Liquid biopsy markers praktikabel, doch uns fehlt der richtige Marker

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Liquid biopsy markers praktikabel, doch uns fehlt der richtige Marker"

Transkript

1 Liquid biopsy markers praktikabel, doch uns fehlt der richtige Marker PD Dr. C. Schem, MaHM

2 Was sind liquid biopsy markers?

3 Wofür liquid biopsy markers? Therapieauswahl & Monitoring zur Vermeidung von ineffektiven Therapien und unnötigen Nebenwirkungen Evaluation neuer Therapeutika Analyse immunologischer Reaktionen Therapie Monitoring erfolgt meist über die Bildgebung Strahlenbelastung Belastung für die Patientin Schnellere/frühere Reaktion auf Veränderungen Neue zuverlässige Biomarker mit verbesserter Sensitivität und hoher Spezifität sind von großem klinischen Interesse

4 Wanted: Biomarker mit hoher Spezifität und Sensibilität Cancer Antigen CA 15-3 hat eine Sensitivität von 60-70% Große Schwankungen im Messwert (u.a. metabolische Einflüsse) Messung von zirkulierenden Tumorzellen CellSearch System (FDA approved) Sensitivität von 65% 1 Zelle in 7,5 ml Blut >5 Zellen/7,5ml Blut Verschlechterung der Prognose Einzelzellanalyse von zirkulierenden Tumorzellen möglich

5 Was läuft hierzu in der GBG? HER2 im Serum (CTC s, micrna in Quattro, Quinto) Müller V 1, Gade S, Steinbach B, Loibl S, von Minckwitz G, Untch M, Schwedler K, Lübbe K, Schem C, Fasching PA, Mau C, Pantel K, Schwarzenbach H. Changes in serum levels of mir-21, mir-210, and mir-373 in HER2-positive breast cancer patients undergoing neoadjuvant therapy: a translational research project within the Geparquinto trial. Breast Cancer Res Treat Aug;147(1):61-8. Witzel I, Loibl S, von Minckwitz G, Eidtmann H, Fehm T, Khandan F, Schmatloch S, Hauschild M, Bischoff J, Fasching PA, Mau C, Schem C, Rack B, Meinhold-Heerlein I, Liedtke C, Karn T, Huober J, Zu Eulenburg C, Issa-Nummer Y, Untch M, Müller V. Predictive value of HER2 serum levels in patients treated with lapatinib or trastuzumab - a translational project in the neoadjuvant GeparQuinto trial. Br J Cancer Sep 4;107(6):

6 Beispiel: Zirkulierende DNA-Fragmente Werden in der zellfreien Blutfraktion gefunden (Plasma) Repräsentieren nur einen kleinen Teil der zirkulierenden DNA Moderne Sequenzierung ermöglicht eine schnelle Identifikation von somatischen, genomischen Veränderungen Diese Veränderungen machen personalisierte Assays für das Monitoring möglich Initialstudien haben mit verschiedenen soliden Tumoren ein proof of concept vorgelegt (niedrige Fallzahlen)

7 Ist diese Technologie jetzt Ready for Prime-Time?

8 Dawson SJ et al. - Methoden Direkter Vergleich von CA15-3 und zirkulierenden Tumorzellen, Bildgebung (CT) mit ctdna Single-center Studie Einschlusskriterien: Patientinnen mit metastasiertem Mammakarzinom unter Behandlung 52 Patientinnen rekrutiert 30 Patientinnen zeigten genomische Veränderungen im Tumor, die ein Monitoring ermöglichen (60%) Serielle Blutentnahmen 4/2010 und 4/2012 über 3 oder mehr Wochen CT-Analyse erfolgte verblindet nach RECIST-Kriterien (Version 1.1)

9 Dawson SJ et al. - Methoden Identifikation der somatischen genomischen Veränderungen: Sequenzierung anhand der DNA des Primarius Mutationen und strukturelle Variationen: PIK3CA und TP53 Paired-end whole-genome Sequencing Kandidatengenmutationen und strukturelle Varianten wurden mit Hilfe der Sanger-Sequenzierung als somatisch validiert

10 Dawson SJ et al. - Methoden Die DNA-Isolation erfolgt aus dem Plasma Die DNA mit den spezifischen Varianten und Mutationen wurden mit Hilfe einer quantitativ digitalen PCR identifiziert CA 15-3 Assay aus dem Plasma als Immunoassay Zirkulierende Tumorzellen aus dem Vollblut innerhalb von 96 Stunden (CellSearchSystem Veridex, USA) Die Auswertung erfolgt jeweils verblindet (z.b. Bildgebung)

11 In 97% (29 von 30 Pat.) Konnte ctdna nachgewiesen werden In 60% (30 von 52) konnten entweder Mutationen oder SV nachgewiesen werden CA 15-3 in 78% (21 von 27) ctc in 87% (26 von 30) Die ctdna zeigt eine größere Variationsbreite und eine bessere Korrelation mit der Tumorlast Die ctdna liefert die frühsten Veränderungen bei Therapieansprechen Mediane DNA-Menge: 150 Kopien/ml Plasma

12 Die Methode ist quantitativ (A) Verschiedene Mutationen zeigen denselben Verlauf (B) Es gibt aber klonale Heterogenität mit dominierenden Mutationen (C) Veränderungen zu verschiedenen Zeitpunkten der Tumorevolution verhalten sich unterschiedlich (D)

13 Überlegende Sensitivität im Vergleich CA15-3 und ctc

14

15 Ausblick Screening bei Rezidiv Gefahr einer asymptomatischen Patientin. Zunächst muss der Nutzen aber im Patienten Outcome bewiesen werden! Die Technologie liefert die Identifikation neuer Mutationen und Informationen über die personalisierte Tumorevolution - mögliche Targets, die aus dem Primärtumor nicht ersichtlich sind. Eine Verknüpfung der genetischen Informationen mit dem klinischen Phänotyp des Tumors (Signaltransduktionswege) stellt die größte Herausforderung dar.

