filtrat mit einem 50 ml Reaktionsgefäß aufgefangen. 10,5 ml Isopropanol wurden in das Gefäß gegeben und 30 min bei x g und 4 C zentrifugiert um die DNA zu präzipitieren. Der Überstand wurde verworfen, das DNA-Pellet mit 5 ml 70% Ethanol gewaschen. Es folgte eine erneute 10minütige Zentrifugation mit x g und RT. Der Überstand wurde erneut verworfen und so viel Ethanol wie möglich mit einer Pipette entfernt um eine schnelle Lufttrockung des DNA-Pellets zu gewährleisten. Nach erfolgreicher Lufttrocknung wurde das Pellet in ca. 100 µl H 2 O gelöst und die DNA- Konzentration mit dem NanoDrop 2000 (ThermoScientific) gemessen. Hierzu wurde das Gerät zuerst auf das Lösungsmittel equilibriert. Danach wurde 1 µl der DNA- Lösung auf die Messfläche des Geräts aufgetragen, der Messarm geschlossen und von der Maschine Licht durch den DNA-Tropfen geleitet. Die Konzentration wurde dann über die Absorption von Licht mit einer Wellenlänge von 260 nm errechnet (Absorptionsmaximum von DNA) Primerdesign Für Cre-IRES-SyGCamP5G: - Cre-IRES 1) 5 - TCTAGTATTTAAATGATGTCCAATTTACTGACC - 3 (vorwärts Primer) 2) 5 - ATTCACCACGTCCATGGTTGTGGCCATATTATC - 3 (rückwärts Primer) - SyGCaMP5G 3.) 5 - AATATGGCCACAACCATGGACGTGGTGAATCAG - 3 (vorwärts Primer) 4.) 5 - AATTTCTAGAGGATCTCACTTCGCTGTCATCAT - 3 (rückwärts Primer) Der 30

35 Für ΔCre-IRES-SyGCamP5G: - ΔCre 5.) 5 - TCTAGTATTTAAATGATGTCCAATTTACTGACC - 3 (vorwärts Primer) 6.) 5 - AATTAACGGATCCGCCTACTTACGGATTCGCCG - 3 (rückwärts Primer) -IRES 7.) 5 - CGAATCCGTAAGTAGGCGGATCCGTTAATTCCG - 3 (vorwärts Primer) 8.) 5 - ATTCACCACGTCCATGGTTGTGGCCATATTATC - 3 (rückwärts Primer) - SyGCaMP5G 9.) 5 - AATATGGCCACAACCATGGACGTGGTGAATCAG - 3 (vorwärts Primer) 1.) 5 - AATTTCTAGAGGATCTCACTTCGCTGTCATCAT - 3 (rückwärts Primer) Mauslinien Folgende Mausmodelle zum Einsatz: SLICK-Modell: RIM1/2 lox/lox, SLICK-V-Cre positiv (Young et al. 2008) EMX1-Mausmodelle o Bsn 2 lox/lox und RIM1/2 lox/lox mit EMX 1 Cre +/- (dreifach KO) o Bsn 2 lox/lox und RIM1/2 lox/lox mit EMX 1 Cre +/+ (WT) KO durch Infektion mit Lentivirus als Vector o Bsn2 lox/lox (nicht publiziert, TaconaArtemis, Fejtova) o RIM1/2 lox/lox (Kaeser et al. 2011) o Bsn2 lox/lox und RIM1/2 lox/lox (nicht publiziert, in domo) Bei allen hier verwendeten Mauskulturen kommt grundsätzlich dieselbe Strategie um ein Knockout (KO) zu erhalten zum Einsatz, das Cre/loxP-System. Hierbei werden Abschnitte der Ziel-Gene der gewünschten Proteine, die aus der Zellkultur entfernt werden sollen um somit eine KO-Kultur zu erhalten, mit einer lox-sequenz (gefloxt) versehen. Dies ist die Erkennungssequenz für die Cre-Recombinase (Cre - causes recombination ), ein Enzym, welches die Spaltung und Neuverknüpfung von DNA zwischen diesen bestimmten Basenpaaren katalysiert und somit den Abschnitt exzidiert. Für die Exprimierung der Cre-Sequenz wird zusätzlich ein entsprechender Promotor benötigt. 31

36 Der Name des erstgenannten Mausmodells (SLICK) steht für Single-neuron labelling inducible Cre-KO. Bei dieser Form des Cre/loxP-Systems ist ein Verlust durch Tamoxifen induzierbar und gleichzeitig wird das KO-Neuron farbig markiert. Bei den beiden zweitgenannten Mausmodellen sind die Sequenzen der drei Ziel- Proteine gefloxt und die Recombinase wird durch einen EMX1-Promotor exprimiert. Dieser befindet sich nur in exzitatorischen Synapsen des Vorderhirns. Bei den letztgenannten Kulturen handelt es sich um KOs für einerseits nur Bsn, nur RIM1/2 und allen drei Proteinen zusammen. Hierfür wurden die Ziel-Sequenzen ebenfalls gefloxt, allerdings wird das Gen für die Cre-Recombinase nicht in den Organismus eingebracht und somit auch nicht im vornherein exprimiert. Hier wurde, wie im Abschnitt beschrieben, die Sequenz für die Cre-Recombinase nachträglich per lentiviralem Vektor in die Zellkultur eingebracht und somit wurde erst nach der Infektion das KO ausgelöst Statistische Analyse Alle Ergebnisse der quantitativen Analysen wurden mit ± dem Standardfehler (S.E.M.) der jeweiligen analysierten Zellen angegeben. Es wurde das GraphPad Prism Programm für die statistischen Analysen genutzt. Die verwendeten Tests sind unter den jeweiligen Abbildungen angegeben. * entspricht p<0,05, ** entspricht p<0,01 und *** entspricht p<0,

37 3 Ergebnisse 3.1 Grundlagen der verwendeten KO-Modelle Um die Funktionen von Proteinen evaluieren zu können, bedient man sich in der wissenschaftlichen Forschung häufig dem sogenannten KO. Der Phänotyp, der dann von den Tieren oder Zellkulturen präsentiert wird, lässt Rückschlüsse zu, die dann auf die physiologische Funktion des KO-Proteins schließen lassen. In dieser Arbeit soll die Rolle von RIM1/2 und Bsn im Hinblick auf die Rekrutierung von VGCC in die AZ und mögliche Interaktion der beiden beleuchtet werden. Um diese Fragestellung untersuchen zu können, verwendeten wir KO-Modelle der Proteine. Die verwendeten Mauskulturen sind in aufgeführt. Es gibt grundsätzlich einerseits konstitutive und andererseits konditionale KO-Modelle. Eine bereits vorangegangene Publikation konnte zeigen, dass ein konstitutiver KO für RIM1/2 zwar primär lebendige, allerdings nicht überlebensfähige Mäuse hervorbrachte. Sie zeigten eine abnormale Körperhaltung, reagierten nicht auf taktile Stimuli und starben direkt postnatal, wahrscheinlich aufgrund von einer Unfähigkeit zu atmen (Schoch et al. 2006). Eine in unserem Institut durchgeführte Arbeit konnte zeigen, dass ein konstitutiver KO von Bsn in Mäusen zu spontanen epileptischen Anfällen führt an denen 50% in den ersten 6 Monaten versterben (Altrock et al. 2003). Somit entschieden wir uns für eine Herangehensweise per konditionalem KO, die auf dem Cre/loxP-Modell basiert. Hierbei werden sogenannte lox-sequenzen vor und hinter bestimmten Abschnitten von Zielgenen, die für das gewünschte KO-Protein kodieren, eingebracht. Diese eingebrachten Sequenzen können von einem Enzym, der Cre- Recombinase, erkannt werden. Wenn die Recombinase in den Zellkern gelangt, werden die lox-sequenzen detektiert und infolgedessen die dazwischenliegende Sequenz exzidiert. Es entsteht ein funktionelles KO. Die hier zugrundeliegenden Strategien werden in Abbildung 9 gezeigt. 33

38 Abbildung 9: Mechanismus hinter den KO-Modellen A zeigt die KO-Strategie für Bsn. Das Exon 2 wird durch die klassischen Mechanismen per homologer Rekombination mit lox-sequenzen umrahmt. Nach der Rekombination durch Cre entsteht ein Frameshift ab dem untranslatierten Exon 1 und ein vorzeitiges STOP-Codon (Abbildung ist unpubliziert und wurde freundlicherweise von Prof. Fejtova bereitgestellt). B zeigt die KO-Strategie für RIM1. Hierbei wird das Exon 6 nach gleichem Schema von zwei lox-sequenzen umrahmt und nach erfolgreicher Rekombination durch Cre entfernt. Dies führt zu einem KO der RIM-Isoformen RIM1α und β (Kaeser et al. 2008). In C wird die Strategie für RIM2 gezeigt. Hier wird das Exon 26 Ziel der Rekombinationsstrategie. Durch die Rekombination kommt es zu einer instabilen unvollständigen mrna, so dass es zu einem Verlust der drei RIM2-Isoformen (RIM2α, β und γ) kommt (Kaeser et al. 2011). Die zugrundeliegende Theorie ist in allen Modellen gleich. Es wird ein targeting construct für eine homologe Rekombination kreiert, in dem das gewünschte Exon von lox-sequenzen umrahmt ist. Zusätzlich ist auf dem Konstrukt eine Antibiotikaresistenzkassette, häufig Neomycin, welche von flp-sequenzen umgeben ist. Dieses Konstrukt wird in Stammzellen eingebracht und per Antibiotikaselektion die Zellen selektioniert, in denen das Konstrukt erfolgreich eingebaut wurde. Nachfolgend wird per flp-rekombinase die Antibiotikaresistenzkassette entfernt. Es resultiert ein gefloxtes Exon, welches letztendlich von der Cre-Rekombinase erkannt und exzidiert werden kann (Sauer et al. 1988, Hall et al. 2009). 34

