Genome Engineering in der Ratte

Größe: px
Ab Seite anzeigen:

Download "Genome Engineering in der Ratte"

Transkript

1 Boris Jerchow 41. Seminar über Versuchstiere und Tierversuche 08. Mai 2012, BfR, Berlin Genome Engineering in der Ratte Stehen wir vor der Renaissance eines Modellorganismus? SEITE 1

2 1828 Geschichte Laborratte stammt von Wanderratte ab Berichte über Rattenfänger aus dem 19. Jahrhundert Fänger studierten Verhalten 1828 Hungerstudien genetische Studien durch Crampe Anfang 20. Jahrhundert Wiederentdeckung Mendelsche Gesetze (Fellfarbgenetik) Wanderratte (Hans-Jörg Hellwig, wikipedia.org) 1906 Beginn der Zucht im Wistar Institute for Anatomy and Biology (www.wistar.org) 1909 erste Inzuchtratte Laborratte (Pemelet, wikipedia.org) SEITE 2

3 Die Ratte hat sich als ausgezeichnetes Tiermodell erwiesen Pharmakologie/Wirkstoffsuche Toxikologie Neurobiologie/Verhaltensforschung Herz-/Kreislaufforschung Bilder: wikipedia.org Wistarat (US public domain) Zucker Ratte (J. Servaes) Sprague-Dawley Ratte (J.-E. Minh-Duy Poirrier) SEITE 3

4 Timoféef-Ressovsky, Zimmer, Delbrück betrahlen Drosophila und weisen nach, dass Gene chemische Struktur besitzen 1940 Watson, Crick klären Doppelhelixstruktur der DNA auf 1953 Struktur von Genen; Mechanismen der Replikation, Expression, Regulation (nur Prokarionten und Viren) erste transgene Organismen 1960er 1970er erstes künstilches Plasmid 1971 Southern Blot 1975 Sanger Sequenzierung 1977 Knock-Out Technik 1980er Gordon/Ruddle und Costantini/Lacy: Transgene Mäuse 1981 Evans: murine ES-Zellen 1981 Mullis: PCR 1983 Smithies: Homologe Rekkombination 1985 Capecchi: Knock Out Maus 1989 SEITE 4

5 80% 70% 60% 50% 40% 30% 20% 10% 0% Ratte Maus Publikationen Ratte, Maus Die Ratte war in der Prä-Knockout-Ära das dominante Versuchstier SEITE 5

6 1989 Warum die Ratte? 1990 seit ¼ Jahrhundert kann das Genom der Maus maßgeschneidert werden seitdem wurden tausende gentechnisch veränderte Mauslinien erzeugt (z.b. EMMA: fast 3000, Jackson Lab: >6000 Linien) 65% 60% 55% 50% 2002 unzählige Untersuchungen mit diesen Mauslinien, große Menge an Daten akkumuliert Zucht und Haltung von Ratten deutlich teurer als bei der Maus 45% 40% 35% 30% Ratte Maus SEITE 6

7 Warum die Ratte? seit Anfang des 20. Jahrhunderts Zucht von Inzuchtstämmen aufgrund von Eigenschaften, die von biomedizinschem Interesse sind seit kurzem ist es möglich, auch das Genom der Ratte zielgerichtet zu verändern schon rund 600 Stämme und Unterstämme in der Rat Genome Database SEITE 7

8 Die Ratte ist nicht nur eine große Maus! mehrere Millionen Jahre evolutionärer Abstand Physiologie in vielen Fällen dem Menschen ähnlicher bis zur Entwicklung der ko Maus war Ratte das dominante Versuchstier in der biomedizinischen Forschung große Mengen von Daten müssten in der Maus neu erhoben werden (Tierschutz!) Bilder: wikipedia.org SEITE 8

9 Herz-Kreislauf-Erkrankungen gutes Modell, vor allem Schlaganfall und Bluthochdruck verschiedene gezüchtete Linien ideal für entsprechende Studien operative Eingriffe Überwachung physiologischer Parameter Volumina SEITE 9

10 Verhaltensstudien Ratte intelligenter als die Maus Ratte löst komplexere Aufgaben z.b. Radial Arm Maze zur Untersuchung Einfluss pharmakologisch wirksamer Substanzen auf Erinnerung Radial Arm Maze nach Olton, D.S., & Samuelson, R.J. (1976) Bild: wikipedia.org SEITE 10

11 und weitere Forschungsrichtungen z.b. Brustkrebs Hormonabhängigkeit vergleichbar mit dem Menschen prä-maligne Stadien sehr ähnlich denen beim Menschen z.b. Toxikologie und Wirkstoffforschung Abbau von Giftstoffen ähnlich wie beim Menschen Blutentnahmen in kurzen Abständen möglich Ratte war immer wichtiges Modell in der Industrie SEITE 11

12 Eine neue Ära: GENTECHNISCHE VERÄNDERUNGEN IN DER RATTE SEITE 12

13 ENU ohne Möglichkeit zur zielgerichteten Mutagenese: ENU-Behandlung von Männchen Punktmutationen sehr aufwändig, Mutationen zu identifizieren mögliche Kosegregation Forward Genetics wikipedia.org SEITE 13

