Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: , deutsch

Größe: px
Ab Seite anzeigen:

Download "Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch"


1 Forschungsbericht über das Projekt Einfluss der TLR3-Aktivierung des retinalen Pigmentepithels auf das Verhalten von Makrophagen, gefördert durch die DOG im Rahmen der Forschungsförderung innovativer wissenschaftlicher Projekte in der Augenheilkunde Antragstellerin Dr. Alexa Klettner Dienststellung: Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: , deutsch Dienstadresse: UK S-H, Campus Kiel Klinik für Ophthalmologie Arnold-Heller-Str. 3, Kiel Telefon/Telefax: / adresse: Zusammenfassung: Die Aktivierung des toll-like receptors 3 (TLR3) vermindert im Mausmodell die Ausbildung von Neovaskularisationen [Kleinmann et al]. Die darunter liegenden Mechanismen sind nicht bekannt. In der ersten Förderperiode haben wir den Einfluss der Aktivierung des TLR3 Rezeptors auf das retinale Pigmentepithel untersucht. Dabei fanden wir überraschend, dass die Aktivierung des TLR3 Rezeptors mit polyriboinosinic: polyribocytidylic acid (Poly I:C) einen dosisabhängigen Zelltod auslöst. Der Zelltod wird zum Teil durch die Mitogen-activated protein kinase (MAPK) JNK vermittelt. Ebenfalls überraschender Weise vermindert die Aktivierung des TLR3 Receptors die VEGF Sekretion nicht, sondern induziert sogar einen leichten Anstieg der VEGF Sekretion. Dieser Anstieg der Sekretion ist nicht abhängig von den MAPK JNK, p38 oder Erk. Eine durch andere Gruppen bereits beschriebenen Anstieg der IFN-beta Sekretion [Kumar 2004] konnten wir ebenfalls feststellen. Die Aktivierung von TLR3 induziert außerdem eine Phosphorylierung von ERK1/2. Die Monozytenkultur wurde etabliert und erste Experimente zur Interaktion von Monozyten mit RPE-Organkulturen in der 2-Photonenmikroskopie wurden durchgeführt. Ausführlicher Forschungsbericht: Poly I:C induziert einen konzentrationsabhängigen Zelltod Der Zelltod wurde mittels MTT-Assay, Trypanblau-Exklusions-Assay und Cell-Death-ELISA untersucht. Während im MTT-Assay keine Abnahme der Zellzahl festzustellen war, zeigte der (sensiblere) Trypanblau-Exklusions-Assay und der Cell-Death Detection ELISA einen signifikanten Zelltod bei 1 µg/ml, 10 µg/ml und 100 µg/ml (Abbildung 1).

2 Abbildung 1 :Zelltod induziert durch Poly I:C, untersucht im a) Trypanblau Exclusion Assay nach 24 h, b) Trypanblau Exclusion Assay nach 4 h, c) Cell death detection ELISA nach 24 h, d) MTT-Assay nach 24 h. Einfluss von MAPK auf den Poly I:C induzierten Zelltod Die Inhibition der MAPK p38 und ERK1/2 konnten diesen Zelltod nicht verhindern, während die Inhibition der MAPK JNK einen leicht protektiven Effekt zeigte. Die Inhibition von ERK1/2 führte dagegen zu einem signifikanten Ansteigen des Zelltodes, was auf einen protektiven Effekt von ERK1/2 hindeutet (Abbildung 2). VEGF-Sekretion Die Aktivierung von TLR3 zeigt einen leichten, konzentrationsabhängigen Anstieg der VEGF- Sekretion (Abbildung 3).

3 Abbildung 2: Einfluss unterschiedlicher MAPK auf den durch Poly I:C induzierten Zelltod nach 24 h, gemessen in Trypanblau Exclusion Assay. A) ERK1/2, b) p38, c) JNK VEGF (% control) control 10 ng 100 ng 1 µg 10 µg 100 µg Abbildung 3: VEGF Konzentration nach Gabe unterschiedlicher Poly I:C Konzentrationen, gemessen im VEGF ELISA 4 h nach Stimulation.

4 Einfluss von MAPK auf die VEGF-Sekretion Die Inhibition der MAPK p38, ERK1/2 und JNK zeigen keinen signifikanten Einfluss auf die VEGF-Sekretion unter Poly I:C Stimulation (Abbildung 4). VEGF (% untreated control) no inhib SB SP U 10 µg 100 µg Abbildung 4: VEGF Konzentration nach Gabe von 10 µg/ml bzw. 100 µg/ml Poly I:C bei Inhibition unterschiedlicher MAPK (SB = p38 Inhibitor, SP = JNK Inhibitor, U = ERK1/2 Inhibitor), gemessen im VEGF ELISA 4 h nach Stimulation. IFN-beta Sekretion Die TLR3 Aktivierung durch Poly I:C induziert auch bei geringen Konzentrationen eine Sekretion von IFN-beta. Diese Experimente sind noch nicht abgeschlossen. Aktivierung von ERK1/2 Die MAPK ERK1/2 wird konzentrationsabhängig durch Poly I:C aktiviert. Diese Aktivierung steht nicht mit dem Zelltod oder mit der VEGF-Ausschüttung in Zusammenhang. Vorläufige Monozytenexperimente Die Kultur der Monozyten ist etabliert worden und erste Experimente zur Interaktion von RPE Organkulturen und Monozyten wurden bereits durchgeführt. Die Charakterisierung der Interaktion von Monozyten und RPE wird in der nächsten Förderperiode bearbeitet. Erste Experimente zur Interaktion von RPE Zellen mit Monozyten im 2-Photonenmikroskop wurden in Zusammenarbeit mit Dr. Miura aus dem Laserzentrum Lübeck durchgeführt (Abbildung 5).