39 In Abbildung 9A sieht man die Schritte, die oben beschrieben wurden, spezifisch für das Bsn-KO-Modell. Das Exon 2 ist hier Ziel der Rekombination. Es resultiert eine Deletion des N-Terminus der Zn-RING-Domäne, sowie einem Frameshift ab dem untranslatierten Exon 1. Dadurch kommt es zu einem vorzeitigen STOP-Codon und einem Verlust der Funktion des Bsn-Gens (9A ist unpubliziert und mit freundlicher Genehmigung von Prof Fejtova hier gezeigt). Die Abbildung 9B und 9C zeigen die KO-Strategien für RIM1 bzw. RIM2 (Kaeser et al. 2008, Kaeser et al. 2011). Für RIM1 wurde um das Exon 6 die lox-sequenzen eingebracht, was nach der Exzision durch Cre in dem Verlust der RIM1-Isoformen (RIM1α und β) resultiert (Kaeser et al. 2008). Bei RIM2 wurde das Exon 26 als Insertionspunkt der lox-sequenzen ausgewählt, da es das erste Exon aller drei RIM-Isoformen ist (RIM2α, β und γ). Das nach der Cre- Rekombinierung entstehende Allel produziert eine nicht-translatierte unstabile mrna, so dass es zu einem Funktionsverlust des RIM2-Protein kommt (Kaeser et al. 2011). Die in dieser Arbeit verwendeten Mausmodelle unterscheiden sich nur in der Methode der Expression der Cre-Rekombinase. Diese unterschiedlichen Methoden werden in den kommenden Abschnitten charakterisiert und auf Verwendbarkeit untersucht. 3.2 Charakterisierung des SLICK-Mausmodells Zuerst wurde das RIM1/2 lox/lox SLICK-V-Cre-Modell verwendet. SLICK steht für Single-neuron labelling inducible Cre-KO. In diesem speziellen Cre/lox-Modell ist die Recombinase an eine veränderte Domäne des Östrogen-Rezeptors gebunden, die allerdings nicht endogene Östrogene bindet, sondern nur Tamoxifen. Daher ist die Translokation von Cre in den Zellkern von der externen Applikation von Tamoxifen abhängig. Zusätzlich wird diese besondere Recombinase und ein Farbstoff (YFP) gleichzeitig coexprimiert. Um dies zu erreichen, wird die Expression des Farbstoffes und des Enzyms von zwei entgegengesetzten Thy1-Promotern getrieben (Abb. 10). Dementsprechend sind die Neuronen in denen die Ziel-Gene erfolgreich entfernt wurden automatisch mit dem Farbstoff gekennzeichnet (Feil et al. 1997, Young et al. 2008, Heimer-McGinn et al. 2011). In den Publikationen wurde das Tamoxifen oral den Mäusen appliziert, jedoch nie direkt in eine Zellkultur hinzugegeben. Da wir allerdings mit primären hippocampalen Mausneuronenkulturen arbeiteten, versuchten wir, durch eine direkte Applikation am 1 DIV von verschiedenen Konzentrationen des in Methanol 35

40 gelösten Tamoxifens (100nM, 400nM und 1µM), ein KO zu induzieren. Folgend inkubierten wir die Zellen für 4, 7 und 12 Tage. Nach immunhistochemischer Färbung zeigte sich allerdings nicht das gewünschte KO in ausreichendem Maße, so dass von diesem Mausmodell Abstand genommen wurde und zu dem EMX1-Mausmodell gewechselt wurde. Abbildung 10: Der SLICK-Cre-Mechanismus Das SLICK-Cre-System führt einerseits zu einem KO in Neuronen und andererseits werden diese gleichzeitig markiert. Dies wird mithilfe von zwei Thy1-Promotorn, die sich, wie in A gezeigt, in entgegengesetzter Richtung befinden verwirklicht. Es wird die Expression des Farbstoffes (YFP) und gleichzeitig die Expression des Cre-Enzyms getrieben. Zusätzlich ist in diesem System das Cre-Enzym an eine veränderte Domäne des Östrogenrezeptors (ER) gebunden, so dass Cre nur in den Zellkern gelangt, wenn Tamoxifen appliziert wird und an dem Rezeptor bindet. B zeigt ein Gen, welches von loxp- Sequenzen markiert ist und das KO als Produkt nach Tamoxifen-Applikation (Young et al. 2008) 3.3 Charakterisierung des EMX1-Mausmodells Zur Untersuchung der Effekte des Verlusts von RIM1/2 und Bsn wurde als nächstes das Mausmodell basierend auf dem EMX1-Promotor charakterisiert. In diesem Fall liegt die Cre-Recombinase als Knock-in-Gen downstream des EMX1-Promotors und wird durch ihn exprimiert. Der EMX1-Promotor wird in den Embryonen nur in den exzitatorischen Synapsen des Telencephalons ab dem 9,5 Tag nach Beginn der Gravidität exprimiert (Simeone et al. 1992, Guo et al. 2000, Jin et al. 2000). Eine Maus hat den Genotyp Bsn2 lox/lox, RIM1/2 lox/lox EMX1-Cre -/- (WT) und die andere Bsn2 lox/lox, RIM1/2 lox/lox EMX1-Cre +/- (TKO), wie in Abbildung 11 gezeigt ist. Letztgenannte entspricht dem Cre Knock-in. Nach erfolgreicher Kreuzung präsentiert der Wurf erneut die beiden Genotypen der Elterngeneration. Der Vorteil dieser Methode bestand darin, dass die Mäusejungen lebensfähig waren, weil ein KO nur in den exzitatorischen Synapsen des Telencephalons zu finden war und sie, soweit beobachtet, keine 36

41 phänotypischen Auffälligkeiten aufwiesen. Ein weiterer Vorzug war, dass aus einem Wurf die EMX1-Cre +/- - Mäuse als KO und die EMX1-Cre -/- - Wurfgeschwister als Kontrolle genutzt werden konnten. Abbildung 11: Erzeugung der konditionellen KO-Mäuse für RIM1/2 und Bsn Die schematische Darstellung zeigt die Genotypen der Elterngeneration als einerseits Bsn2 lox/lox, RIM1/2 lox/lox EMX1-Cre -/-, sowie andererseits Bsn2 lox/lox, RIM1/2 lox/lox EMX1-Cre +/-. Das KO beruht auf dem Cre/lox Modell. Das Gen für die Cre-Recombinase wurde als Knock-in downstream des EMX1- Promotors liegend eingebracht. Dieser kommt ausschließlich in exzitatorischen Synapsen des Telencephalons vor. Aus einem Wurf können sowohl die konditionellen KO-Kulturen, als auch die Kontroll-Kulturen aus ihren Wurfgeschwistern gewonnen werden. Um das KO-Modell zu kontrollieren, wurden die Mäuse einerseits genotypisiert und andererseits die WT- und TKO- primären hippocampalen Kulturen am 18 DIV fixiert sowie darauffolgend die Ziel-Proteine Bsn und RIM1/2 immunhistochemisch angefärbt. Als präsynaptischer exzitatorischer Marker wurde VGlut verwendet. 37

42 Abbildung 12: Verlust von Bsn und RIM1/2 in exzitatorischen Synapsen des EMX1-Mausmodells A und B: Repräsentative Bilder der immunhistochemischen Färbung einer primären hippocampalen WT (A)- und Triple KO-Kultur (TKO) (B) (Genotypen WT: Bsnlox/lox, RIM1/2lox/lox EMX1+/+; TKO: Bsnlox/lox, RIM1/2lox/lox EMX1+/-) am DIV für Bsn, RIM1/2 und VGlut. Es zeigt sich deutlich der Verlust der Zielproteine in den KO-Kulturen gegenüber der WT-Population in den VGlut-positiven (exzitatorischen) Synapsen. Der Maßstab ist 15 µm auf den größeren Bildern und 5 µm auf den Ausschnitten. C: Quantifizierung der mittleren Immunfluoreszenz ± S.E.M. der gezeigten Bilder in A und B. Die Anzahl der Experimente ist 2 und die Anzahl Zellen ist in den jeweiligen Säulen angegeben. Zur Testung der Signifikanz wurde der Student s t-test verwendet. Statistische Signifikanz von *** entspricht p<0,001. In Abbildung 12A und B sieht man repräsentative Bilder der Färbungen. Es zeigt sich, wie erwartet, eine dramatische Reduktion von Bsn und RIM1/2 in den VGlut positiven Präsynapsen. Abbildung 12C zeigt die Quantifizierung der gemittelten Fluoreszenz ± S.E.M. normalisiert zum WT. Bsn und RIM1/2 sind deutlich reduziert (KOBsn:34% ± 0,6% gegenüber des WT; KORIM1/2: 26% ± 0,5% gegenüber des WT). Es fallen in der Abbildung 12B einige helle Punkte auf (mit Pfeilen markiert), die jedoch nicht mit 38

43 VGlut colokalisieren und dementsprechend nicht exzitatorischen Neuronen zuzuordnen sind. Um diese inhibitorischen Synapsen darstellen zu können wurden immunohistochemische Färbungen für Bsn, VGlut und VGat angefertigt und hier als WT (13A) und TKO (13B) gezeigt. In der TKO-Kultur lassen sich ebenfalls Synapsen, die mit hoher Fluoreszenz (mit Pfeilen markiert) imponieren, registrieren. Diese stellen sich allerdings wie erwartet als VGat-positive Synapsen heraus und können somit als inhibitorische Synapsen interpretiert werden. Die mit Sternen markierten exzitatorischen Synapsen zeigen den erwarteten Verlust von Bsn. Somit wurde gezeigt, dass das EMX1-Cre Mausmodell wie erwartet funktioniert. Abbildung 13: Kein Verlust der Proteine in inhibitorischen Synapsen im EMX1-Mausmodell A und B: repräsentative Bilder einer immunhistochemischen Färbung für Bsn, VGat und VGlut einer primären hippocampalen Kultur (18-21 DIV) mit den Genotypen Bsn lox/lox, RIM1/2 lox/lox EMX1 +/+ für den WT und Bsn lox/lox, RIM1/2 lox/lox EMX1 +/- für den TKO. Es zeigt sich im Vergleich zwischen A und B ein Verlust von Bsn in den VGlut positiven, dementsprechend exzitatorischen Synapsen (mit Sternen markiert), wohingegen die Fluoreszenz in den inhibitorischen (VGat-positiven) Synapsen (mit Pfeilen markiert) erhalten bleibt. Die Farbgebung für das übereinandergelegte Bild rechts ist in den einzelnen Bildern markiert. Der Maßstab entspricht 5 µm. 3.4 Charakterisierung des Calciumsensors und der Stimulation Um den Effekt des Verlustes der drei Proteine auf die Rekrutierung der VGCC und somit auf den Calciumeinstrom zeigen zu können, wurden die primären hippocampalen Kulturen mit dem Calciumsensor SyGCaMP5G lentiviral infiziert. Hierbei handelt es sich um ein genetisch kodierten Calcium Indikator der eine Calmodulin Bindungsdomäne beinhaltet. Er reagiert auf steigende Calciumspiegel mit einer Fluoreszenzerhöhung (Dreosti et al. 2009, Akerboom et al. 2012). In Abbildung 14B ist eine schematische Darstellung zu sehen. Der eigentliche Calciumsensor ist GCaMP5G und durch die Verbindung mit dem C-Terminus von Synaptophysin der Ratte (ein Protein, das in der Membran von synaptischen Vesikeln vorkommt) ist er präsynaptisch lokalisiert. In Abbildung 14C sieht man Bildausschnitte einer primären hippocampalen Mausneuronenkultur, die die Fluoreszenzänderung bei den 39