14 Kyoto University Rat Mutant Archive ENU in der Maus 1979 (KURMA) ENU als genet. Werkzeug 1981 extensive ENU-Mutagenese Spermien von tausenden G1-Männchen kryokonserviert optimiertes Screening-Verfahren über Mu Transposon (einzelne Basenunterschiede als Zielsequenz) optimierte Rückgewinnung von Linien über ICSI viele interessante Linien identifiziert verschiedene Probleme bleiben 1989 PKU Modell Linien 2011 Ziel: SEITE 14

15 Gene Traps über Transposons ITR SA Reporter pa SD + Transposase ITR SEITE 15

16 Funktionsweise Gene Trap ITR SA Reporter pa SD ITR + Transposase Restprotein-Reporter-Fusion Exon 1 Exon 2 Exon 3 Exon 2 Exon 3 SEITE 16

17 Über transgene Ratten Transposase x Transposase SEITE 17

18 Über Spermatogoniale Stammzellen (SSCs) Transposase Dazl -/- Selektion Analyse Kryokonservierung Transplantation SEITE 18

19 Mit Gene Traps nicht alle Gene erreichbar Anzahl der Stammzellklone unterschiedliche Gene mit Mutation SEITE 19

20 Zielgerichtete Mutagenese DIE KÖNIGSDISZIPLIN SEITE 20

21 Evans 1981 Ratten ES-Zellen Capecchi 1989 Standard-Methoden aus der Maus nicht übertragbar Erfolg in der Maus abhängig vom Stamm Kultur mit Inhibitorcocktails führt bei nichtpermissiven Mausstämmen zum Erfolg (3i, 2i) Übertragung auf Ratte Zellen sehr instabil Durchführung wie bei Maus 2i Medium 2008 echte res-zellen 2008 p53 KO 2010 SEITE 21

22 z.b. knock out von genomischen Sequezen ES-Zellkultur x x x x x x knock out ES-Zellen Johannes Wilbertz, KI Stockholm ISTT Mediensammlung, SEITE 22

23 Kombination einer Blastozyste mit KO ES-Zellen chimäre Ratte chimär X Keimbahntransmission schwierig! wildtypisch heterozygot SEITE 23

24 Zink-Finger, TALENs und Homing Endonukleasen Chimäres Protein: ZF-FokI 1996 ZFN-aktivierte hom Rek. in Zellkultur 2003 KO über ZFN in Drosophila 2003 ZFNs, TALENs: modular zusammengesetzt erzeugen Doppelstrangbrüche (DSB) Aktivierung zellulärer Reparaturmechanismen KO Homologe Rekombination Regulation von Genen KO Ratten 2009 chimäres Protein: TAL-effektor-FokI Homologe Rek. in der Ratte SEITE 24

25 ZFN-Mechanismus FokI catttacctggaatatgtgaggagtggggg aaatgcctaccaggtgttcttgacttctga gtaaatggaccttatacactcctcaccccc DSB tttacggatggtccacaagaactgaagact FokI

26 Zelluläre Reparaturmechanismen catttacctggaatatgtgaggagtggggg aaatgcctaccaggtgttcttgacttctga gtaaatggaccttatacactcctcaccccc tttacggatggtccacaagaactgaagact DSB NHEJ homologe Rekombination fehlerbehafteter Reparaturmech. Deletion von Nukleotiden (selten Insertionen) Frame-Shift führt zum KO homologe Rekombination mit anderem Allel oder eingebrachter exogener DNA SEITE 26

27 Knock In DSB Cui et. al, Nature Biotech. 2011: Knock In von GFP in den Mdr1a Lokus homologe Bereiche können kurz sein Technisch einfach: Koinjektion von Nuklease und targeting Vektor in Pronukleus homologe Rekombination homologe Rekombination mit anderem Allel oder eingebrachter exogener DNA SEITE 27

28 SEITE 28 Koinjektion von mrna und targeting Vektor

29 TALENs als Alternative zu ZFNs TAL Effektoren aus dem Pflanzenpathogen Xanthomonas spp. Repeats aus 34 Aminosäuren AS 12 und 13 binden an ein Nukleotid in DNA-Sequenz Code 2009 entschlüsselt In Verbindung mit FokI DSBs wie mit ZFNs SEITE 29

30 Vor- und Nachteile TALENs ein Repeat bindet ein Nukleotid mehr Repeats benötigt scheinen einfach so zu funktionieren aaatgcctaccaggtgttcttgacttctga tttacggatggtccacaagaactgaagact hohe Spezifizät auch mit wildtypischer FokI relativ günstig, relativ leicht selbst zu machen neue Technik ZFNs Repeats binden Triplets nicht alle Kombinationen möglich hoher Optimierungsbedarf (Wechelwirkungen der aaatgcctaccaggtgttcttgacttctga Repeats) tttacggatggtccacaagaactgaagact off-target Effekte, veränderte FokI erforderlich relativ teuer, relativ schwierig selbst zu machen 15 Jahre Entwicklung und Erfahrung SEITE 30

