Institut für Neuropathologie. Institut für Medizinische Molekulargenetik Universität Zürich Prof. Dr. W. Berger

Größe: px
Ab Seite anzeigen:

Download "Institut für Neuropathologie. Institut für Medizinische Molekulargenetik Universität Zürich Prof. Dr. W. Berger"

Transkript

1 UZL Universitäres Zentrum für Labormedizin und Pathologie NEWS Verbund von Kerninstitutionen für Labormedizin und Pathologie der Universität und des s mit Vertretung von assoziierten USZ-Speziallabors Nr. 32 Klinik für Hämatologie Prof. Dr. M. G. Manz Institut für Klinische Pathologie Prof. Dr. H. Moch Institut für Medizinische Mikrobiologie Prof. Dr. E. C. Böttger Klinik für Immunologie Prof. Dr. O. Boyman Institut für Neuropathologie Prof. Dr. A. Aguzzi Institut für Medizinische Molekulargenetik Prof. Dr. W. Berger Institut für Klinische Chemie Prof. Dr. A. v. Eckardstein Institut für Medizinische Genetik Frau Prof. Dr. A. Rauch Institut für Medizinische Virologie Frau Prof. Dr. A. Trkola Speziallabors Verschiedene Kliniken und Institute Kontaktpersonen: Für spezifische medizinische Fragen Ärzteteam, Tel , Fax Für administrative Fragen Barbara Roth, Tel , Institut für Medizinische Genetik, Neues Analyseangebot des Instituts für Medizinische Genetik Leitung: Prof. Dr. med. Anita Rauch, Fachärztin für Medizinische Genetik FMH, Spezialistin Medizinisch-Genetische Analytik FAMH, Die Hochdurchsatz- bzw. Next-Generation-Sequenzierung ermöglicht neu eine kostengünstige und effektive genetische Differentialdiagnostik. Bei fast allen chronischen Erkrankungen stehen genetische Ursachen differentialdiagnostisch im Raum. Mittlerweile konnten ca Gene definierten Erkrankungen zugeordnet werden und es wird geschätzt, dass tatsächlich ca. 7% der Bevölkerung mindestens eine solche Erkrankung aufweisen. Bei diesen Erkrankungen ist der Nachweis des genetischen Defektes in der Regel mit einer hohen diagnostischen und prognostischen Aussagekraft verbunden. Da die meisten Erkrankungen jedoch durch mehrere verschiedene Krankheitsgene verursacht werden können, war die genetische Diagnostik bisher sehr aufwendig und teuer. Durch die Entwicklung der Hochdurchsatz- bzw. Next-Generation-Sequenzierung ist jetzt aber eine deutlich effektivere und kostengünstigere Sequenzierung von mehreren Genen gleichzeitig möglich. Seit 2015 ist die Hochdurchsatzsequenzierung als Pflichtleistung der Grundversicherung in der Analysenliste des BAG aufgeführt. Die Hochdurchsatzsequenzierung fällt dabei in 3 Preisgruppen: 1 10 Gene kosten insgesamt im Grundpreis 2900 CHF, Gene 3300 CHF und über 100 Gene 3800 CHF.

2 Hinzukommen allfällige Zusatzkosten für die Validierung auffälliger Befunde. Wir konnten deshalb unser Leistungsspektrum grund legend erneuern und stark ausdehnen. Häufig nachgefragte Gene bieten wir als Panel-Sequenzierung an. Dies hat den Vorteil, dass die dabei analysierten Gene mit sehr hoher Sensitivität erfasst werden und nicht nur auf Mutationen, sondern auch auf Deletionen und Duplikationen untersucht werden können. Für seltenere Fragestellungen oder Krankheitsgruppen mit sehr zahlreichen Krankheitsgenen bieten wir eine Exom- Sequenzierung an, bei der ca Gene parallel sequenziert werden und dann je nach Fragestellung einzelne oder viele Gene analysiert werden. Hiermit können fast alle bekannten Krankheitsgene analysiert werden. Ausnahmen sind Gene, die sich aufgrund ihrer Zusammensetzung bislang nicht ausreichend mittels Exomsequenzierung erfassen lassen (z. B. 21-Hydroxylase) oder deren Mutationsmechanismen auf Repeat-Wiederholungen (z. B. Fragiles-X-Syndrom, Spinocerebelläre Ataxien, Friedreich Ataxie, Myotone Dystrophie, M. Huntington) oder epigenetischen Effekten (z. B. Silver-Russell-Syndrom, Beckwith- Wiedemann-Syndrom) basieren. Folgende Erkrankungen bieten wir als Panel-Analyse an: Hereditäre Krebserkrankungen (z. B. Brust-und Ovarialkarzinom, Darmkrebs, Wilms-Tumor, Fanconi Anämie), Alagille-Syndrom, Alport-Syndrom, M. Alzheimer, Amyloidosen, Cholestasen, Cystische Fibrose, Ehlers-Danlos-Syndrom, Epilepsie, Hemimegalencephalus-Syndrome, Hydrocephalus, Kleinwuchs, Lippen-/ Gaumenspalten, Marfan- Syndrom, MODY, Neurofibromatose, Osteogenesis imperfekta, Hereditäre Pankreatitis, Polyzystische Nieren, Noonan-Syndrom und andere Rasopathien sowie häufige Retardierungssyndrome (siehe alphabetische Liste unten). Eine Exomsequenzierung mit Analyse indikationsrelevanter Gene bieten wir insbesondere für folgende in der Analysenliste aufgeführten Krankheitsgruppen an: Blut, Gerinnung, Immunsystem Haut-, Bindegewebe, Knochenerkrankungen Hereditäre Krebserkrankungen Metabolische und endokrine Krankheiten Mitochondriale Erkrankungen (nukleäre Gene) Neuromuskuläre und neurodegenerative Erkrankungen Urogenitalsystem, Fertilitätsstörungen, Sterilität Seltene genetische Krankheiten (Orphan Disease; hierunter z. B. auch Krankheitsgruppen wie Herzfehler, Heterotaxie, Schwerhörigkeit) Spezialanalysen und Zytogenetik Die Sequenzierung sehr kleiner Gene oder die Überprüfung familiärer Mutationen führen wir nach wie vor mittels Sanger-Technik durch (erstes Exon 300 CHF, jedes weitere plus 215 CHF). Daneben bieten wir weiterhin verschiedene Spezialanalysen für folgende Erkrankungen an: Fragiles X Syndrom, Spinale Muskelatrophie, Charcot-Marie- Tooth-Erkrankung/HNPP, Beckwith-Wiedemann- Syndrom, Silver-Russell-Syndrom, Angelman/Prader- Willi-Syndrome, uniparentale Disomie (Methylierungstest für Chromosom 7 und 14). Im zytogenetischen Bereich bieten wir neben klassischen mikroskopischen Chromosomen- und FISH- Analysen chromosomale Mikroarray Analysen zum Nachweis von Mikrodeletions-/Duplikationssyndromen aus Blut, Fruchtwasser, Chorionzotten, Nabelschnurblut und Gewebebiopsien. Im Rahmen der assistierten Reproduktion führen wir ferner chromosomale Mikro array-analysen an Polkörpern durch. NEU etabliert haben wir für Schwangere einen nicht-invasiven Test (NIPT) aus mütterlichem Blut sowohl auf die häufigen Trisomien als auch auf gröbere Abweichungen der Chromosomen Ebenfalls NEU führen wir ferner in Kooperation mit der Klinik für Klinische Pharmakologie und Toxikologie ein Pharmakogenetik-Screening mittels SNP-Array- Technik durch. Das Institut bietet zudem eine Sprechstunde für Patientinnen und Patienten an. Im Rahmen der Sprechstunde kann für ambulante Patienten die genetische Diagnostik aufgegleist und die Kostenübernahme durch die Krankenkasse geklärt werden. Ferner können auch schon diagnostizierte Patienten eine genetische Beratung erhalten. Die genetische Beratung dient der Aufklärung betroffener Patienten oder deren Angehörigen über eine genetisch bedingte Erkrankung, das heisst über deren Ursache, Vererbung, Möglichkeiten der Behandlung und Vorsorge sowie über pränatale und prädiktive diagnostische Möglichkeiten. 2