44 verschiedenen Stimulationsstärken, die in 14A gezeigt sind, repräsentieren. Es zeigt sich eindeutig, dass die Intensität der Fluoreszenz zwischen den drei Stimulationsstufen zunimmt. Der Maßstab entspricht 10 µm und an der rechten Seite ist die Legende für die Farbgebung zu sehen. In der Publikation von Dreosti et al. (2009), aber auch Experimente in unserem Labor, konnte gezeigt werden, dass die Fluoreszenz proportional zu der Stimulationsstärke ist und erst bei 20 Impulsen ein Plateau erreicht wird. A +APV +CNQX 50mA 20/50 20Hz Hz B SV C 5 pulses 10 pulses 20 pulses Ionomycin Synapto physin F0 GCaMP5G D F5 F10 F20 Abbildung 14: Charakterisierung der Stimulation A: Schematische Darstellung des Stimulationsmusters, bestehend aus 5, 10 und 20 elektrischen Impulsen mit 50mA und 1ms. Die Bildgebungslösung beinhaltet CNQX und APV sind Blocker der AMPA- bzw. NMDA-Rezeptor um spontane Aktivität zu unterbinden. B: schematische Darstellung der Verbindung des Calciumsensors (GCaMP5G) mit dem vesikulären Protein Synaptophysin. Dadurch wird die präsynaptische Lokalisation gewährleistet. C zeigt einen Bildausschnitt einer primären hippocampalen Mausneuronenkultur am DIV mit der Intensität des Calciumsensors bei den verschiedenen Stimulationsstufen. Der Maßstab entspricht 10µm. D zeigt repräsentativ die Fluoreszenzänderung über die Zeit (Mittelwerte ±S.E.M.) bei den verschiedenen Stimulationsstärken. Die Abbildung wurde von Dr. Andres-Alonso aus der Arbeitsgruppe bereitgestellt. Es handelt sich hierbei um die Analyse von hippokampaler Rattenneuronenkulturen von 3 unabhängigen Experimenten. 40

45 3.5 Live Imaging und Reduktion des Calciumeinstroms in den EMX1-Kulturen Der eingebrachte Sensor ist zwar präsynaptisch lokalisiert, jedoch nicht spezifisch für exzitatorische Synapsen. Dementsprechend zeigt er neben dem Calciumeinstrom in exzitatorische Synapsen auch den Einstrom in inhibitorischen Synapsen, die in der hier verwendeten KO-Kultur jedoch weiterhin Bsn und RIM1/2 exprimieren, wie in der Abbildung 13 deutlich gezeigt wurde. Daher mussten die exzitatorischen Synapsen markiert werden. Dies wurde durch den hier verwendeten GluA-Antikörper mit einer Oyster 550-Markierung erreicht. Der Antikörper bindet an die extrazelluläre Domäne des postsynaptischen AMPA-Rezeptors und ermöglicht somit die live Markierung der korrespondierenden Postsynapse zur exzitatorischen Präsynapse. Die Kulturen wurden zwischen dem DIV zum Experiment herangezogen. In Abbildung 15A sieht man exemplarisch, wie einerseits der Calciumsensor Grün in der Präsynapse imponiert, wohingegen die exzitatorischen Postsynapsen in Rot durch den GluA-Antikörper angefärbt sind. Im rechten Bild bei 15A ist die Colokalisation des Calciumsensors und der exzitatorischen Postsynapse mit Sternen markiert. 41

46 Abbildung 15: Live Markierung der Neuronenkultur und Reduzierung des Calciumeinstroms in der TKO-Kultur A repräsentative Mikroskopbilder der mit dem Calciumsensor markierten Präsynapsen und mit GluA markierten exzitatorischen Postsynapsen einer DIV alten primären hippocampalen Mausneuronenkultur mit dem Genotyp Bsn lox/lox, RIM1/2 lox/lox EMX1 +/- (links und mittig). Das rechte Bild stellt die Colokalisation der beiden Bilder dar. B zeigt die Fluoreszenzänderung (Mittelwerte ±S.E.M.) über die Zeit bei 10 elektrischen Stimuli mit 50mA. Dies entspricht dem Calciumeinstrom. Die WT- Kultur hatte den Genotyp Bsn lox/lox, RIM1/2 lox/lox EMX1 -/-, wohingegen die TKO-Kultur den Genotyp Bsn lox/lox, RIM1/2 lox/lox EMX1 +/- besaß. C ist die Quantifizierung der mittleren maximalen Amplitude der TKO-Kultur normalisiert gegenüber der WT-Kultur (Mittelwert ±S.E.M.). Die Anzahl der Zellen sind in den jeweiligen Säulen angegeben Zum Vergleich der beiden Kulturen wurde der Student s t-test benutzt. Statistische Signifikanz bei ns: p=0,149. Maßstäbe 10 µm und 2µm. Zur Analyse wurde die Fluoreszenzänderung aufgrund des Calciumeinstroms in den Synapsen gemessen. Um eine WT Synapse zu markieren wurde eine ROI manuell auf eine Präsynapse gelegt, die nicht eine korrespondierende exzitatorische Postsynapse aufweisen konnte. Wohingegen zur Markierung einer TKO-Synapse die ROI auf eine Präsynapse mit korrespondierender GluA-markierter Postsynapse gelegt wurde. In beiden Fällen wurde dann die Fluoreszenzänderung über den zeitlichen Verlauf gemessen. 15B und 15C zeigen die Quantifizierung bei 10 elektrischen Stimuli. Abbildung 15B zeigt die Kinetik des Ca ++ -Einstroms bei Stimulation. Bei 15C wird die durchschnittliche maximale Fluoreszenzänderung gegenüber der Kontroll-Kulturen normalisiert dargestellt. Unerwarteterweise zeigte sich nur ein milder Effekt in den TKO-Kulturen gegenüber dem WT (TKO: 74,9% ± 9,1% des WT), der 42

47 nicht signifikant war. Dies war erstaunlich, da bereits von Kaeser et al. (2011) gezeigt wurde, dass der Verlust von RIM1/2 in einem verminderten Calciumeinstrom von ca. 50% resultiert und wir daher eine Verminderung des Calciumeinstroms mindestens in der gleichen Größenordnung erwartet hätten. Wir folgerten daher, dass unsere Daten eventuell durch eine ungenügende Markierung der exzitatorischen Synapsen fehlerhaft waren. Aufgrund der erschwerten Arbeitsbedingungen mit diesem Mausmodell, bezogen auf die unzufriedenstellende Markierung der exzitatorischen Präsynapse und der dadurch erschwerten und fehlerbehafteten Analyse der Bildfolgen, wurde das Mausmodell gewechselt. 3.6 Charakterisierung der Mauslinien Bsn2 lox/lox, RIM1/2 lox/lox und Bsn2 lox/lox mit RIM1/2 lox/lox In dem neuen Mausmodell war die Cre-Recombinase nicht wie in den anderen beiden Mausmodellen bereits in das Genom eingebracht, sondern wurde per lentiviralem Vektor in die jeweiligen Zellkulturen eingefügt. Der untere Teil der Abbildung 16A zeigt die Sequenzen der hier verwendeten Cre- bzw. ΔCre-Konstrukte. Um ein KO zu erreichen wurden die Neuronenkulturen mit dem Cre-Vektor infiziert. Für die Kontroll-Kultur wurden die primären hippocampalen Kulturen wiederum mit dem ΔCre-Vektor infiziert. Das Cre-interne Nuclear localising signal (NLS) ermöglicht Cre in den Nucleus zu gelangen und dort die Zielgene zu entfernen (Ho et al. 2006). Da das ΔCre-Konstrukt nur ein unvollständiges NLS besitzt (s. Abb. 16A) kann es nicht in den Nucleus translozieren und dementsprechend nicht für ein KO sorgen. Die Originalkonstrukte von Ho et al. (2006) wurden durch ein nucleoplasmin NLS erweitert um eine bessere Anreicherung des GFP im Nucleus zu erzeugen (s. Abb. 16A) (Robbins et al. 1991, Kaeser et al. 2011). Dies resultiert in einer besseren Signal-zu- Rauschen-Auflösung in der Peripherie, welches in Abbildung 16B deutlich wird. Die hier verwendeten Mausmodelle hatten den Vorteil, dass man, im Gegensatz zum EMX1-Modell, nicht die exzitatorischen Synapsen markieren musste, allerdings resultiert es in einer deutlich anspruchsvolleren Methodik, da eine Doppelinfektion vonnöten war, um einerseits die Cre- bzw. ΔCre-Sequenz und andererseits den Calciumsensor in die Neuronen einzubringen. 43

48 Abbildung 16: Mechanismus hinter den KO-Modellen A zeigt die Sequenzen der hier verwendeten Cre- bzw. ΔCre-Virus. Die oberen beiden Sequenzen entstammen der Publikation von Ho et al. (2006) und sind die Grundlage für die darunter abgebildeten modifizierten Sequenzen von Kaeser et al. (2011). Die Originalsequenzen wurden um ein nucleoplasmin Nucleus Localising Signal (nclnls) erweitert. Dies sorgt für ein besseres Signal-zu-Rauschen Verhältnis, welches in B deutlich zu sehen ist. B zeigt im oberen Abschnitt einen Ausschnitt einer Neuronenkultur, die mit den Originalsequenzen infiziert wurde. Im unteren Abschnitt sieht man einen Ausschnitt, der mit den modifizierten Sequenzen infiziert wurde. Man sieht deutlich eine spezifischere Anreicherung im Nucleus (Kaeser et al. 2011). Da das KO-System bereits für die RIM1/2 lox/lox Mäuse publiziert und etabliert ist (Kaeser et al. 2011) werden hier nur Quantifizierungen und immunhistochemische Bilder für Mäuse mit dem Genotyp Bsn2 lox/lox und RIM1/2 lox/lox gezeigt. 44

49 Abbildung 17: Charakterisierung und Quantifizierung der TKO-Kultur A: Immunhistochemische Färbung für Bsn, RIM1, Synapsin1,2 (von links nach rechts) einer primären hippocampalen Mausneuronenkultur mit dem Genotyp: Bsn2 lox/lox, RIM1/2 lox/lox. Die Kulturen wurden am 3 DIV mit dem Cre- bzw. ΔCre-Vektor sowie dem Calciumsensor infiziert und am DIV für das Experiment herangezogen. Rechts ist die Colokalisation der Bilder. B: Quantifizierung der Reduktion für Bsn und Rim1 gegen die ΔCre-Kultur normalisiert der in A gezeigten Bilder. Durchschnittliche Fluoreszenzwerte ± S.E.M. Die Anzahl der Zellen sind bei den entsprechenden Säulen angegeben. Zur Testung der Signifikanz wurde der Student s t-test verwendet. Statistische Signifikanz von *** entspricht p<0,001 Die immunhistochemische Markierung zeigt eindeutig eine Reduktion der Proteine Bsn und RIM1 (17A). In der Quantifizierung sieht man eine signifikante Reduktion in den jeweiligen markierten Zielproteinen (Bsn: 9,6% ± 0,2% gegenüber der ΔCre-Kultur; RIM1 32,7% ± 0,7% gegenüber der ΔCre-Kultur). Die Quantifizierung wurde hier nur für das TKO-Modell durchgeführt. Da das TKO-Modell durch Kreuzung des Bsn lox/lox - Systems mit dem RIM1/2 lox/lox -System, lässt sich einiges ableiten. Einerseits zeigt die hier dargestellte Quantifizierung ein nahezu vollkommenes Verschwinden von Bsn. Dadurch kann man davon ausgehen, dass sich auch in Mäusen, welche nur den Genotyp Bsn lox/lox haben, ein ähnliches Bild nach der Infektion zeigen wird. Weiterhin lässt sich trotz des verwendeten RIM1-Antikörpers die Ergebnisse auch auf RIM2 übertragen, da das Modell bereits publiziert und etabliert wurde (Kaeser et al. 2011). Damit ist gezeigt, dass durch die viral eingebrachte Cre-Recombinase, bzw. deren Gegenstück die ΔCre- Recombinase, effektiv die gewünschten Gene, nach der in Abbildung 9 gezeigten Methoden, entfernt werden und somit ein KO für diese Proteine erzeugt wird. Mit diesen funktionierenden Systemen konnte sich nun der Fragestellung bezüglich des 45

