Genome Engineering in der Ratte

Größe: px
Ab Seite anzeigen:

Download "Genome Engineering in der Ratte"

Transkript

1 Boris Jerchow 41. Seminar über Versuchstiere und Tierversuche 08. Mai 2012, BfR, Berlin Genome Engineering in der Ratte Stehen wir vor der Renaissance eines Modellorganismus? SEITE 1

2 1828 Geschichte Laborratte stammt von Wanderratte ab Berichte über Rattenfänger aus dem 19. Jahrhundert Fänger studierten Verhalten 1828 Hungerstudien genetische Studien durch Crampe Anfang 20. Jahrhundert Wiederentdeckung Mendelsche Gesetze (Fellfarbgenetik) Wanderratte (Hans-Jörg Hellwig, wikipedia.org) 1906 Beginn der Zucht im Wistar Institute for Anatomy and Biology (www.wistar.org) 1909 erste Inzuchtratte Laborratte (Pemelet, wikipedia.org) SEITE 2

3 Die Ratte hat sich als ausgezeichnetes Tiermodell erwiesen Pharmakologie/Wirkstoffsuche Toxikologie Neurobiologie/Verhaltensforschung Herz-/Kreislaufforschung Bilder: wikipedia.org Wistarat (US public domain) Zucker Ratte (J. Servaes) Sprague-Dawley Ratte (J.-E. Minh-Duy Poirrier) SEITE 3

4 Timoféef-Ressovsky, Zimmer, Delbrück betrahlen Drosophila und weisen nach, dass Gene chemische Struktur besitzen 1940 Watson, Crick klären Doppelhelixstruktur der DNA auf 1953 Struktur von Genen; Mechanismen der Replikation, Expression, Regulation (nur Prokarionten und Viren) erste transgene Organismen 1960er 1970er erstes künstilches Plasmid 1971 Southern Blot 1975 Sanger Sequenzierung 1977 Knock-Out Technik 1980er Gordon/Ruddle und Costantini/Lacy: Transgene Mäuse 1981 Evans: murine ES-Zellen 1981 Mullis: PCR 1983 Smithies: Homologe Rekkombination 1985 Capecchi: Knock Out Maus 1989 SEITE 4

5 80% 70% 60% 50% 40% 30% 20% 10% 0% Ratte Maus Publikationen Ratte, Maus Die Ratte war in der Prä-Knockout-Ära das dominante Versuchstier SEITE 5

6 1989 Warum die Ratte? 1990 seit ¼ Jahrhundert kann das Genom der Maus maßgeschneidert werden seitdem wurden tausende gentechnisch veränderte Mauslinien erzeugt (z.b. EMMA: fast 3000, Jackson Lab: >6000 Linien) 65% 60% 55% 50% 2002 unzählige Untersuchungen mit diesen Mauslinien, große Menge an Daten akkumuliert Zucht und Haltung von Ratten deutlich teurer als bei der Maus 45% 40% 35% 30% Ratte Maus SEITE 6

7 Warum die Ratte? seit Anfang des 20. Jahrhunderts Zucht von Inzuchtstämmen aufgrund von Eigenschaften, die von biomedizinschem Interesse sind seit kurzem ist es möglich, auch das Genom der Ratte zielgerichtet zu verändern schon rund 600 Stämme und Unterstämme in der Rat Genome Database SEITE 7

8 Die Ratte ist nicht nur eine große Maus! mehrere Millionen Jahre evolutionärer Abstand Physiologie in vielen Fällen dem Menschen ähnlicher bis zur Entwicklung der ko Maus war Ratte das dominante Versuchstier in der biomedizinischen Forschung große Mengen von Daten müssten in der Maus neu erhoben werden (Tierschutz!) Bilder: wikipedia.org SEITE 8

9 Herz-Kreislauf-Erkrankungen gutes Modell, vor allem Schlaganfall und Bluthochdruck verschiedene gezüchtete Linien ideal für entsprechende Studien operative Eingriffe Überwachung physiologischer Parameter Volumina SEITE 9

10 Verhaltensstudien Ratte intelligenter als die Maus Ratte löst komplexere Aufgaben z.b. Radial Arm Maze zur Untersuchung Einfluss pharmakologisch wirksamer Substanzen auf Erinnerung Radial Arm Maze nach Olton, D.S., & Samuelson, R.J. (1976) Bild: wikipedia.org SEITE 10

11 und weitere Forschungsrichtungen z.b. Brustkrebs Hormonabhängigkeit vergleichbar mit dem Menschen prä-maligne Stadien sehr ähnlich denen beim Menschen z.b. Toxikologie und Wirkstoffforschung Abbau von Giftstoffen ähnlich wie beim Menschen Blutentnahmen in kurzen Abständen möglich Ratte war immer wichtiges Modell in der Industrie SEITE 11

12 Eine neue Ära: GENTECHNISCHE VERÄNDERUNGEN IN DER RATTE SEITE 12

13 ENU ohne Möglichkeit zur zielgerichteten Mutagenese: ENU-Behandlung von Männchen Punktmutationen sehr aufwändig, Mutationen zu identifizieren mögliche Kosegregation Forward Genetics wikipedia.org SEITE 13

14 Kyoto University Rat Mutant Archive ENU in der Maus 1979 (KURMA) ENU als genet. Werkzeug 1981 extensive ENU-Mutagenese Spermien von tausenden G1-Männchen kryokonserviert optimiertes Screening-Verfahren über Mu Transposon (einzelne Basenunterschiede als Zielsequenz) optimierte Rückgewinnung von Linien über ICSI viele interessante Linien identifiziert verschiedene Probleme bleiben 1989 PKU Modell Linien 2011 Ziel: SEITE 14