31 Zielgerichtete Mutagenese in der Ratte ist eine Option! ZUSAMMENFASSUNG SEITE 31

32 Zusammenfassung I Ratte hat seitens Physiologie, Intelligenz und Größe Vorteile gegenüber der Maus bis zur Entwicklung der KO-Technik war die Ratte der häufiger verwendete Modellorganismus (große Datenmengen) seit kurzem ist es möglich, zielgerichtete Mutatioen in der Ratte zu erzeugen neue Frage: welche Spezies ist das besser geeignete Modell? SEITE 32

33 Zusammenfassung II ENU induzierte Mutationen nicht steuerbar, aufwändige Detektion, nur Punktmutationen, häufige Kosegregation Gene Traps über transgene Ratten oder SSCs Sättigungseffekte Kultur, Selektion, Konservierung und Transplantation von SSCs noch im Anfangsstadium ES-Zelltechnologie wie bei der Maus Zellen instabil, offensichtlich als Routinetechnik (noch) nicht anwendbar SEITE 33

34 Zusammenfassung III chimäre Proteine aus ZF- oder TAL-Effektor-Repeats scheinen das größte Potential zu haben homing Endonukleasen von Effiktivität her vergleichbar aber Sequenzspezifität schwieriger zu erzeugen größere Zahl von KO-Rattenmodellen bereits erzeugt zusammen mit Targeting-Vektor KI möglich Endonukleasen: Technik der Zukunft? SEITE 34

35 Ressourcen Rat Genome Database, rgd, Knock Out Rat Consortium, KORC, Kyoto University Rat Mutant Archive, KURMA, NIH Rat Genomics and Genetics, Sigma Advanced Genetic Engineering Labs, SAGE, Cellectis, SEITE 35

Inhalte unseres Vortrages

Inhalte unseres Vortrages Inhalte unseres Vortrages Vorstellung der beiden paper: Germ line transmission of a disrupted ß2 mirkroglobulin gene produced by homologous recombination in embryonic stem cells ß2 Mikroglobulin deficient

Mehr

Transgene Tiere: Genmodifikation in der Maus

Transgene Tiere: Genmodifikation in der Maus Transgene Tiere: Genmodifikation in der Maus Gentechnik und Genomics WiSe 2007/2008 Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Nobelpreis Physiologie und Medizin 2007

Mehr

RNA-guided editing of bacterial genomes using CRISPR-Cas systems

RNA-guided editing of bacterial genomes using CRISPR-Cas systems RNA-guided editing of bacterial genomes using CRISPR-Cas systems Wenyan Jiang, David Bikard, David Cox, Feng Zhang, and Luciano A. Marraffini Nature Biotechnology, 31, 233 239, 2013 Nadja Kleisch Biotechnologie,

Mehr

Grundlegende Experimente der Molekulargenetik

Grundlegende Experimente der Molekulargenetik Übung 12 Wiederholung/Zusatzübung Inhalte: Mendelscher Erbgang Grundlegende Experimente der Molekulargenetik Transposons Methoden 1. Sie haben drei runde, gelbe Erbsen (A, B und C). Aus jeder der drei

Mehr

Mobile Genetische Elemente / Transposition

Mobile Genetische Elemente / Transposition Mobile Genetische Elemente / Transposition Transposition Retrotransposition / Retroviren repetitive Elemente mobile Elemente und Genomevolution / -regulation Gentherapie Berit Jungnickel Institut für Klinische

Mehr

Alexandra Ribarits Institut für Saat- und Pflanzgut, Pflanzenschutzdienst und Bienen

Alexandra Ribarits Institut für Saat- und Pflanzgut, Pflanzenschutzdienst und Bienen Neue Techniken der Pflanzenzüchtung Cisgenetik, Intragenetik, Zink-Finger-Nukleasen (ZFN), Oligonukleotid-gerichtete Mutagenese (ODM), Agroinfiltration, RNA-abhängige DNA Methylierung (RdDM), Umkehrzüchtung

Mehr

Transgene Tiere. Beispiele: - Das Gen für Wachstumshormon (GH) wurde mit einem starke Promotor in das Genom der Maus eingepflanzt.

Transgene Tiere. Beispiele: - Das Gen für Wachstumshormon (GH) wurde mit einem starke Promotor in das Genom der Maus eingepflanzt. Transgene Tiere Definition: Ein transgenes Tier besitzt definierte Veränderungen im Genom, die nicht durch klassische Züchtung oder zufällige Mutagenese zu erreichen wären. Beispiele: - Das Gen für Wachstumshormon

Mehr

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema Gentechnologie Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Die Genklonierung in Bakterien Vektor-DNA Spender-DNA Restriktionsenzym Rekombinante

Mehr

Pflanzenbiotechnologie

Pflanzenbiotechnologie Pflanzenbiotechnologie 1. Nicht molekular basierte Methoden = klassische Züchtungsforschung - beruft sich auf Spontanmutationen und Kreuzung von Eigenschaften = Austausch des gesamten Allels (= Genoms)