50 Effektes eines Verlustes der genannten Proteine suffizient zugewandt werden. Deswegen wurden die nachfolgenden live-experimente unter Verwendung von dieser experimentellen Strategie durchgeführt. 3.7 Ein Verlust von RIM1/2 vermindert den Calciumeinstroms Um die Effekte des Verlustes von RIM1/2 auf den Calciumeinstrom zu untersuchen, wurden primäre hippocampale Mausneuronenkulturen des Genotyps RIM1/2 lox/lox am 3 DIV einerseits mit der Cre- bzw. ΔCre-Recombinase und andererseits mit dem Calciumsensor viral infiziert und zwischen den DIV für das Experiment verwendet. Es werden hier nur die Daten für 10 elektrische Stimuli gezeigt. 18A repräsentiert den gemittelten Calciumeinstrom ±S.E.M. über die Zeit von sowohl der Cre- als auch ΔCre-Kultur. Bei der Analyse des ΔF/F 0 -Quotienten bei den RIM1/2-KO- Kulturen zeigte sich eine deutliche signifikante Reduktion des Calciumeinstroms (42,9% ± 4,7% gegenüber der ΔCre-Kultur) (18B). Um die Frage zu adressieren, ob sich die einzelnen ROIs bzw. die einzelnen Präsynapsen nach einer Gausschen Verteilung verhalten und das beobachtete Phänomen somit konsistent zwischen den einzelnen ROIs ist, wurde ein Histogram angefertigt. Dieses zeigt eine Konsistenz des beobachteten Phänomens (18C). 46

51 Abbildung 18: deutliche Reduktion des Calciumeinstroms bei RIM1/2 defizienten Kulturen A: Repräsentative Darstellung der Fluoreszenzänderung über die Zeit ±SEM einer primären hippocampalen Mauskultur mit dem Genotyp: RIM1/2 lox/lox bei Stimulation mit 10 AP. Dies lässt sich mit dem Calciumeinstrom in die Zellen gleichsetzen. Die Kulturen wurden am 3 DIV mit dem Cre- bzw. ΔCre-Vektor sowie dem Calciumsensor infiziert und am DIV für das Experiment herangezogen. B: Quantifizierung der in A gezeigten Zellen. Es ist die mittlere maximale Amplitude ± SEM, normalisiert gegen ΔCre, dargestellt. Die Anzahl der Zellen ist in den jeweiligen Säulen angegeben. C zeigt das Histogram der beiden Kulturen. Die Anzahl der Experimente war 2. Zur Testung der Signifikanz wurde der Student s t-test verwendet. Statistische Signifikanz von *** entspricht p=0,0004 Die hier gezeigten Ergebnisse waren zu erwarten und stehen im Konsens zu den bereits publizierten Daten von Kaeser et al. (2011), die zeigen konnten, dass eine Deletion von RIM1/2 zu einem um ca. 50% reduzierten Calciumeinstrom führt. RIM1/2 spielt eine große Rolle bei einer Vielzahl an Prozessen in der Präsynapse, insbesondere auch bei der Rekrutierung von VGCC zur AZ. Dementsprechend erklärt sich diese große Reduktion des Calciumeinstroms beim Fehlen der Proteine. 3.8 Erhöhter Calciumeinstrom, wenn ein Verlust von Bsn vorliegt Nachdem der Verlust von RIM1/2, als Protein welches VGCC rekrutiert und mit vielen anderen Proteinen der Präsynapse in Kontakt steht, eine erwartete Reduktion des Calciumeinstroms zeigte, wurde sich Bsn zugewendet. Bsn ist ein großes Gerüstprotein 47

52 der Präsynapse, hat ebenfalls viele Interaktionspartner und ist, genauso wie RIM1/2, an der Rekrutierung von VGCC beteiligt, allerdings nur der Calciumkanäle mit einer PQ- Untereinheit. Um die Effekte des Verlustes von Bsn auf den Calciumeinstrom zu untersuchen, wurden primäre hippocampale Mausneuronenkulturen des Genotyps Bsn2 lox/lox nach der gleichen Methodik infiziert und inkubiert wurden und zwischen den DIV für das Experiment verwendet wurden. Es werden hier nur die Daten für 10 elektrische Stimuli gezeigt. 19A repräsentiert den gemittelten Calciumeinstrom ±S.E.M. über die Zeit von sowohl der Cre- als auch ΔCre-Kultur. Hier sieht man eine erhöhte Amplitude der Bsn2-defizienten Kultur. Dies lässt sich auch in der Quantifizierung der maximalen gemittelten Amplitude ablesen, die hier ± S.E.M. in Abb. 19B dargestellt ist (141,1% ± 15,1% gegenüber der ΔCre-Kultur). Dieses erstaunliche Phänomen war zwischen den verschiedenen ROIs konsistent. Das wird durch das Histogram gezeigt (19C). Abbildung 19: Erhöhter Calciumeinstrom in der Bsn2-Ko-Kultur A: repräsentative Darstellung der Fluoreszenzänderung über die Zeit ± SEM einer primären hippocampalen Mauskultur mit dem Genotyp: Bsn2 lox/lox bei Stimulation mit 10 AP. Dies lässt sich mit dem Calciumeinstrom in die Zellen gleichsetzen. Die Kulturen wurden am 3 DIV mit dem Cre- bzw. ΔCre-Vektor sowie dem Calciumsensor infiziert und am DIV für das Experiment herangezogen. B Quantifizierung der mittleren maximalen Amplitude ± SEM, normalisiert gegen ΔCre der Kulturen aus A. Die Anzahl der Zellen sind in den jeweiligen Säulen angegeben. C zeigt das Histogram der beiden Kulturen. Die Anzahl der Experimente war 2. Zur Testung der Signifikanz wurde der Student s t-test verwendet. Statistische Signifikanz von * entspricht p=0,

53 Dieser Anstieg des einströmenden Calciums von 41% verglichen mit der ΔCre-Kultur war vollkommen unerwartet, insbesondere in Hinblick auf Bsns Anzahl an Interaktionspartner und auf die Rolle bei der Rekrutierung des P/Q-Typ VGCC. Eine Reduktion des Calciumeinstroms wäre zu erwarten gewesen. Es könnten unter anderem kompensatorische Mechanismen durch eine erhöhte Expression anderer präsynaptischer Proteine (z.b. Pclo oder RIMs) zu diesen Resultaten führen. Zusätzlich ist zu adressieren, dass der Calciumsensor nicht nur das einströmende Calcium an der Aktiven Zone registriert, sondern generell einströmendes Calcium, so dass z.b. auch vermehrt VGCC außerhalb der AZ ebenfalls zu diesen Ergebnissen beitragen könnten. 3.9 Reduktion des Calciumeinstroms in Synapsen ohne Bsn und RIM1/2 (TKO) Zur Analyse möglicher Interaktionen zwischen den drei Proteinen (Bsn sowie RIM1/2) wurden die gleichen Experimente durchgeführt wie bei den beiden vorangegangenen Kulturen. Vor dem Hintergrund der erstaunlichen Ergebnisse der Bsn-KO Kultur, waren die Resultate dieser TKO-Kulturen, die keins der drei genannten Proteine exprimieren natürlich höchst interessant. Um die Effekte auf die Rekrutierung der Calciumkanäle bzw. auf den Calciumeinstrom bei Verlust der drei wichtigen Proteine der Präsynapse, die für die Rekrutierung zuständig sind, untersuchen zu können wurden hier primäre hippocampale Mausneuronenkulturen des Genotyps Bsn2 lox/lox, RIM1/2 lox/lox verwendet und nach der bereits genannten Methodik infiziert und inkubiert. Sie wurden zwischen den DIV für die Experimente verwendet. Es werden hier nur die Daten für 10 elektrische Stimuli gezeigt. 20A repräsentiert den gemittelten Calciumeinstrom ± S.E.M. über die Zeit von sowohl der Cre- als auch ΔCre-Kulturen. Hier sieht man eine erniedrigte Amplitude der TKO-Kultur. Die Quantifizierung der maximalen gemittelten Amplitude ± S.E.M. (Abb. 20B) zeigt das gleiche Bild (41,1% ± 3,8% gegenüber der ΔCre-Kultur). Dieses Ergebnis war zwischen den verschiedenen ROIs konsistent, wie im Histogram gezeigt wird (20C). 49

54 Abbildung 20: Verminderter Calciumeinstrom in die TKO-Kulturen A: repräsentative Darstellung der Fluoreszenzänderung über die Zeit ± SEM einer primären hippocampalen Mauskultur mit dem Genotyp: Bsn2 lox/lox, RIM1/2 lox/lox bei Stimulation mit 10 AP. Dies lässt sich mit dem Calciumeinstrom in die Zellen gleichsetzen. Die Kulturen wurden am 3. DIV mit dem Cre- bzw. ΔCre-Vektor sowie dem Calciumsensor infiziert und am DIV für das Experiment herangezogen. B Quantifizierung der mittleren maximalen Amplitude ± SEM, normalisiert gegen ΔCre der Kulturen aus A. Die Anzahl der Zellen sind in den jeweiligen Säulen angegeben. C zeigt das Histogram der beiden Kulturen. Die Anzahl der Experimente war 3. Zur Testung der Signifikanz wurde der Student s t-test verwendet. Statistische Signifikanz von *** entspricht p<0,0001 Die Untersuchungen der verschiedenen Genotypen haben zum Teil erwartete Ergebnisse, wie der verminderter Calciumeinstrom bei Verlust von RIM1/2 und dem TKO, allerdings auch unerwartete Resultate, wie der erhöhte Calciumeinstrom bei einem Verlust von Bsn und unbeeinträchtigter Expression von RIM1/2 erbracht. 50