15 Gene Traps über Transposons ITR SA Reporter pa SD + Transposase ITR SEITE 15

16 Funktionsweise Gene Trap ITR SA Reporter pa SD ITR + Transposase Restprotein-Reporter-Fusion Exon 1 Exon 2 Exon 3 Exon 2 Exon 3 SEITE 16

17 Über transgene Ratten Transposase x Transposase SEITE 17

18 Über Spermatogoniale Stammzellen (SSCs) Transposase Dazl -/- Selektion Analyse Kryokonservierung Transplantation SEITE 18

19 Mit Gene Traps nicht alle Gene erreichbar Anzahl der Stammzellklone unterschiedliche Gene mit Mutation SEITE 19

20 Zielgerichtete Mutagenese DIE KÖNIGSDISZIPLIN SEITE 20

21 Evans 1981 Ratten ES-Zellen Capecchi 1989 Standard-Methoden aus der Maus nicht übertragbar Erfolg in der Maus abhängig vom Stamm Kultur mit Inhibitorcocktails führt bei nichtpermissiven Mausstämmen zum Erfolg (3i, 2i) Übertragung auf Ratte Zellen sehr instabil Durchführung wie bei Maus 2i Medium 2008 echte res-zellen 2008 p53 KO 2010 SEITE 21

22 z.b. knock out von genomischen Sequezen ES-Zellkultur x x x x x x knock out ES-Zellen Johannes Wilbertz, KI Stockholm ISTT Mediensammlung, SEITE 22

23 Kombination einer Blastozyste mit KO ES-Zellen chimäre Ratte chimär X Keimbahntransmission schwierig! wildtypisch heterozygot SEITE 23

24 Zink-Finger, TALENs und Homing Endonukleasen Chimäres Protein: ZF-FokI 1996 ZFN-aktivierte hom Rek. in Zellkultur 2003 KO über ZFN in Drosophila 2003 ZFNs, TALENs: modular zusammengesetzt erzeugen Doppelstrangbrüche (DSB) Aktivierung zellulärer Reparaturmechanismen KO Homologe Rekombination Regulation von Genen KO Ratten 2009 chimäres Protein: TAL-effektor-FokI Homologe Rek. in der Ratte SEITE 24

25 ZFN-Mechanismus FokI catttacctggaatatgtgaggagtggggg aaatgcctaccaggtgttcttgacttctga gtaaatggaccttatacactcctcaccccc DSB tttacggatggtccacaagaactgaagact FokI

26 Zelluläre Reparaturmechanismen catttacctggaatatgtgaggagtggggg aaatgcctaccaggtgttcttgacttctga gtaaatggaccttatacactcctcaccccc tttacggatggtccacaagaactgaagact DSB NHEJ homologe Rekombination fehlerbehafteter Reparaturmech. Deletion von Nukleotiden (selten Insertionen) Frame-Shift führt zum KO homologe Rekombination mit anderem Allel oder eingebrachter exogener DNA SEITE 26

27 Knock In DSB Cui et. al, Nature Biotech. 2011: Knock In von GFP in den Mdr1a Lokus homologe Bereiche können kurz sein Technisch einfach: Koinjektion von Nuklease und targeting Vektor in Pronukleus homologe Rekombination homologe Rekombination mit anderem Allel oder eingebrachter exogener DNA SEITE 27

28 SEITE 28 Koinjektion von mrna und targeting Vektor

29 TALENs als Alternative zu ZFNs TAL Effektoren aus dem Pflanzenpathogen Xanthomonas spp. Repeats aus 34 Aminosäuren AS 12 und 13 binden an ein Nukleotid in DNA-Sequenz Code 2009 entschlüsselt In Verbindung mit FokI DSBs wie mit ZFNs SEITE 29

30 Vor- und Nachteile TALENs ein Repeat bindet ein Nukleotid mehr Repeats benötigt scheinen einfach so zu funktionieren aaatgcctaccaggtgttcttgacttctga tttacggatggtccacaagaactgaagact hohe Spezifizät auch mit wildtypischer FokI relativ günstig, relativ leicht selbst zu machen neue Technik ZFNs Repeats binden Triplets nicht alle Kombinationen möglich hoher Optimierungsbedarf (Wechelwirkungen der aaatgcctaccaggtgttcttgacttctga Repeats) tttacggatggtccacaagaactgaagact off-target Effekte, veränderte FokI erforderlich relativ teuer, relativ schwierig selbst zu machen 15 Jahre Entwicklung und Erfahrung SEITE 30

31 Zielgerichtete Mutagenese in der Ratte ist eine Option! ZUSAMMENFASSUNG SEITE 31

32 Zusammenfassung I Ratte hat seitens Physiologie, Intelligenz und Größe Vorteile gegenüber der Maus bis zur Entwicklung der KO-Technik war die Ratte der häufiger verwendete Modellorganismus (große Datenmengen) seit kurzem ist es möglich, zielgerichtete Mutatioen in der Ratte zu erzeugen neue Frage: welche Spezies ist das besser geeignete Modell? SEITE 32

33 Zusammenfassung II ENU induzierte Mutationen nicht steuerbar, aufwändige Detektion, nur Punktmutationen, häufige Kosegregation Gene Traps über transgene Ratten oder SSCs Sättigungseffekte Kultur, Selektion, Konservierung und Transplantation von SSCs noch im Anfangsstadium ES-Zelltechnologie wie bei der Maus Zellen instabil, offensichtlich als Routinetechnik (noch) nicht anwendbar SEITE 33

34 Zusammenfassung III chimäre Proteine aus ZF- oder TAL-Effektor-Repeats scheinen das größte Potential zu haben homing Endonukleasen von Effiktivität her vergleichbar aber Sequenzspezifität schwieriger zu erzeugen größere Zahl von KO-Rattenmodellen bereits erzeugt zusammen mit Targeting-Vektor KI möglich Endonukleasen: Technik der Zukunft? SEITE 34