16 Liquid biopsy markers - Fazit Das Proof of concept für die ctdna als sensitiver Biomarker ist erbracht! Ob das Überleben der Patientinnen verbessert werden kann bleibt zu beweisen! Die technologischen Entwicklungen und den damit verbundenen Preisentwicklungen spielen bei der Etablierung des Markers die entscheidende Rolle

17 Preisentwicklung des Deep-Sequencing DNALDI

Liquid biopsy markers

Liquid biopsy markers Liquid biopsy markers Alle Welt redet davon Wo stehen wir, was macht die GBG? PD Dr. Christian Schem, MaHM Universitätsklinikum Schleswig-Holstein Campus Kiel Was sind liquid biopsy markers? Wofür liquid

Mehr

Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: "Hip or Hype"

Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: Hip or Hype Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: "Hip or Hype" 3. Nationales Biobankensymposium 2014 Berlin, 04.12.2014 Prof. Dr. rer. nat Edgar Dahl RWTH zentralisierte Biomaterialbank

Mehr

DETECT III DETECT III

DETECT III DETECT III DETECT III Eine prospektive, randomisierte, zweiarmige, multizentrische Phase III Studie zum Vergleich Standardtherapie versusstandardtherapie mit Lapatinib bei metastasierten Patientinnen mit initial

Mehr

Früherkennung durch Bildgebung Neueste Entwicklungen

Früherkennung durch Bildgebung Neueste Entwicklungen Früherkennung durch Bildgebung Neueste Entwicklungen Dr. K. Holzapfel Institut für Radiologie Klinikum rechts der Isar Technische Universität München Aufgaben der Bildgebung in der Onkologie Tumordetektion

Mehr

1. Neoadjuvante Therapie. 2. Adjuvante Therapie. 3. Metastasiertes Mamma-Ca. 4. Mamma-Ca. in der Schwangerschaft. 5. Nicht-interventionelle Studien

1. Neoadjuvante Therapie. 2. Adjuvante Therapie. 3. Metastasiertes Mamma-Ca. 4. Mamma-Ca. in der Schwangerschaft. 5. Nicht-interventionelle Studien 1. Neoadjuvante Therapie GeparOcto-Studie Penelope-Studie 2. Adjuvante Therapie GAIN II-Studie Adapt-Studie Katherine-Studie TREAT CTC-Studie 3. Metastasiertes Mamma-Ca. First-line Therapie: Ab Second-line

Mehr

mi-rna, zirkulierende DNA

mi-rna, zirkulierende DNA Erbsubstanz: Grundlagen und Klinik mi-rna, zirkulierende DNA 26.11.2010 Ingolf Juhasz-Böss Homburg / Saar Klinische Erfahrungen zirkulierende mirna erstmals 2008 im Serum von B-Zell Lymphomen beschrieben

Mehr

Endokrine und zielgerichtete Therapie des metastasierten Mammakarzinoms

Endokrine und zielgerichtete Therapie des metastasierten Mammakarzinoms Diagnostik und Therapie primärer und metastasierter Mammakarzinome AGO e. V. Version 2015.1D Endokrine und zielgerichtete Therapie des metastasierten Mammakarzinoms Endokrine Therapie des metastasierten

Mehr

Cerebrale Metastasierung warum?

Cerebrale Metastasierung warum? Molekulare Erklärungen für klinische Beobachtungen Cerebrale Metastasierung warum? Volkmar Müller Klinik für Gynäkologie, Brustzentrum am UKE Universitätsklinikum Hamburg-Eppendorf Cerebrale Metastasierung

Mehr

Implementierung und Evaluation personalisierter Therapie: Das Netzwerk Genomische Medizin

Implementierung und Evaluation personalisierter Therapie: Das Netzwerk Genomische Medizin MSD Forum Gesundheitspartner Workshop 5: Zielorientiertes Gesundheits-Management wie geht s? Implementierung und Evaluation personalisierter Therapie: Das Netzwerk Genomische Medizin Jürgen Wolf Klinik

Mehr

ADAPT. Adjuvant Dynamic marker- Adjusted Personalized Therapy trial optimizing risk assessment and therapy response prediction in early breast cancer

ADAPT. Adjuvant Dynamic marker- Adjusted Personalized Therapy trial optimizing risk assessment and therapy response prediction in early breast cancer ADAPT Adjuvant Dynamic marker- Adjusted Personalized Therapy trial optimizing risk assessment and therapy response prediction in early breast cancer 1 The ADAPT Design : optimale Prognoseabschätzung nduktionstherapie

Mehr

Hintergrund. Bedeutung des Nachweises von CTC in der metastasierten Situation

Hintergrund. Bedeutung des Nachweises von CTC in der metastasierten Situation Hintergrund Für die Kommission Mamma: Prof. Dr. Volkmar Müller, Prof. Dr. Wolfgang Janni Für die Kommission Translationale Forschung: PD. Dr. Brigitte Rack, Prof. Dr. Tanja Fehm Unter Mitarbeit von Prof.

Mehr

HER2 resistance - können wir den richtigen Prädiktor finden?

HER2 resistance - können wir den richtigen Prädiktor finden? HER2 resistance - können wir den richtigen Prädiktor finden? Volkmar Müller Klinik für Gynäkologie, Brustzentrum am UKE Universitätsklinikum Hamburg-Eppendorf Heilung durch Innovation, Kompetenz und Partnerschaft

Mehr

Onkologie. Individualisierte Therapie Beispiel: Brustkrebs. K. Possinger

Onkologie. Individualisierte Therapie Beispiel: Brustkrebs. K. Possinger Onkologie Individualisierte Therapie Beispiel: Brustkrebs Med. Klinik für Onkologie und Hämatologie Charité Campus Mitte Universitätsmedizin Berlin K. Possinger Überleben bei Brustkrebs 1978 2006 (Tumorregister

Mehr

improvement of patient outcome

improvement of patient outcome BrainMet - GBG 79 Brain Metastases in Breast Cancer Network Germany (BMBC) Meeting a clinical need for the improvement of patient outcome Priv. Doz. Dr. Marc Thill, AGAPLESION MARKUS KRANKENHAUS, Frankfurt

Mehr

Post St. Gallen Chemo- und Immuntherapie

Post St. Gallen Chemo- und Immuntherapie Post St. Gallen 2009 Chemo- und Immuntherapie Rupert Bartsch Universitätsklinik für Innere Medizin 1 Klinische Abteilung für Onkologie 1 Neue Daten von HERA und FinHER Empfehlungen des Panels zu Adjuvanten

Mehr

New Kids on the Block. welche Studienkonzepte führen. in die Klinik

New Kids on the Block. welche Studienkonzepte führen. in die Klinik New Kids on the Block welche Studienkonzepte führen in die Klinik Gunter von Minckwitz German Breast Group und Senologische Onkologie Düsseldorf HE2 positive Breast Cancer Heilung durch Innovation, Kompetenz

Mehr

Neoadjuvante (Primäre) systemische Therapie

Neoadjuvante (Primäre) systemische Therapie Diagnosis Diagnostik and und Treatment Therapie of primärer Patients with und Primary metastasierter and Metastatic Mammakarzinome Breast Cancer AGO e. V. Neoadjuvante (Primäre) systemische Therapie Neoadjuvante