5 Abbildung 5: 2-Photonenmikroskopisches Bild einer RPE Zellschicht (Organkultur) in Interaktion mit Monozyten (Pfeil) Ausblick Im zweiten Jahr der Förderung wird die Interaktion von Monozyten mit dem retinalen Pigmentepithel bearbeitet. Dafür wird in Transwellkokulturen zum einen das Migrationsverhalten von Monozyten bei aktiviertem RPE untersucht, zum anderen die Auswirkungen der RPE-Aktivierung auf die Phänotyp der Monozyten, wie im Antrag beschrieben. Veröffentlichungen der Ergebnisse Die Ergebnisse wurden als Kongressbeitrag für die ARVO 2011 eingereicht. Nach Abschluss Experimente zur IFN-ß Ausschüttung wird eine Publikation in einem Fachjournal eingereicht. Literatur Kleinman ME, Yamada K, Takeda A, et al Nature 452:591 Kumar MV, Nagineni C, Chin MS, Hooks JJ, Detrick B J Neuroimmunol 153:7

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose Aus der Medizinischen Universitätsklinik und Poliklinik Abteilung für Pneumologie der Albert-Ludwigs-Universität Freiburg im Breisgau Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen


Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsäsche Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Dissertation finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin Nähere


Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt


NF-κB = Nuclear Factor kappab

NF-κB = Nuclear Factor kappab NF-κB = Nuclear Factor kappab 1. Transkriptionsfaktor 2. weitgehend ubiquitär exprimiert 3. durch eine Vielzahl von unterschiedlichen Stimuli induzierbar 4. zentrale Rolle bei der Entstehung und Aufrechterhaltung


A. Sak, S. Grehl, M. Engelhard, A. Wierlemann, HP. Kaelberlah, P. Erichsen, C. Pöttgen, M. Groneberg, M. Stuschke

A. Sak, S. Grehl, M. Engelhard, A. Wierlemann, HP. Kaelberlah, P. Erichsen, C. Pöttgen, M. Groneberg, M. Stuschke γ-h2ax Foci Induktion in Lymphocten des peripheren Bluts von Tumorpatienten: in vivo und in vitro Interaktion von Cisplatin mit Doppelstrangbruch-Signalen ionisierender Strahlen A. Sak, S. Grehl, M. Engelhard,


Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen

Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen Entwicklung und Optimierung von in vitro Testverfahren zur Evaluierung von antiinflammatorisch wirkenden Arzneistoffen DISSERTATION der Fakultät für Chemie und Pharmazie der Eberhard-Karls-Universität


Stand von letzter Woche

Stand von letzter Woche RUB ECR1 AXR1 Stand von letzter Woche E2 U? E1-like AXR1 Repressor ARF1 Proteasom AuxRE Repressor wird sehr schnell abgebaut notwendig für Auxinantwort evtl. Substrat für SCF Identifikation des SCF-Ubiquitin


Forschungsbericht. Molekulare Toxikologie von Monomeren zahnärztlicher Komposite

Forschungsbericht. Molekulare Toxikologie von Monomeren zahnärztlicher Komposite Forschungsbericht zur Verwendung der Mittel im Rahmen der Förderung des Projektes Molekulare Toxikologie von Monomeren zahnärztlicher Komposite (Abschlußbericht) Projekt: Schw 431/11-1 Kennwort: Biokompatibilität


Immunregulatorische Funktionen von T-Lymphozyten

Immunregulatorische Funktionen von T-Lymphozyten Immunregulatorische Funktionen von T-Lymphozyten DISSERTATION zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Christian-Albrechts-Universität zu Kiel vorgelegt von


Autismus. autism spectrum disorders

Autismus. autism spectrum disorders Autismus autism spectrum disorders Index Was ist Autismus? Wissenschaftliche Grundlagen Phelan-McDermid-Syndrome (PMDS) Pharmakologische Tests Zusammenfassung Schlussfolgerungen Methoden Elektrophysiologische


Grundlegende Methoden der Molekularen Biologie, AD II. Prof. Dr. Albert Duschl

Grundlegende Methoden der Molekularen Biologie, AD II. Prof. Dr. Albert Duschl Grundlegende Methoden der Molekularen Biologie, AD II Prof. Dr. Albert Duschl Molekulare Mechanismen Themen für die erste Vorlesung: Signalwege, am Beispiel von Jak/STAT Immunpräzipitation, Immunfluoreszenz


Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen

Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen Dr. rer. nat. Jasmin Wellbrock und Prof. Dr. Walter Fiedler Projektbericht an die Alfred & Angelika Gutermuth Stiftung Einfluss von Hypoxie auf die Interaktion von Leukämieblasten mit Knochenmark-Stromazellen


Kapitel 5. Diskussion

Kapitel 5. Diskussion Kapitel 5 Diskussion Ziel der vorliegenden Arbeit war es, ein Kultursystem zu etablieren, das die Analyse der IFN-γ Produktion von Th1 polarisierten naiven CD4 + Th-Zellen zuläßt. Dieses Kultursystem mußte



DETECT III DETECT III DETECT III Eine prospektive, randomisierte, zweiarmige, multizentrische Phase III Studie zum Vergleich Standardtherapie versusstandardtherapie mit Lapatinib bei metastasierten Patientinnen mit initial


Einsatz einer Rinder-spezifischen Internen Kontrolle im Rahmen des BVDV-Nachweises mittels real-time RT-PCR aus Ohrgewebe

Einsatz einer Rinder-spezifischen Internen Kontrolle im Rahmen des BVDV-Nachweises mittels real-time RT-PCR aus Ohrgewebe Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit Einsatz einer Rinder-spezifischen Internen Kontrolle im Rahmen des BVDV-Nachweises mittels real-time RT-PCR aus Ohrgewebe AVID-Workshop BVD-Ohrstanzendiagnostik