35 Ressourcen Rat Genome Database, rgd, Knock Out Rat Consortium, KORC, Kyoto University Rat Mutant Archive, KURMA, NIH Rat Genomics and Genetics, Sigma Advanced Genetic Engineering Labs, SAGE, Cellectis, SEITE 35

Inhalte unseres Vortrages

Inhalte unseres Vortrages Inhalte unseres Vortrages Vorstellung der beiden paper: Germ line transmission of a disrupted ß2 mirkroglobulin gene produced by homologous recombination in embryonic stem cells ß2 Mikroglobulin deficient

Mehr

Transgene Tiere: Genmodifikation in der Maus

Transgene Tiere: Genmodifikation in der Maus Transgene Tiere: Genmodifikation in der Maus Gentechnik und Genomics WiSe 2007/2008 Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Nobelpreis Physiologie und Medizin 2007

Mehr

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Prof. Dr. med. Brigitte Schlegelberger 670513011/15 Olaparib Zulassung in Europa: Rezidiv eines Platin-sensitiven Ovarialkarzinoms

Mehr

Control of Peripheral Nerve Myelination by the ß-Secretase (BACE1 )

Control of Peripheral Nerve Myelination by the ß-Secretase (BACE1 ) Über Methoden der Grundlagenforschung Textquelle 1 Originally published in Science Express on 21 September 2006 Science 27 October 2006:; Vol. 314. no. 5799, pp. 664-666 DOI: 10.1126/science.1132341 Reports

Mehr

Pathologie und Prädiktion - neue Aspekte. Prof. Dr. med. C. Wickenhauser Institut für Pathologie

Pathologie und Prädiktion - neue Aspekte. Prof. Dr. med. C. Wickenhauser Institut für Pathologie Pathologie und Prädiktion - neue Aspekte Paradigmenwechsel in der Pathologie -Pathologe zentraler Lotse bei der individuellen Therapieentscheidung -Gewebeuntersuchung nicht nur aus diagnostischen sondern

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

H.Schwab Genetik. Überblick

H.Schwab Genetik. Überblick Überblick Einleitung: Historisches Klassische - Mendel DNA, Aufbau, übergeordnete Strukturen, Konfigurationen, zelluläre Organisation Chromatin, Chromosomenaufbau, Genome Extrachromosomale Elemente, mobile

Mehr

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Karl Heinimann, MD PhD Medizinische Genetik Universitätskinderspital beider Basel karl.heinimann@unibas.ch 14. Internationales Seminar DESO St.

Mehr

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung

Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1. Übung Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: Einführung Übung Bitte bereiten Sie folgende Probleme vor der Übung am Mittwoch. Die Klausur

Mehr

Eine Reise zu den Herz - Genen

Eine Reise zu den Herz - Genen Eine Reise zu den Herz - Genen Berner Kardiologie Update 2014 12./13. September 2014 Schloss Hünigen Dr. med. Siv Fokstuen Service de médecine génétique Hôpitaux Universitaires de Genève Reise Programm

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14 Evolution II Molekulare Variabilität Bachelorkurs Evolutionsbiolgie II WS 2013/14 Molekulare Variabilität 1) rten der molekularen Variabilität und ihre Entstehung (rten der Mutation) 2) Wie kann man molekulare

Mehr

Für eine Knockout-Maus nach Sendai

Für eine Knockout-Maus nach Sendai David DREWS Charité Universitätsmedizin Berlin Freie Universität Berlin Ich habe immer davon geträumt, eines Tages nach Japan zu fahren und eventuell auch längere Zeit dort zu verbringen. Das Land hat

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen

MOL.504 Analyse von DNA- und Proteinsequenzen MOL.504 Analyse von DNA- und Proteinsequenzen Kurs 1 Monika Oberer, Karl Gruber MOL.504 Modul-Übersicht Einführung, Datenbanken BLAST-Suche, Sequenzalignment Proteinstrukturen Virtuelles Klonieren Abschlusstest

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

20 Jahre Anbau gentechnisch veränderter Pflanzen - Folgen des Anbaus in den USA

20 Jahre Anbau gentechnisch veränderter Pflanzen - Folgen des Anbaus in den USA 20 Jahre Anbau gentechnisch veränderter Pflanzen - Folgen des Anbaus in den USA Vor 60 Jahren: DNA entschlüsselt Vor 30 Jahren: Erste gentechnisch veränderte Pflanzen Vor 20 Jahren: Anti-Matsch Tomate

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Erzeugung und Charakterisierung von Knockout-Mäusen des Maus Vas Deferens Proteins

Erzeugung und Charakterisierung von Knockout-Mäusen des Maus Vas Deferens Proteins Erzeugung und Charakterisierung von Knockout-Mäusen des Maus Vas Deferens Proteins Dissertation zur Erlangung des akademischen Grades des Doktors der Naturwissenschaften (Dr. rer. nat.) eingereicht am

Mehr

Abschlussbericht zum Thema: Transposon-Tagging für biotechnologisch relevante Pilze (Kennziffer 2785)

Abschlussbericht zum Thema: Transposon-Tagging für biotechnologisch relevante Pilze (Kennziffer 2785) Abschlussbericht zum Thema: Transposon-Tagging für biotechnologisch relevante Pilze (Kennziffer 2785) von Prof. Dr. Frank Kempken, Christian-Albrechts-Universität zu Kiel Einführung Nachdem in einer vorangegangenen

Mehr

Drexler G.A. 1, Derer A 1, Dirks W.G. 2, Hable V. 3, Greubel C. 3, Burgdorfer C. 3, Dollinger G. 3, Du G. 4, Friedl A.A. 1