Mehr

Roche in Deutschland Strategie in der Zusammenarbeit mit Forschern und Kliniken Gerd Maass, Leiter Translational Research Office

Roche in Deutschland Strategie in der Zusammenarbeit mit Forschern und Kliniken Gerd Maass, Leiter Translational Research Office Roche in Deutschland Strategie in der Zusammenarbeit mit Forschern und Kliniken Gerd Maass, Leiter Translational Research Office München, 17. Juni 2013 Roche Ansatz zur Pharma Innovation Diversität in

Mehr

Primäre systemische Therapie PST

Primäre systemische Therapie PST Primäre systemische Therapie PST Primäre systemische Therapie (PST) Version 2002: Costa Version 2003: Kaufmann / Untch Version 2004: Nitz / Heinrich Version 2005: Schneeweiss / Dall Version 2006: Göhring

Mehr

Post Chicago 2015 Metastasiertes Mammakarzinom. P. Mallmann

Post Chicago 2015 Metastasiertes Mammakarzinom. P. Mallmann Post Chicago 2015 Metastasiertes Mammakarzinom P. Mallmann Metastasiertes Mammakarzinom 1. Hormonrezeptorpositives Mammakarzinom 2. HER 2 neu positives Mammakarzinom 3. Triple negatives Mammakarzinom 4.

Mehr

Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie

Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie Zielgerichtete personalisierte Tumortherapie was gibt es Neues in der Onkologie Prof. Dr. Wolfgang Herr Innere Medizin III Hämatologie und intern. Onkologie Klinik und Poliklinik für Innere Medizin III

Mehr

S3-Leitlinie Exokrines Pankreaskarzinom : Empfehlung für die Kombinationstherapie mit Tarceva

S3-Leitlinie Exokrines Pankreaskarzinom : Empfehlung für die Kombinationstherapie mit Tarceva S3-Leitlinie Exokrines Pankreaskarzinom : Empfehlung für die Kombinationstherapie mit Tarceva München (20. Mai 2008) - Die Zulassung von Erlotinib (Tarceva ) in der Indikation Pankreaskarzinom gilt als

Mehr

T Zell Diagnostik Eine neue Welt öffnet sich

T Zell Diagnostik Eine neue Welt öffnet sich T Zell Diagnostik Eine neue Welt öffnet sich Prof. Dr. Martina Sester Abteilung für Transplantations und Infektionsimmunologie Institut für Virologie Universität des Saarlandes 66421 Homburg Tel.: 06841

Mehr

Innovationen der Medizintechnik

Innovationen der Medizintechnik Innovationen der Medizintechnik Verbesserte Früherkennung und Therapie- Kontrolle durch nuklearmed. Verfahren Winfried Brenner Klinik für Nuklearmedizin Innovation Nutzen Kosten Innovationen verbesserte

Mehr

HIPEC noch Wissenschaft oder schon Routine in der Rezidivsituation? Walther Kuhn Universitätsfrauenklinik, Bonn

HIPEC noch Wissenschaft oder schon Routine in der Rezidivsituation? Walther Kuhn Universitätsfrauenklinik, Bonn HIPEC noch Wissenschaft oder schon Routine in der Rezidivsituation? Walther Kuhn Universitätsfrauenklinik, Bonn Intraperitoneale Therapie: Rationale Ovarialkarzinom-Peritoneale Erkrankung Intraperitoneale

Mehr

Bisphosphonate und der RANKL-Antikörper Denosumab

Bisphosphonate und der RANKL-Antikörper Denosumab Diagnostik und Therapie primärer und metastasierter Mammakarzinome D Bisphosphonate und der RANKL-Antikörper Denosumab Bisphosphonate und RANKL-Antikörper Denosumab Versionen bis 2011: Diel / Fehm/ Friedrich/

Mehr

TNBC und BRCAness - Neue Therapieoptionenen -

TNBC und BRCAness - Neue Therapieoptionenen - TNBC und BRCAness - Neue Therapieoptionenen - Priv.-Doz. Dr. med. Cornelia Liedtke - Direktor: Prof. Dr. med. Achim Rody - Universitätsklinikum Schleswig-Holstein / Campus Lübeck Zusammenhang zwischen

Mehr

Gute Überlebensqualität Trastuzumab beim metastasierten Magenkarzinom

Gute Überlebensqualität Trastuzumab beim metastasierten Magenkarzinom Gute Überlebensqualität Trastuzumab beim metastasierten Magenkarzinom München (24. April 2012) - Mit dem monoklonalen Antikörper Trastuzumab (Herceptin ) steht bislang die einzige zielgerichtete Substanz

Mehr

Individualisierte Medizin und Gendiagnostik: Beispiel (Lungen) - Krebs

Individualisierte Medizin und Gendiagnostik: Beispiel (Lungen) - Krebs Individualisierte Medizin und Gendiagnostik: Beispiel (Lungen) - Krebs Jürgen Wolf Klinik I für Innere Medizin Centrum für Integrierte Onkologie Uniklinik Köln (Lungen-) Krebs setzt sich aus vielen Untergruppen

Mehr

Adjuvante zytostatische und zielgerichtete Therapien

Adjuvante zytostatische und zielgerichtete Therapien Diagnostik und Therapie primärer und metastasierter Mammakarzinome Adjuvante zytostatische und zielgerichtete Therapien Adjuvante zytostatische und zielgerichtete Therapien Version 2002: Möbus / Nitz Versionen

Mehr

Register zum Mammakarzinom in der.

Register zum Mammakarzinom in der. Register zum Mammakarzinom in der Schwangerschaft GBG-29 / BIG 02-03 www.germanbreastgroup.de/pregnancy Dr. Mattea Reinisch Kliniken Essen-Mitte Zielkriterien Primäres Zielkriterium: Fetales Outcome nach

Mehr

Führt der molekulare Ansatz in der Pathologie zum Durchbruch in der personalisierten Onkologie?

Führt der molekulare Ansatz in der Pathologie zum Durchbruch in der personalisierten Onkologie? SULM - Bern June 25, 2015 Führt der molekulare Ansatz in der Pathologie zum Durchbruch in der personalisierten Onkologie? Joachim Diebold Luzerner Kantonsspital Pathologisches Institut Herr FU 1962 Amateur-Marathonläufer,

Mehr

Bedeutung des Nachweises von CTC in der metastasierten Situation

Bedeutung des Nachweises von CTC in der metastasierten Situation Hintergrund Für die Kommission Mamma: Prof. Dr. Volkmar Müller, Prof. Dr. Wolfgang Janni Für die Kommission Translationale Forschung: PD Dr. Brigitte Rack, Prof. Dr. Tanja Fehm Unter Mitarbeit von Prof.