55 Abbildung 21: Zusammenfassung der drei unterschiedlichen KO-Modelle A: Repräsentative Darstellung der maximalen gemittelten Amplituden ±SEM der drei verschiedenen KO Modelle bei Stimulation mit 10 AP normalisiert gegen ΔCre. Es handelt sich um primäre hippocampale Mausneuronenkulturen, die am DIV 3 mit dem Cre- bzw. ΔCre-Vektor sowie dem Calciumsensor infiziert und am DIV für das Experiment herangezogen wurden. Die Anzahl der Zellen sind in den jeweiligen Säulen angegeben. Es wurde eine einfache Varianzanalyse (one way ANOVA) mit Bonferroni post-test durchgeführt. B: repräsentative Darstellung der gemittelten maximalen Amplitude ± SEM der RIM1/2 und TKO Kulturen aus A gegen RIM1/2 normalisiert. Statistische Signifikanz von *** entspricht p<0,0001; ns entspricht p=0,4891 Abbildung 21A fasst die bereits dargestellten Phänotypen zusammen, stellt sie gegenüber und zeigt die statistische Signifikanz zwischen den einzelnen KO-Modellen. Es zeigt sich eine signifikante Erhöhung zwischen sowohl Bsn und RIM1/2, als auch Bsn und TKO, wohingegen es keinen signifikanten Unterschied zwischen einem Verlust von RIM1/2 und TKO gibt. Letzteres Resultat ist erneut unerwartet. Es ist ebenfalls in 21B dargestellt. Hier wurde der TKO-Wert gegen RIM1/2 normalisiert (TKO: 95,8% ± 8,7% gegenüber RIM1/2). Im Anbetracht des erhöhten Calciumeinstroms bei Verlust von Bsn hätte man bei einem zusätzlichen Verlust von RIM1/2 entweder mit einem Wert für den Calciumeinstrom gerechnet, der zwischen dem Bsn2 lox/lox - und dem RIM1/2 lox/lox -Phänotypen liegt oder mit einem Wert der signifikant unter dem von RIM1/2 lox/lox liegt. Da bereits publiziert wurde, dass RIM1/2 sowohl PQ- als auch N-Typ VGCC zur AZ rekrutieren kann, Bsn allerdings nur mit PQ-Typ Kanälen interagiert, stellte sich die Frage nach dem Beitrag der beiden Subpopulationen der VGCC auf die oben gezeigten Phänotypen. Zur Analyse bezüglich der Fragestellung wie viel Calcium durch den jeweiligen Subtyp an VGCC einströmt, sollten weitere Experimente durchgeführt werden. 51

Übertragung zwischen einzelnen Nervenzellen: Synapsen

Übertragung zwischen einzelnen Nervenzellen: Synapsen Übertragung zwischen einzelnen Nervenzellen: Synapsen Kontaktpunkt zwischen zwei Nervenzellen oder zwischen Nervenzelle und Zielzelle (z.b. Muskelfaser) Synapse besteht aus präsynaptischen Anteil (sendendes

Mehr

postsynaptische Potentiale graduierte Potentiale

postsynaptische Potentiale graduierte Potentiale postsynaptische Potentiale graduierte Potentiale Postsynaptische Potentiale veraendern graduierte Potentiale aund, wenn diese Aenderungen das Ruhepotential zum Schwellenpotential hin anheben, dann entsteht

Mehr

BK07_Vorlesung Physiologie. 05. November 2012

BK07_Vorlesung Physiologie. 05. November 2012 BK07_Vorlesung Physiologie 05. November 2012 Stichpunkte zur Vorlesung 1 Aktionspotenziale = Spikes Im erregbaren Gewebe werden Informationen in Form von Aktions-potenzialen (Spikes) übertragen Aktionspotenziale

Mehr

Exzitatorische (erregende) Synapsen

Exzitatorische (erregende) Synapsen Exzitatorische (erregende) Synapsen Exzitatorische Neurotransmitter z.b. Glutamat Öffnung von Na+/K+ Kanälen Membran- Potential (mv) -70 Graduierte Depolarisation der subsynaptischen Membran = Erregendes

Mehr

Erregungsübertragung an Synapsen. 1. Einleitung. 2. Schnelle synaptische Erregung. Biopsychologie WiSe Erregungsübertragung an Synapsen

Erregungsübertragung an Synapsen. 1. Einleitung. 2. Schnelle synaptische Erregung. Biopsychologie WiSe Erregungsübertragung an Synapsen Erregungsübertragung an Synapsen 1. Einleitung 2. Schnelle synaptische Übertragung 3. Schnelle synaptische Hemmung chemische 4. Desaktivierung der synaptischen Übertragung Synapsen 5. Rezeptoren 6. Langsame

Mehr

Funktionelle Analyse von Neuropilin 1 und 2 in der Epidermis: Bedeutung in der Wundheilung und in der UVBinduzierten

Funktionelle Analyse von Neuropilin 1 und 2 in der Epidermis: Bedeutung in der Wundheilung und in der UVBinduzierten Funktionelle Analyse von Neuropilin 1 und 2 in der Epidermis: Bedeutung in der Wundheilung und in der UVBinduzierten Apoptose INAUGURAL-DISSERTATION zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen

Mehr

Die neuronale Synapse

Die neuronale Synapse Die neuronale Synapse AB 1-1, S. 1 Arbeitsweise der neuronalen Synapse Wenn am synaptischen Endknöpfchen ein Aktionspotenzial ankommt, öffnen sich spannungsgesteuerte Calciumkanäle. Da im Zellaußenmedium

Mehr

1 Bau von Nervenzellen

1 Bau von Nervenzellen Neurophysiologie 1 Bau von Nervenzellen Die funktionelle Einheit des Nervensystems bezeichnet man als Nervenzelle. Dendrit Zellkörper = Soma Zelllkern Axon Ranvier scher Schnürring Schwann sche Hüllzelle

Mehr

2.1 Die Entstehung des Gehirns aus neuralen Stammzellen Transkriptionsfaktoren in der Gehirnentwicklung...16

2.1 Die Entstehung des Gehirns aus neuralen Stammzellen Transkriptionsfaktoren in der Gehirnentwicklung...16 Inhaltsverzeichnis Danksagung...3 Inhaltsverzeichnis...5 Abkürzungverzeichnis...1 1 Zielsetzung...4 2 Einleitung...6 2.1 Die Entstehung des Gehirns aus neuralen Stammzellen...6 2.2 Radiale Gliazellen...9

Mehr

Synaptische Übertragung und Neurotransmitter

Synaptische Übertragung und Neurotransmitter Proseminar Chemie der Psyche Synaptische Übertragung und Neurotransmitter Referent: Daniel Richter 1 Überblick Synapsen: - Typen / Arten - Struktur / Aufbau - Grundprinzipien / Prozesse Neurotransmitter:

Mehr

Anwendung von Botulinumtoxin (BoNT) bei neurologischen Indikationen

Anwendung von Botulinumtoxin (BoNT) bei neurologischen Indikationen Anwendung von Botulinumtoxin (BoNT) bei neurologischen Indikationen ÖPG/ÖDBAG Zertifizierungskurs Teil 1 Allgemeines Modul 2 Th. Sycha Universitätsklinik für Neurologie, AKH-Wien thomas.sycha@meduniwien.ac.at

Mehr

Signale und Signalwege in Zellen

Signale und Signalwege in Zellen Signale und Signalwege in Zellen Zellen müssen Signale empfangen, auf sie reagieren und Signale zu anderen Zellen senden können Signalübertragungsprozesse sind biochemische (und z.t. elektrische) Prozesse

Mehr

Übung 6 Vorlesung Bio-Engineering Sommersemester Nervenzellen: Kapitel 4. 1

Übung 6 Vorlesung Bio-Engineering Sommersemester Nervenzellen: Kapitel 4. 1 Bitte schreiben Sie Ihre Antworten direkt auf das Übungsblatt. Falls Sie mehr Platz brauchen verweisen Sie auf Zusatzblätter. Vergessen Sie Ihren Namen nicht! Abgabe der Übung bis spätestens 21. 04. 08-16:30

Mehr

3.2 Posttranslationelle Modifikation von Wt1 durch Phosphorylierung

3.2 Posttranslationelle Modifikation von Wt1 durch Phosphorylierung 3.2 Posttranslationelle Modifikation von Wt1 durch Phosphorylierung Transkriptionsfaktoren erfahren oft eine posttranslationelle Modifikation in Form von Phosphorylierung und werden dadurch in ihrer Aktivität

Mehr

Passive und aktive elektrische Membraneigenschaften

Passive und aktive elektrische Membraneigenschaften Aktionspotential Passive und aktive elektrische Membraneigenschaften V m (mv) 20 Overshoot Aktionspotential (Spike) V m Membran potential 0-20 -40 Anstiegsphase (Depolarisation) aktive Antwort t (ms) Repolarisation

Mehr

Zusammenfassung. Abkürzungsverzeichnis

Zusammenfassung. Abkürzungsverzeichnis Zusammenfassung Abkürzungsverzeichnis I IX 1. Einleitung 1 1.1. Glutamatrezeptoren.............................. 1 1.1.1. Modularer Aufbau von ionotropen Glutamatrezeptoren....... 3 1.1.2. AMPA-Rezeptoren...........................

Mehr

Hyperforin aktiviert TRP-Kanäle - ein neuer antidepressiver. Wirkmechanismus? Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften

Hyperforin aktiviert TRP-Kanäle - ein neuer antidepressiver. Wirkmechanismus? Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften Hyperforin aktiviert TRP-Kanäle - ein neuer antidepressiver Wirkmechanismus? Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften Vorgelegt beim Fachbereich Biochemie, Chemie und Pharmazie

Mehr

Die Immunsynapse AB 3-1

Die Immunsynapse AB 3-1 Die Immunsynapse AB 3-1 A typical immunological response involves T cells and Antigen Presenting Cells (APCs). APCs capture and ingest infectious microbes, cut them apart, and display pieces of their proteins

Mehr

INHALTSVERZEICHNIS 1 KURZFASSUNG EINLEITUNG ZIELSETZUNG Inhaltsverzeichnis

INHALTSVERZEICHNIS 1 KURZFASSUNG EINLEITUNG ZIELSETZUNG Inhaltsverzeichnis I INHALTSVERZEICHNIS 1 KURZFASSUNG... 1 2 EINLEITUNG... 3 2.1 Die Plasmamembran Vermittler zwischen zwei Welten... 3 2.1.1 Lipide der Plasmamembran... 4 2.1.2 Proteine der Plasmamembran... 7 2.1.3 Modelle

Mehr

SERVA Streptavidin Agarose Resin Agarosematrix zur Affinitätsreinigung von biotinylierten Biomolekülen

SERVA Streptavidin Agarose Resin Agarosematrix zur Affinitätsreinigung von biotinylierten Biomolekülen GEBRAUCHSANLEITUNG SERVA Streptavidin Agarose Resin Agarosematrix zur Affinitätsreinigung von biotinylierten Biomolekülen (Kat.-Nr. 42177) SERVA Electrophoresis GmbH - Carl-Benz-Str. 7-69115 Heidelberg

Mehr

Aufbau und Funktionweise der Nervenzelle - Wiederholung Vorlesung -

Aufbau und Funktionweise der Nervenzelle - Wiederholung Vorlesung - Aufbau und Funktionweise der Nervenzelle - Wiederholung Vorlesung - Fragen zur Vorlesung: Welche Zellen können im Nervensystem unterschieden werden? Aus welchen Teilstrukturen bestehen Neuronen? Welche