3 Alphabetische Liste der angebotenen Analysen (weitere auf Anfrage) 22q11-Syndrome Achondroplasia Adams-Oliver-Syndrom Adenokarzinom Adrenokortikales Karzinom Akrocallosales Syndrom Alagille-Syndrom Alport-Syndrom Alzheimer Erkrankung Amyloidosen Anauxetische Dysplasie Angelman-Syndrom Aniridie Aortenaneurysma Apert-Syndrom Ataxia Telangetasia Baller-Gerold-Syndrom Bardet-Biedl-Syndrom Basalzellkarzinom, Gorlin-Syndrom Beckwith-Wiedemann-Syndrom Birth-Hogg-Dubé-Syndrom Blepharophimose-Ptosis-Epikanthus inversus-syndrom Bloom s-syndrom Brooke-Spiegler-Syndrom Brust-/Ovarial-Krebs CATCH22 CATSHL Cerebrale Arteriopathie Cervix Karzinom CHARGE-Syndrom Charcot-Marie-Tooth-Erkrankung Cherubismus Christianson-Syndrom Cleidocraniale Dysplasie Coffin-Lowry-Syndrom Cohen-Syndrom Cornelia-de-Lange-Syndrom Costello-Syndrom Cholestasen Craniosynosthose-Syndrome CRASH/MASA-Syndrom Cri-du-chat-Syndrom Crouzon-Syndrom Cutis Laxa Cylindromatosis fam. Cystische Fibrose DiGeorge-Syndrom Down-Syndrom Dravet-Syndrom Ehlers-Danlos-Syndrom Eiigkeitstestung bei Mehrlingen Emberger-Syndrom Endokrine Neoplasie type I Endometrium-Karzinom Epileptische Encephalopathie Fabry-Erkrankung Fanconi Anämie FG / Lujan-Fryns-Syndrom FGFR3-bedingte Syndrome Floating-Harbor-Syndrom Fragiles-X-Syndrom Gastrointestinaler Stromatumor Gaumenspalten Generalisierte Lipodystrophie Goldberg-Shprintzen-Syndrom Hamartoma-Tumor-Syndrom Hereditäre Pankreatitis Hemimegalencephalus-Syndrome Hepatozelluläres Karzinom Hirschsprung-Syndrom Homozystinurie HMSN/HNPP Hydocephalus Hydrocephalus with medial diverticulum Hypochondroplasie Hypophysenadenom Kabuki-Syndrom Karyotyp KBG-Syndrom Kleefstra-Syndrom Klinefelter-Syndrom Knorpel-Haar-Hypoplasie Kolonkarzinom, nonpolyposis Kolonkarzinom, mismatch repair Gene Kolorektales Karzinom Langer-Giedion-Syndrom Leiomyomatose Leopard-Syndrom Li-Fraumeni-Syndrom Lippen-Kiefer-Gaumenspalte Lymphom, non-hodgkin Lynch-Syndrom M. Alexander M. Alzheimer Magenkarzinom Marfan-Syndrom Medulloblastoma Megalencephaly Melanoma Mikrodeletionen Mittralklappenprolaps MODY MOPD2 Mosaic varieg. Aneuploidy Mowat-Wilson-Syndrom Muenke-Syndrom Neuroblastom Neuroblastom mit Hirschsprung Neurofibromatosis Nijmegen-Breakage-Syndrom Noonan-Syndrom Ösophaguskarzinom Osteochondrom Osteogenesis Imperfecta Osteoglophone Dysplasie Osteosarcom Pancreas Karzinom Pankreatitis Paragangliom Parathyroid Karzinom Perlman-Syndrom Pfeiffer-Syndrom Phäochromocytom Pharmakogenetik Pitt-Hopkins-Syndrom Pleuropulmonary Blastoma Polypose Polyzystische Nieren Popliteales Pterygium-Syndrom Prostatakrebs Prader-Willi-Syndrom Pseudohypoparathyreoidismus PTEN Hamartoma Tumor Syndrom Radioulnare Synostose mit amegakaryoctotischer Thrombozytopenie Rasopathien Retinoblastom RETT (-like)-syndrom Rhabdoid Tumor Rubinstein-Taybi-Syndrom Saethre-Chotzen-Syndrom Schilddrüsenkarzinom Schwerhörigkeit (Cx26) SHOX-assoziierter Kleinwuchs Shwachman-Bodian-Diamond-Syndrom Shprintzen-Syndrom Silver-Russell-Syndrom Simpson-Golabi-Behmel-Syndrom Smith-Lemli-Opitz-Syndrom Smith-Magenis-Syndrom Sotos-Syndrom Spinale Muskelatrophie Stickler-Syndrom Supravalvuläre Aortenstenose Thanatophore Dysplasie Thyroid Karzinom Trichoepitheliom Trichorhinophalageales Syndrom Trisomien Tuberöse Sklerose Turner-Syndrom Uniparentale Disomie Van-der-Woude-Syndrom Velocardiofaciales Syndrom Von Hippel-Lindau WAGR-Syndrom Weaver-Syndrom Werner-Syndrom Williams-Beuren-Syndrom Wilms-Tumor Wolf-Hirschhorn-Syndrom Xeroderma pigmentosum Ziliopathien 3

4 Diese Übersichtsliste beruht auf dem Stand April Da sich die Untersuchungsmethoden in der Genetik laufend weiterentwickeln, bitten wir Sie, sich über den aktuellsten Stand unseres Angebots auf unserer Website zu informieren. Weitere Informationen zu Handhabung und Versand der Proben, unsere Anmeldeformulare sowie weiteres Informationsmaterial und Broschüren finden Sie unter Gerne stehen wir Ihnen bei Fragen telefonisch (Tel ) oder per zur Verfügung. Bei spezifischen medizinischen Fragen oder für eine Vorbesprechung der Analyse können Sie sich gerne an unser Ärzteteam wenden (Tel ). Das Institut für Medizinische Genetik ist vom Bundesamt für Gesundheit (BAG) zur Durchführung genetischer Untersuchungen beim Menschen zugelassen und nach ISO/IEC 17025:2005 und ISO 15189:2012 akkreditiert. Kontakt und Probenversand an: Institut für Medizinische Genetik Wagistrasse 12 CH-8952 Schlieren Telefon Telefax Kontaktperson: Dr. Jan-Dirk Studt, Tel , Klinik für Hämatologie, Änderungen der akademischen Laborleitung Seit ist Dr. Jan-Dirk Studt, Innere Medizin FMH, Hämatologie FMH, Spezialist für hämatologische Labordiagnostik FAMH, verantwortlicher Leiter des Hämatologielabors. Stv. Leiter ist PD Dr. Dr. Stefan Balabanov. Seit ist Dr. Inga Hegemann, Innere Medizin FMH, Hämatologie FMH, Spezialistin für hämatologische Labordiagnostik FAMH, für die Immunhämatologie und Transfusionsmedizin verantwortlich. Stv. Leiter ist PD Dr. U. Schanz. Spezielle Zuständigkeiten Hämatologie-Routinelabor: Dr. J.-D. Studt; Stv. PD Dr. Dr. S. Balabanov Knochenmarksbefundung, Immunphänotypisierung, molekulare Diagnostik: PD Dr. Dr. S. Balabanov, Stv. Dr. R. Müller Gerinnungsdiagnostik: Dr. J.-D. Studt, Stv. Dr. I. Hegemann Immunhämatologie und Transfusionsmedizin: Dr. I. Hegemann, Stv. PD Dr. U. Schanz Zusatzmethoden zur Messung des Gerinnungsfaktors VIII Neben der bewährten Standardmethode der koagulometrischen Messung der Faktor VIII-Aktivität stehen neu weitere Methoden zur Verfügung, die in ausgewählten Fällen eine ergänzende Charakterisierung erlauben: Chromogener Assay der Faktor VIII-Aktivität (*). Dieser Test ist nach entsprechender Kalibration besonders für das Monitoring wirkungsverlängerter Faktor VIII-Präparate interessant; dies ist gegenwärtig auch Gegenstand von Studien. Verfügbarkeit: auf Anfrage. Faktor VIII-Antigen (*). Immunologische Methode, Messung in Kombination mit der Faktor VIII-Aktivität vorgesehen. Verfügbarkeit: auf Anfrage. Faktor VIII-Bindungskapazität des von-willebrand- Faktors. Dieser Test erlaubt die Differenzierung einer (milden) Hämophilie A von Varianten des von- Willebrand-Syndroms, die mit einer verminderten Faktor VIII-Stabilisierung einhergehen (VWS 2N, «Normandy»). Verfügbarkeit: alle 3 Monate Thrombozyten-Durchflusszytometrie Diese Methode wird zur weitergehenden Klassifikation von Thrombozytenfunktionsstörungen eingesetzt, etwa zur Bestätigung eines Bernard-Soulier-Syndroms, einer Thrombasthenie Glanzmann oder eines Storage-Pool- Defekts. Sie liefert Informationen über das Vorhandensein von Oberflächenrezeptoren, Aktivierungs- und Degranulationsmarkern der Thrombozyten. Üblicherweise geht ihrem Einsatz eine funktionelle Untersuchung der Thrombozyten voraus, beispielsweise die Thrombozytenaggregometrie in plättchenreichem Plasma nach Born. Verfügbarkeit: auf Anfrage, bis zu 4/Woche. (*) nicht im akkreditierten Bereich 4