Drexler G.A. 1, Derer A 1, Dirks W.G. 2, Hable V. 3, Greubel C. 3, Burgdorfer C. 3, Dollinger G. 3, Du G. 4, Friedl A.A. 1 Nutzung von bi-cistronischen Vektoren für die Beobachtung der Rekrutierung von Signal- und Reparaturproteinen an DNA-Schäden nach Ionen- Mikrobestrahlung durch Live-Cell Imaging Drexler G.A. 1, Derer A

Mehr

Die Knockout -Maus als Krankheitsmodell

Die Knockout -Maus als Krankheitsmodell Jürgen R. Braun Thomas E. Willnow Die Untersuchung von Genfunktionen mittels gerichteter Mutagenese im Reagenzglas (in vitro) gehört seit längerem zum Standardrepertoire der Molekulargenetik. Aber erst

Mehr

Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich

Mehr

Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf

Mehr

1. Definition und Mechanismen

1. Definition und Mechanismen Zusammenfassung 1. Definition und Mechanismen Epigenetik (von griechisch epi- über ) bezeichnet erbliche Veränderungen in der Genexpression, die nicht von Veränderungen in der DNA Sequenz (Mutationen)

Mehr

Ansatz zur Generierung einer konditionalen, reversiblen Wt1 k.o.-maus

Ansatz zur Generierung einer konditionalen, reversiblen Wt1 k.o.-maus Ansatz zur Generierung einer konditionalen, reversiblen Wt1 k.o.-maus Dissertation zur Erlangung des Grades Doktor der Naturwissenschaften am Fachbereich Biologie der Johannes Gutenberg-Universität in

Mehr

Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2

Mehr

Grundprinzip-Sanger. Verfahren - Sanger. Vorlesung 12: Neandertal Genome. Sanger (dideoxy) sequencing. Sequencing ladder 6/28/11

Grundprinzip-Sanger. Verfahren - Sanger. Vorlesung 12: Neandertal Genome. Sanger (dideoxy) sequencing. Sequencing ladder 6/28/11 Vorlesung 12: eandertal Genome Dideoxy (Sanger) Sequenzierung Pyrosequenzierung Sequenz des eandertalers: erste Schritte Sequenz des eandertalers: aktuelle Situation FOXP2 Gen und die Sprache des eandertalers

Mehr

Applied Bioinformatics. maria.fischer@i-med.ac.at http://icbi.at/courses/bioinformatics_ex

Applied Bioinformatics. maria.fischer@i-med.ac.at http://icbi.at/courses/bioinformatics_ex Applied Bioinformatics SS 2013 maria.fischer@i-med.ac.at http://icbi.at/courses/bioinformatics_ex Organisatorisches Termine Mo 18.03.2013 RR19 9:00 Di 19.03.2013 RR19 9:00 Mi 20.03.2013 RR19 9:00 Übungsziele

Mehr

Entwicklungsbiologie Master-Module. (bzw. 9 + 3)

Entwicklungsbiologie Master-Module. (bzw. 9 + 3) Entwicklungsbiologie Master-Module (bzw. 9 + 3) Entwicklungsbiologie Master-Module Block 3 Ebio I Evolution von Musterbildung und Gametogenese Mikroinjektion von Tribolium-Embryonen zur Proteinlokalisierung

Mehr

Local Structures (Examples)

Local Structures (Examples) Lokale Strukturen Local Structures (Examples) cruciform from: NAR 1995 23 11, 1977-1983 H-DNA may play a role in eukaryote transcription (only weak evidence) Funktionen lokaler Strukturen (Beispiel) Struktur

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

Stammzellen. Therapie der Zukunft?

Stammzellen. Therapie der Zukunft? Stammzellen Therapie der Zukunft? Was sind Stammzellen? Embryo, aus embryonalen Stammzellen bestehend Stammzellen sind Ausgangszellen für die Bildung aller Gewebe und Organe, aus denen ein Lebewesen besteht

Mehr

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese

Mehr

Tierische Erzeugung im Klimawandel: Auswirkungen und Anpassungen - aus der Sicht der Züchtung

Tierische Erzeugung im Klimawandel: Auswirkungen und Anpassungen - aus der Sicht der Züchtung DAF-Tagung Klimawandel und Extremwettereignisse: ein Problem für die Landwirtschaft? " v.ti, Braunschweig, 7. und 8.11.2012 Tierische Erzeugung im Klimawandel: Auswirkungen und Anpassungen - aus der Sicht

Mehr

Entwicklung und Überprüfung von Strategien zur Erzeugung virusresistenter Reben, - Einsatz der Gentechnik als Ergänzung zur klassischen Züchtung.

Entwicklung und Überprüfung von Strategien zur Erzeugung virusresistenter Reben, - Einsatz der Gentechnik als Ergänzung zur klassischen Züchtung. Entwicklung und Überprüfung von Strategien zur Erzeugung virusresistenter Reben, - Einsatz der Gentechnik als Ergänzung zur klassischen Züchtung. G.M. Reustle 1, P. Winterhagen 1, P. Cobanov 1, G. Nölke

Mehr

Protein Expression. Expression, homolog oder heterolog?

Protein Expression. Expression, homolog oder heterolog? Protein Expression Expression, homolog oder heterolog? Heterologe Expression in anderem Host Kompartment Codon usage Posttranslationale Modifikationen Kofaktoren Chaperone 1 promoter Expressionssystem

Mehr

Biologicals Innovationen der besonderen Art. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie JWG-Universität Frankfurt.