Activation of T Lymphocytes

Activation of T Lymphocytes Immunologie II Activation of T Lymphocytes Chapter 9 - Cellular and Molecular Immunology, Abbas-Lichtman-Pillai 6th edition Leslie Saurer Institut für Pathologie (Prof. Christoph Müller) Uebersicht Kapitel


Antigen Receptors and Accessory Molecules of T Lymphocytes

Antigen Receptors and Accessory Molecules of T Lymphocytes Immunologie II Antigen Receptors and Accessory Molecules of T Lymphocytes Chapter 7 - Cellular and Molecular Immunology, Abbas-Lichtman-Pillai 6th edition Leslie Saurer Institut für Pathologie (Prof. Christoph


Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel. Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar

Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel. Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar Kleine Moleküle mit großer Wirkung: micrornas und Mikrovesikel Kerstin Junker Klinik für Urologie und Kinderurologie Homburg/Saar Rejektion Hartono et al., 2009 Seite 2 Untersuchungsmaterial Nierengewebe


BMP / TGF-ß Receptor. Prof. Dr. Albert Duschl

BMP / TGF-ß Receptor. Prof. Dr. Albert Duschl BMP / TGF-ß Receptor Prof. Dr. Albert Duschl Biologische Regelsysteme Behalten Sie bitte im Gedächtnis, daß biologische Systeme immer wieder vor vergleichbaren Aufgaben stehen, bei denen es darum geht,


Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1


Den Ursachen der Alzheimer-Erkrankung auf der Spur: Neue Einsichten in zellbiologische Prozesse

Den Ursachen der Alzheimer-Erkrankung auf der Spur: Neue Einsichten in zellbiologische Prozesse 3.762 Zeichen Abdruck honorarfrei Beleg wird erbeten. Den Ursachen der Alzheimer-Erkrankung auf der Spur: Neue Einsichten in zellbiologische Prozesse Die zellbiologischen Prozesse, die neurodegenerative


Wirkungen von Aminothalidomid und Suramin auf die LPS-induzierte Zytokinbildung von TNFα, IL-12p40 und IL-10 in CD-14 + -Monozyten

Wirkungen von Aminothalidomid und Suramin auf die LPS-induzierte Zytokinbildung von TNFα, IL-12p40 und IL-10 in CD-14 + -Monozyten Wirkungen von Aminothalidomid und Suramin auf die LPS-induzierte Zytokinbildung von TNFα, IL-12p40 und IL-10 in CD-14 + -Monozyten Inaugural-Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen


Diplom Genetikerin Feoktistova Maria Alexeevna The role of RIP-1 and ciaps in apoptotic and non-apoptotic signalling via TLR3 and death receptors

Diplom Genetikerin Feoktistova Maria Alexeevna The role of RIP-1 and ciaps in apoptotic and non-apoptotic signalling via TLR3 and death receptors Diplom Genetikerin Feoktistova Maria Alexeevna The role of RIP-1 and ciaps in apoptotic and non-apoptotic signalling via TLR3 and death receptors Summary Skin cancers, like squamous cell carcinoma (SCC),


G-Protein gekoppelte Rezeptoren

G-Protein gekoppelte Rezeptoren G-Protein gekoppelte Rezeptoren Bedeutung, Funktionen, Liganden Prinzipielle Funktionsmechanismen Klassifizierung und Eigenschaften von G-Proteinen Desensitivierung Beispiele G-Protein gekoppelte Rezeptoren


Inhaltsverzeichnis... 6. 1 Einleitung... 14. 1.1 ATP-Binding-Cassette Transporter... 14. 1.2 ABC-Transporter Subfamilie A... 16

Inhaltsverzeichnis... 6. 1 Einleitung... 14. 1.1 ATP-Binding-Cassette Transporter... 14. 1.2 ABC-Transporter Subfamilie A... 16 Inhaltsverzeichnis Inhaltsverzeichnis... 6 1 Einleitung... 14 1.1 ATP-Binding-Cassette Transporter... 14 1.2 ABC-Transporter Subfamilie A... 16 1.2.1 ABCA2: Funktion und MDR... 16 1.3 ABC-Transporter Subfamilie


Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005

Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005 Optimality and evolutionary tuning of the expression level of a protein Erez Dekel & Uri Alon Nature Vol 436, July 2005 Wie Zellen Denken Übersicht Hintergrund Mathematische Formulierung (cost-benefit-theory)


4. Quantitative Analyse der Ligand-Bindungsstudien

4. Quantitative Analyse der Ligand-Bindungsstudien 4. Quantitative Analyse der Ligand-Bindungsstudien Im folgenden apitel sollen die grundlegenden analytischen Methoden zur Interpretation der experimentell gewonnenen Bindungsdaten vorgestellt werden. ie


Projektskizze: Studie/ Auswertung/ Publikation

Projektskizze: Studie/ Auswertung/ Publikation Projektskizze: Studie/ Auswertung/ Publikation Name: PD Dr. Dr. Robert Bals, CAPNetz C11 Datum: 30. 8. 2007 Institution(en)/Autor(en): Klinikum der Universität Marburg Klinik für Innere Medizin mit Schwerpunkt


3.2 Analyse des Signaltransduktionsweges, über den Hyaluronsäure die Aktivierung des MMP-9-Gens vermittelt

3.2 Analyse des Signaltransduktionsweges, über den Hyaluronsäure die Aktivierung des MMP-9-Gens vermittelt 3.2 Analyse des Signaltransduktionsweges, über den Hyaluronsäure die Aktivierung des MMP-9-Gens vermittelt 3.2.1 Hyaluronsäure vermittelt die transkriptionelle Aktivierung des MMP-9-Gens und nicht die