5 Kontaktperson: Dr. med Dr. phil. II Elisabeth Probst-Müller, Tel , Klinik für Immunologie,, Klinik für Immunologie, Monitoring von Biologika: Adalimumab, Infliximab und Eculizumab Adalimumab und Infliximab Für die Behandlung von chronischen Entzündungen und Autoimmunerkrankungen spielen Biologika eine wichtige Rolle. Biologika sind gentechnisch hergestellte Medikamente, die sich hochspezifisch gegen am Entzündungsprozess beteiligte Komponenten, z. B. Zytokine, Rezeptoren oder Immunzellen, richten. Ein Monitoring ist wichtig, da sich die Medikamentenspiegel aufgrund der individuellen Pharmakokinetik bei gleicher Dosierung stark von Patient zu Patient unterscheiden können. Zudem kann es im Verlauf der Behandlung zur Bildung von Antikörpern (Anti-Drug Antibodies, ADA) kommen. Diese binden das Biologikum, was zum sekundären Wirkungsverlust führen kann. Für eine kosteneffektive Therapie ist daher das Monitoring dieser Substanzen essentiell. Wir bieten Ihnen zurzeit das Adalimumab- und Infliximab-Monitoring an; weitere Biologika werden folgen. Adalimumab (z. B. Humira ) und Infliximab (z. B. Remicade ) hemmen das TNF und werden zur Behandlung von Patienten mit chronisch entzündlichen Darmerkrankungen, rheumatoider Arthritis, Morbus Bechterew, Psoriasis-Arthritis und Psoriasis eingesetzt. Wir überprüfen den TNF -Spiegel, die Talspiegel- Konzentration des Wirkstoffes und allfällige Anti-Drug- Antibodies. Abrechnung Die Preise und das benötigte Material entnehmen Sie der folgenden Tabelle. Diese Anti-Drug antibodies werden nur als Paket zusammen mit Talspiegel- und TNF -Bestimmung durchgeführt. Analyse Tarifposition Bezeichnung Taxpunkte Material Präanalytik Adalimumab Talspiegel * Autoantikörper seltene, qn, Keine speziellen Vorkehrungen. Adalimumab- AK Autoantikörper seltene, qn, Bitte Öffnungszeiten beachten! Infliximab Talspiegel Autoantikörper seltene, qn, Infliximab-AK Autoantikörper seltene, qn, TNF Zytokine/Adhäsionsmoleküle/ -Rezeptoren/Inhibitoren, qn, * Wenn die Position mehr als 2x vorhanden ist, dann wird die Position mit 67 TP verrechnet. Eculizumab Eculizumab (Soliris ) ist ein monoklonaler Antikörper, der an das Komplementprotein C5 bindet. Das gebundene Eculizumab verhindert dessen Spaltung in die Fragmente C5a und C5b und blockiert so die Bildung des terminalen Komplementkomplexes C5b-9, des sogenannten Membranangriffkomplexes. Zugelassen ist Eculizumab bereits bei der paroxysmalen nächtlichen Hämoglobinurie und beim atypischen hämolytischurämischen Syndrom. Weitere Indikationen werden sicher folgen. In vitro kann die Therapie durch Messen der Komplementaktivität monitorisiert werden, da Eculizumab zu einer vollständigen Blockade der Komplementaktivität führt. 5

6 Abrechnung Die Preise und das benötigte Material entnehmen Sie der folgenden Tabelle. Es werden jeweils alle drei Wege zusammen bestimmt. Einzelbestimmungen sind nicht möglich. Verrechnet werden nur der alternative und der klassische Weg. Bezeichnung Tarifposition Taxpunkte Material Präanalytik Komplement, gesamt, alternativer Weg Serum Intern: Serum muss schnellstmöglich bei uns im Labor eintreffen Komplement, gesamt, klassischer Weg Komplement, gesamt, MBL-Weg Serum Serum Extern: Serum muss gefroren geschickt werden, auf Trockeneis bei 70 C. Bitte Öffnungszeiten beachten! Kontaktperson: Dr. Daniel Müller, Tel ; Institut für Klinische Chemie,, Institut für Klinische Chemie, Umstellung der Messmethode für Katecholamine im Plasma Per wurde die Messmethode für Katecholamine, differenziert im Plasma, von HPLC-ECD auf LC-MS/MS umgestellt. Die neue Methode ist spezifischer, wodurch das Risiko für analytische Interferenzen sinkt. Die Werte der alten und neuen Methode sind vergleichbar. Gleichzeitig wurden die Referenzwerte wie folgt aktualisiert (1): Adrenalin: < 0.45 nmol/l Dopamin: < 0.38 nmol/l Noradrenalin: < 2.95 nmol/l Die Messung erfolgt neu aus Heparin-Plasma, welches als Stabilisator-Zusatz Glutathion und EGTA enthalten muss. Entsprechende Vacutainer können im IKC unter Telefon angefordert werden. Die Empfehlungen bezüglich Präanalytik bleiben dieselben wie mit der alten Methode. Der Patient sollte vor der Blutentnahme mit durchgespülter Kanüle mindestens 30 Minuten liegen. Die Probe muss nach 60min abzentrifugiert, eingefroren und gefroren versandt werden. Referenzen 1. Clin Chem (3): UZL-Geschäftsstelle Rämistrasse 100, OPS D 23, 8091 Sekretariat, Christine Genné: Tel , Fax April 2016

STS-Verzeichnis Akkreditierungsnummer: STS 0460

STS-Verzeichnis Akkreditierungsnummer: STS 0460 Internationale Norm: ISO/IEC 17025:2005 & ISO 15189:2012 Schweizer Norm: SN EN ISO/IEC 17025:2005 & SN EN ISO 15189:2013 Institut für Medizinische Genetik der Universität Zürich Wagistrasse 12 CH-8952

Mehr

genomischen Mutation in bis zu 25 Kilobasen kodierender Sequenz 11445

genomischen Mutation in bis zu 25 Kilobasen kodierender Sequenz 11445 05315 Zuschlag zu den Gebührenordnungspositionen 31840, 31841, 36840 und 36841 11501 Zuschlag zu den Gebührenordnungspositionen 11502 und 11503 für die Anwendung eines Kulturverfahrens zur Anzucht von

Mehr

STS-Verzeichnis Akkreditierungsnummer: STS 0460

STS-Verzeichnis Akkreditierungsnummer: STS 0460 Internationale Norm: ISO/IEC 17025:2005 & ISO 15189:2012 Schweizer Norm: SN EN ISO/IEC 17025:2005 & SN EN ISO 15189:2013 Institut für Medizinische Genetik der Universität Zürich Wagistrasse 12 CH-8952

Mehr

Allgemeine Indikationen zur Genetischen Beratung

Allgemeine Indikationen zur Genetischen Beratung ZENTRUM FÜR HUMANGENETIK UND LABORATORIUMSMEDIZIN Dr. Klein und Dr. Rost GENETIK IN DER PÄDIATRIE Beratung und Diagnostik www.medizinische-genetik.de Version 05-07 Genetik in der Kinderheilkunde Bei der

Mehr

Fachhandbuch für F09 - Humangenetik (9. FS) Inhaltsverzeichnis. 1. Übersicht über die Unterrichtsveranstaltungen... 2

Fachhandbuch für F09 - Humangenetik (9. FS) Inhaltsverzeichnis. 1. Übersicht über die Unterrichtsveranstaltungen... 2 Fachhandbuch für F09 - Humangenetik (9. FS) Inhaltsverzeichnis 1. Übersicht über die Unterrichtsveranstaltungen... 2 1.1. Vorlesung... 2 1.2. Seminar/Praktikum... 5 2. Beschreibung der Unterrichtsveranstaltungen...