Biologicals Innovationen der besonderen Art. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie JWG-Universität Frankfurt. Biologicals Innovationen der besonderen Art Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie JWG-Universität Frankfurt Arzneimittel sind Stoffe oder Stoffgemische unterschiedlicher chemischer

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

Luke Alphey. DNA-Sequenzierung. Aus dem Englischen übersetzt von Kurt Beginnen. Spektrum Akademischer Verlag

Luke Alphey. DNA-Sequenzierung. Aus dem Englischen übersetzt von Kurt Beginnen. Spektrum Akademischer Verlag Luke Alphey DNA-Sequenzierung Aus dem Englischen übersetzt von Kurt Beginnen Spektrum Akademischer Verlag Inhalt Abkürzungen 11 Vorwort 15 Danksagung 16 Teil 1: Grundprinzipien und Methoden 1. 1.1 1.2

Mehr

Transgen oder Nicht Transgen: Biotechnologie bei Pflanzen

Transgen oder Nicht Transgen: Biotechnologie bei Pflanzen Transgen oder Nicht Transgen: Biotechnologie bei Pflanzen 10.000 Jahre Domestikation von Pflanzengenen Petra Bauer, Molekulare Pflanzenbiologie und Botanik http://www.uni-saarland.de/fak8/botanik/ Ernährung

Mehr

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held ACT/CVS neueste gendiagnostische Verfahren 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held DNA, Gene, Chromosomen DNA besteht aus den Basenpaaren Adenin - Thymin

Mehr

Einführung Nukleinsäuren

Einführung Nukleinsäuren Einführung Nukleinsäuren Dr. Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Einführung 1. Semester, WiSe 2007/2008 Historischer Überblick Literatur Bilder aus: Taschenatlas

Mehr

Klonierung bzw. Generierung von Genen für die Genexpression. Gene, die für Proteine kodieren

Klonierung bzw. Generierung von Genen für die Genexpression. Gene, die für Proteine kodieren 62 Klonierung bzw. Generierung von Genen für die Genexpression Inhaltsvorschau Für die Produktion biopharmazeutischer Produkte werden deren Gene benötigt. In diesem Kapitel wird erläutert, wie die Gene,

Mehr

Grüne Gentechnologie Beispiel: Kartoffel

Grüne Gentechnologie Beispiel: Kartoffel Grüne Gentechnologie Beispiel: Kartoffel Inhalt 1. Gentechnisch veränderte (transgene) Pflanzen und drei Methoden der Herstellung transgener Pflanzen 2. Bedeutung von Antibiotika-Selektionsmarkern bei

Mehr

In addition to fulfilling the basic service

In addition to fulfilling the basic service 231_236_avm.qxd 14.05.2004 12:52 Uhr Seite 231 Abteilung für Vergleichende Medizin Department of Comparative Medicine Neuherberg (Leiter / Head: Prof. Dr. Jörg Schmidt) Die Institute Die Abteilung für

Mehr

Sie sagen Kartoffel. Huntington-Krankheit zu entwickeln.

Sie sagen Kartoffel. Huntington-Krankheit zu entwickeln. Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Übersetzungsprobleme? Neue Einblicke in die Entstehung des Huntington-Proteins

Mehr

Mikrobiologie für Physiker. Mikrobielle Genetik. Madeleine Leisner Bilder by Brock. happend. wanted

Mikrobiologie für Physiker. Mikrobielle Genetik. Madeleine Leisner Bilder by Brock. happend. wanted Mikrobiologie für Physiker Mikrobielle Genetik happend Madeleine Leisner Bilder by Brock wanted Mikrobielle Genome 250 Mikrobielle Genome sequenziert www.genomesonline.org Bei Prokaryoten steigt die Anzahl

Mehr

7. Regulation der Genexpression

7. Regulation der Genexpression 7. Regulation der Genexpression 7.1 Regulation der Enzymaktivität Stoffwechselreaktionen können durch Kontrolle der Aktivität der Enzyme, die diese Reaktionen katalysieren, reguliert werden Feedback-Hemmung

Mehr

Einblicke in das menschliche Erbgut (Genom) am Computer

Einblicke in das menschliche Erbgut (Genom) am Computer Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Binger Nacht der Wissenschaft - 16.04.2010 Das menschliche Genom ist entschlüsselt

Mehr

Replikationsassoziierte Reparatur. und Doppelstrangbruchreparatur

Replikationsassoziierte Reparatur. und Doppelstrangbruchreparatur Replikationsassoziierte Reparatur und Doppelstrangbruchreparatur Berit Jungnickel Institut für Klinische Molekularbiologie und Tumorgenetik GSF-Forschungszentrum für Umwelt und Gesundheit München jungnickel@gsf.de

Mehr

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom...

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... Inhaltsverzeichnis Abkürzungsverzeichnis... 7 Inhaltsverzeichnis... 11 Abbildungsverzeichnis... 17 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... 21 1.1.2 Protein-Protein Interaktionen allgemein...

Mehr

Klonierung und Sequenzierung von DNA

Klonierung und Sequenzierung von DNA Klonierung und Sequenzierung von DNA Heike Mitternacht ( 10.08.2001 ) Inhalt Klonierung von DNA 1. Allgemeines 1.1. Klonierungsvektoren 1.1.1. Plasmidvektoren 1.1.2. Phagenvektoren 1.1.3. Cosmide, Phasmide

Mehr

Aufbau, Struktur, Funktion von DNA, RNA und Proteinen

Aufbau, Struktur, Funktion von DNA, RNA und Proteinen Aufbau, Struktur, Funktion von DNA, RNA und Proteinen Mitarbeiterseminar der Medizinischen Fakultät Ruhr-Universität Bochum Andreas Friebe Abteilung für Pharmakologie und Toxikologie Aufbau, Struktur,

Mehr

Die Abteilung für Vergleichende Medizin

Die Abteilung für Vergleichende Medizin Abteilung für Vergleichende Medizin Department of Comparative Medicine Neuherberg (Leiter / Head: Prof. Dr. Jörg Schmidt) Die Institute Die Abteilung für Vergleichende Medizin bearbeitet neben den Dienstleistungen