Marianti Manggau. Untersuchungen zu Signalwegen von SPP in humanen Keratinozyten

Marianti Manggau. Untersuchungen zu Signalwegen von SPP in humanen Keratinozyten Marianti Manggau Untersuchungen zu Signalwegen von SPP in humanen Keratinozyten Die Deutsche Bibliothek - CIP-Einheitsaufnahme Manggau, Marianti: Untersuchungen zu Signalwegen von SPP in humanen Keratinozyten


Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9

Verzeichnis der Abkürzungen... 6. 1. Einleitung... 9 Inhaltsverzeichnis Verzeichnis der Abkürzungen... 6 1. Einleitung... 9 1.1 Probiotika...9 1.1.1 Definition und Historisches...9 1.1.2 Klinische Bedeutung probiotisch wirksamer Bakterienstämme...9 1.1.3


Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Bernd Hoffmann, Klaus R. Depner, Horst Schirrmeier & Martin Beer Friedrich-Loeffler-Institut Greifswald-Insel Riems


To sleep or not to sleep

To sleep or not to sleep Manfred Hallschmid Institut für Neuroendokrinologie, Universität Lübeck Ernährung, Bewegung, Entspannung alles zu seiner Zeit München, 31. März 2011 To sleep or not to sleep Der Einfluss des Schlafs auf


T-Lymphozyten. T-Lymphozyten erkennen spezifisch nur zell- ständige Antigene (Proteine!) und greifen sie direkt an. verantwortlich.

T-Lymphozyten. T-Lymphozyten erkennen spezifisch nur zell- ständige Antigene (Proteine!) und greifen sie direkt an. verantwortlich. T-Lymphozyten T-Lymphozyten erkennen spezifisch nur zell- ständige Antigene (Proteine!) und greifen sie direkt an. Sie sind für die zellvermittelte Immunität verantwortlich. Antigenerkennung B Zellen erkennen


Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt.

Rekombinante Wirkstoffe. Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt. Rekombinante Wirkstoffe Prof. Dr. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt Dingermann@em.uni-frankfurt.de Empfohlene Literatur Rekombinante Wirkstoffe Der legale


Aktuelles zur Therapie der MS

Aktuelles zur Therapie der MS KLINIKEN LANDKREIS SIGMARINGEN GmbH AKADEMISCHES LEHRKRANKENHAUS DER UNIVERSITÄT TÜBINGEN Aktuelles zur Therapie der MS PD Dr. med. Oliver Neuhaus Chefarzt Abteilung Neurologie Was ist Multiple Sklerose?


Glatte Muskulatur. Dr. G. Mehrke

Glatte Muskulatur. Dr. G. Mehrke Glatte Muskulatur 1 Glatte Muskulatur Eigenschaften und Unterschiede zur Skelettmuskulatur: Spindelförmige, einkernige Zellen, funktionell über Gap Junctions verbunden. Aktin- und Myosinfilamente sind


Lebend / Tot Differenzierung von bierschädlichen Bakterien mittels Real-Time PCR

Lebend / Tot Differenzierung von bierschädlichen Bakterien mittels Real-Time PCR Lebend / Tot Differenzierung von bierschädlichen Bakterien mittels Real-Time PCR Autoren: Dipl.-Ing. Andreas Brandl, Dr.-Ing. Christoph Tenge, Prof. Dr.-Ing. Eberhard Geiger, Lehrstuhl für Technologie


Olfaktion. Olfaktion

Olfaktion. Olfaktion Olfaktion Emotionen und Verhalten Erinnerung Sozialverhalten Aroma Kontrolle der Nahrung Reviermarkierung Partnerwahl Orientierung in der Umwelt Duftstoffwahrnehmung Axel, R. Spektrum der Wissenschaft,


Zielgerichtete Therapie Ob Ihr wollt oder nicht

Zielgerichtete Therapie Ob Ihr wollt oder nicht Zielgerichtete Therapie Ob Ihr wollt oder nicht Ziad Atassi Universitätsfrauenklinik Ulm Direktor: Prof.Dr.R.Kreienberg inedome Ulm 08.07.2009 ADECATUMUMAB N = 22 NERATINIB N = 37 PERTUZUMAB N = 29 TRASTUZUMAB


Kontrolle des Zellzyklus: Checkpoints. kann an bestimmten Kontrollpunkten gestoppt werden

Kontrolle des Zellzyklus: Checkpoints. kann an bestimmten Kontrollpunkten gestoppt werden Kontrolle des Zellzyklus: Checkpoints kann an bestimmten Kontrollpunkten gestoppt werden G2 checkpoint komplette DNA Replikation? sind DNA Schäden vorhanden? ist die Zelle groß genug? ist die Umgebung


RSV-Infektion Mögliche pathogenetische Mechanismen und Labordiagnostik

RSV-Infektion Mögliche pathogenetische Mechanismen und Labordiagnostik RSV-Infektion Mögliche pathogenetische Mechanismen und Labordiagnostik Therese Popow-Kraupp Respiratory Syncytial Virus (RSV) Häufigste Ursache von Infektionen der Atemwege bei Kleinkindern In Europa:


Apoptose 69. 1. Einleitung 2. Extrinsischer Weg 3. Intrinsischer Weg

Apoptose 69. 1. Einleitung 2. Extrinsischer Weg 3. Intrinsischer Weg Teil III. Signalweg des Zelltodes im Herzen Apoptose 69. 1. Einleitung 2. Extrinsischer Weg 3. Intrinsischer Weg >50% der Neuronen Während der Entwicklung 70. Kontraktionsband Nekrose Retina DNA Abbau


Genetische Disposition für r Infektion und Sepsis

Genetische Disposition für r Infektion und Sepsis Genetische Disposition für r Infektion und Sepsis Martijn van Griensven TRAUMA Forschungszentrum für Traumatologie der AUVA Ludwig Boltzmann Institut für experimentelle und klinische Traumatologie Lorenz


4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins

4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd30-igg1-tnf- Fusionsproteins ERGEBNISSE 29 4. Ergebnisse 4.1. Herstellung des CH2/CH3-trunkierten dimerisierten anti-cd3-igg1-tnf- Fusionsproteins Im vorliegenden Immunzytokin wurden die Domänen CH2/CH3 des humanen Fc-Fragmentes durch


Pharmakokinetische Untersuchungen zur Aufnahme von (-)-Linalool und 1,8-Cineol nach Inhalation und dermaler Applikation

Pharmakokinetische Untersuchungen zur Aufnahme von (-)-Linalool und 1,8-Cineol nach Inhalation und dermaler Applikation Pharmakokinetische Untersuchungen zur Aufnahme von (-)-Linalool und 1,8-Cineol nach Inhalation und dermaler Applikation Eva Heuberger Universität des Saarlandes, Pharmazeutische Biologie, 66123 Saarbrücken


Allgemeine Pharmakologie

Allgemeine Pharmakologie Allgemeine Pharmakologie Pharmakologie Arzneistoff: Wirkstoff, der zur Vorbeugung, Linderung, Heilung oder Erkennung von Erkrankungen dient Pharmakon: biologisch Wirksame Substanz Lehre von den Wirkungen


Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin


Aus der Klinik für Anästhesie und Intensivmedizin Sana-Herzzentrum Cottbus. Dissertation

Aus der Klinik für Anästhesie und Intensivmedizin Sana-Herzzentrum Cottbus. Dissertation Aus der Klinik für Anästhesie und Intensivmedizin Sana-Herzzentrum Cottbus Dissertation Veränderung der Monozyten- und Complementaktivierung als Zeichen der Immunsuppression bei postoperativem SIRS und


Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon


Wie erblich sind Epilepsien? Konzepte für die Interaktion von Genen und Umwelt

Wie erblich sind Epilepsien? Konzepte für die Interaktion von Genen und Umwelt Wie erblich sind Epilepsien? Konzepte für die Interaktion von Genen und Umwelt Ingo Helbig Klinik für Neuropädiatrie UKSH Kiel www.epilepsiegenetik.de Aufbau Aufbau - Warum? Aufbau - Warum? - Der Stand


IMMUNOLOGIE II. Kapitel 12 - Zytokine. Britta Engelhardt Theodor Kocher Institut Universität Bern. bengel@tki.unibe.ch

IMMUNOLOGIE II. Kapitel 12 - Zytokine. Britta Engelhardt Theodor Kocher Institut Universität Bern. bengel@tki.unibe.ch IMMUNOLOGIE II Kapitel 12 - Zytokine Britta Engelhardt Theodor Kocher Institut Universität Bern bengel@tki.unibe.ch Immunolgie II Eigenschaften von Zytokinen Zytokine = Polypeptide die von Zellen das angeborenen


Neue Entwicklungen in der Behandlung von Darmkrebs. Priv.-Doz. Dr. med. G.-M. Robertz-Vaupel Spessartstrasse 9 53119 Bonn

Neue Entwicklungen in der Behandlung von Darmkrebs. Priv.-Doz. Dr. med. G.-M. Robertz-Vaupel Spessartstrasse 9 53119 Bonn Neue Entwicklungen in der Behandlung von Darmkrebs Priv.-Doz. Dr. med. G.-M. Robertz-Vaupel Spessartstrasse 9 53119 Bonn Darmkrebs (kolorektale Karzinome, CRC) streng genommen handelt es sich dabei um


Extrakorporale Photopherese. Dr. med. Carolin Bouveret Klinik für Dermatologie und Allergologie HELIOS Klinikum Berlin-Buch

Extrakorporale Photopherese. Dr. med. Carolin Bouveret Klinik für Dermatologie und Allergologie HELIOS Klinikum Berlin-Buch Extrakorporale Photopherese Dr. med. Carolin Bouveret Klinik für Dermatologie und Allergologie HELIOS Klinikum Berlin-Buch Extrakorporale Photopherese Erstbeschreibung 1987 in der Behandlung kutaner T-Zell-


Programmfolge. Klinik für Innere Medizin I, Universitätsklinikum des Saarlandes

Programmfolge. Klinik für Innere Medizin I, Universitätsklinikum des Saarlandes Universität des Saarlandes Univ. Prof. Dr. Martina Sester 66421 Homburg An alle Fachrichtungen und Kliniken der Medizinischen Fakultät der Universität des Saarlandes mit der Bitte um Weitergabe und Aushang


«Willkommen zu Hause» - Neue Versorgungsmodelle in Langzeitpflegeinstitutionen

«Willkommen zu Hause» - Neue Versorgungsmodelle in Langzeitpflegeinstitutionen «Willkommen zu Hause» - Neue Versorgungsmodelle in Langzeitpflegeinstitutionen Jubiläumstagung 10 Jahre Stiftung Pflegewissenschaft Schweiz Bern, 16.10.2015 Dr. Dietmar Ausserhofer Universität Basel, Department


Controlling the Surface Properties of Nanoparticles Bioorganically modified Nanoparticles for Cell Signaling (NANOCYTES)

Controlling the Surface Properties of Nanoparticles Bioorganically modified Nanoparticles for Cell Signaling (NANOCYTES) Surfaces and Interfaces NANCYTES Engineering at the Nanoscale, DECHEMA, 9. März 2005 Controlling the Surface Properties of Nanoparticles Bioorganically modified Nanoparticles for Cell Signaling (NANCYTES)


Untersuchungen zur Chemotherapie-Resistenz des malignen testikulären Keimzelltumors

Untersuchungen zur Chemotherapie-Resistenz des malignen testikulären Keimzelltumors Untersuchungen zur Chemotherapie-Resistenz des malignen testikulären Keimzelltumors Dissertation zur Erlangung des akademischen Grades doctor rerum naturalium (Dr. rer. nat.) vorgelegt der Mathematisch-Naturwissenschaftlich-Technischen


Cluster #4 stellt sich (was) vor...

Cluster #4 stellt sich (was) vor... Cluster #4 stellt sich (was) vor... Ausgangssituation Der Cluster Experimental Therapy & Drug Resistance vertritt ein zentrales Thema Schwerpunkt an der Schnittfläche zwischen experimenteller und klinischer


Das Paper von heute. Samuel Grimm & Jan Kemna

Das Paper von heute. Samuel Grimm & Jan Kemna Das Paper von heute Samuel Grimm & Jan Kemna Bisheriges Modell Was bereits bekannt war - TIR1 ist an Auxinantwort (Zellteilung, Elongation, Differenzierung) beteiligt, im selben Signalweg wie AXR1 - TIR1


Erythrozyten-Verformbarkeit und Training

Erythrozyten-Verformbarkeit und Training Forschungskolloquium Erythrozyten-Verformbarkeit und Training Dr. Marijke Grau Verformbarkeit Fähigkeit des Erythrozyten seine Form den dynamischen Bedingungen des Blutflusses anzupassen Kapillarpassage


Regulation des Zellcylus

Regulation des Zellcylus Regulation des Zellcylus Dr. F. Neuschäfer-Rube Cyclin-abhängige Kinasen (CDKs) Cyclin-abhängige Kinasen: Motoren und Schalter des Zellzyclus Dr. F. Neuschäfer-Rube Der Zellzyklus M S Der Zellzyklus M


Aptamere als Biorezeptoren zur Detektion kleiner Moleküle in Flüssigkeiten und der Gasphase

Aptamere als Biorezeptoren zur Detektion kleiner Moleküle in Flüssigkeiten und der Gasphase Abschlussbericht für die Max-Buchner-Forschungsstiftung (MBFSt) Aptamere als Biorezeptoren zur Detektion kleiner Moleküle in Flüssigkeiten und der Gasphase 1. Einleitung und Aufgabenstellung Die Detektion


Einzelmolekül-Kraftspektroskopie an kovalenten Bindungen

Einzelmolekül-Kraftspektroskopie an kovalenten Bindungen Einzelmolekül-Kraftspektroskopie an kovalenten Bindungen VDI Arbeitskreis Mechatronik 18-01-2012 f f Dr. Sebastian Schmidt Fakultät für Mikro- und Feinwerktechnik, Physikalische Technik der Hochschule


presented by Diplom-Biologin, Johann Wolfgang Goethe-University,Frankfurt/M.

presented by Diplom-Biologin, Johann Wolfgang Goethe-University,Frankfurt/M. DISS. ETH NO.: 15505 NOVEL APPROACHESFOR ANTI-ANGIOGENICINTERVENTION A dissertation submitted to the SWISS FEDERAL INSTITUTEOF TECHNOLOGYZÜRICH for the degreeof Doctor of Natural Sciences presented by


Inhibition der Signaltransduktion von Toll-like-Rezeptoren durch Annexin 1 auf der Oberfläche apoptotischer Zellen

Inhibition der Signaltransduktion von Toll-like-Rezeptoren durch Annexin 1 auf der Oberfläche apoptotischer Zellen Inhibition der Signaltransduktion von Toll-like-Rezeptoren durch Annexin 1 auf der Oberfläche apoptotischer Zellen Dissertation zur Erlangung der Doktorwürde der Naturwissenschaftlich-Mathematischen Gesamtfakultät


Angstkrankheiten II. Verhaltenspharmakologische und genetische Methoden

Angstkrankheiten II. Verhaltenspharmakologische und genetische Methoden Angstkrankheiten II Verhaltenspharmakologische und genetische Methoden Tiermodelle Annäherungs Vermeidungs-Paradigma di Instinktives Verhalten o Schock-induziert o Isolations-induziert Interaktion mit


2 Physikalische Eigenschaften von Fettsäuren: Löslichkeit, Dissoziationsverhalten, Phasenzustände

2 Physikalische Eigenschaften von Fettsäuren: Löslichkeit, Dissoziationsverhalten, Phasenzustände 2 Physikalische Eigenschaften von Fettsäuren: Löslichkeit, Dissoziationsverhalten, Phasenzustände Als Fettsäuren wird die Gruppe aliphatischer Monocarbonsäuren bezeichnet. Der Name Fettsäuren geht darauf


Die Toll- / IL-1- Rezeptorfamilie:

Die Toll- / IL-1- Rezeptorfamilie: Die Toll- / IL-1- Rezeptorfamilie: Gemeinsamkeiten und Unterschiede der Signaltransduktion von Interleukin-1, Interleukin-18 und Lipopolysaccharid Vom Fachbereich Chemie der Universität Hannover zur Erlangung


Publikationsliste Priv.-Doz. Dr. med. Dje Philippe N Guessan, DPH. Cumulative IF (life time): 168,38 H (Hirsch)-Index: 17

Publikationsliste Priv.-Doz. Dr. med. Dje Philippe N Guessan, DPH. Cumulative IF (life time): 168,38 H (Hirsch)-Index: 17 Publikationsliste Priv.-Doz. Dr. med. Dje Philippe N Guessan, DPH Cumulative IF (life time): 168,38 H (Hirsch)-Index: 17 1. Scharf S, Zahlten J, Szymanski K, Hippenstiel S, Suttorp N, N Guessan PD. Streptococcus






Abbildungsverzeichnis I INHALTSVERZEICHNIS Abkürzungen VI Abbildungsverzeichnis VIII I. Einleitung 1. Neurone und Axonwachstum 1 2. Oligodendrozyten und Myelin 3 3. Das Proteolipid Protein (PLP) 6 4. Mutationen im PLP-Gen und


Die Entwicklung der Keimbahn. wahrend der Embryogenese von Caenorhabditis elegans

Die Entwicklung der Keimbahn. wahrend der Embryogenese von Caenorhabditis elegans Die Entwicklung der Keimbahn wahrend der Embryogenese von Caenorhabditis elegans Von der Fakultat fur Lebenswissenschaften der Technischen Universitat Carolo-Wilhelmina zu Braunschweig zur Erlangung des


Plate Test) Opioid-Rezeptor Bindung in. ex vivo Audioradiographie mit μ- Ligand ([3H]DAMGO. Autoradiography)

Plate Test) Opioid-Rezeptor Bindung in. ex vivo Audioradiographie mit μ- Ligand ([3H]DAMGO. Autoradiography) Tabelle: Tierstudien zum Effekt von Schlafdeprivation auf die Schmerzwahrnehmung Tierstudien Autor Tiere Behandlung a Maße Ergebnisse Nascimento Wistar Kontrolle vs. REM-SD über 4 Tage Schmerzschwellen


bakterielle Toxine Ingo Just Institut für Toxikologie Medizinische Hochschule Hannover

bakterielle Toxine Ingo Just Institut für Toxikologie Medizinische Hochschule Hannover Dieses Handout ist nur für den Gebrauch im DGPT-Weiterbildungskurs in Göttingen 2014 bestimmt. bakterielle Toxine Ingo Just Institut für Toxikologie Medizinische Hochschule Hannover Wirkung der bakteriellen


Chronisch obstruktive Lungenerkrankung (COPD) Therapie

Chronisch obstruktive Lungenerkrankung (COPD) Therapie Chronisch obstruktive Lungenerkrankung (COPD) Therapie PD Dr. Andrea Koch Oberärztin und Leiterin des Schwerpunkts Pneumologie Klinik III für Innere Medizin / Herzzentrum Universität zu Köln Globale Initiative


Molekulare Mechanismen der Signaltransduktion

Molekulare Mechanismen der Signaltransduktion Molekulare Mechanismen der Signaltransduktion 07 - Identifizierung von ARF1 + Hinweise für Vorträge Folien: http://tinyurl.com/modul-mms http://www.pnas.org/content/111/14/5427/f1.large.jpg neues Modell


Stress & kognitive Flexibilität (Aufgabenwechsel) Luca Spliethoff

Stress & kognitive Flexibilität (Aufgabenwechsel) Luca Spliethoff Stress & kognitive Flexibilität (Aufgabenwechsel) Dresden, 08.12.2015 Luca Spliethoff Franziska Keßler Gliederung 1. Einleitung: Was ist kognitive Flexibilität? 2. Metaanalyse von Shields et al. (2015)


Neue Ost-West-Migration nach Deutschland? - Zuwanderung im Kontext von Freizügigkeit und Wirtschaftskrise am Beispiel Bulgariens und Rumäniens

Neue Ost-West-Migration nach Deutschland? - Zuwanderung im Kontext von Freizügigkeit und Wirtschaftskrise am Beispiel Bulgariens und Rumäniens Neue Ost-West-Migration nach Deutschland? - Zuwanderung im Kontext von Freizügigkeit und Wirtschaftskrise am Beispiel Bulgariens und Rumäniens Dr. Stephan Humpert (mit Elisa Hanganu und Dr. Martin Kohls)


Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin


Neue diagnostische Verfahren zum Nachweis von Erregern Lebensmittelbedingter Infektionen

Neue diagnostische Verfahren zum Nachweis von Erregern Lebensmittelbedingter Infektionen FEDERAL INSTITUTE FOR RISK ASSESSMENT Neue diagnostische Verfahren zum Nachweis von Erregern Lebensmittelbedingter Infektionen Burkhard Malorny Moderne Erregerdiagnostik: Der Wettlauf gegen die Zeit Ziel:


Ernährung und Multiple Sklerose. Dieter Pöhlau Kamillus Klinik Asbach (Westerwald)

Ernährung und Multiple Sklerose. Dieter Pöhlau Kamillus Klinik Asbach (Westerwald) Ernährung und Multiple Sklerose Dieter Pöhlau Kamillus Klinik Asbach (Westerwald) Die Multiple Sklerose -eine chronische, entzündliche, demyelinisierende ZNS - Erkrankung Zentralnervensystem und Oxidation


Immunreaktion nach. transientem kutanem adenoviralem Gentransfer

Immunreaktion nach. transientem kutanem adenoviralem Gentransfer Immunreaktion nach transientem kutanem adenoviralem Gentransfer Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Fakultät für Biologie und Biotechnologie an der Internationalen


Inaugural-Dissertation zur Erlangung der medizinischen Doktorwürde des Fachbereichs Humanmedizin der Freien Universität Berlin

Inaugural-Dissertation zur Erlangung der medizinischen Doktorwürde des Fachbereichs Humanmedizin der Freien Universität Berlin Aus dem Institut für Physiologie des Fachbereiches Humanmedizin der Freien Universität Berlin (Zentrum für Weltraummedizin Berlin) Direktor : Prof. Dr. med. Axel R. Pries Der Einfluß einer körperlichen


Ophthalmologe Zeitschrift der Deutschen Ophthalmologischen Gesellschaft

Ophthalmologe Zeitschrift der Deutschen Ophthalmologischen Gesellschaft Der Ophthalmologe Zeitschrift der Deutschen Ophthalmologischen Gesellschaft Elektronischer Sonderdruck für M. Kernt Ein Service von Springer Medizin Ophthalmologe 211 18:445 451 DOI 1.17/s347-1-234-7 Springer-Verlag


Amiodaron und Schilddrüse

Amiodaron und Schilddrüse Kardiologischer Gesprächskreis 05.10.2011 Amiodaron und Schilddrüse Alexander Lammert V. Medizinische Klinik Amiodaron und Iodstoffwechsel Iodgehalt: 37% des Molekulargewichts Iodbeladung pro Tag: n 75


Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin


Welche Gerinnungsparameter außer FVIII sind zur Beurteilung der Plasmaqualität von Bedeutung?

Welche Gerinnungsparameter außer FVIII sind zur Beurteilung der Plasmaqualität von Bedeutung? 0,7 0,6 0,5 Welche Gerinnungsparameter außer FVIII sind zur Beurteilung der Plasmaqualität von Bedeutung? OD 0,4 0,3 0,2 0,1 0 0 0,2 0,4 0,6 0,8 1 1,2 Anti Fxa-Aktivität [IU/ml] Berlin, 21. November 2015


Apoptosemechanismen und neurodegenerative Erkrankungen

Apoptosemechanismen und neurodegenerative Erkrankungen Apoptosemechanismen und neurodegenerative Erkrankungen Die Alzheimer Demenz Dr. Claudia Götz Übersicht Die Alzheimer Demenz Die Entdeckung der Krankheit Charakteristika der Alzheimer Krankheit Alzheimer


Antimikrobielle Peptide als funktionale Moleküle für die Oberflächenbeschichtung

Antimikrobielle Peptide als funktionale Moleküle für die Oberflächenbeschichtung Antimikrobielle Peptide als funktionale Moleküle für die berflächenbeschichtung K. apsch, F.F. Bier und M. von Nickisch-osenegk Fraunhofer Institut für Biomedizinische Technik (IBMT) Inhaltsverzeichnis


Kraftpaket Muskel. Sarkomere. Muskelhypertrophie. Valentin Leibetseder. FA Med. Leistungsphysiologie. 12. GOTS-Treffen Ischgl 2009

Kraftpaket Muskel. Sarkomere. Muskelhypertrophie. Valentin Leibetseder. FA Med. Leistungsphysiologie. 12. GOTS-Treffen Ischgl 2009 Kraftpaket Muskel Valentin Leibetseder FA Med. Leistungsphysiologie 12. GOTS-Treffen Ischgl 2009 Sarkomere Sarkomer max. um ca. 30 % verkürzen direktes Verhältnis zum Training: Faser-Charakteristik ist


Willkommen zum 4. Lüdenscheider Tag der MS

Willkommen zum 4. Lüdenscheider Tag der MS Willkommen zum 4. Lüdenscheider Tag der MS Update 2012 Therapieoptionen bei MS Referent: Dr. med. Sebastian Schimrigk Lüdenscheid, den 11. Februar 2012 Was sind die Behandlungsziele? 1. Ordnung: Verhinderung


Neue Substanzen in der Therapie des KRK Prof. V. Heinemann

Neue Substanzen in der Therapie des KRK Prof. V. Heinemann Neue Substanzen in der Therapie des KRK Prof. V. Heinemann Medizinische Klinik und Poliklinik III, Klinikum Großhadern Ludwig-Maximilians Universität München Extrazellulär Neue Targets in der Krebstherapie


Grundlegende Methoden der Molekularen Biologie, AD I. Prof. Dr. Albert Duschl

Grundlegende Methoden der Molekularen Biologie, AD I. Prof. Dr. Albert Duschl Grundlegende Methoden der Molekularen Biologie, AD I Prof. Dr. Albert Duschl Molekulare Mechanismen Themen für die erste Vorlesung: Signalwege, am Beispiel von Jak/STAT Immunpräzipitation, Immunfluoreszenz


Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden

Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden Stammzellenmanipulation Hämatopoietische Stammzellen können gebraucht werden um kranke Zellen mit gesunden zu ersetzen (siehe experiment bestrahlte Maus) Epidermale Stammzellpopulationen können in Kultur


Windkraftanlagen können gefährlich für die menschliche Gesundheit sein

Windkraftanlagen können gefährlich für die menschliche Gesundheit sein Windkraftanlagen können gefährlich für die menschliche Gesundheit sein Alec N. Salt, Ph.D., Cochlear Flüssigkeiten Research Laboratory, Washington University in St. Louis. Große Windkraftanlagen erzeugen


3 2 1 meins! Das dritte Brustkrebsgen Oder: Ein folgenreicher Paradigmenwechsel

3 2 1 meins! Das dritte Brustkrebsgen Oder: Ein folgenreicher Paradigmenwechsel 3 2 1meins! DasdritteBrustkrebsgen Oder:EinfolgenreicherParadigmenwechsel Prof.Dr.AlfonsMeindl FrauenklinikamKlinikumrechtsderIsar Abt.GynäkologischeTumorgenetik E mail:alfons.meindl@lrz.tum.de Phone:0049


Informationssystem über Wirkungen elektromagnetischer Felder auf den Menschen (EMFIS) - Wissensbasierte Literaturdatenbank -

Informationssystem über Wirkungen elektromagnetischer Felder auf den Menschen (EMFIS) - Wissensbasierte Literaturdatenbank - Informationssystem über Wirkungen elektromagnetischer Felder auf den Menschen (EMFIS) - Wissensbasierte Literaturdatenbank - Silny J. Forschungszentrum für Elektro-Magnetische Umweltverträglichkeit (femu),universitätsklinikum,


Um eine notwendige Strahlentherapie

Um eine notwendige Strahlentherapie Ursachen individueller Strahlenempfindlichkeit: DNA-Reparatur und andere zelluläre Antworten auf Bestrahlung Causes of individual radio sensitivity: DNA repair and other cellular responses to radiation