Mehr

Neue Diagnostik für akute myeloische Leukämie

Neue Diagnostik für akute myeloische Leukämie Neue Diagnostik für akute myeloische Leukämie Neuherberg (9. März 2011) - Wissenschaftler des Helmholtz Zentrums München und der Ludwig-Maximilians-Universität München haben eine Methode entwickelt, mit

Mehr

Personalisierte Medizin: Genetische Analyse zirkulierender Tumorzellen mittels eines mikrofluidischen Chipsystems

Personalisierte Medizin: Genetische Analyse zirkulierender Tumorzellen mittels eines mikrofluidischen Chipsystems 16. Heiligenstädter Kolloquium, IBA Heilbad Heiligenstadt, 2012-09-25 Personalisierte Medizin: Genetische Analyse zirkulierender Tumorzellen mittels eines mikrofluidischen Chipsystems Christine Steinbach

Mehr

Nicht-invasive molekulargenetische Pränataldiagnostik

Nicht-invasive molekulargenetische Pränataldiagnostik Nicht-invasive molekulargenetische Pränataldiagnostik Dr. rer. medic. Wera Hofmann Medical Director LifeCodexx AG Dr. Wera Hofmann, Medical Director Porto, ECA 2011 July 2, 2011 page 1 2011 LifeCodexx

Mehr

PET/CT beim Prostatakarzinom. Stefan Dresel HELIOS Klinikum Berlin Klinik für Nuklearmedizin

PET/CT beim Prostatakarzinom. Stefan Dresel HELIOS Klinikum Berlin Klinik für Nuklearmedizin PET/CT beim Prostatakarzinom Stefan Dresel HELIOS Klinikum Berlin Ga-68 PSMA PET und CT CT Funktionell metabolische Funktion fehlt Reaktion morphologischer Strukturen auf Therapie spät Differenzierung

Mehr

ASCO 2015 Neues zur Therapie des HER2-positiven Mammakarzinoms

ASCO 2015 Neues zur Therapie des HER2-positiven Mammakarzinoms ASCO 2015 Neues zur Therapie des HER2-positiven Mammakarzinoms Bonn (16. Juni 2015) - Ein Schwerpunkt des weltweit größten Krebskongresses, der 51. Jahrestagung der American Society of Clinical Oncology

Mehr

IMPACT. IMmunoglobulins Purified for Anti- Cancer Therapy

IMPACT. IMmunoglobulins Purified for Anti- Cancer Therapy IMPACT IMmunoglobulins Purified for Anti- Cancer Therapy Bis zu 3% der Blutspender besitzen Plasma mit starker zytotoxischer Wirkung gegen bestimmte Tumore. Die tumorspezifische, zytotoxische Wirkung basiert

Mehr

NEUE HOFFNUNG, NEUE DIAGNOSTIK, NEUE THERAPIEN

NEUE HOFFNUNG, NEUE DIAGNOSTIK, NEUE THERAPIEN CAMPUS GROSSHADERN CAMPUS INNENSTADT KLINIK UND POLIKLINIK FÜR FRAUENHEILKUNDE UND GEBURTSHILFE DIREKTOR: PROF. DR. MED. SVEN MAHNER LEBEN MIT BRUSTKREBS- WAS GIBT ES NEUES? WAS KANN ICH TUN? NEUE HOFFNUNG,

Mehr

Standard-Chemotherapie könnte wesentlich wirksamer sein!

Standard-Chemotherapie könnte wesentlich wirksamer sein! Standard-Chemotherapie könnte wesentlich wirksamer sein! For more efficiency at less risk Maßgeschneiderte Krebstherapie Der Biomarker TP53 Obwohl in den letzten 20 Jahren laufend neue Substanzen in der

Mehr

Universitätsklinikum Regensburg Standards und Aktuelles in der Therapie des Malignen Melanoms

Universitätsklinikum Regensburg Standards und Aktuelles in der Therapie des Malignen Melanoms Standards und Aktuelles in der Therapie des Malignen Melanoms Sebastian Haferkamp Häufigkeit des Malignen Melanoms Fälle pro 100.000 www.rki.de Therapie des Melanoms Universitätsklinikum Regensburg 1975

Mehr

Neues aus Diagnostik und Therapie beim Lungenkrebs. Jürgen Wolf Centrum für Integrierte Onkologie Universitätsklinikum Köln

Neues aus Diagnostik und Therapie beim Lungenkrebs. Jürgen Wolf Centrum für Integrierte Onkologie Universitätsklinikum Köln Neues aus Diagnostik und Therapie beim Lungenkrebs Jürgen Wolf Centrum für Integrierte Onkologie Universitätsklinikum Köln Über was ich Ihnen heute berichten will: Lungenkrebs ist nicht gleich Lungenkrebs

Mehr

SABCS 2011 Adjuvante Mammakarzinom- Therapie im Wandel

SABCS 2011 Adjuvante Mammakarzinom- Therapie im Wandel SABCS 2011 Adjuvante Mammakarzinom- Therapie im Wandel T. Reimer Universitäts-Frauenklinik Rostock 19.03.2012 2009 UNIVERSITÄT ROSTOCK MEDIZINISCHE FAKULTÄT Gliederung Review-Vorträge DCIS Präoperativ

Mehr

Programm-Vorschau. 8. Wissenschaftliches Symposium der Kommission Translationale Forschung. 10./11. November TraFo Symposium 2016 der AGO

Programm-Vorschau. 8. Wissenschaftliches Symposium der Kommission Translationale Forschung. 10./11. November TraFo Symposium 2016 der AGO Programm-Vorschau TraFo Symposium 2016 der AGO 8. Wissenschaftliches Symposium der Kommission Translationale Forschung der Arbeitsgemeinschaft Gynäkologische Onkologie 10./11. November 2016 Krankheit verstehen

Mehr

Gastrointestinale Tumore: Kleine wichtige Fortschritte und Lichtblicke

Gastrointestinale Tumore: Kleine wichtige Fortschritte und Lichtblicke Gastrointestinale Tumore: Kleine wichtige Fortschritte und Lichtblicke PD Dr. Thomas Zander Klinik I für Innere Medizin Centrum für Integrierte Onkologie Universitätsklinik Köln Thomas.Zander@uk-koeln.de