Mehr

Institut für Onkologie/Hämatologie. Onkologie KSB Baden. Kantonsspital Baden

Institut für Onkologie/Hämatologie. Onkologie KSB Baden.  Kantonsspital Baden Institut für Onkologie/Hämatologie Onkologie KSB Baden www.ksb.ch Kantonsspital Baden Liebe Patientin, lieber Patient Willkommen am Standort Baden Fortschritte in der Medizin machen es möglich, dass hochspezialisierte

Mehr

Onkologisch-genetische Erkrankungen und deren psychosozialer Einfluss im familiären Kontext

Onkologisch-genetische Erkrankungen und deren psychosozialer Einfluss im familiären Kontext Onkologisch-genetische Erkrankungen und deren psychosozialer Einfluss im familiären Kontext Dorothea Wand Medizinische Genetik USB Schönbeinstrasse 40; CH-4031 Basel Fachtagung Päd. Onkologiepflege XI/2017

Mehr

?? Klausur Humangenetik, Gruppe B

?? Klausur Humangenetik, Gruppe B Seite 1 von 8?? Klausur Humangenetik, Gruppe B 1) Welche der folgenden Aussagen sind richtig? 1. An einer zentrischen Fusion sind zwei Chromosomen beteiligt 2. An einer reziproken Translokation sind zwei

Mehr

Deutsche Akkreditierungsstelle GmbH

Deutsche Akkreditierungsstelle GmbH Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D ML 13293 01 00 nach DIN EN ISO 15189:2007 Gültigkeitsdauer: 08.08.2012 bis 07.08.2017 Urkundeninhaber: Zentrum für Humangenetik Mannheim,

Mehr

Facharzt für Hämatologie

Facharzt für Hämatologie Literaturempfehlungen Facharzt für Hämatologie CareerStart 2013 medalumni UZH Markus G. Manz Klinik für Hämatologie USZ/UZH Weiterbildungsinhalte Klinische Hämatologie und Hämostaseologie (Zelluläre und

Mehr

Unter- suchg.- zahl. Inhalte* Der Weiterbildungsinhalt umfaßt entsprechende Kenntnisse, Erfahrungen und Fertigkeiten bei:

Unter- suchg.- zahl. Inhalte* Der Weiterbildungsinhalt umfaßt entsprechende Kenntnisse, Erfahrungen und Fertigkeiten bei: der Erkennung, Stadieneinteilung und systemischer, insbesondere chemotherapeutischer Behandlung der Erkrankungen des Blutes, der blutbildenden Organe und des lymphatischen Systems einschließlich der hämatologischen

Mehr

Anlage zur Akkreditierungsurkunde D-ML-17482-01-00 nach DIN EN ISO 15189:2014

Anlage zur Akkreditierungsurkunde D-ML-17482-01-00 nach DIN EN ISO 15189:2014 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-ML-17482-01-00 nach DIN EN ISO 15189:2014 Gültigkeitsdauer:19.08.2015 bis 29.11.2017 Ausstellungsdatum: 19.08.2015 Urkundeninhaber:

Mehr

auf den Lösungsbogen.

auf den Lösungsbogen. Test-Fragen für die Klausur Humangenetik Test-Fragen für die Klausur Humangenetik Es folgen 9 Fragen und der Lösungsbogen (blanko). Sie haben 13,5 min Zeit zum Beantworten der Fragen und zum Übertragen

Mehr

Die optimale Therapie? Ich frage meine Gene!

Die optimale Therapie? Ich frage meine Gene! Die optimale Therapie? Ich frage meine Gene! Grössere Behandlungserfolge und weniger Nebenwirkungen dank individueller Genanalyse Ein Angebot von DRUGSAFETY.CH in Zusammenarbeit mit SONOGEN, Labor Risch

Mehr

SS07 Klausur Humangenetik

SS07 Klausur Humangenetik Seite 1 von 8 SS07 Klausur Humangenetik 13.07.2007 1. Welche Aussage über strukturelle Chromosomenaberrationen trifft nicht zu? A) Ein Isochromosom ist in der Regel akrozentrisch. B) Unter einer Robertson'schen

Mehr

und morgen? Moderne Methoden in der Humangenetik Schülerveranstaltung

und morgen? Moderne Methoden in der Humangenetik Schülerveranstaltung und morgen? Moderne Methoden in der Humangenetik Schülerveranstaltung 29.03.2017 PD Dr. med. Sabine Hoffjan MEDIZINISCHE FAKULTÄT Moderne Methoden Ethische Konfliktfelder 2 Next-generation sequencing (NGS)

Mehr

Ihre Therapie verstehen Fragen und Antworten zu Remsima kurz und verständlich

Ihre Therapie verstehen Fragen und Antworten zu Remsima kurz und verständlich Ihre Therapie verstehen Fragen und Antworten zu Remsima kurz und verständlich 1 2 Bei welchen Erkrankungen wird Remsima eingesetzt? Remsima ist ein Arzneimittel, das bei chronischent zündlichen Erkrankungen

Mehr

Analysenliste vom 1. Januar 2014

Analysenliste vom 1. Januar 2014 Analysenliste vom 1. Januar 2014 Verordnung des EDI vom 29. September 1995 über Leistungen in der obligatorischen Krankenpflegeversicherung (Krankenpflege-Leistungsverordnung, KLV) 832.112.31 Analysenliste

Mehr

Nachweis von Interferon-gamma genauer als Haut-Test

Nachweis von Interferon-gamma genauer als Haut-Test Neue Hinweise zum Tuberkulose-Screening vor Biologika-Therapie Nachweis von Interferon-gamma genauer als Haut-Test Berlin (17. Juli 2009) - Biologika gelten als hochwirksam in der Behandlung chronisch

Mehr

. Medizinische Laboratoriumsdiagnostik (DlN EN ISO 15189:2007) . Mikrobiologie. Virologie. Transfusionsmedizin. . Ligandenassays. Agglutinationsteste

. Medizinische Laboratoriumsdiagnostik (DlN EN ISO 15189:2007) . Mikrobiologie. Virologie. Transfusionsmedizin. . Ligandenassays. Agglutinationsteste Untersuchungen im Bereich. Medizinische Laboratoriumsdiagnostik (DlN EN ISO 15189:2007) Untersuchungsgebiete o Klinische Chemie o lmmunologie. Mikrobiologie. Virologie. Transfusionsmedizin o Humangenetik

Mehr

Leben mit einem Lambert-Eaton Myasthenischen Syndrom

Leben mit einem Lambert-Eaton Myasthenischen Syndrom Leben mit einem Lambert-Eaton Myasthenischen Syndrom Bei Ihnen ist ein Lambert-Eaton Myasthenisches Syndrom, kurz LEMS, diagnostiziert worden. Dieses Merkblatt soll Sie und Ihre Angehörigen darüber informieren,

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

Humangenetische Diagnostik und Beratung bei Hämophilie

Humangenetische Diagnostik und Beratung bei Hämophilie Hämophilie-Symposium, Homburg/Saar 06.11.2010 Humangenetische Diagnostik und Beratung bei Hämophilie Wolfram Henn Institut für Humangenetik Universität des Saarlandes, Homburg/Saar Genetik der Hämophilie

Mehr

Normales Altern oder Demenz? Abklärung Beratung Therapie in der Memory Klinik, Station U1

Normales Altern oder Demenz? Abklärung Beratung Therapie in der Memory Klinik, Station U1 Normales Altern oder Demenz? Abklärung Beratung Therapie in der Memory Klinik, Station U1 Psychiatrie Inhaltsverzeichnis Normales Altern oder Demenz? Abklärung Beratung Therapie Anmeldung / Eintritt 7