Mehr

Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem

Mehr

GV-SOLAS, Ausschuss für Genetik und Labortierzucht, Typen gentechnisch veränderter Tiere. Fachinformation

GV-SOLAS, Ausschuss für Genetik und Labortierzucht, Typen gentechnisch veränderter Tiere. Fachinformation Fachinformation aus dem Ausschuss für Genetik und Labortierzucht Typen gentechnisch veränderter Tiere Stand: März 2012 Autoren: Ingrid Renner-Müller, München Johannes Schenkel, Heidelberg Bernhard Aigner,

Mehr

Biotechnologie. Auf Gentechnologie basierende Aspekte. Nicht-genetisch basierende Techniken. Transgenische & knockout Lebewesen.

Biotechnologie. Auf Gentechnologie basierende Aspekte. Nicht-genetisch basierende Techniken. Transgenische & knockout Lebewesen. 1. Biotechnologie Auf Gentechnologie basierende Aspekte Nicht-genetisch basierende Techniken Transgenische & knockout Lebewesen Rekombinante Proteine Neue Stammzellen - Techniken Industrielle Fermentation

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Prof. Dr. med. Brigitte Schlegelberger 670513011/15 Olaparib Zulassung in Europa: Rezidiv eines Platin-sensitiven Ovarialkarzinoms

Mehr

β2-microglobulin deficient mice lack CD4-8+cytolytic T cells

β2-microglobulin deficient mice lack CD4-8+cytolytic T cells β2-microglobulin deficient mice lack CD4-8+cytolytic T cells Mäuse mit einem Knock-out bezüglich ß-Microglobulin sind nicht in der Lage CD4-8+ cytotoxische T-Zellen zu bilden Nature,Vol 344, 19. April

Mehr

Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen

Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen Quelle: scientopia.org Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen 30. Januar 2014 ChrisEna Spilker Intelligenz Charakter Gedächtnis Plas5zität beruht auf der chemischen Zwiesprache

Mehr

Transgene Organismen

Transgene Organismen Transgene Organismen Themenübersicht 1) Einführung 2) Komplementäre DNA (cdna) 3) Vektoren 4) Einschleusung von Genen in Eukaryontenzellen 5) Ausmaß der Genexpression 6) Genausschaltung (Gen-Knockout)

Mehr

Control of Peripheral Nerve Myelination by the ß-Secretase (BACE1 )

Control of Peripheral Nerve Myelination by the ß-Secretase (BACE1 ) Über Methoden der Grundlagenforschung Textquelle 1 Originally published in Science Express on 21 September 2006 Science 27 October 2006:; Vol. 314. no. 5799, pp. 664-666 DOI: 10.1126/science.1132341 Reports

Mehr

Pathologie und Prädiktion - neue Aspekte. Prof. Dr. med. C. Wickenhauser Institut für Pathologie

Pathologie und Prädiktion - neue Aspekte. Prof. Dr. med. C. Wickenhauser Institut für Pathologie Pathologie und Prädiktion - neue Aspekte Paradigmenwechsel in der Pathologie -Pathologe zentraler Lotse bei der individuellen Therapieentscheidung -Gewebeuntersuchung nicht nur aus diagnostischen sondern

Mehr

Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt.

Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt. Rekombinante Wirkstoffe Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt.de Praktische Definitionen Gentechnik Unmittelbare neukombination

Mehr

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 1.2.1.1. Molekulare Struktur von NCAM S.

Mehr

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG

Cornel Mülhardt. Genomics. 6. Auflaqe. Spektrum k - / l AKADEMISCHER VERLAG I Cornel Mülhardt Genomics 6. Auflaqe Spektrum k - / l AKADEMISCHER VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger...

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

Anwendung und Regulierung der neuen Pflanzenzüchtungstechniken aus deutscher Sicht. Hans-Jörg Buhk Quedlinburg, 18.06.2014

Anwendung und Regulierung der neuen Pflanzenzüchtungstechniken aus deutscher Sicht. Hans-Jörg Buhk Quedlinburg, 18.06.2014 Anwendung und Regulierung der neuen Pflanzenzüchtungstechniken aus deutscher Sicht Hans-Jörg Buhk Quedlinburg, 18.06.2014 New Techniques Working Group Einrichtung: Auf Vorschlag von national zuständigen

Mehr

Stand von letzter Woche

Stand von letzter Woche RUB ECR1 AXR1 Stand von letzter Woche E2 U? E1-like AXR1 Repressor ARF1 Proteasom AuxRE Repressor wird sehr schnell abgebaut notwendig für Auxinantwort evtl. Substrat für SCF Identifikation des SCF-Ubiquitin

Mehr

Molekularbiologie/ Genomics

Molekularbiologie/ Genomics Cornel Mülhardt Molekularbiologie/ Genomics 5. Auflage ELSEVIER SPEKTRUM AKADEMISCHER VERLAG Spektrum k-zlakademischer VERLAG Inhalt 1 Was ist denn "Molekularbiologie", bitteschön? 1 1.1 Das Substrat der