Mehr

Innere Medizin 3 Zentrum für Hämatologie und medizinische Onkologie. Die Rolle der Onkologie im Brustkompetenzzentrum

Innere Medizin 3 Zentrum für Hämatologie und medizinische Onkologie. Die Rolle der Onkologie im Brustkompetenzzentrum Die Rolle der Onkologie im Brustkompetenzzentrum Onkologe Chirurg Strahlentherapeut Nuklearmediziner Psycho- Onkologe? Plastischer Chirurg Gynäkologe Radiologe Erfolge können in der Krebsbehandlung nur

Mehr

TUMORMARKER "Serumbank"

TUMORMARKER Serumbank TUMORMARKER Tumormarker haben in den letzten Jahren die Differentialdiagnostik und insbesondere die Verlaufskontrolle der genannten Tumore wesentlich verbessert. Darüber hinaus konnten die Nachweisverfahren

Mehr

Subkutan oder intravenös? Besonderheiten bei der sub- kutanen Injektion von Herceptin

Subkutan oder intravenös? Besonderheiten bei der sub- kutanen Injektion von Herceptin Universität St. Gallen 5./6. September 2013 Subkutan oder intravenös? Besonderheiten bei der sub- kutanen Injektion von Herceptin Anja Kröner, MScN, HöFa I Onkologie, RN Pflegeexpertin Hämatologie und

Mehr

Journal: Journal of Clinical Oncology Publikationsjahr: 2012 Autoren: Paulo M. Hoff, Andreas Hochhaus, Bernhard C. Pestalozzi et al.

Journal: Journal of Clinical Oncology Publikationsjahr: 2012 Autoren: Paulo M. Hoff, Andreas Hochhaus, Bernhard C. Pestalozzi et al. Cediranib Plus FOLFOX/CAPOX Versus Placebo Plus FOLFOX/CAPOX in Patients With Previously Untreated Metastatic Colorectal Cancer: A Randomized, Double Blind, Phase III Study (HORIZON II) Journal: Journal

Mehr

Adipositas und Mammakarzinom

Adipositas und Mammakarzinom Adipositas und Mammakarzinom Tumorzentrum München Aktuelles vom SABCS 2011 Brigitte Rack Frauenklinik der Ludwig-Maximilians-Universität München Klinikum Innenstadt Direktor: Prof. Dr. K. Friese Hintergrund

Mehr

Strategien in der Zusammenarbeit. Partnerschaften

Strategien in der Zusammenarbeit. Partnerschaften Strategien in der Zusammenarbeit mit Forschern und Kliniken Gerd Maass Leiter Strategische Gerd Maass, Leiter Strategische Partnerschaften Stratifizierende Medizin Welche Verfahren nützen wem und wer soll

Mehr

1. Neoadjuvante Therapie. 2. Adjuvante Therapie. 3. Metastasiertes Mamma-Ca. 4. Mamma-Ca. in der Schwangerschaft. 5. Nicht-interventionelle Studien

1. Neoadjuvante Therapie. 2. Adjuvante Therapie. 3. Metastasiertes Mamma-Ca. 4. Mamma-Ca. in der Schwangerschaft. 5. Nicht-interventionelle Studien 1. Neoadjuvante Therapie GeparOcto-Studie Penelope-Studie 2. Adjuvante Therapie GAIN II-Studie Katherine-Studie TREAT CTC-Studie OLYMPIA Studie 3. Metastasiertes Mamma-Ca. First-line Therapie: Ab Second-line

Mehr

Diagnostik von Infektionen. Professor Christian Ruef Institut für Infektiologie und Spitalhygiene

Diagnostik von Infektionen. Professor Christian Ruef Institut für Infektiologie und Spitalhygiene Diagnostik von Infektionen Professor Christian Ruef Institut für Infektiologie und Spitalhygiene 1 Schwerpunkte Einleitung, Uebersicht Klinische Beispiele Sepsis Pneumonie auf der Intensivstation Ausblick

Mehr

Neue Ansätze in der personalisierten Krebsdiagnostik und Therapie

Neue Ansätze in der personalisierten Krebsdiagnostik und Therapie Institut für Tumorbiologie Direktor: Prof. Dr. med. Klaus Pantel Neue Ansätze in der personalisierten Krebsdiagnostik und Therapie Neu diagnostizierte Tumorerkrankungen in Deutschland (2012) 477.950 pro

Mehr

Empfehlungen der Projektgruppe Mammakarzinom am Tumorzentrum Bonn

Empfehlungen der Projektgruppe Mammakarzinom am Tumorzentrum Bonn Empfehlungen der Projektgruppe Mammakarzinom am Tumorzentrum Bonn zum Einsatz der Sentinel-Technik bei der Behandlung des Mammakarzinoms September 2006 Diese Konsensusempfehlung wurde durch folgende Mitglieder

Mehr

Der HER2-Rezeptor & seine therapeutischen Ansprechpartner beim HER2-pos. Mammakarzinom

Der HER2-Rezeptor & seine therapeutischen Ansprechpartner beim HER2-pos. Mammakarzinom Der HER2-Rezeptor & seine therapeutischen Ansprechpartner beim HER2-pos. Mammakarzinom Her2/neu (human epidermal growth factor receptor 2, erb-b2, c-erbb2) Der HER2-Rezeptor gehört zur Familie der epidermalen

Mehr

Anti-Angiogenese: friend or foe

Anti-Angiogenese: friend or foe Anti-Angiogenese: friend or foe Prof. Dr. Andreas Schneeweiss Sektionsleiter Universitätsfrauenklinik Heidelberg (Ärztl. Direktor: Prof. Dr. Prof. h.c. C. Sohn) Nationales Centrum für Tumorerkrankungen

Mehr

Brustkrebs: Adjuvante Therapie mit Herceptin

Brustkrebs: Adjuvante Therapie mit Herceptin Trastuzumab after adjuvant Chemotherapy in HER2-positive Breast Cancer Piccart-Gebhart et al: New England Journal of Medicine 353 : 1659 72, October 20, 2005. HERA 2-year follow-up of trastuzumab after

Mehr

Das Mammakarzinom der jungen Patientin. Dr. C.Kreisel-Büstgens Onkologische Schwerpunktpraxis Minden Lübbecke

Das Mammakarzinom der jungen Patientin. Dr. C.Kreisel-Büstgens Onkologische Schwerpunktpraxis Minden Lübbecke Das Mammakarzinom der jungen Patientin Dr. C.Kreisel-Büstgens Onkologische Schwerpunktpraxis Minden Lübbecke Flurweg 13, 32457 Porta Westfalica Dr. Martin Becker Dr. Christiane Kreisel-Büstgens Dr. Enno

Mehr

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms?