Mehr

G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010

G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Institut für f r Biochemische Verfahren und Analysen (IBVA) Genomik?! Tobias Schäfer Institut für f r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Inhalt Methoden der Gensequenzierung Nutzen genetischer

Mehr

Nachlese zu den Referaten

Nachlese zu den Referaten Nachlese zu den Referaten Referate Die Themen Phylogenie Aminosäurematrizen für die Eukaryontenphylogenie Ansätze für die Prokaryontenphylogenie Vergleichende Sequenzierung Spezieswahl zur Informationsoptimierung

Mehr

PCR basierte- Detektionstechniken

PCR basierte- Detektionstechniken PCR basierte- Detektionstechniken Warum überhaupt? Forensische Analysen: Vaterschaftstests, Kriminalistik Mikrobielle Gemeinschaften: Biofilme, medizinische Mikrobiologie 2 Warum überhaupt? minimale Mengen

Mehr

Modul biol113 Zellbiologie - Nachweis von mitochondrialem Import

Modul biol113 Zellbiologie - Nachweis von mitochondrialem Import Modul biol113 Zellbiologie - Nachweis von mitochondrialem Import Einführung Ein grundlegendes Problem der Zellbiologie ist es, die korrekte zelluläre Lokalisation eines Peptides zu bestimmen. Durch den

Mehr

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory Sequenzierung Norbert Arnold Neue Sequenziertechnologien (seit 2005) Next Generation Sequenzierung (NGS, Erste Generation) Unterschiedliche Plattformen mit unterschiedlichen Strategien Roche 454 (basierend

Mehr

Electromagnetic Tools for Controlling Biological Systems

Electromagnetic Tools for Controlling Biological Systems DISS. ETH NO. 22677 Electromagnetic Tools for Controlling Biological Systems A thesis submitted to attain the degree of DOCTOR OF SCIENCES of ETH ZURICH (Dr. sc. ETH Zurich) presented by Taeuk Kim Master

Mehr

DAS METABOLOM: ERNÄHRUNGSSTATUS, METABOLISMUS, METABOLITEN

DAS METABOLOM: ERNÄHRUNGSSTATUS, METABOLISMUS, METABOLITEN DAS METABOLOM: ERNÄHRUNGSSTATUS, METABOLISMUS, METABOLITEN Das Metabolom Extrinsiche Faktoren Ernährung (Nährstoffe und nicht nutritive Lebensmittelinhaltsstoffe) Arzneimittel Physische Aktivität Darmflora

Mehr

Einfluss der Überexpression von CD83 und mir183 in CD4 + T-Zellen

Einfluss der Überexpression von CD83 und mir183 in CD4 + T-Zellen Einfluss der Überexpression von CD83 und mir183 in CD4 + T-Zellen Inaugural-Dissertation zur Erlangung des Doktorgrades Dr. rer. nat. der Fakultät für Biologie an der Universität Duisburg-Essen vorgelegt

Mehr

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden Molbi Nachklausur 2009 Hier mal so die Fragen die mir noch so einfallen. Also es war gefragt: Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich

Mehr

Der neue cobas T KRAS Mutation Test (CE-IVD) Hinter jedem Ergebnis steht ein Patient, der darauf vertraut

Der neue cobas T KRAS Mutation Test (CE-IVD) Hinter jedem Ergebnis steht ein Patient, der darauf vertraut Der neue cobas T KRAS Mutation Test (CE-IVD) Hinter jedem Ergebnis steht ein Patient, der darauf vertraut cobas T KRAS Mutation Test (CE-IVD) Diagnostik für die personalisierte Darmkrebstherapie Unkontrollierte

Mehr

Transposons DNA transposons: leave their site of insertion (nonreplicative transpostion) or duplicate during transposition (replicative

Transposons DNA transposons: leave their site of insertion (nonreplicative transpostion) or duplicate during transposition (replicative Transposons DNA transposons: leave their site of insertion (nonreplicative transpostion) or duplicate during transposition (replicative transpositions RNA (Retro) transposons: stay at the site of insertion,

Mehr

Gesundheitsgefahren durch Mobilfunk? Alexander Lerchl Jacobs-University Bremen

Gesundheitsgefahren durch Mobilfunk? Alexander Lerchl Jacobs-University Bremen Gesundheitsgefahren durch Mobilfunk? Alexander Lerchl Jacobs-University Bremen Hintergrund Die Besorgnis der Bevölkerung ist relativ konstant bei ca. 30%. Eine Beeinträchtigung der eigenen Gesundheit wird

Mehr

22 rubin sonderheft 12. DNA nutzen eine neue Impfstrategie

22 rubin sonderheft 12. DNA nutzen eine neue Impfstrategie 22 rubin sonderheft 12 DNA nutzen eine neue Impfstrategie Abb. 1: Dr. Thomas Grunwald mit einer Flasche, in der sich eine humane Zellkultur befindet. Solche Zellen werden verwendet, um Virus-Proteine herzustellen,

Mehr

Anlage zur Akkreditierungsurkunde D PL 13372 01 00

Anlage zur Akkreditierungsurkunde D PL 13372 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13372 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 22.05.2014 bis 25.03.2017 Ausstellungsdatum: 22.05.2014 Urkundeninhaber:

Mehr

Von der Genetik zur Gentechnik

Von der Genetik zur Gentechnik Von der Genetik zur Gentechnik Gernot Walzl (Technische Universität Graz, Österreich gernot.walzl@student.tugraz.at ) Kurzfassung: Dieser Artikel beschäftigt sich mit der historischen Entwicklung, von

Mehr

Genetik und Evolution der Laktosetoleranz im Menschen

Genetik und Evolution der Laktosetoleranz im Menschen Semesterarbeit FS 2012 Genetik und Evolution der Laktosetoleranz im Menschen Universität Bern, Institut für Ökologie und Evolution Erhaltene Note: 6.0 Vorgelegt von Carmela Hodel Betreuer Prof. Laurent