Mehr

Der Weg der Probe vom Patienten ins Labor

Der Weg der Probe vom Patienten ins Labor Der Weg der Probe vom Patienten ins Labor Univ. Prof. Prim. Dr. Gabriele Halwachs-Baumann, MSc, MBA Leiterin Institut für Medizinische-Chemische Labordiagnostik LKH Steyr Patient Patient LABOR EXTERN Aktion

Mehr

Verbesserung des Tuberkulose-Screenings bei Patienten mit rheumatischen Erkrankungen vor Beginn einer Therapie mit TNFα-Blockern

Verbesserung des Tuberkulose-Screenings bei Patienten mit rheumatischen Erkrankungen vor Beginn einer Therapie mit TNFα-Blockern Rheumatologie / Klinische Immunologie Prof. Dr. H.P. Tony (Leiter des Schwerpunktes) Prof. Dr. med. Ch. Kneitz Medizinische Poliklinik Klinikstr. 6-8 97070 Würzburg Abstract: 1 / 10 Verbesserung des Tuberkulose-Screenings

Mehr

Logbuch für das Praktische Jahr. Institut für Humangenetik Name:

Logbuch für das Praktische Jahr. Institut für Humangenetik Name: Logbuch für das Praktische Jahr Institut für Humangenetik Name: Liebe PJ-Studierende, herzlich Willkommen im Institut für Humangenetik des Universitätsklinikums Leipzig AöR. Wir freuen uns sehr, dass Sie

Mehr

Update PID Deutschland Süd

Update PID Deutschland Süd Joint-FERRING FORUM der Reproduktionsmedizin und der pädiatrischen Endokrinologie 24.4.2015 Hamburg Update Deutschland Süd 2011-1/2015 Reproduktionsmedizin München Bollmann Brückner Noss Ulrich Noss Birgit

Mehr

Anlage zur Akkreditierungsurkunde D-ML nach DIN EN ISO 15189:2013

Anlage zur Akkreditierungsurkunde D-ML nach DIN EN ISO 15189:2013 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-ML-13425-01-00 nach DIN EN ISO 15189:2013 Gültigkeitsdauer: 29.08.2014 bis 13.03.2018 Ausstellungsdatum: 29.08.2014 Urkundeninhaber:

Mehr

Qualität aus ärztlichen Händen. Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter

Qualität aus ärztlichen Händen. Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter Qualität aus ärztlichen Händen Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter Liebe Schwangere, als werdende Mutter befinden Sie sich wahrscheinlich in einer der emotionalsten Phasen

Mehr

Hämatologische Erkrankungen - Neue Behandlungsmöglichkeiten bei CLL / CML

Hämatologische Erkrankungen - Neue Behandlungsmöglichkeiten bei CLL / CML Hämatologische Erkrankungen - Neue Behandlungsmöglichkeiten bei CLL / CML Von Priv.-Doz. Dr. R. Liersch Gemeinschaftspraxis für Hämatologie und Onkologie, Münster Innere Medizin III (Hämatologie/Onkologie)Clemenshospital

Mehr

Klinisches Institut für Medizinische und Chemische Labordiagnostik (KIMCL) Allgemeines Krankenhaus Wien. Medizinische Universität Wien

Klinisches Institut für Medizinische und Chemische Labordiagnostik (KIMCL) Allgemeines Krankenhaus Wien. Medizinische Universität Wien Klinisches Institut für Medizinische und Chemische Labordiagnostik (KIMCL) Allgemeines Krankenhaus Wien Medizinische Universität Wien KlMCL Probenaufkommen Ca. 8.000 Proben/Tag Ca. 80.000 Ergebnisse/ Tag

Mehr

ATTGACTTTGGACTAGAATCGATAAAATCCGCATCATCATACCCATTGGCCGGGTAACCCTG TCATGTCATTTAGGGATTTTTATTTTTAAAACGTATTATGGACCACAGGATCATGATCATGAC

ATTGACTTTGGACTAGAATCGATAAAATCCGCATCATCATACCCATTGGCCGGGTAACCCTG TCATGTCATTTAGGGATTTTTATTTTTAAAACGTATTATGGACCACAGGATCATGATCATGAC ATTGACTTTGGACTAGAATCGATAAAATCCGCATCATCATACCCATTGGCCGGGTAACCCTG ACGATTAGTCATCATGAGGGACTGGTTTAGGTTTCCACATGACGTATGCATTAAACCCTTTAG TGGAGGGTTTGGGGCCCATTCATGATCTCTCTCAAGGAGATACGATCATGTCCCCCCTTTTGG ACGTATGACTAAGGCCTACCATGGGACTGGTCAGTCATGCATGACATAGACTGGTACCATTT

Mehr

Deutsche Gesellschaft für Humangenetik e.v. Indikationskriterien für genetische Diagnostik Bewertung der Validität und des klinischen Nutzens

Deutsche Gesellschaft für Humangenetik e.v. Indikationskriterien für genetische Diagnostik Bewertung der Validität und des klinischen Nutzens Deutsche Gesellschaft für Humangenetik e.v. Indikationskriterien für genetische Diagnostik Bewertung der Validität und des klinischen Nutzens german society of human genetics www.gfhev.de Indikationskriterien

Mehr

Was kommt auf uns zu? Neue Erkenntnisse über die Bedeutung von Vitamin D

Was kommt auf uns zu? Neue Erkenntnisse über die Bedeutung von Vitamin D Was kommt auf uns zu? Neue Erkenntnisse über die Bedeutung von Vitamin D PD Dr. med. Elizabeth Ramos-Lopez Klinikum der Johann Wolfgang Goethe-Universität Medizinische Klinik I Endokrinologie und Diabetes

Mehr

Strahlenbiologische Grundlagen

Strahlenbiologische Grundlagen Strahlenbiologische Grundlagen Wolfgang-Ulrich MüllerM Häufigkeit von Tumoren im Kindesalter (auf der Basis der Jahre 1997-2006) (Quelle: Robert-Koch-Institut basierend auf den Daten des Deutschen Kinderkrebsregisters,

Mehr

Änderung per 1. März 2019

Änderung per 1. März 2019 Verordnung des EDI vom 29. September 1995 über Leistungen in der obligatorischen Krankenpflegeversicherung (Krankenpflege-Leistungsverordnung, KLV) SR 832.112.31 Anhang 3 1 Änderung per 1. März 2019 (Art.

Mehr

Nicht-invasive molekulargenetische Pränataldiagnostik

Nicht-invasive molekulargenetische Pränataldiagnostik Nicht-invasive molekulargenetische Pränataldiagnostik Dr. rer. medic. Wera Hofmann Medical Director LifeCodexx AG Dr. Wera Hofmann, Medical Director Porto, ECA 2011 July 2, 2011 page 1 2011 LifeCodexx

Mehr

B E S C H L U S S. des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 386. Sitzung am 12. Dezember Teil A

B E S C H L U S S. des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 386. Sitzung am 12. Dezember Teil A B E S C H L U S S des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 386. Sitzung am 12. Dezember 2016 Teil A zur Änderung des Einheitlichen Bewertungsmaßstabes (EBM) mit Wirkung zum 1. Januar

Mehr

Angriffspunkte bei der Behandlung von Autoimmunerkrankungen

Angriffspunkte bei der Behandlung von Autoimmunerkrankungen Angriffspunkte bei der Behandlung von Autoimmunerkrankungen Dr. Ilse Zündorf Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt zuendorf@em.uni-frankfurt.de Autoimmunerkrankungen Grundlagen

Mehr

Anästhesie bei seltenen Erkrankungen

Anästhesie bei seltenen Erkrankungen Anästhesie bei seltenen Erkrankungen Bearbeitet von Peter Biro, Dierk A. Vagts, Uta Emmig, Thomas Pasch 4., vollst. überarb. u. erw. Aufl. 2010. Buch. xxxiv, 269 S. Hardcover ISBN 978 3 642 01046 0 Format