Mehr

Corynebacterium glutamicum

Corynebacterium glutamicum Biochemische und molekularbiologische Untersuchungen zu AmtR, dem Stickstoffregulator in Corynebacterium glutamicum Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg

Mehr

GENERIERUNGTRANSGENERRANSGENER SUSANNE BIERL BOD8 IMMUNOLOGIE FR. DR. B. JUNGNICKEL FR DR. I. PFEIL 08.04.2009

GENERIERUNGTRANSGENERRANSGENER SUSANNE BIERL BOD8 IMMUNOLOGIE FR. DR. B. JUNGNICKEL FR DR. I. PFEIL 08.04.2009 GENERIERUNGTRANSGENERRANSGENER TIERMODELLE SUSANNE BIERL BOD8 IMMUNOLOGIE FR. DR. B. JUNGNICKEL FR DR. I. PFEIL 08.04.2009 INHALTÜBERSICHT 2 INHALTSVERZEICHNIS Einführung Definitionen Knock-In-Strategie

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

Herstellung und Selektion rekombinanter Antikörper

Herstellung und Selektion rekombinanter Antikörper Herstellung und Selektion rekombinanter Antikörper Für jeden Topf ein Deckel Sintox 16.04.2015 16.04.15 Sintox 1 Inhalte Begriffsklärungen Rekombinant Lymphozyten Antikörper und Antigene Somatische Hypermutation

Mehr

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61

Tier-Biotechnologie. Teil II: Genomanalyse sowie gendiagnostische Verfahren. 61 Tier-Biotechnologie Inhaltsverzeichnis Vorwort. 9 Mitarbeiter. 10 Einführung in die Tier-Biotechnologie. 11 Teil I: Zellkultur- und Bioverfahrenstechniken. 23 1 Kultivierung tierischer Zellen. 25 1.1 Voraussetzungen

Mehr

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58

Inhalt. 3 Das Werkzeug... 47 3.1 Restriktionsenzyme... 47 3.2 Gele... 58 3.2.1 Agarosegele... 58 Inhalt 1 Was ist denn Molekularbiologie, bitteschön?...................... 1 1.1 Das Substrat der Molekularbiologie, oder: Molli-World für Anfänger.... 2 1.2 Was brauche ich zum Arbeiten?..................................

Mehr

Einführung in die Internationale Nomenklatur. Jutta Davidson Charles River Deutschland Technical Manager

Einführung in die Internationale Nomenklatur. Jutta Davidson Charles River Deutschland Technical Manager Einführung in die Internationale Nomenklatur Jutta Davidson Charles River Deutschland Technical Manager Historischer Überblick Regeln für Nomenklatur der Mausgenetik wurden bereits in 1940 durch Dunn,

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

Chimäre. χίμαιρα. Ziege

Chimäre. χίμαιρα. Ziege Chimäre χίμαιρα Ziege Lykisches Ungeheuer: πρόσθε λέων, ǒπισθεν θέ δράκων, μέσση θέ χίμαιρα Vorn ein Löwe, hinten eine Schlange, in der Mitte eine Ziege Sphinx: Löwe mit Frauenkopf Definition Eine Chimäre

Mehr

Das Paper von heute. Samuel Grimm & Jan Kemna

Das Paper von heute. Samuel Grimm & Jan Kemna Das Paper von heute Samuel Grimm & Jan Kemna Bisheriges Modell Was bereits bekannt war - TIR1 ist an Auxinantwort (Zellteilung, Elongation, Differenzierung) beteiligt, im selben Signalweg wie AXR1 - TIR1

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

Homologie und Sequenzähnlichkeit. Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Homologie und Sequenzähnlichkeit. Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Homologie und Sequenzähnlichkeit Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Homologie Verwandtschaft aufgrund gleicher Abstammung basiert auf Speziation (Artbildung): aus einer

Mehr

6. DNA -Bakteriengenetik

6. DNA -Bakteriengenetik 6. DNA -Bakteriengenetik Konzepte: Francis Crick DNA Struktur DNA Replikation Gentransfer in Bakterien Bakteriophagen 2. Welcher der folgenden Sätze entspricht der Chargaff-Regel? A) Die Menge von Purinen

Mehr

Zentronukleäre Myopathien von der Diagnose zur Therapie

Zentronukleäre Myopathien von der Diagnose zur Therapie MTM Familientreffen Göttingen, 5./6. Juni 2014 Zentronukleäre Myopathien von der Diagnose zur Therapie Dr. Johann Böhm IGBMC, Strasbourg Ein paar Worte über Strasbourg.and über das IGBMC Ein paar Worte

Mehr

2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24

2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 IV. Ergebnisse 90 2. Konstruktion und Charakterisierung einer stx 2 -Mutante im E. coli-stamm O157:H7 86-24 Die Konstruktion einer isogenen Toxinmutante des Stx2-produzierenden EHEC- Stamm O157:H7 86-24

Mehr

Die Entwicklung der Keimbahn. wahrend der Embryogenese von Caenorhabditis elegans

Die Entwicklung der Keimbahn. wahrend der Embryogenese von Caenorhabditis elegans Die Entwicklung der Keimbahn wahrend der Embryogenese von Caenorhabditis elegans Von der Fakultat fur Lebenswissenschaften der Technischen Universitat Carolo-Wilhelmina zu Braunschweig zur Erlangung des

Mehr

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Karl Heinimann, MD PhD Medizinische Genetik Universitätskinderspital beider Basel karl.heinimann@unibas.ch 14. Internationales Seminar DESO St.