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Brustkrebs aktuell - OSP am 21.10.2015 Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Prof. Dr. German Ott, Institut für Pathologie Robert-Bosch-Krankenhaus

Mehr

Neue Daten zur endokrinen Therapie des Mammakarzinoms

Neue Daten zur endokrinen Therapie des Mammakarzinoms 2010 Neue Daten zur endokrinen Therapie des Mammakarzinoms C. Wolf Medizinisches Zentrum ULM - Kooperatives Brustzentrum ULM/ NEU ULM Adjuvante Therapie Postmenopause: NCIC CTG MA.27 (Paul Goss) Prämenopause:

Mehr

Next Generation Sequencing Vorder- und Rückseite des kompletten Genoms

Next Generation Sequencing Vorder- und Rückseite des kompletten Genoms Next Generation Sequencing Vorder- und Rückseite des kompletten Genoms Thomas Karn Klinik für Gynäkologie und Geburtshilfe J.W. Frankfurt Direktor Prof. S. Becker Whole Genome Sequencing Therapeutische

Mehr

Intraoperative Strahlentherapie bei Brustkrebs. Patienteninformation zur intraoperativen Strahlentherapie des Tumorbettes (Boost)

Intraoperative Strahlentherapie bei Brustkrebs. Patienteninformation zur intraoperativen Strahlentherapie des Tumorbettes (Boost) Intraoperative Strahlentherapie bei Brustkrebs Patienteninformation zur intraoperativen Strahlentherapie des Tumorbettes (Boost) Kein Grund für Verzweiflung Wenn die Diagnose Brustkrebs festgestellt wird,

Mehr

EGF-R-Familie als Target für zytotoxische T-Lymphozyten. Helga Bernhard

EGF-R-Familie als Target für zytotoxische T-Lymphozyten. Helga Bernhard EGF-R-Familie als Target für zytotoxische T-Lymphozyten Helga Bernhard Adoptiver Transfer von HER2-spezifischen T-Zellen zur Therapie des HER2-positiven Mammakarzinoms Patientin mit HER2 + Mammakarzinom

Mehr

Ergebnis-Cockpit Anlage zum Erhebungsbogen für die Zertifizierung von Brustgesundheitszentren (BGZ)

Ergebnis-Cockpit Anlage zum Erhebungsbogen für die Zertifizierung von Brustgesundheitszentren (BGZ) von Brustgesundheitszentren Ergebnis-Cockpit Anlage zum Erhebungsbogen für die von Brustgesundheitszentren (BGZ) Version 4.0 vom 20.04.2015 Angaben des Name des Brustgesundheitszentrums Straße Ort Name

Mehr

Nikos Fersis Klinik für Frauenheilkunde und Geburtshilfe Klinikum Chemnitz ggmbh

Nikos Fersis Klinik für Frauenheilkunde und Geburtshilfe Klinikum Chemnitz ggmbh Nikos Fersis Klinik für Frauenheilkunde und Geburtshilfe Klinikum Chemnitz ggmbh Antikörpertherapie : Hoffnung im Horizont? Wachstumsfaktor Östrogen IGFR EGFR / HER2 Trastuzumab Plasmamembran P P P P

Mehr

Schwangerschaft nach Mammakarzinom Update 2015. Dr. Teelke Beck Brust-Zentrum t.beck@brust-zentrum.ch www.brust-zentrum.ch

Schwangerschaft nach Mammakarzinom Update 2015. Dr. Teelke Beck Brust-Zentrum t.beck@brust-zentrum.ch www.brust-zentrum.ch Schwangerschaft nach Mammakarzinom Update 2015 Dr. Teelke Beck Brust-Zentrum t.beck@brust-zentrum.ch www.brust-zentrum.ch Situation heute Verlegung der Schwangerschaft ins höhere Alter ca. 7-10% der Pat.mit

Mehr

Zusätzliche Behandlungs möglichkeiten für Ihre Patienten

Zusätzliche Behandlungs möglichkeiten für Ihre Patienten Zusätzliche Behandlungs möglichkeiten für Ihre Patienten Über FoundationOne Bei dem validierten umfassenden Tumorprofil von FoundationOne wird die gesamte codierende Sequenz von 315 krebsassoziierten Genen

Mehr

Prognostische und prädiktive Faktoren

Prognostische und prädiktive Faktoren Diagnostik und Therapie primärer und metastasierter Mammakarzinome Prognostische und prädiktive Faktoren Prognostische und prädiktive Faktoren Version 2002: Thomssen / Harbeck Version 2003 2009: Costa

Mehr

Der neue cobas T BRAF V600 Mutation Test (CE-IVD) Was wäre, wenn Sie ihr die richtige Antwort früher geben könnten?

Der neue cobas T BRAF V600 Mutation Test (CE-IVD) Was wäre, wenn Sie ihr die richtige Antwort früher geben könnten? Der neue cobas T BRAF V600 Mutation Test (CE-IVD) Was wäre, wenn Sie ihr die richtige Antwort früher geben könnten? cobas T BRAF V600 Mutation Test Diagnostik für die personalisierte Hautkrebstherapie

Mehr

Faktenblatt: Traditionelle Chinesische Medizin. (Siehe auch: Mind-Body-Therapien und Medizinische Pilze) Methode/Substanz

Faktenblatt: Traditionelle Chinesische Medizin. (Siehe auch: Mind-Body-Therapien und Medizinische Pilze) Methode/Substanz Faktenblatt: Traditionelle Chinesische Medizin Mai 2015 Verantwortlich: PD Dr. J. Hübner, Prof. K. Münstedt, Prof. O. Micke, PD Dr. R. Mücke, Prof. F.J. Prott, Prof. J. Büntzel, Prof. V. Hanf, Dr. C. Stoll

Mehr

Brustkrebs Nachsorge. Diagnostik und Therapie primärer und metastasierter Mammakarzinome. AGO e.v. in der DGGG e.v. sowie in der DKG e.v.