Mehr

Anlage zur Akkreditierungsurkunde D-ML-13294-03-00 nach DIN EN ISO 15189:2007

Anlage zur Akkreditierungsurkunde D-ML-13294-03-00 nach DIN EN ISO 15189:2007 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-ML-13294-03-00 nach DIN EN ISO 15189:2007 Gültigkeitsdauer: 17.12.2014 bis 19.02.2017 Ausstellungsdatum: 17.12.2014 Urkundeninhaber:

Mehr

Humangenetik. Dr. Sabine Hentze

Humangenetik. Dr. Sabine Hentze Humangenetik Diagnostik Indikationen Ethische Fragen Dr. Sabine Hentze 1 Genetik ist Medizin Forschung Technologie und Informatik Politik 2 Humangenetik Diagnostik Indikationen Ethische Fragen 3 Diagnostische

Mehr

Anlage zur Akkreditierungsurkunde D-ML nach DIN EN ISO 15189:2014

Anlage zur Akkreditierungsurkunde D-ML nach DIN EN ISO 15189:2014 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-ML-13425-01-00 nach DIN EN ISO 15189:2014 Gültigkeitsdauer: 01.03.2018 bis 28.02.2023 Ausstellungsdatum: 01.03.2018 Urkundeninhaber:

Mehr

DARMKREBS VERHINDERN. Eine Patienteninformation zur Darmspiegelung

DARMKREBS VERHINDERN. Eine Patienteninformation zur Darmspiegelung DARMKREBS VERHINDERN Eine Patienteninformation zur Darmspiegelung WCP, Mannheim Bismarckplatz 1 68165 Mannheim Tel. 0621/123475-0 Fax 0621/123475-75 www.enddarm-zentrum.de Am effektivsten lässt sich Darmkrebs

Mehr

Morbus Waldenström. Diagnostische Empfehlung. Methode Antikoagulans Empfehlung. Zytomorphologie EDTA obligat

Morbus Waldenström. Diagnostische Empfehlung. Methode Antikoagulans Empfehlung. Zytomorphologie EDTA obligat 1/7 Morbus Waldenström Diagnostische Empfehlung Methode Antikoagulans Empfehlung Zytomorphologie EDTA obligat Immunphänotypisierung EDTA oder Heparin obligat Chromosomenanalyse Heparin fakultativ FISH

Mehr

Anwendung pränataldiagnostischer Verfahren im 1. Trimenon

Anwendung pränataldiagnostischer Verfahren im 1. Trimenon Anwendung pränataldiagnostischer Verfahren im 1. Trimenon (Stellungnahme der DEGUM Stufe III) Peter Kozlowski praenatal.de Stufe II Treffen Ost der DEGUM-Sektion Gynäkologie Leipzig 27. Januar 2018 g-ba.de

Mehr

Anlage zur Akkreditierungsurkunde D-ML-13135-02-00 nach DIN EN ISO 15189:2013

Anlage zur Akkreditierungsurkunde D-ML-13135-02-00 nach DIN EN ISO 15189:2013 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-ML-13135-02-00 nach DIN EN ISO 15189:2013 Gültigkeitsdauer: 22.08.2014 bis 21.08.2019 Ausstellungsdatum: 22.08.2014 Urkundeninhaber:

Mehr

Dr. med. Stefan Weyhenmeyer

Dr. med. Stefan Weyhenmeyer Kompetenz verbindet. Dr. med. Stefan Weyhenmeyer Innere Medizin Gastroenterologie Hepatologie Proktologie Kritik ernst nehmen, zuhören und mit dem Patienten als Partner sprechen, darin sehe ich eine wichtige

Mehr

Klare ANTWORTEN auf wichtige Fragen

Klare ANTWORTEN auf wichtige Fragen Klare ANTWORTEN auf wichtige Fragen Der HARMONY PRÄNATAL-TEST ist ein neuartiger, DNA-basierter Bluttest zur Erkennung von Trisomie 21 (Down-Syndrom). Der Harmony- Test ist zuverlässiger als herkömmliche

Mehr

Änderungen der Humangenetik im Kapitel 11, 19 und 32 des EBM zum 1. Juli 2016

Änderungen der Humangenetik im Kapitel 11, 19 und 32 des EBM zum 1. Juli 2016 Änderungen der Humangenetik im Kapitel 11, 19 und 32 des EBM zum 1. Juli 2016 Punktzahl Alt Neu 11310 bis 11312 11320 bis 11322 gestrichen 11330 bis 11334 Abschnitt 11.4.1 Pauschalen der in-vitro-diagnostik

Mehr

Änderung per 1. Januar 2017

Änderung per 1. Januar 2017 Änderung per 1. Januar 2017 Kapitel 2: enetik 2.2.2 Molekulargenetische Analysen 2018.00 350 Chromosomenuntersuchung, konstitutioneller Karyotyp oder maligne Hämopathien, Zuschlag für In-situ- Hybridisierung

Mehr

DAS NATIONALE CENTRUM FÜR TUMORERKRANKUNGEN HEIDELBERG IHRE SPENDE WIRKT

DAS NATIONALE CENTRUM FÜR TUMORERKRANKUNGEN HEIDELBERG IHRE SPENDE WIRKT DAS NATIONALE CENTRUM FÜR TUMORERKRANKUNGEN HEIDELBERG IHRE SPENDE WIRKT DANK IHRER UNTERSTÜTZUNG KÖNNEN WIR NEUE PROJEKTE AM NCT HEIDELBERG REALISIEREN FACHÜBERGREIFEND FORSCHEN, THERAPIEREN UND VORBEUGEN

Mehr

2. Aachener Mikroskopierkurs, Stufe III Spezielle Hämatologie

2. Aachener Mikroskopierkurs, Stufe III Spezielle Hämatologie Klinik für Onkologie, Hämatologie Einladung und Programm Unter der Schirmherrschaft der DGHO 2. Aachener Mikroskopierkurs, Stufe III Spezielle Hämatologie Klinik für Onkologie, Hämatologie Prof. Dr. med.

Mehr

INFORMATION FÜR PATIENTEN

INFORMATION FÜR PATIENTEN 3010 Bern INFORMATION FÜR PATIENTEN Informierte Zustimmung zu genetischen Untersuchungen Eine genetische Untersuchung hat zum Ziel, durch eine Analyse des Erbguts eine genetische Krankheit oder eine Veranlagung

Mehr

Vorsorge: Darmspiegelung

Vorsorge: Darmspiegelung Vorsorge: Darmspiegelung Seit vielen Jahren hatte ich die Vorsorge-Darmspiegelung vor mir hergeschoben. Und nun die Nachricht Darmkrebs! Ich stand vor einem unüberwindbaren Berg aus Angst und Fragen. Zum

Mehr

Pränatale Analytik Informationen für die Eltern

Pränatale Analytik Informationen für die Eltern Pränatale Analytik Informationen für die Eltern Liebe Eltern Sie entscheiden. Diese Broschüre vermittelt Ihnen wichtige Informationen zur pränatalen Diagnostik fetaler Trisomien. Die Entscheidung, einen

Mehr

Jahreshauptversammlung 2014 Bericht aus Kiel

Jahreshauptversammlung 2014 Bericht aus Kiel KINDERKREBSINITIATIVE BUCHHOLZ Holm-Seppensen (KKI) Jahreshauptversammlung 2014 Bericht aus Kiel 50 Jahre LKR 40 Jahre Kiel-Klassifikation 1963 Karl Lennert Prof. Hamperl (stellvertretender Vorsitzende

Mehr

Ratgeber für Patienten. Kampf dem Darmkrebs

Ratgeber für Patienten. Kampf dem Darmkrebs Ratgeber für Patienten Kampf dem Darmkrebs Auch Sie können selbst dazu beitragen Deutsche Gesellschaft zur Bekämpfung der Krankheiten von Magen, Darm, Leber und Stoffwechsel sowie von Störungen der Ernährung

Mehr

Pränatale array-cgh. Abklären und erkennen. Für eine erweiterte pränatale Vorsorge

Pränatale array-cgh. Abklären und erkennen. Für eine erweiterte pränatale Vorsorge Pränatale array-cgh Abklären und erkennen Für eine erweiterte pränatale Vorsorge Untersuchung für Schwangere mit speziellen Risiken Array-CGH: Warum kann sie nötig sein? Chromosomen: Die Träger der Erbinformationen