Mehr

Modifizierte Gene Editor Mutagenese

Modifizierte Gene Editor Mutagenese Modifizierte Gene Editor Mutagenese zur gleichzeitigen Einführung mehrerer Punktmutationen DNA Template Präparation: 2 µg Plasmid DNA (bei 6 kb, sonst entsprechend mehr oder weniger) + 2 µl 2M NaOH, 2

Mehr

STOFFTRANSPORT DURCH BIOMEM- BRANEN

STOFFTRANSPORT DURCH BIOMEM- BRANEN DIE BIOMEMBRAN Vorkommen Plasmalemma Grenzt Cytoplasma nach außen ab Tonoplast Grenzt Vakuole vom Cytoplasma ab Zellkernmembran Mitochondrienmembran Plastidenmembran ER Kompartimente Durch Zellmembran

Mehr

Untersuchungen zur Wirkung von Pasteurella multocida Toxin

Untersuchungen zur Wirkung von Pasteurella multocida Toxin Institut fiir Experimentelle und Klinische Pharmakologie und Toxikologie der Albert-Ludwigs-Universitat Freiburg Untersuchungen zur Wirkung von Pasteurella multocida Toxin Dissertation zur Erlangung des

Mehr

Bipolar Disorder (BD) Nina Stremmel, Universität zu Köln,

Bipolar Disorder (BD) Nina Stremmel, Universität zu Köln, Bipolar Disorder (BD) Nina Stremmel, Universität zu Köln, 07.06.18 Inhalt Allgemein Genetische Grundlagen CACNA I C, NCAN, ANK3 Neurobiologische Grundlagen Dopamin und Glutamat Behandlung Allgemein Neuropsychotische

Mehr

Nanostrukturphysik II Michael Penth

Nanostrukturphysik II Michael Penth 16.07.13 Nanostrukturphysik II Michael Penth Ladungstransport essentiell für Funktionalität jeder Zelle [b] [a] [j] de.academic.ru esys.org giantshoulders.wordpress.com [f] 2 Mechanismen des Ionentransports

Mehr

Entdeckungen unter der Schädeldecke. Jean-Marc Fritschy Institut für Pharmakologie und Toxikologie

Entdeckungen unter der Schädeldecke. Jean-Marc Fritschy Institut für Pharmakologie und Toxikologie Entdeckungen unter der Schädeldecke Jean-Marc Fritschy Institut für Pharmakologie und Toxikologie Inhalt 1. GFP, das Wunderprotein 2. Die Nervenzellen bei der Arbeit beobachten 3. Nervenzellen mit Licht

Mehr

Multifunktionale DNA Kassetten zur konditionalen Mutagenese in der Maus

Multifunktionale DNA Kassetten zur konditionalen Mutagenese in der Maus Multifunktionale DNA Kassetten zur konditionalen Mutagenese in der Maus Von der Fakultat fur Lebenswissenschaften der Technischen Universitat Carolo-Wilhelmina zu Braunschweig zur Erlangung des Grades

Mehr

Biopsychologie als Neurowissenschaft Evolutionäre Grundlagen Genetische Grundlagen Mikroanatomie des NS

Biopsychologie als Neurowissenschaft Evolutionäre Grundlagen Genetische Grundlagen Mikroanatomie des NS 1 1 25.10.06 Biopsychologie als Neurowissenschaft 2 8.11.06 Evolutionäre Grundlagen 3 15.11.06 Genetische Grundlagen 4 22.11.06 Mikroanatomie des NS 5 29.11.06 Makroanatomie des NS: 6 06.12.06 Erregungsleitung

Mehr

Die motorische Endplatte und die Steuerung der Muskelkontraktion

Die motorische Endplatte und die Steuerung der Muskelkontraktion Die motorische Endplatte und die Steuerung der Muskelkontraktion 1. Aufbau des Muskels 2. Mechanismus und Steuerung der Muskelkontraktion 2.1 Gleitfilamenttheorie 2.2 Zyklus der Actin-Myosin Interaktion

Mehr

Skript zum Thema Epigenetik

Skript zum Thema Epigenetik Skript zum Thema Epigenetik Name: Seite! 2 von! 14 Worum geht s hier eigentlich? Zelle Erbgut im Zellkern Organismus 1 Die genetische Information, die jeder Mensch in seinen Zellkernen trägt, ist in jeder

Mehr

Glutamat und Neurotoxizitaet. Narcisse Mokuba WS 18/19

Glutamat und Neurotoxizitaet. Narcisse Mokuba WS 18/19 Glutamat und Neurotoxizitaet Narcisse Mokuba WS 18/19 Gliederung 1.Teil : Glutamat als Botenstoff ; Synthese Glutamat-Rezeptoren : Aufbau & Funktion Signaluebertragung 2.Teil : Bedeutung als Gescmacksverstaerker

Mehr

Kulturen von humanen Nabelschnur-Endothelzellen (HUVEC) produzieren konstant Endothelin-1 (ET-1) und geben dieses in das Kulturmedium ab.

Kulturen von humanen Nabelschnur-Endothelzellen (HUVEC) produzieren konstant Endothelin-1 (ET-1) und geben dieses in das Kulturmedium ab. 4 ERGEBNISSE 4.1 Endothelin Kulturen von humanen Nabelschnur-Endothelzellen (HUVEC) produzieren konstant Endothelin-1 (ET-1) und geben dieses in das Kulturmedium ab. 4.1.1 Dosisabhängige Herabregulation

Mehr

3 Ergebnisse. 3.1 Die Speckling-Domäne von Wt1 umfaßt die Aminosäuren

3 Ergebnisse. 3.1 Die Speckling-Domäne von Wt1 umfaßt die Aminosäuren 3 Ergebnisse 3.1 Die Speckling-Domäne von Wt1 umfaßt die Aminosäuren 76-120 Die Existenz verschiedener Isoformen von WT1 ist unter anderem auf die Verwendung einer für die Aminosäuren KTS kodierenden alternativen

Mehr

Chemokin-Rezeptor-Modulation während der T-Zell-Aktivierung: Untersuchung zur Funktion der GTPase Ras

Chemokin-Rezeptor-Modulation während der T-Zell-Aktivierung: Untersuchung zur Funktion der GTPase Ras Aus dem Institut für Immunologie der Universität Heidelberg Geschäftsführender Direktor: Herr Prof. Dr. med. Stefan Meuer Chemokin-Rezeptor-Modulation während der T-Zell-Aktivierung: Untersuchung zur Funktion

Mehr

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) Differenzierung von E.coli-Stämmen mit Hilfe der Pulsfeldgelelektrophorese

Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) Differenzierung von E.coli-Stämmen mit Hilfe der Pulsfeldgelelektrophorese Methodensammlung der Bund/Länder-Arbeitsgemeinschaft Gentechnik (LAG) Differenzierung von E.coli-Stämmen mit Hilfe der Pulsfeldgelelektrophorese Erstellt vom Unterausschuss Methodenentwicklung der LAG,

Mehr

Synaptische Transmission

Synaptische Transmission Synaptische Transmission Wie lösen APe, die an den Endknöpfchen der Axone ankommen, die Freisetzung von Neurotransmittern in den synaptischen Spalt aus (chemische Signalübertragung)? 5 wichtige Aspekte:

Mehr

8.1. Zusammensetzung und Herstellung der verwendeten Medien für die In-vitro-Maturation, -Fertilisation und - Kultivierung

8.1. Zusammensetzung und Herstellung der verwendeten Medien für die In-vitro-Maturation, -Fertilisation und - Kultivierung 8. Anhang 8.1. Zusammensetzung und Herstellung der verwendeten Medien für die In-vitro-Maturation, -Fertilisation und - Kultivierung 1.) Spüllösung (modifizierte PBS-Lösung) modifizierte PBS-Lösung 500

Mehr

Zellstreckung/Phototropismus

Zellstreckung/Phototropismus Zellstreckung/Phototropismus Phototropismus Zeitrafferaufnahmen von Haferkoleoptilen, die von links mit Blaulicht bestrahlt wurden. Effektiv: Blaulicht Krümmung erfolgt durch Zellstreckung auf der dem

Mehr

Protokoll Versuch 1: VDJ-Rekombination in humanen prä-b-zellen

Protokoll Versuch 1: VDJ-Rekombination in humanen prä-b-zellen F2-Praktikum Genetik Protokoll Versuch 1: VDJ-Rekombination in humanen prä-b-zellen Gruppe 4 (Susanne Duncker, Kristin Hofmann) Einleitung Wir untersuchten in diesem Versuch die Effizienz der VDJ-Rekombination

Mehr

Regulation der Expression, Funktion und Internalisierung von muscarinischen Acetylcholinrezeptoren

Regulation der Expression, Funktion und Internalisierung von muscarinischen Acetylcholinrezeptoren 00G Regulation der Expression, Funktion und Internalisierung von muscarinischen Acetylcholinrezeptoren INAUGURAL-DISSERTATION zur Erlangung der Doktorwürde im Fachbereich Pharmazie der Freien Universität

Mehr

Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS

Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Von: Andreas Tschammer, Fachhochschule Aalen-Hochschule f. Technik und Wirtschaft, Fachbereich Chemie, Schwerpunkt Molekulare Biotechnologie Material

Mehr

Aufbau eines Assays zur Optimierung einer Polymerase für die Generierung hochgradig fluoreszenz-markierter DNA

Aufbau eines Assays zur Optimierung einer Polymerase für die Generierung hochgradig fluoreszenz-markierter DNA Aufbau eines Assays zur Optimierung einer Polymerase für die Generierung hochgradig fluoreszenz-markierter DNA Von der Naturwissenschaftlichen Fakultät der Technischen Universität Carolo-Wilhelmina zu

Mehr

1. EINLEITUNG 1 1.1 Angeborene Immunität Die erste Abwehr 1 1.2 Phagozytose und Phagosomenreifung 2 1.2.1 Phagozytose 2 1.2.2 Phagosomenreifung 3 1.3 Die vakuoläre Protonenpumpe (v-atpase) 6 1.3.1 Die

Mehr

Ligandengesteuerte Ionenkanäle

Ligandengesteuerte Ionenkanäle Das Gehirn SS 2010 Ligandengesteuerte Ionenkanäle Ligandengesteuerte Kanäle Ligand-gated ion channels LGIC Ionotrope Rezeptoren Neurotransmission Liganden Acetylcholin Glutamat GABA Glycin ATP; camp; cgmp;

Mehr

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene Übung 11 Genregulation bei Prokaryoten Konzepte: Entwicklungs /gewebespezifische Genexpression Coexpression funktional überlappender Gene Positive Genregulation Negative Genregulation cis /trans Regulation

Mehr

Das Gehirn: Eine Einführung in die Molekulare Neurobiologie. A. Baumann

Das Gehirn: Eine Einführung in die Molekulare Neurobiologie. A. Baumann Das Gehirn: Eine Einführung in die Molekulare Neurobiologie A. Baumann Das Gehirn Ligandengesteuerte Ionenkanäle Das Gehirn Ligandengesteuerte Kanäle Ligand-gated ion channels LGIC Ionotrope Rezeptoren