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden

Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden Stammzellenmanipulation Hämatopoietische Stammzellen können gebraucht werden um kranke Zellen mit gesunden zu ersetzen (siehe experiment bestrahlte Maus) Epidermale Stammzellpopulationen können in Kultur

Mehr

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Einleitung: Drosophila melanogaster hat sich als Modellorganismus in der Entwicklungsbiologie und der Genetik bewährt, und findet

Mehr

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen.

Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. Kapitel 9 Genetische Variation Der Ausdruck genetische Variation bezieht sich auf die Vielfältigkeit aller Genome auf diesem Planeten, die unterschiedliche Individuen hervorbringen. 9a Genetische Variation

Mehr

Molekulare Mechanismen der Signaltransduktion

Molekulare Mechanismen der Signaltransduktion Molekulare Mechanismen der Signaltransduktion 07 - Identifizierung von ARF1 + Hinweise für Vorträge Folien: http://tinyurl.com/modul-mms http://www.pnas.org/content/111/14/5427/f1.large.jpg neues Modell

Mehr

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

Neurodegenerative Erkrankungen: Mäuse stehen Modell

Neurodegenerative Erkrankungen: Mäuse stehen Modell NEUROrubin 2003 Neurodegenerative Erkrankungen: Mäuse stehen Modell Das Problem der Forscher bestand lange Zeit darin, dass sie sterbende Nervenzellen am lebenden Menschen nicht untersuchen können und

Mehr

Molekulare Pathologie 1: Mutationen

Molekulare Pathologie 1: Mutationen Molekulare Pathologie 1: Mutationen Peter N. Robinson Institut für medizinische Genetik Charité Universitätsmedizin Berlin 23. Juni 2008 Peter N. Robinson (Charité) Molekulare Pathologie 1 23. Juni 2008

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung

Thema Gentechnologie. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema Gentechnologie Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Amazon-Preis: EUR 31,00 Kostenlose Lieferung. Siehe Details. Versandfertig bei Amazon

Mehr

Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7. Einführung 19

Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7. Einführung 19 Inhaltsverzeichnis Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7 Einführung 19 Über dieses Buch 19 Konventionen in diesem Buch 19 Was Sie nicht lesen müssen 20 Törichte Annahmen über

Mehr

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin

Mehr

Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus

Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus Seminar Molekulare Diagnostik 2011 30. November 2011, Wien AnDiaTec Kernkompetenz Entwicklung und Produktion

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

Inhaltsverzeichnis... I. Ein Vorwort... VII. Synopse der Arbeit... IX. Synopsis of the thesis... XIII

Inhaltsverzeichnis... I. Ein Vorwort... VII. Synopse der Arbeit... IX. Synopsis of the thesis... XIII I INHALTSVERZEICHNIS Inhaltsverzeichnis... I Ein Vorwort... VII Synopse der Arbeit... IX Synopsis of the thesis... XIII A. Untersuchungen über die Stereoselektivität bakterieller, Pyruvat-abhängiger Aldolasen...

Mehr

20 Jahre Anbau gentechnisch veränderter Pflanzen - Folgen des Anbaus in den USA

20 Jahre Anbau gentechnisch veränderter Pflanzen - Folgen des Anbaus in den USA 20 Jahre Anbau gentechnisch veränderter Pflanzen - Folgen des Anbaus in den USA Vor 60 Jahren: DNA entschlüsselt Vor 30 Jahren: Erste gentechnisch veränderte Pflanzen Vor 20 Jahren: Anti-Matsch Tomate

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen

MOL.504 Analyse von DNA- und Proteinsequenzen MOL.504 Analyse von DNA- und Proteinsequenzen Kurs 1 Monika Oberer, Karl Gruber MOL.504 Modul-Übersicht Einführung, Datenbanken BLAST-Suche, Sequenzalignment Proteinstrukturen Virtuelles Klonieren Abschlusstest

Mehr

Transcriptomics: Analysis of Microarrays

Transcriptomics: Analysis of Microarrays Transcriptomics: Analysis of Microarrays Dion Whitehead dion@uni-muenster.de Division of Bioinformatics, Westfälische Wilhelms Universität Münster Microarrays Vorlesungsüberblick : 1. Überblick von Microarray

Mehr

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl. Molekulare Mechanismen der Signaltransduktion 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.com/modul-mms bisheriges Modell auxin auxin AXR1 auxin response AXR1 potentieller

Mehr

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14 Evolution II Molekulare Variabilität Bachelorkurs Evolutionsbiolgie II WS 2013/14 Molekulare Variabilität 1) rten der molekularen Variabilität und ihre Entstehung (rten der Mutation) 2) Wie kann man molekulare