Mehr

Medizinisch-technische Laboratoriumsassistentinnen/ Medizinisch-technische Laboratoriumsassistenten

Medizinisch-technische Laboratoriumsassistentinnen/ Medizinisch-technische Laboratoriumsassistenten Medizinisch-technische Laboratoriumsassistentinnen/ Medizinisch-technische Laboratoriumsassistenten arbeiten selbstständig und eigenverantwortlich in 5 Fachgebieten der Laboratoriumsmedizin, die gleichzeitig

Mehr

Diagnose Brustkrebs. Informationen für Patientinnen

Diagnose Brustkrebs. Informationen für Patientinnen Diagnose Brustkrebs Informationen für Patientinnen Für jede Patientin die individuelle Therapie In Deutschland erkranken jährlich rund 72.000 Frauen an Brustkrebs. Viel wichtiger aber für Sie: Brustkrebs

Mehr

Pränatale Diagnostik. Methoden:

Pränatale Diagnostik. Methoden: Ziel = Früherkennung von Schädigungen bei Föten Nicht-Ziel = Prävention oder medizinisch-therapeutische Intervention hinsichtlich erkannter Schädigungen und Beeinträchtigungen Methoden: 1. Nicht-invasive

Mehr

HUMANGENETISCHE BERATUNG BEI FEHLGEBURTEN

HUMANGENETISCHE BERATUNG BEI FEHLGEBURTEN HUMANGENETISCHE BERATUNG BEI FEHLGEBURTEN Zertifiziert nach DIN EN ISO 9001 IHRE PARTNER IN GENETISCHER BERATUNG UND DIAGNOSTIK WW W.DNA-DIAGNOSTIK.HAMBURG GEMEINSCHAFTSPRAXIS IN KOOPERATION MIT DEM PRÄNATALZENTRUM

Mehr

Das Freiburger Zentrum für Seltene Erkrankungen

Das Freiburger Zentrum für Seltene Erkrankungen Das Freiburger Zentrum für Seltene Erkrankungen Prof. Dr. med. Janbernd Kirschner Klinik Neuropädiatrie und Muskelerkrankungen 6. FORUM Patientennahe Klinische Forschung 26. November 2014 in Freiburg Seltene

Mehr

Pränatales Screening auf Chromosomenstörungen

Pränatales Screening auf Chromosomenstörungen Unsere Patienten-Information Pränatales Screening auf Chromosomenstörungen Leitfaden für werdende Mütter und Väter Unsere Patienten-Information Liebe Patientin, eine Schwangerschaft ist ein ganz besonderes

Mehr

Lernziele. Molekulargenetik I

Lernziele. Molekulargenetik I Molekulargenetik I Lernziele Nach dem Seminar können Sie o Vererbungsmodi vorwärts (Entwurf eines plausiblen Stammbaums zum bekannten Erbmodus) und rückwärts anwenden (wahrscheinlichsten Erbmodus aus vorgegebenem

Mehr

Medizinische Klinik II. Patienteninformation der Klinik für Hämatologie, Internistische Onkologie und Palliativmedizin

Medizinische Klinik II. Patienteninformation der Klinik für Hämatologie, Internistische Onkologie und Palliativmedizin Medizinische Klinik II Patienteninformation der Klinik für Hämatologie, Internistische Onkologie und Palliativmedizin 2 Medizinische Klinik II Medizinische Klinik II 3 Darüber hinaus verfügen wir über

Mehr

Extra: Schilddrüsenprobleme. Alle wichtigen Heilmethoden Das können Sie selbst tun. Gesunde Rezepte für die Schilddrüse. natürlich behandeln

Extra: Schilddrüsenprobleme. Alle wichtigen Heilmethoden Das können Sie selbst tun. Gesunde Rezepte für die Schilddrüse. natürlich behandeln DR. ANDREA FLEMMER Schilddrüsenprobleme natürlich behandeln Alle wichtigen Heilmethoden Das können Sie selbst tun Extra: Gesunde Rezepte für die Schilddrüse Krankheiten und Probleme Schilddrüsenerkrankungen

Mehr

Ringversuch zur Qualitätssicherung in der Interphase-FISH-Diagnostik in der Tumorzytogenetik 2013 (QUITZ)

Ringversuch zur Qualitätssicherung in der Interphase-FISH-Diagnostik in der Tumorzytogenetik 2013 (QUITZ) Ringversuch zur Qualitätssicherung in der Interphase-FISH-Diagnostik in der Tumorzytogenetik 2013 (QUITZ) www.bvdh-ringversuche.de Organisation - Ablauf Seit 2012 wird der RV Tumor-FISH durch den BVDH

Mehr

Pränatale genetische Diagnostik

Pränatale genetische Diagnostik Pränatale genetische Diagnostik Vorgeburtliche Diagnostik Überblick der Testverfahren Die pränatale Diagnostik ermöglicht den Nachweis von genetisch bedingten Erkrankungen und Entwicklungsstörungen vor

Mehr

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms?

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Brustkrebs aktuell - OSP am 21.10.2015 Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Prof. Dr. German Ott, Institut für Pathologie Robert-Bosch-Krankenhaus

Mehr

Molekulargenetische Diagnostik bei Lynch-Syndrom / Hered. Nicht-Polyposis Kolorektalkarzinom (HNPCC; OMIM )

Molekulargenetische Diagnostik bei Lynch-Syndrom / Hered. Nicht-Polyposis Kolorektalkarzinom (HNPCC; OMIM ) Molekulargenetische Diagnostik bei Lynch-Syndrom / Hered. Nicht-Polyposis Kolorektalkarzinom (HNPCC; OMIM 120435) Klinisch-genealogische Einschlusskriterien Amsterdam Kriterien II (1998): Drei oder mehr

Mehr

Genetische Varianten: Aufgaben der Pharmakogenetik. Personalisierte Medizin mit Hilfe der Pharmacogenetik

Genetische Varianten: Aufgaben der Pharmakogenetik. Personalisierte Medizin mit Hilfe der Pharmacogenetik Personalisierte Medizin mit Hilfe der Pharmacogenetik Priv. Doz. Dr. Annette Kaiser Medizinsches Forschungszentrum Institut für Pharmakogenetik Hufelandstrasse 55 45147 Essen Telefon: 0201-723-3468 email:

Mehr

FORMULAR zum Wahlfachmodul. Chirurgie in einem Krankenhaus der Grund- und Regelversorgung

FORMULAR zum Wahlfachmodul. Chirurgie in einem Krankenhaus der Grund- und Regelversorgung Chirurgie in einem Krankenhaus der Grund- und Regelversorgung Klinisches Wahlfachangebot für den Wahlfach-Schwerpunkt: Magen-Darm-Trakt Dozenten:, Veranstaltungsform: Praktikum/Seminar, ganztags, Semesterferien,

Mehr

Labortests für Ihre Gesundheit. Personalisierte Medizin

Labortests für Ihre Gesundheit. Personalisierte Medizin Labortests für Ihre Gesundheit Personalisierte Medizin 33 01IPF Labortests für Ihre Gesundheit Personalisierte Medizin Das sollten Sie wissen Krebs ist nicht gleich Krebs eine solche Differenzierung gilt

Mehr

2.7 15-Jahre Überleben zu häufigen Krebserkrankungen

2.7 15-Jahre Überleben zu häufigen Krebserkrankungen 45 2.7 15-Jahre Überleben zu häufigen Krebserkrankungen Die krankheitsspezifische Mortalität - präziser Letalität - ist eine wichtige Kenngröße jeder Krebserkrankung. Auch wenn Aussagen wie "92% aller

Mehr

Azilsartan ist potenter Blutdrucksenker

Azilsartan ist potenter Blutdrucksenker Hochwirksam bei essentieller Hypertonie Azilsartan ist potenter Blutdrucksenker Berlin (6. Dezember 2012) - Azilsartan bindet stärker als andere Sartane am AT1-Rezeptor und kann so eine besonders ausgeprägte

Mehr

Erblichkeit von Krebserkrankungen Was ist für den Hausarzt wichtig?