Mehr

Neuronale Grundlagen bei ADHD. (Attention Deficit/Hyperactivity Disorder) Mechanismen der Ritalinwirkung. Dr. Lutz Erik Koch

Neuronale Grundlagen bei ADHD. (Attention Deficit/Hyperactivity Disorder) Mechanismen der Ritalinwirkung. Dr. Lutz Erik Koch Neuronale Grundlagen bei ADHD (Attention Deficit/Hyperactivity Disorder) Mechanismen der Ritalinwirkung Dr. Lutz Erik Koch Die Verschreibung von Ritalin bleibt kontrovers Jeden Tag bekommen Millionen von

Mehr

Abbildungs- und Tabellenverzeichnis Abkürzungsverzeichnis Genbezeichnung. 1. Einleitung 1

Abbildungs- und Tabellenverzeichnis Abkürzungsverzeichnis Genbezeichnung. 1. Einleitung 1 Abbildungs- und Tabellenverzeichnis Abkürzungsverzeichnis Genbezeichnung VI VIII X 1. Einleitung 1 1.1 Das Plastom 1 1.2 Transkription in Chloroplasten 4 1.2.1 Die plastidäre Transkriptionsmaschinerie

Mehr

MPP Multiplex 2x PCR-Mastermix

MPP Multiplex 2x PCR-Mastermix Datenblatt Artikel-Nr. BS91.522.0250 250 Reaktionen in 20µl Artikel-Nr. BS91.522.1250 1250 Reaktionen a 20µl (Nur für Forschung und in vitro-anwendungen) Chargen-Nr.: Mindestens haltbar bis: Aussehen:

Mehr

Methodensammlung des LAG PCR-Nachweis von gentechnisch veränderten Organismen, die von pbr322 abgeleitete Sequenzen enthalten

Methodensammlung des LAG PCR-Nachweis von gentechnisch veränderten Organismen, die von pbr322 abgeleitete Sequenzen enthalten Methodensammlung des LAG PCR-Nachweis von gentechnisch veränderten Organismen, die von pbr322 abgeleitete Sequenzen enthalten erstellt vom Unterausschuß Methodenentwicklung des LAG 1. Zweck und Anwendungsbereich

Mehr

Expression und Funktion. von Neurotransmitterrezeptoren auf Astrozyten im intakten. Hirngewebe der Maus

Expression und Funktion. von Neurotransmitterrezeptoren auf Astrozyten im intakten. Hirngewebe der Maus Expression und Funktion von Neurotransmitterrezeptoren auf Astrozyten im intakten Hirngewebe der Maus Dissertation zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) von Dipl.-Biochem.

Mehr

M 3. Informationsübermittlung im Körper. D i e N e r v e n z e l l e a l s B a s i s e i n h e i t. im Überblick

M 3. Informationsübermittlung im Körper. D i e N e r v e n z e l l e a l s B a s i s e i n h e i t. im Überblick M 3 Informationsübermittlung im Körper D i e N e r v e n z e l l e a l s B a s i s e i n h e i t im Überblick Beabeablog 2010 N e r v e n z e l l e n ( = Neurone ) sind auf die Weiterleitung von Informationen

Mehr

6.3 Phospholipide und Signaltransduktion. Allgemeines

6.3 Phospholipide und Signaltransduktion. Allgemeines 6.3 Phospholipide und Signaltransduktion Allgemeines Bei der Signaltransduktion, das heißt der Weiterleitung von Signalen über die Zellmembran in das Innere der Zelle, denkt man zuerst einmal vor allem

Mehr

Abschlußklausur zur VorlesUD!! Biomoleküle III

Abschlußklausur zur VorlesUD!! Biomoleküle III Abschlußklausur zur VorlesUD!! Biomoleküle III Berlin, den 25. Juli 2008 SS 2008 Name: Studienfach: Matrikelnummer: Fachsemester: Hinweise: 1. Bitte tragen Sie Ihren Namen, Matrikelnummer, Studienfach

Mehr

Vorlesung Einführung in die Biopsychologie. Kapitel 4: Nervenleitung und synaptische Übertragung

Vorlesung Einführung in die Biopsychologie. Kapitel 4: Nervenleitung und synaptische Übertragung Vorlesung Einführung in die Biopsychologie Kapitel 4: Nervenleitung und synaptische Übertragung Prof. Dr. Udo Rudolph SoSe 2018 Technische Universität Chemnitz Grundlage bisher: Dieser Teil nun: Struktur

Mehr

2) Mischen Sie daraufhin das Ligationsprodukt zusammen. Dazu werden 50 µl Zellen und 2 µl Plasmid zusammengegeben

2) Mischen Sie daraufhin das Ligationsprodukt zusammen. Dazu werden 50 µl Zellen und 2 µl Plasmid zusammengegeben Translation of lab protocols Transformation Protocol 1) Stellen Sie die kompetenten Zellen auf Eis 2) Mischen Sie daraufhin das Ligationsprodukt zusammen. Dazu werden 50 µl Zellen und 2 µl Plasmid zusammengegeben

Mehr

Abbildung 1: Schematische Darstellung der Domänenorganisation von Survivin

Abbildung 1: Schematische Darstellung der Domänenorganisation von Survivin Abbildung 1: Schematische Darstellung der Domänenorganisation von Survivin Survivin weist eine N-terminale BIR-Domäne (grün) und eine C-terminale α-helix (blau) auf. Das intrinsische nuclear export signal

Mehr

Von der Synapse zum Lerneffekt

Von der Synapse zum Lerneffekt Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/von-der-synapse-zumlerneffekt/ Von der Synapse zum Lerneffekt Was Hänschen nicht lernt, lernt Hans nimmermehr - so

Mehr

Vorlesung Neurophysiologie

Vorlesung Neurophysiologie Vorlesung Neurophysiologie Detlev Schild Abt. Neurophysiologie und zelluläre Biophysik dschild@gwdg.de Vorlesung Neurophysiologie Detlev Schild Abt. Neurophysiologie und zelluläre Biophysik dschild@gwdg.de

Mehr

Neurobiologie. Prof. Dr. Bernd Grünewald, Institut für Bienenkunde, FB Biowissenschaften

Neurobiologie. Prof. Dr. Bernd Grünewald, Institut für Bienenkunde, FB Biowissenschaften Neurobiologie Prof. Dr. Bernd Grünewald, Institut für Bienenkunde, FB Biowissenschaften www.institut-fuer-bienenkunde.de b.gruenewald@bio.uni-frankfurt.de Synapsen I Ausschüttung von Transmitter - Synapsentypen

Mehr

Molekulare Anpassungen an der aktiven Zone der Photorezeptor-Bandsynapsen

Molekulare Anpassungen an der aktiven Zone der Photorezeptor-Bandsynapsen Molekulare Anpassungen an der aktiven Zone der Photorezeptor-Bandsynapsen Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer.

Mehr

Neurobiologie. Prof. Dr. Bernd Grünewald, Institut für Bienenkunde, FB Biowissenschaften

Neurobiologie. Prof. Dr. Bernd Grünewald, Institut für Bienenkunde, FB Biowissenschaften Neurobiologie Prof. Dr. Bernd Grünewald, Institut für Bienenkunde, FB Biowissenschaften www.institut-fuer-bienenkunde.de b.gruenewald@bio.uni-frankfurt.de Synapsen II Die postsynaptische Membran - Synapsentypen

Mehr

Identifikation einer neuen WRKY-Transkriptionsfaktorbindungsstelle. in bioinformatisch identifizierten,

Identifikation einer neuen WRKY-Transkriptionsfaktorbindungsstelle. in bioinformatisch identifizierten, Identifikation einer neuen WRKY-Transkriptionsfaktorbindungsstelle in bioinformatisch identifizierten, Pathogen-responsiven c/s-elementen aus Arabidopsis thaliana Von der Fakultät für Lebenswissenschaften

Mehr

Abkürzungsverzeichnis... VII. 1. Einleitung Regulation intrazellulärer Signalwege durch camp Optogenetische Methoden...

Abkürzungsverzeichnis... VII. 1. Einleitung Regulation intrazellulärer Signalwege durch camp Optogenetische Methoden... I Abkürzungsverzeichnis... VII 1. Einleitung... 13 1.1 Regulation intrazellulärer Signalwege durch camp... 13 1.2 Optogenetische Methoden... 15 1.3 camp-abhängige Mechanismen synaptischer Plastizität...

Mehr

The Arabidopsis F-box protein TIR1 is an auxin receptor. Von Stefan Kepinski & Ottoline Leyser

The Arabidopsis F-box protein TIR1 is an auxin receptor. Von Stefan Kepinski & Ottoline Leyser The Arabidopsis F-box protein TIR1 is an auxin receptor Von Stefan Kepinski & Ottoline Leyser Bekanntes Modell Was war bekannt? In der Zwischenzeit gefunden: - ABP1 kann große Mengen Auxin binden und ist

Mehr

Verteilen von Proteinen innerhalb der Zelle

Verteilen von Proteinen innerhalb der Zelle Verteilen von Proteinen innerhalb der Zelle cytosolische Proteine Proteine, die direkt in Organellen transportiert werden Proteine, die über das ER transportiert werden Regulation der eukaryontischen Genexpression

Mehr

Das Wichtigste: 3 Grundlagen der Erregungs- und Neurophysiologie. - Erregungsausbreitung -

Das Wichtigste: 3 Grundlagen der Erregungs- und Neurophysiologie. - Erregungsausbreitung - Das Wichtigste Das Wichtigste: 3 Grundlagen der Erregungs- und Neurophysiologie - Erregungsausbreitung - Das Wichtigste: 3.4 Erregungsleitung 3.4 Erregungsleitung Elektrotonus Die Erregungsausbreitung

Mehr

Synaptische Transmission

Synaptische Transmission Synaptische Transmission Wie lösen APe, die an den Endknöpfchen der Axone ankommen, die Freisetzung von Neurotransmittern in den synaptischen Spalt aus (chemische Signalübertragung)? 5 wichtige Aspekte:

Mehr

Neurobiologie. Prof. Dr. Bernd Grünewald, Institut für Bienenkunde, FB Biowissenschaften

Neurobiologie. Prof. Dr. Bernd Grünewald, Institut für Bienenkunde, FB Biowissenschaften Neurobiologie Prof. Dr. Bernd Grünewald, Institut für Bienenkunde, FB Biowissenschaften www.institut-fuer-bienenkunde.de b.gruenewald@bio.uni-frankfurt.de Synapsen I Präsynaptische Ereignisse - Synapsentypen

Mehr

Testfragen zur 1. Vorlesung in Biochemie

Testfragen zur 1. Vorlesung in Biochemie Testfragen zur 1. Vorlesung in Biochemie 1. Nennen Sie die zentralen Komponenten des Zwei-Komponenten-Systems 2. Auf welche Aminosäurereste werden die Phosphatgruppen übertragen? 3. Was wird bei der Chemotaxis

Mehr

Die Rolle roter Blutzellen bei der Thrombusbildung. Alexandra Maas 12. Dezember 2012 Betreuer: Prof. I. Bernhardt