Brustkrebs Nachsorge. Diagnostik und Therapie primärer und metastasierter Mammakarzinome. AGO e.v. in der DGGG e.v. sowie in der DKG e.v. Diagnostik und Therapie primärer und metastasierter Mammakarzinome Brustkrebs Nachsorge Brustkrebs Nachsorge Version 2002: Thomssen / Scharl Version 2003 2008: Bauerfeind / Bischoff / Blohmer / Böhme /

Mehr

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg

PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin - Status und Zukunft PD Dr. med. Christian Meisel Site Leader Oncology & Head Translational Medicine Roche Pharma Research and Early Development, Penzberg Personalisierte Medizin

Mehr

Blut, Urin, Leben: NMR-Analytik macht Verborgenes sichtbar

Blut, Urin, Leben: NMR-Analytik macht Verborgenes sichtbar Blut, Urin, Leben: NMR-Analytik macht Verborgenes sichtbar Einleitung Blut und Urin Paracelsus: Seit Antike üblich: Schmecken und Riechen des Urins Gut zugängliche Körperflüssigkeiten Routinemäßig zu erhalten

Mehr

Krebstherapie maßgeschneidert individualisiert & ganzheitlich

Krebstherapie maßgeschneidert individualisiert & ganzheitlich Krebstherapie maßgeschneidert individualisiert & ganzheitlich Günther Gastl UK für Innere Medizin V Hämatologie & Onkologie Medizinische Universität Innsbruck Die Heilkunst umfasst dreierlei: - die Erkrankung

Mehr

Einzelzellanalyse prädiktives Diagnostikum in der Onkologie der Zukunft? Was ist aus dem Blut möglich? m

Einzelzellanalyse prädiktives Diagnostikum in der Onkologie der Zukunft? Was ist aus dem Blut möglich? m UNIVERSITÄTSKLINIKUM Schleswig-Holstein Einzelzellanalyse prädiktives Diagnostikum in der Onkologie der Zukunft? Was ist aus dem Blut möglich? m 19.10.2005 / 1 Prof. Dr. Burkhard Brandt Klinische Problemstellung

Mehr

Prostatakarzinom: Neue Wege in der Diagnostik durch PET/CT. Prof. Dr. Frank M. Bengel, Prof. Dr. Axel S. Merseburger Medizinische Hochschule Hannover

Prostatakarzinom: Neue Wege in der Diagnostik durch PET/CT. Prof. Dr. Frank M. Bengel, Prof. Dr. Axel S. Merseburger Medizinische Hochschule Hannover Prostatakarzinom: Neue Wege in der Diagnostik durch PET/CT Prof. Dr. Frank M. Bengel, Prof. Dr. Axel S. Merseburger Medizinische Hochschule Hannover Gezielte PET/CT Bildgebung des Prostata-Spezifischen

Mehr

Verbesserte Lebensqualität für Brustkrebspatientinnen unter Chemotherapie

Verbesserte Lebensqualität für Brustkrebspatientinnen unter Chemotherapie Neue Studie zu Iscador Verbesserte Lebensqualität für Brustkrebspatientinnen unter Chemotherapie Schwäbisch-Gmünd (2. Dezember 2009) - Eine prospektive randomisierte offene Pilotstudie ergab eine Verbesserung

Mehr

ASCO 2012: Neoadjuvant, Neue Wege und Beiträge aus München

ASCO 2012: Neoadjuvant, Neue Wege und Beiträge aus München Campus Innenstadt Campus Großhadern Klinik und Poliklinik für Frauenheilkunde und Geburtshilfe ASCO 2012: Neoadjuvant, Neue Wege und Beiträge aus München Prof. Dr. Nadia Harbeck der Universität München

Mehr

OXFORD-DISKUSSION. Brauchen wir genomische Analysen? - PRO - Priv.-Doz. Dr. med. Cornelia Liedtke. Klinik für Gynäkologie und Geburtshilfe

OXFORD-DISKUSSION. Brauchen wir genomische Analysen? - PRO - Priv.-Doz. Dr. med. Cornelia Liedtke. Klinik für Gynäkologie und Geburtshilfe OXFORD-DISKUSSION Brauchen wir genomische Analysen? - PRO - Priv.-Doz. Dr. med. Cornelia Liedtke - Direktor: Prof. Dr. med. Achim Rody - Universitätsklinikum Schleswig-Holstein / Campus Lübeck Warum? Unsere

Mehr

UCLA UCLA. Welche Tumoren/Patientinnen sind wirklich endokrin resistent? Was bedeutet es für die Klinik? Peter A. Fasching

UCLA UCLA. Welche Tumoren/Patientinnen sind wirklich endokrin resistent? Was bedeutet es für die Klinik? Peter A. Fasching Welche Tumoren/Patientinnen sind wirklich endokrin resistent? Was bedeutet es für die Klinik? Peter A. Fasching UCLA David Geffen School of Medicine Dep. Hem/Onc UCLA Endokrine Resistenz wo müssen wir

Mehr

Molekulare Diagnostik in der Zytologie

Molekulare Diagnostik in der Zytologie Molekulare Diagnostik in der Zytologie Nicole Pawlaczyk Karsten Neumann Institut für Pathologie Pneumologische Onkologie Lungenkarzinom häufigste krebsbedingte Todesursache für beide Geschlechter dritthäufigste

Mehr

Update Triple Negatives Mammakarzinom. Airport Meeting 26.1.2013 J. Huober Frauenklinik Klinikum der Heinrich-Heine-Universität Düsseldorf

Update Triple Negatives Mammakarzinom. Airport Meeting 26.1.2013 J. Huober Frauenklinik Klinikum der Heinrich-Heine-Universität Düsseldorf Update Triple Negatives Mammakarzinom Airport Meeting 26.1.2013 J. Huober Frauenklinik Klinikum der Heinrich-Heine-Universität Düsseldorf Triple negativer Phänotyp und molekularer Subtyp Basal like aber

Mehr

HER2-positives Mammakarzinom im Fokus Innovative Behandlungsstrategien für Patientinnen mit Brus

HER2-positives Mammakarzinom im Fokus Innovative Behandlungsstrategien für Patientinnen mit Brus HER2-positives Mammakarzinom im Fokus Innovative Behandlungsstrategien für Patientinnen mit Brus HER2-positives Mammakarzinom im Fokus Innovative Behandlungsstrategien für Patientinnen mit Brustkrebs München

Mehr

Genetische Beratung und Diagnostik. All is genetics. Familiäre Tumore Personalisierte Medizin

Genetische Beratung und Diagnostik. All is genetics. Familiäre Tumore Personalisierte Medizin Seminar Humangenetik 2015 Genetische Beratung und Diagnostik All is genetics. Familiäre Tumore Personalisierte Medizin 9. Dezember 2015 Seminarraum Seminar Humangenetik 2015 Genetische Beratung und Diagnostik

Mehr

MammaTYPER. Ki67 mrna Einzelgenmessung prädiziert Ansprechen auf Chemotherapie

MammaTYPER. Ki67 mrna Einzelgenmessung prädiziert Ansprechen auf Chemotherapie MammaTYPER Ki67 mrna Einzelgenmessung prädiziert Ansprechen auf Chemotherapie Erkenntnisse der RNA Analysen verändern die Leitlinien zur Brustkrebsbehandlung Goldhirsch et al., Annals of Oncology (2011)

Mehr

Ist ein Umdenken bei der Therapie des metastasierten Prostata Carzinoms notwendig?