Erblichkeit von Krebserkrankungen Was ist für den Hausarzt wichtig? Erblichkeit von Krebserkrankungen Was ist für den Hausarzt wichtig? Jochen Heymanns Koblenz 28.08.2013 Einführung Warum dieses Thema? Einführung da heutige Familien klein sind, Familienmitglieder über

Mehr

GEMEINSCHAFTSPRAXIS FÜR HUMANGENETIK

GEMEINSCHAFTSPRAXIS FÜR HUMANGENETIK GEMEINSCHAFTSPRAXIS FÜR HUMANGENETIK DR. MED. USHA PETERS DR. MED. SASKIA KLEIER DR. MED. RIXA WOITSCHACH PRAENATALZENTRUM HAMBURG UND HUMANGENETIK IM GYNAEKOLOGICUM Ihre Partner in genetischer Beratung

Mehr

Universitäts-Frauenklinik Essen. Pränataldiagnostik und Fetalmedizin Perinatalzentrum Level 1

Universitäts-Frauenklinik Essen. Pränataldiagnostik und Fetalmedizin Perinatalzentrum Level 1 Universitäts-Frauenklinik Essen Pränataldiagnostik und Fetalmedizin Perinatalzentrum Level 1 Sehr geehrte Kolleginnen und Kollegen, Liebe Eltern, unsere Hochschulambulanz für pränatale Medizin bietet Ihnen

Mehr

B E S C H L U S S. des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 386. Sitzung am 12. Dezember Teil A

B E S C H L U S S. des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 386. Sitzung am 12. Dezember Teil A B E S C H L U S S des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 386. Sitzung am 12. Dezember 2016 Teil A zur Änderung des Einheitlichen Bewertungsmaßstabes (EBM) mit Wirkung zum 1. Januar

Mehr

Was ist BWS? Familieninformationstreffen Beckwith- Wiedemann Syndrom Spektrum 23. und 24. Juni in Hannover

Was ist BWS? Familieninformationstreffen Beckwith- Wiedemann Syndrom Spektrum 23. und 24. Juni in Hannover Was ist BWS? Familieninformationstreffen Beckwith- Wiedemann Syndrom Spektrum 23. und 24. Juni in Hannover Was ist BWS? 1. Erstbeschreibung und Epidemiologie 2. Genetische Ursachen 3. Begriffsdefinition

Mehr

der Beitrag der Labordiagnostik im modernen Umfeld der Krebstherapie

der Beitrag der Labordiagnostik im modernen Umfeld der Krebstherapie der Beitrag der Labordiagnostik im modernen Umfeld der Krebstherapie Was können die Labors heute leisten? Prof. Dr. med. Wolfgang Korte Chefarzt und CEO Zentrum für Labormedizin St. Gallen Der klinische

Mehr

Entzündliche Hautkrankheiten

Entzündliche Hautkrankheiten Entzündliche Hautkrankheiten Dermatologische Klinik Entzündliche Hautkrankheiten Entzündliche Hautkrankheiten Liebe Leserin Lieber Leser Die Dermatologische Klinik am UniversitätsSpital Zürich ist spezialisiert

Mehr

Fachklinik für Orthopädie

Fachklinik für Orthopädie Fachklinik für Orthopädie KURPARK-KLINIK KURPARK-KLINIK Zentrum für medizinische Rehabilitation WILLKOMMEN IN DER FACHKLINIK FÜR ORTHOPÄDIE DER KURPARK-KLINIK IN BAD NAUHEIM Sicherheit und Stabilität ORTHOPÄDIE

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

1. Kapitel: Chemie/Hämatologie/Immunologie... 3

1. Kapitel: Chemie/Hämatologie/Immunologie... 3 Verordnung des EDI vom 29. September 1995 über Leistungen in der obligatorischen Krankenpflegeversicherung (Krankenpflege-Leistungsverordnung, ) 832.112.31 Analysenliste 2 Anhang 3 1 (Art. 28) Inhaltsübersicht

Mehr

9 5 Chronisch lymphatische Leukämie und andere lymphoproliferative Krankheiten 154

9 5 Chronisch lymphatische Leukämie und andere lymphoproliferative Krankheiten 154 Inhalt Einleitung 1 1 Das Immunsystem: Struktur, Entwicklung und Möglichkeiten der Reizantwort 3 1.1 Struktur des Immunsystems 3 1.2 Die an Immunreaktionen beteiligten Zelltypen 7 1.3 Zellzirkulation im

Mehr

Allgemeine Angaben des Instituts für Humangenetik

Allgemeine Angaben des Instituts für Humangenetik B-34.1 Allgemeine Angaben des Instituts für Humangenetik Fachabteilung: Art: Institut für Humangenetik nicht Betten führend Ärztlicher Direktor: Prof. Dr. med. Christian Kubisch Ansprechpartner: Regina

Mehr

Block 8 Mentale Retardierung (Oligophrenie):

Block 8 Mentale Retardierung (Oligophrenie): Block 8 Mentale Retardierung (Oligophrenie): Klassifikation und Häufigkeit: Sprach- und Lernstörung IQ 70-85* 5-10 % - Leseschwäche (Dyslexie) - Lernschwäche (LD = learning disability) - Konzentrations-

Mehr

HABILITATIONSSCHRIFT. Syndromale Erkrankungsbilder mit mentaler Retardierung

HABILITATIONSSCHRIFT. Syndromale Erkrankungsbilder mit mentaler Retardierung Aus dem Charité Centrum 17 Institut für Medizinische Genetik Direktor: Prof. Dr. Stefan Mundlos HABILITATIONSSCHRIFT Syndromale Erkrankungsbilder mit mentaler Retardierung zur Erlangung der Venia legendi

Mehr

Entscheidungserhebliche Gründe

Entscheidungserhebliche Gründe Entscheidungserhebliche Gründe zum Beschluss des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 386. Sitzung am 12. Dezember 2016 zur Änderung des Einheitlichen Bewertungsmaßstabes (EBM) Teil

Mehr

Patienteninformation zur Präimplantationsdiagnostik V3 07/2015 Seite 1 von 5

Patienteninformation zur Präimplantationsdiagnostik V3 07/2015 Seite 1 von 5 Medizinisch Genetisches Zentrum Prof. Dr. med. Dipl. chem. Elke Holinski-Feder, PD Dr. med. Angela Abicht Fachärztinnen für Humangenetik, MVZ Patienteninformation zur Präimplantationsdiagnostik Begriffserläuterung

Mehr

Essen / Düsseldorf Dresden. Frankfurt / Mainz. Heidelberg. Tübingen. München

Essen / Düsseldorf Dresden. Frankfurt / Mainz. Heidelberg. Tübingen. München Berlin Essen / Düsseldorf Dresden Frankfurt / Mainz Heidelberg Tübingen Freiburg München Was ist das MASTER Programm? Das MASTER Programm hat zum Ziel, auf Basis von Veränderungen im Erbgut einzelner Tumoren

Mehr

Methoden der invasiven Pränataldiagnostik. Methoden zur Beurteilung der fetalen Kondition

Methoden der invasiven Pränataldiagnostik. Methoden zur Beurteilung der fetalen Kondition Pränataldiagnostik Nicht-invasive invasive Methoden der Pränataldiagnostik Sonographie-Screening (10., 20., 30. SSW) und weiterführende Sonographie Ersttrimesterscreening Methoden der invasiven Pränataldiagnostik

Mehr

Therapeutisches Drug Monitoring bei Antiepileptika

Therapeutisches Drug Monitoring bei Antiepileptika Therapeutisches Drug Monitoring bei Antiepileptika Prof. Dr. med. Gerd Mikus Abteilung Innere Medizin VI Klinische Pharmakologie und Pharmakoepidemiologie Universitätsklinikum Heidelberg gerd.mikus@med.uni-heidelberg.de

Mehr

Atypisches HUS und Genetik. Gesa Schalk / Kinderspital Zürich ahus-patiententag / Bonn /

Atypisches HUS und Genetik. Gesa Schalk / Kinderspital Zürich ahus-patiententag / Bonn / Atypisches HUS und Genetik Gesa Schalk / Kinderspital Zürich ahus-patiententag / Bonn / 20.05.2017 Warum dieser Vortrag auf dem Patiententag? Man weiss heute, dass die genetische Ursache erhebliche Unterschiede

Mehr