Mehr

DATENQUALITÄT IN GENOMDATENBANKEN

DATENQUALITÄT IN GENOMDATENBANKEN DATENQUALITÄT IN GENOMDATENBANKEN Alexander Fehr 28. Januar 2004 Gliederung Motivation Biologische Grundkonzepte Genomdaten Datenproduktion und Fehler Data Cleansing 2 Motivation (1) Genomdatenbanken enthalten

Mehr

B E S C H L U S S. des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 309. Sitzung am 27. Juni 2013

B E S C H L U S S. des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 309. Sitzung am 27. Juni 2013 B E S C H L U S S des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 309. Sitzung am 27. Juni 2013 zur Änderung des Einheitlichen Bewertungsmaßstabes (EBM) mit Wirkung zum 1. Oktober 2013

Mehr

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien

Mehr

Prediktive Pathologie. Luca Mazzucchelli Swisshistotech Symposium Locarno 2007

Prediktive Pathologie. Luca Mazzucchelli Swisshistotech Symposium Locarno 2007 Prediktive Pathologie Luca Mazzucchelli Swisshistotech Symposium Locarno 2007 Target therapy Selektiv für die neoplastischen Zellen Personalisierte Therapie Möglichst wenige Nebenwirkungen ER/PR bei Mammakarzinom

Mehr

Multiplex Ligation Dependent Probe Amplification (MLPA): Einsatzmöglichkeiten bei hereditären Erkrankungen

Multiplex Ligation Dependent Probe Amplification (MLPA): Einsatzmöglichkeiten bei hereditären Erkrankungen ÖÄK-Diplomkurs Genetik 2015 MLPA-Einsatzmöglichkeiten Multiplex Ligation Dependent Probe Amplification (MLPA): Einsatzmöglichkeiten bei hereditären Erkrankungen Assoc.-Prof. PD Dr. Jürgen Neesen Institut

Mehr

RNA Interferenz Hintergrund und Perspektiven

RNA Interferenz Hintergrund und Perspektiven RNA Interferenz Hintergrund und Perspektiven Dr. Michael Meinhard, Fabrikstr. 6, 85354 Freising, michaelmeinhard@aol.com Ob Graig Mello and Andrew Fire vom Carnegie Institut in Baltimore den Sekt schon

Mehr

Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005

Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005 Optimality and evolutionary tuning of the expression level of a protein Erez Dekel & Uri Alon Nature Vol 436, July 2005 Wie Zellen Denken Übersicht Hintergrund Mathematische Formulierung (cost-benefit-theory)

Mehr

Steuerung der Proteinproduktion durch kleine RNA-Moleküle

Steuerung der Proteinproduktion durch kleine RNA-Moleküle Meister, Gunter Steuerung der Proteinproduktion durch kleine RNA-Moleküle Tätigkeitsbericht 2009/2010 Steuerung der Proteinproduktion durch kleine RNA-Moleküle Meister, Gunter Max-Planck-Institut für Biochemie,

Mehr

Literatur LITERATUR. [1] Rolf D. Stoll, Gudrun Anna Leierer: PHP 4 & MySQL Data Becker Verlag, Düsseldorf, 2. Auflage (2000)

Literatur LITERATUR. [1] Rolf D. Stoll, Gudrun Anna Leierer: PHP 4 & MySQL Data Becker Verlag, Düsseldorf, 2. Auflage (2000) Literatur [1] Rolf D. Stoll, Gudrun Anna Leierer: PHP 4 & MySQL Data Becker Verlag, Düsseldorf, 2. Auflage (2000) [2] Thomas Weinert, Mark Kronsbein, Peter Petermann, Clemens Gutweiler: PHP Sybex Verlag,

Mehr

Neue Pflanzenzuchtverfahren

Neue Pflanzenzuchtverfahren Induzierte Hypomethylation Beschleunigte Züchtung Zentromer-vermittelte Genomelimination Cisgenese Zinkfinger-Nukleasen-Technik Methyltransferasen-Technik Virus-induziertes Gen-Silencing Oligonukleotid-dirigierte

Mehr

Christiane Nüsslein-Volhard, MPI für Entwicklungsbiologie, Tübingen. Vernunft sei überall zugegen, wo Leben sich des Lebens freut

Christiane Nüsslein-Volhard, MPI für Entwicklungsbiologie, Tübingen. Vernunft sei überall zugegen, wo Leben sich des Lebens freut Berliner Lektion Christiane Nüsslein-Volhard, MPI für Entwicklungsbiologie, Tübingen Vernunft sei überall zugegen, wo Leben sich des Lebens freut Die Diskussionen über Genforschung und menschliche Embryonen

Mehr

Astrobiologie Sommersemester 2015

Astrobiologie Sommersemester 2015 Astrobiologie Sommersemester 2015 Teil 1: Astrobiologie aus der Sicht der Einzeldisziplinen Es ist kein Zufall, dass es 2015 eine Astrobiologie-Vorlesung an der Uni Hamburg gibt Die Zeit ist reif für

Mehr

Seminararbeit zum Thema Genetische Algorithmen

Seminararbeit zum Thema Genetische Algorithmen Seminararbeit zum Thema Genetische Algorithmen Seminar in Intelligent Management Models in Transportation und Logistics am Institut für Informatik-Systeme Lehrstuhl Verkehrsinformatik Univ.-Prof. Dr.-Ing.