Ist ein Umdenken bei der Therapie des metastasierten Prostata Carzinoms notwendig? JOURNAL CLUB α Ist ein Umdenken bei der Therapie des metastasierten Prostata Carzinoms notwendig? Derzeit gängige Theorie der Metastasierung Aus einer Zelle oder einem Zellklon entsteht eine Metastase

Mehr

Chromosomale Veränderungen in der Tumodiagnostik: Bedeutung und neue Anforderungen an die Qualitätssicherung

Chromosomale Veränderungen in der Tumodiagnostik: Bedeutung und neue Anforderungen an die Qualitätssicherung Chromosomale Veränderungen in der Tumodiagnostik: Bedeutung und neue Anforderungen an die Qualitätssicherung Prof. Dr. Beat Schäfer Laborleiter Onkologie Universitäts-Kinderkliniken Zürich Molekulare Diagnostik,

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

Braucht jeder Patient eine pharmazeutische Betreuung?

Braucht jeder Patient eine pharmazeutische Betreuung? Braucht jeder Patient eine pharmazeutische Betreuung? Carole Kaufmann, MSc(Pharm) Pharmaceutical Care Research Group & Kantonsspital Baselland, Klinische Pharmazie Das Problem [1] Wiesner C. Dissertation.

Mehr

Aktive Überwachung (Active Surveillance)

Aktive Überwachung (Active Surveillance) Aktive Überwachung (Active Surveillance) Hubert Kübler Urologische Klinik und Poliklinik Technische Universität München Klinikum rechts der Isar Direktor: Univ.-Prof. Dr. med. J. E. Gschwend Risiko Prostatakarzinom

Mehr

Systemische Mastozytose

Systemische Mastozytose Systemische Mastozytose auf dem 5. Aachener Patienten- und Angehörigensymposium 2014 Aachen, 17.05.2014 Karla Bennemann & Jens Panse Blutbildung dynamischer Prozess täglich > 7 x 10 9 Blutzellen pro kg

Mehr

Auf dem Weg zur individualisierten Behandlung des Brustkrebses. Welche Möglichkeiten bieten Biomarker?

Auf dem Weg zur individualisierten Behandlung des Brustkrebses. Welche Möglichkeiten bieten Biomarker? Auf dem Weg zur individualisierten Behandlung des Brustkrebses Welche Möglichkeiten bieten Biomarker? Prof. Dr. med. O. Ortmann Klinik für Frauenheilkunde und Geburtshilfe der Universität Regensburg am

Mehr

Mit Genehmigung der Medizinischen Fakultät der Universität München. Prof. Dr. med. Dr. h.c. M. Reiser, FACR, FRCR

Mit Genehmigung der Medizinischen Fakultät der Universität München. Prof. Dr. med. Dr. h.c. M. Reiser, FACR, FRCR Mit Genehmigung der Medizinischen Fakultät der Universität München Berichterstatter: Herr Prof. Dr. med. Volker Heinemann Mitberichterstatter: Herr Prof. Dr. med. Thomas Kirchner Frau Priv. Doz. Dr. med.

Mehr

Liquid-biopsy-Analysen mithilfe zellfreier DNA (cfdna)

Liquid-biopsy-Analysen mithilfe zellfreier DNA (cfdna) Pathologe DOI 10.1007/s00292-015-0078-z Springer-Verlag Berlin Heidelberg 2015 Schwerpunktherausgeberin R. Knüchel-Clarke, Aachen E. Dahl 1,2,3 V. Kloten 1 1 Arbeitsgruppe Molekulare Onkologie, Institut

Mehr

Adjuvante systemische Therapie des Mammakarzinoms

Adjuvante systemische Therapie des Mammakarzinoms Adjuvante systemische Therapie des Mammakarzinoms G. Tschurtschenthaler I. Interne Abteilung Leiter: Univ.Prof.Dr. G. Michlmayr 1 MAMMAKARZINOM Mortalität nach 5 Jahren (%) Tumorgröße (cm) Anzahl der positiven

Mehr

Thema. Hodenkarzinom. Aufbaukurs Krebswissen WS 2015.16. Gero Kramer. Urologie. Autor, Einrichtung, Abteilung...

Thema. Hodenkarzinom. Aufbaukurs Krebswissen WS 2015.16. Gero Kramer. Urologie. Autor, Einrichtung, Abteilung... Aufbaukurs Krebswissen WS 2015.16 Hodenkarzinom Gero Kramer Urologie 1 Hodenkarzinom Epidemiologie 1% aller bösartiger Neubildungen beim Mann 3-10 neue Fälle / 100 000 Männer / Jahr (Westen) Anstieg in

Mehr

newsletter01 UniversitätsKlinikum Heidelberg Sehr geehrte, liebe Frau Kollegin, sehr geehrter Herr Kollege, THEMEN UNIVERSITÄTS-FRAUENKLINIK 01/2013

newsletter01 UniversitätsKlinikum Heidelberg Sehr geehrte, liebe Frau Kollegin, sehr geehrter Herr Kollege, THEMEN UNIVERSITÄTS-FRAUENKLINIK 01/2013 UniversitätsKlinikum Heidelberg newsletter01 01/2013 Sehr geehrte, liebe Frau Kollegin, sehr geehrter Herr Kollege, das Jahr 2013 wird viele Neuerungen für die Mitarbeiter der Frauenklinik mit sich bringen.

Mehr

Brustkrebs Nachsorge. Diagnostik und Therapie primärer und metastasierter Mammakarzinome. AGO e.v. in der DGGG e.v. sowie in der DKG e.v.

Brustkrebs Nachsorge. Diagnostik und Therapie primärer und metastasierter Mammakarzinome. AGO e.v. in der DGGG e.v. sowie in der DKG e.v. Diagnostik und Therapie primärer und metastasierter Mammakarzinome Brustkrebs Nachsorge Brustkrebs Nachsorge Versionen 2002 2011: Bauerfeind / Bischoff / Blohmer / Böhme / Costa / Diel / Gerber / Hanf

Mehr