Mehr

Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese

Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die Regulation der enterobakteriellen Kapselbiosynthese Inaugural-Dissertation zur Erlangung der Doktorwürde vorgelegt

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Inaugural-Dissertation zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

Epigenetik. J. Breckow

Epigenetik. J. Breckow Felder der strahlenbiologischen Forschung : Klassische Strahlenbiologie : Dosis-Wirkungsbeziehungen für zelluläre Effekte (z.b. Überlebenskurven, Proliferationsfähigkeit, RBW, ) (Klassische) Molekulare

Mehr

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR

Labortechniken (2) Amplifikationskurve (linear linear) Realtime-PCR Realtime PCR Quantitative PCR Prinzip: Nachweis der PCR-Produkte in Echtzeit und Quantifizierung anhand eines fluoreszenten Reporters R Q Taq-Polymerase Synthese- und Nuklease-Einheit R=Reporter, Q=Quencher

Mehr

H.Schwab Genetik. Überblick

H.Schwab Genetik. Überblick Überblick Einleitung: Historisches Klassische - Mendel DNA, Aufbau, übergeordnete Strukturen, Konfigurationen, zelluläre Organisation Chromatin, Chromosomenaufbau, Genome Extrachromosomale Elemente, mobile

Mehr

Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:

Frage 1 A: Wieviele Codone des Universellen genetisches Codes kodieren: Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren: Aminosäuren Translationsstart Translationsstop? B: Welche biochemische Reaktion wird von Aminoazyl-tRNA-Synthetasen katalysiert?

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats Das humane Genom satellites and single repeats protein coding & non-protein coding mobile (transposable) DNA elements Alle Genome sind individuell, selbst jene eineiiger Zwillinge! 1 Variationen im humanen

Mehr

Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich

Mehr

Angewandte Zellbiologie

Angewandte Zellbiologie Angewandte Zellbiologie Bt-BZ01: Pflanzenzellen als Bioreaktoren 8 CP (VL + Pr) MENDEL (VL) HÄNSCH (Pr) Bt-BZ02: Zellbiologie der Tiere I 8 CP (VL + Pr) BUCHBERGER WINTER (VL) VAUTI (Pr) Bt-BZ03: Zellbiologie

Mehr

Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik

Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik Teil I (Fischbach): Drosophila als Modellsystem der Entwicklungsgenetik Termine 20.10. 2010 Reichweite der Entwicklungsgenetik 27.10. 2010 Die Festlegung der Körperachsen 03.11. 2010 Neurogenese 10.11.

Mehr

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl Übung II Einführung, Teil 1 Arbeiten mit Ensembl Ensembl Genome Browser (Bereitstellung von Vielzeller Genomen) Projekt wurde 1999 initiiert Projektpartner EMBL European Bioinformatics Institute (EBI)

Mehr

Verzeichnis der Abbildungen und Tabellen... VIII Verzeichnis der Abkürzungen und Trivialnamen... XI I Einleitung... 1

Verzeichnis der Abbildungen und Tabellen... VIII Verzeichnis der Abkürzungen und Trivialnamen... XI I Einleitung... 1 Verzeichnis der Abbildungen und Tabellen... VIII Verzeichnis der Abkürzungen und Trivialnamen... XI I Einleitung... 1 1 Extremophile Organismen... 1 2 Halophile Mikroorganismen... 2 2.1 Lebensräume und

Mehr

Arten der Intronen. Spliceosome Struktur des snrnp U1. Spliceosome. Vorlesung 3: Evolution des eukaryotischen Genoms 4/20/11

Arten der Intronen. Spliceosome Struktur des snrnp U1. Spliceosome. Vorlesung 3: Evolution des eukaryotischen Genoms 4/20/11 Vorlesung 3: Evolution des eukaryotischen Genoms Struktur des eukaryotischen Gens Intronen und Exonen Genduplikation--Familien des Gens Eiweißdomänen (Protein domains) Domänen und Exonen: sind sie verwandt?

Mehr

Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen

Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen Humangenom Größe 150 m 3.000.000.000 Nukleotide 3000 x 1000 x 1000 Bücher Seiten Buchstaben 1953 2003 Watson, J.D., and F.H.C.Crick.

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Molekulargenetischer Nachweis und Genotypisierung von HPV

Molekulargenetischer Nachweis und Genotypisierung von HPV Molekulargenetischer Nachweis und Genotypisierung von HPV Dr. Sabine Sussitz-Rack Institut für Labordiagnostik und Mikrobiologie Vorstand: Prim. Prof. DDr. Pranav Sinha Humanes Papillomavirus HPV HPV ist

Mehr

Grüne Gentechnologie Beispiel: Kartoffel

Grüne Gentechnologie Beispiel: Kartoffel Grüne Gentechnologie Beispiel: Kartoffel Inhalt 1. Gentechnisch veränderte (transgene) Pflanzen und drei Methoden der Herstellung transgener Pflanzen 2. Bedeutung von Antibiotika-Selektionsmarkern bei