Mehr

Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010

Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010 Rekonstruktion biologischer Netzwerke (mit probabilistischen Methoden) Einführung 11.10.2010 Prof. Dr. Sven Rahmann 1 Team Prof. Dr. Sven Rahmann Zeit Mo 10-12; Do 8:30-10 Ort OH14, R104 Alle Informationen

Mehr

1 Einleitung... 1. 1.4 Glucoserepression...3. 1.8 Zielsetzung... 24. 2 Material und Methoden... 25

1 Einleitung... 1. 1.4 Glucoserepression...3. 1.8 Zielsetzung... 24. 2 Material und Methoden... 25 Inhaltsverzeichnis 1 Einleitung... 1 1.1 Zuckerstoffwechsel von Saccharomyces cerevisiae... 1 1.2 Glucoseinaktivierung... 2 1.3 Glucoseinduzierter gezielter mrna-abbau... 3 1.4 Glucoserepression...3 1.5

Mehr

Biosimilars ähnlich aber nicht gleich

Biosimilars ähnlich aber nicht gleich DPhG Jahrestagung 2008 Bonn Biosimilars ähnlich aber nicht gleich Prof. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt/Main Zwei Standpunkte zu generischen Biologicals:

Mehr

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden.

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden. 03 Arbeitsauftrag Arbeitsauftrag Ziel: Anhand des Foliensatzes soll die Bildung und der Aufbau des Proteinhormons Insulin erklärt werden. Danach soll kurz erklärt werden, wie man künstlich Insulin herstellt.

Mehr

laborwelt Laborautomation Marktübersicht: DNA-Synthese Nr. 6 / 2008 9. Jahrgang Großer Sonderteil: Medizintechnik und Laboratoriumsmedizin

laborwelt Laborautomation Marktübersicht: DNA-Synthese Nr. 6 / 2008 9. Jahrgang Großer Sonderteil: Medizintechnik und Laboratoriumsmedizin laborwelt Nr. 6 / 2008 9. Jahrgang Laborautomation Metabolom-Analyse von Industrie-Mikroorganismen im Hochdurchsatz Automatisierte Optimierung von Zellkultur-Parametern und Produktionsstämmen Großer Sonderteil:

Mehr

GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse. Erste Lernphase: Aneignungsphase

GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse. Erste Lernphase: Aneignungsphase Folie GRUPPENPUZZLE: Hochdurchsatztechnologien in der Genomanalyse Erste Lernphase: Aneignungsphase Erarbeiten Sie in Ihrer Expertengruppe die Inhalte eines der vier Textabschnitte (2.1, 2.2, 3.1, 3.2).

Mehr

Endbericht Max Buchner Forschungsstiftung 2012. Glykosylierung von rekombinanten Proteinen in der einzelligen Grünalge Chlamydomonas reinhardtii

Endbericht Max Buchner Forschungsstiftung 2012. Glykosylierung von rekombinanten Proteinen in der einzelligen Grünalge Chlamydomonas reinhardtii HSV His Endbericht Max Buchner Forschungsstiftung 2012 Glykosylierung von rekombinanten Proteinen in der einzelligen Grünalge Chlamydomonas reinhardtii Dipl. Biol. Juliane Richter, Dr. Stephanie Geier,

Mehr

Isolierung von DNA. Isolierung von DNA aus verschiedenen Früchten. Material:

Isolierung von DNA. Isolierung von DNA aus verschiedenen Früchten. Material: Isolierung von DNA Noch vor Jahren antwortete bei einer Umfrage fast die Hälfte der Befragten, dass normale Tomaten keine Gene enthalten. Nach Genen in Äpfeln, Bananen, Orangen oder Zwiebeln wurde nicht

Mehr

Theorie der Zellulären Elektromagnetischen Systemsteuerung Von Dr. med. Dietrich Reichwein

Theorie der Zellulären Elektromagnetischen Systemsteuerung Von Dr. med. Dietrich Reichwein Theorie der Zellulären Elektromagnetischen Systemsteuerung Von Dr. med. Dietrich Reichwein Einleitung Für die Weiterentwicklung und das Verständnis der Zusammenhänge der modernen Zellularpathologie ist

Mehr

Charakterisierung der Mutagensensitivität von Lymphozyten und lymphoblastoiden Zelllinien mit BRCA-Mutationen

Charakterisierung der Mutagensensitivität von Lymphozyten und lymphoblastoiden Zelllinien mit BRCA-Mutationen Universitätsklinikum Ulm Abteilung Humangenetik Ärztlicher Direktor: Prof. Dr. W. Vogel Charakterisierung der Mutagensensitivität von Lymphozyten und lymphoblastoiden Zelllinien mit BRCA-Mutationen Dissertation

Mehr

Diskussionspapier: Das überholte Paradigma der Gentechnik

Diskussionspapier: Das überholte Paradigma der Gentechnik Diskussionspapier: Das überholte Paradigma der Gentechnik Im Auftrag von Greenpeace Deutschland Freiburg, im November 2004 Katja Moch, Freiburg Öko-Institut e.v. Geschäftsstelle Freiburg Postfach 6226

Mehr

Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen

Mehr

Hirnschäden des Menschen

Hirnschäden des Menschen Hirnschäden des Menschen Pinel (6. ed) Kapitel 10 www.neuro.psychologie.unisb.de/vorlesung VL8-14-05-08.ppt 1 Hirnschäden des Menschen Zwei Ziele: Verständnis normaler Funktionen Strategien zur Behandlung

Mehr

Promotionsprogramm Translationale Medizin. Projektvorschlag 2013-34. Projektleiter/Betreuer: PD Dr. med. Anne Krug

Promotionsprogramm Translationale Medizin. Projektvorschlag 2013-34. Projektleiter/Betreuer: PD Dr. med. Anne Krug Promotionsprogramm Translationale Medizin Projektvorschlag 2013-34 Projektleiter/Betreuer: PD Dr. med. Anne Krug Klinik/Institut: II. Medizinische Klinik und Poliklinik Promotionsberechtigung: Hochschullehrer

Mehr