Die Rolle roter Blutzellen bei der Thrombusbildung. Alexandra Maas 12. Dezember 2012 Betreuer: Prof. I. Bernhardt Die Rolle roter Blutzellen bei der Thrombusbildung Alexandra Maas 12. Dezember 2012 Betreuer: Prof. I. Bernhardt Inhalt Grundlagen Verteilung der Phospholipide in roten Blutzellen (RBCs) Hämostase Modell

Mehr

Neurobiologie des Lernens. Hebb Postulat Die synaptische Verbindung von zwei gleichzeitig erregten Zellen wird verstärkt

Neurobiologie des Lernens. Hebb Postulat Die synaptische Verbindung von zwei gleichzeitig erregten Zellen wird verstärkt Neurobiologie des Lernens Hebb Postulat 1949 Die synaptische Verbindung von zwei gleichzeitig erregten Zellen wird verstärkt Bliss & Lomo fanden 1973 langdauernde Veränderungen der synaptischen Aktivität,

Mehr

Conotoxine. Von Dominic Hündgen und Evgeni Drobjasko

Conotoxine. Von Dominic Hündgen und Evgeni Drobjasko Conotoxine Von Dominic Hündgen und Evgeni Drobjasko Inhalt Vorkommen Aufbau/Arten Wirkungsweise Therapie und Nutzen 2 Vorkommen Gruppe von Toxinen aus der Kegelschnecken-Gattung Conus 600 anerkannte Arten

Mehr

Posttranskriptionale Veränderungen der Genexpression bei hereditären Erkrankungen

Posttranskriptionale Veränderungen der Genexpression bei hereditären Erkrankungen Posttranskriptionale Veränderungen der Genexpression bei hereditären Erkrankungen Dissertation zur Erlangung des Doktorgrades Dr. rer. nat. des Fachbereichs Biologie, Chemie, Pharmazie der Freien Universität

Mehr

Ca - Antagonisten. Ca-Kanal-Proteine

Ca - Antagonisten. Ca-Kanal-Proteine Ca - Antagonisten Unter Ca-Antagonisten werden Arzneistoffe verstanden, die den Einstrom von Ca-Ionen in die Zelle durch die Ca-Kanäle verhindern. Sie werden auch als Ca-Kanal-Blocker bezeichnet. Die derzeit

Mehr

abiweb NEUROBIOLOGIE 17. März 2015 Webinar zur Abiturvorbereitung

abiweb NEUROBIOLOGIE 17. März 2015 Webinar zur Abiturvorbereitung abiweb NEUROBIOLOGIE 17. März 2015 Webinar zur Abiturvorbereitung Bau Nervenzelle Neuron (Nervenzelle) Dentrit Zellkörper Axon Synapse Gliazelle (Isolierung) Bau Nervenzelle Bau Nervenzelle Neurobiologie

Mehr

Bronchitis: Neueste Erkenntnisse zu Wirkmechanismus von Efeu

Bronchitis: Neueste Erkenntnisse zu Wirkmechanismus von Efeu Bronchitis: Neueste Erkenntnisse zu Wirkmechanismus von Efeu Prof. Dr. Hanns Häberlein Institut für Biochemie und Molekularbiologie Universität Bonn Indikationen für die Anwendung von Efeublätter Trockenextrakt:

Mehr

VL. 3 Prüfungsfragen:

VL. 3 Prüfungsfragen: VL. 3 Prüfungsfragen: - Wie entsteht ein Aktionspotential (AP)? - Welche Ionenkanäle sind am AP beteiligt? - Skizzieren Sie in einem Achsensystem den Verlauf eines APs. Benennen Sie wichtige Potentiale.

Mehr

TEV Protease, rekombinant (Kat.-Nr )

TEV Protease, rekombinant (Kat.-Nr ) GEBRAUCHSANLEITUNG TEV Protease, rekombinant (Kat.-Nr. 36403) SERVA Electrophoresis GmbH - Carl-Benz-Str. 7-69115 Heidelberg Phone +49-6221-138400, Fax +49-6221-1384010 e-mail: info@serva.de -http://www.serva.de

Mehr

Molekulare Klonierung Praktikum

Molekulare Klonierung Praktikum Molekulare Klonierung Praktikum 2013 Praktikumsaufgabe Ligation 1. Zusammensetzung des Ligationsreaktions-ansatzes : 1 l Vektor DNA 1 l Insert DNA 2 l 10X Ligase Puffer 15 l destillertes Wasser 1 l Ligase

Mehr

Signaltransduktion durch Zell-Zell und Zell-Matrix Kontakte

Signaltransduktion durch Zell-Zell und Zell-Matrix Kontakte Signaltransduktion durch Zell-Zell und Zell-Matrix Kontakte - Integrine als zentrale Adhäsionsrezeptoren - - Focal Adhesion Kinase (FAK) als zentrales Signalmolekül - Regulation von Zellfunktionen durch

Mehr

Protokoll Versuch A2 Expressionstests von D1D2 in verschiedenen E. coli-stämmen

Protokoll Versuch A2 Expressionstests von D1D2 in verschiedenen E. coli-stämmen Protokoll Versuch A2 Expressionstests von D1D2 in verschiedenen E. coli-stämmen Gruppe 8 Susanne Duncker und Friedrich Hahn Einleitung und Aufgabenstellung In Versuch A1 stellten wir einen das Gen für

Mehr

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.)

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.) Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen Die verschiedenen Ribosomen-Komplexe können im Elektronenmikroskop beobachtet werden Durch Röntgenkristallographie wurden

Mehr

Abbildungen Schandry, 2006 Quelle: www.ich-bin-einradfahrer.de Abbildungen Schandry, 2006 Informationsvermittlung im Körper Pioniere der Neurowissenschaften: Santiago Ramón y Cajal (1852-1934) Camillo

Mehr

Funktionsprinzipien von Synapsen

Funktionsprinzipien von Synapsen 17.3.2006 Funktionsprinzipien von Synapsen Andreas Draguhn Aufbau Transmitter und präsynaptische Vesikel Postsynaptische Rezeptoren Funktion einzelner Synapsen Prinzipien der Informationsverarbeitung:

Mehr

Zelluläre Kommunikation

Zelluläre Kommunikation Zelluläre Kommunikation 1. Prinzipien der zellulären Kommunikation?? 2. Kommunikation bei Nervenzellen Die Zellen des Nervensystems Nervenzellen = Neuronen Gliazellen ( Glia ) Astrozyten Oligodendrozyten

Mehr

Transkription Teil 2. - Transkription bei Eukaryoten -

Transkription Teil 2. - Transkription bei Eukaryoten - Transkription Teil 2 - Transkription bei Eukaryoten - Inhalte: Unterschiede in der Transkription von Pro- und Eukaryoten Die RNA-Polymerasen der Eukaryoten Cis- und trans-aktive Elemente Promotoren Transkriptionsfaktoren

Mehr

Das Komplettmedium ist für die Expression rekombinanter Proteine geeignet.

Das Komplettmedium ist für die Expression rekombinanter Proteine geeignet. Sf21 21-Zellen in : Wachstumsverlauf und Infektion mit Baculovirus Biochrom AG Information Das Insektenzellmedium der Biochrom AG eignet sich zur Kultivierung von Spodoptera frugiperda und Drosophila melanogaster-

Mehr

3,58 g 0,136 g. ad 100 ml

3,58 g 0,136 g. ad 100 ml 9 Anhang 9.1 Rezepturen der Puffer und Lösungen 9.1.1 Vorbereitung der Proben zur Extraktion Coon s-puffer (0,1 M, ph 7,2-7,6) Na 2 HPO 4 x 12 H 2 O KH 2 PO 4 Aqua dest. 3,58 g 0,136 g 8,77 g 9.1.2 Aufbereitung

Mehr

Die Entwicklung der Gefühle: Aspekte aus der Hirnforschung. Andreas Lüthi, Friedrich Miescher Institut, Basel

Die Entwicklung der Gefühle: Aspekte aus der Hirnforschung. Andreas Lüthi, Friedrich Miescher Institut, Basel Die Entwicklung der Gefühle: Aspekte aus der Hirnforschung Andreas Lüthi, Friedrich Miescher Institut, Basel Wie lernen wir Angst zu haben? Wie kann das Gehirn die Angst wieder loswerden? Angst und Entwicklung

Mehr

Tab. 2-1: TKZT-Zelllinien, Herkunft, histologische Eigenschaften und Referenzen

Tab. 2-1: TKZT-Zelllinien, Herkunft, histologische Eigenschaften und Referenzen Material 28 2 MATERIAL 2.1 Zelllinien In der vorliegenden Studie wurden etablierte Zelllinien von nichtseminomatösen TKZT untersucht. Die Untersuchungen wurden zunächst an den drei Zelllinien H12.1, 2102EP

Mehr

SCRIPTUM HIGH PRECISE

SCRIPTUM HIGH PRECISE Nur für Forschungszwecke Datenblatt Artikel BS.50.020 = 20 Reaktionen x 50 µl Artikel BS.50.100 = 100 Reaktionen x 50 µl Artikel BS.50. 500 = 500 Reaktionen x 50 µl Haltbarkeit: 12 Monate Lagerung bei

Mehr

Membranen. U. Albrecht

Membranen. U. Albrecht Membranen Struktur einer Plasmamembran Moleküle gegeneinander beweglich -> flüssiger Charakter Fluidität abhängig von 1) Lipidzusammensetzung (gesättigt/ungesättigt) 2) Umgebungstemperatur Biologische

Mehr

Phalloidin-Färbung an kultivierten adhärenten Säugerzellen. Formaldehyd-Fixierung

Phalloidin-Färbung an kultivierten adhärenten Säugerzellen. Formaldehyd-Fixierung Phalloidin-Färbung an kultivierten adhärenten Säugerzellen Formaldehyd-Fixierung 2 Materialien Pinzetten Für das Handling der Zellen ist es empfehlenswert Pinzetten mit sehr feiner Spitze zu nutzen. Hier

Mehr

Aus dem Julius-Bernstein-Institut für Physiologie an der Martin-Luther-Universität Halle-Wittenberg (Direktor: Prof. Dr. med. habil. G.

Aus dem Julius-Bernstein-Institut für Physiologie an der Martin-Luther-Universität Halle-Wittenberg (Direktor: Prof. Dr. med. habil. G. Aus dem Julius-Bernstein-Institut für Physiologie an der Martin-Luther-Universität Halle-Wittenberg (Direktor: Prof. Dr. med. habil. G. Isenberg) Der desynchronisierende Effekt des Endothels auf die Kinetik

Mehr

Vertiefendes Seminar zur Vorlesung Biochemie I

Vertiefendes Seminar zur Vorlesung Biochemie I Vertiefendes Seminar zur Vorlesung Biochemie I 30.01.2015 Klausurvorbereitung: Gerhild van Echten-Deckert Rekombinante DNA Fon. +49-228-732703 Homepage: http://www.limes.uni-bonn.de Klärung einiger Begriffe:

Mehr