Mehr

SNPs, Indels, VNTRs. Gründe für ein Interesse an der genetischen Diversität

SNPs, Indels, VNTRs. Gründe für ein Interesse an der genetischen Diversität Genetische Diversität: SNPs, Indels, VNTRs Gründe für ein Interesse an der genetischen Diversität Aufklärung der Geschichte von Populationen (Migrationen, demographische Ereignisse) Forensik / Aussagen

Mehr

Projekt. Humane Thrombozytenextrakte als Serum-Ersatz in der Kultivierung von Stammzellen in In-vitro-Toxizitätstests

Projekt. Humane Thrombozytenextrakte als Serum-Ersatz in der Kultivierung von Stammzellen in In-vitro-Toxizitätstests [Text eingeben] Stiftung zur Förderung der Erforschung von Ersatz- und Ergänzungsmethoden zur Einschränkung von Tierversuchen Projekt Humane Thrombozytenextrakte als Serum-Ersatz in der Kultivierung von

Mehr

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: Einführung Übung Bitte bereiten Sie folgende Probleme vor der Übung am Mittwoch. Die Klausur

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

Präzisions-Gentherapie

Präzisions-Gentherapie Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Gentherapie trifft auf erfolgreiche Stammzelltherapie bei Lebererkrankung

Mehr

Lsd1 weist Stammzellen im Mausembryo den richtigen Weg

Lsd1 weist Stammzellen im Mausembryo den richtigen Weg Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/lsd1-weist-stammzellen-immausembryo-den-richtigen-weg/ Lsd1 weist Stammzellen im Mausembryo den richtigen Weg Die

Mehr

Diskussion 62 6 DISKUSSION

Diskussion 62 6 DISKUSSION Diskussion 62 6 DISKUSSION Kartierungsergebnisse Sowohl die Analyse von Deletionssyndromen, wie dem WAGR-Syndrom, als auch Beobachtungen von Allelverlusten der Region 11p13 14.1 in verschiedenen Tumoren

Mehr

Eine Reise zu den Herz - Genen

Eine Reise zu den Herz - Genen Eine Reise zu den Herz - Genen Berner Kardiologie Update 2014 12./13. September 2014 Schloss Hünigen Dr. med. Siv Fokstuen Service de médecine génétique Hôpitaux Universitaires de Genève Reise Programm

Mehr

Funktionelle Genomik. praktische Anwendungen

Funktionelle Genomik. praktische Anwendungen Funktionelle Genomik praktische Anwendungen Schmelzpunkt der DNA Einzelsträngige DNA absorbiert UV-Licht effektiver SYBR Green fluoresziert nur wenn es an doppelsträngiger DNA bindet Fluoreszenz erhöht

Mehr

Abschlussbericht zum Thema: Transposon-Tagging für biotechnologisch relevante Pilze (Kennziffer 2785)

Abschlussbericht zum Thema: Transposon-Tagging für biotechnologisch relevante Pilze (Kennziffer 2785) Abschlussbericht zum Thema: Transposon-Tagging für biotechnologisch relevante Pilze (Kennziffer 2785) von Prof. Dr. Frank Kempken, Christian-Albrechts-Universität zu Kiel Einführung Nachdem in einer vorangegangenen

Mehr

Gentechnologie in der Medizin - Diagnose & Therapie

Gentechnologie in der Medizin - Diagnose & Therapie Gentechnologie in der Medizin - Diagnose & Therapie Die Gentechnologie umfasst alle Methoden zum Nachweis und Isolierung von Erbmaterial (DNA). Gentechnische Verfahren ermöglichen eine gezielte Veränderung,

Mehr

DNA-Reparaturfoci als Indikator der individuellen Strahlenempfindlichkeit

DNA-Reparaturfoci als Indikator der individuellen Strahlenempfindlichkeit Onkologisches Zentrum Klinik für Strahlentherapie und Radioonkologie 6. Senftenberger Innovationsforum; 16.3.2012, Hochschule Lausitz, Senftenberg DNA-Reparaturfoci als Indikator der individuellen Strahlenempfindlichkeit

Mehr

Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf

Mehr

Ein neuartiges Konzept zur genomweiten Kartierung von ENU-induzierten Mausmutanten im Hochdurchsatz

Ein neuartiges Konzept zur genomweiten Kartierung von ENU-induzierten Mausmutanten im Hochdurchsatz GSF Forschungszentrum für Umwelt und Gesundheit Institut für Experimentelle Genetik Neuherberg Ein neuartiges Konzept zur genomweiten Kartierung von ENU-induzierten Mausmutanten im Hochdurchsatz Matthias

Mehr

Molecular Farming-Produktion von therapeutischen Eiweißen in Pflanzen

Molecular Farming-Produktion von therapeutischen Eiweißen in Pflanzen Molecular Farming-Produktion von therapeutischen Eiweißen in Pflanzen Zellbiologische und methodische Grundlagen Spinnenseidenproteine aus Pflanzen Vogelgrippevakzine aus Pflanzen Therapeutische antibakterielle

Mehr

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht

Mehr

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr