Neuroplastische Veränderungen nach einseitiger Ertaubung und deren Beeinflussung durch CI-Versorgung

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Neuroplastische Veränderungen nach einseitiger Ertaubung und deren Beeinflussung durch CI-Versorgung"

Transkript

1 Neuroplastische Veränderungen nach einseitiger Ertaubung und deren Beeinflussung durch CI-Versorgung Tobias Kleinjung ORL Klinik UniversitätsSpital Zürich

2 Begriffe Neuroplastizität neuronale Plastizität: Unter neuronaler Plastizität versteht man die Eigenschaft von Synapsen, Nervenzellen oder auch ganzen Hirnarealen, sich in Abhängigkeit von der Verwendung in ihren Eigenschaften zu verändern (anzupassen). Abhängig vom betrachteten System spricht man von synaptischer Plastizität oder kortikaler Plastizität. CI-Forum

3 Begriffe Synaptische Plastizität ist ein Begriff, der die aktivitätsabhängige Änderung der Stärke der synaptischen Übertragung beschreibt. Diese Änderungen können sowohl durch Änderungen der Morphologie als auch der Physiologie der Synapse verursacht werden Kortikale Plastizität ist ein Begriff, der die aktivitätsabhängige Änderung der Größe, Konnektivität oder Aktivierungsmuster von kortikalen Netzwerken beschreibt. CI-Forum

4 Definition der einseitigen Ertaubung (Profound) Unilateral hearing loss (UHL) or single-sided deafness (SSD) is a type of hearing impairment where there is normal hearing in one ear and impaired hearing in the other ear. Random Deafness Having Profound Unilateral Hearing Loss is very much like living in both worlds - the world of hearing people and of profoundly deaf people Kongenitale, einseitige Ertaubung Postlingual erworbene, einseitige Ertaubung CI-Forum

5 Epidemiologie der einseitig erworbenen, postlingualen Ertaubung USA: neue Fälle / Jahr (Alexander & Harris, 2013) UK: neue Fälle / Jahr (Baguley et al., 2006) Ca. 200 neue Fälle / 1 Million Ca neue Fälle / Jahr in der Schweiz CI-Forum

6 Ätiologie der einseitig erworbenen, postlingualen Ertaubung Idiopathischer Hörsturz (engl: sudden sensorineural hearing loss / sudden deafness) Morbus Menière Vestibularisschwannom / Meningeom Labyrinthitis: tympanogen (im Rahmen einer akuten Otitis media, viral oder bakteriell), hämatogen (Masern, Mumps, Borreliose) Meningitis Chronische Otitis media (ausgedehntes Cholesteatom) Traumatische Innenohrschädigung: Laterale Schädelbasisfraktur Hereditäre Schwerhörigkeit Autoimmunerkrankungen CI-Forum

7 Graue und weisse Substanz CI-Forum

8 Die Hörbahn Sinneszellen Ganglion Spirale Nucleus Cochlearis Colliculi Inferiores Corpus Geniculatum Mediale Primärer auditorischer Kortex CI-Forum

9 Architektonische Organisation des auditorischen Kortex Strukturelle Hemisphärenasymmetrie im auditorischen System CI-Forum

10 Neurophysiologische Erkenntnisse Spezialisierung der Hemisphären, Auditorische Asymmetrie Linke Hemisphäre Sprachverständnis: Wernicke-Areal - Läsion: sensorische Aphasie Sprachbildung: Broca-Areal - Läsion: motorische Aphasie Normale Hörsituation Rechte Hemisphäre Musikwahrnehmung Richtungshören: - Räumliche Information von der rechten Seite beide Hemisphären - Räumliche Information von der linken Seite rechte Hemisphäre Kontralaterale Dominanz als Konsequenz der kortikalen Repräsentation im kontralateralen akustischen Hemifeld (Kral et al., 2013) CI-Forum

11 Auditorische Neuroplastizität Musiker mit absolutem Gehör Nicht-Musiker Taub Hörend Schaug et al. (1995), Science Emmorey et al. (2003), PNAS Positive auditorische Neuroplastizität: Verbesserung der Sprachwahrnehmung nach CI Negative auditorische Neuroplastizität: Tinnitus CI-Forum

12 SSD Neuroimaging CI-Forum

13 Zatorre et al., 2008 CI-Forum

14 Neurophysiologische Erkenntnisse Corticale Reorganisation bei einseitiger Ertaubung Hauptsächliche Veränderungen auf der Hirn-Seite des gesunden Ohres. Dies gilt vor allem bei linksseitiger Ertaubung, d.h. grössere Veränderungen im Bereich des rechten auditorischen Feldes (Burton et al., 2012). Bei einseitig Ertaubten ist nach Stimulation des gesunden Ohres insgesamt die Aktivität des rechten und linken auditorischen Cortex symmetrischer, dies wahrscheinlich aufgrund erhöhter Aktivität zwischen den beiden Hemisphären (Ponton et al., 2001). Sehr limitiertes Wissen über die Lateralität der Ertaubung in Bezug auf die auditorische Spezialisation der Hemisphären und deren Verbindung über das Corpus Callosum, den Balken (Khosla et al., 2003). CI-Forum

15 Vorstellung und erste Ergebnisse der Multicenter- Studie «Untersuchung zur hemisphärenspezifischen Dominanz einer einseitig erworbenen, postlingualen Ertaubung und Veränderungen / Plastizität durch die Behandlung mit einem Cochlea Implantat»

16 Offene Fragen bezüglich CI und einseitiger Ertaubung (1) Welche Auswirkungen hat die Lateralität der Ertaubung (rechts oder links) auf die zentral neuronale Reorganisation von akustischen Signalen der noch hörenden Gegenseite? (2) Können durch ein Cochlea-Implantat die durch eine einseitige Taubheit verursachten zentralen Veränderungen reversibel gemacht werden (neurale Plastizität)? (3) Profitieren mehr die rechts- oder mehr die linksseitig Ertaubten von einem CI? (4) Was ist das beste Zeitpunkt für eine Implantation eines CI s bei einseitiger Ertaubung? (5) Wie lange dauert die Anpassungsphase des CI s? CI-Forum

17 Einzelheiten zur Studie Studiendesign Multicenter (Bern, Konstanz, Zürich) Prospektiv Offen, nicht randomisiert 5 linksseitig ertaubte Personen 5 rechtsseitig ertaubte Personen 10 Personen ohne Hörbeeinträchtigung CI-Forum

18 Einzelheiten zur Studie Einschluss-Kriterien Einseitige Ertaubung aufgrund eines cochleären Schadens Reguläre Struktur der Cochlea und des N. cochlearis (Bestätigung mittels MRI) Kontralaterales Gehör: Normale Hörfunktion, reguläre Mittelohrfunktion Alter: Jahre Zeitpunkt der Ertaubung: 6 Monate bis 10 Jahre vor Studieneinschluss Fliessende Deutschkenntnisse Beeinträchtigung im täglichen Leben aufgrund der einseitigen Taubheit (eingeschränkte Kommunikation, störender Tinnitus) Erfolgloser Versuch einer Behandlung mittels CROS oder BAHA CI-Forum

19 Einzelheiten zur Studie Ausschluss-Kriterien Unklarheit über die korrekte Diagnose der einseitigen Ertaubung Retrocochleäre Ursache der einseitigen Ertaubung Cochleäre Ossifikation, welche die Elektroden-Einlage verhindert Aktive Mittelohrentzündung Perforation des Trommelfells Metallische Implantate stellen eine Kontraindikation für eine MRI und MEG- Untersuchung des Gehirns dar Strahlenexposition mit einer kumulativen Dosis von 5mSV in den letzten 5 Jahren Schwangerschaft und Stillzeit Psychiatrische Komorbiditäten wie Depression oder kognitive Defizite Erhöhtes Risiko für eine Vollnarkose aufgrund kardiovaskulärer Komorbidität Schwere gleichzeitig bestehende Krankheit mit einem mittleren Überleben von weniger als 5 Jahren CI-Forum

20 Einzelheiten zur Studie Studien-Plan Study Phase Type of Investigation Location Pre-operative (Visits 1-4) Audiometry Zürich/Bern Audiometry (Sound Localization) PET EEG/MEG Bern Zürich Konstanz/D Surgery Cochlea Implant Zürich or Bern Fitting Procedure (Visits 5-10) Fitting of Speech Processor Programming of Speech Processor Data logging First visits in Zürich, the following in Zürich or Bern 3 Months follow-up (Visits 11-12) Audiometry Zürich/Bern EEG Konstanz/D 6 Months follow-up (Visits 13-14) Audiometry/Questionnaires Zürich/Bern EEG Konstanz/D 9 Months follow-up (Visit 15) PET Zürich 12 Months follow-up (Visits 16-18) Audiometry/Questionnaires Zürich/Bern Audiometry (Sound Localization) EEG Bern Konstanz/D CI-Forum

21 Aktueller Stand der Studie Einschluss von 5 Studienpatienten - CI-Implantation bei 5 Studienpatienten (Ertaubung: 3x rechts und 2x links) Subjektive Beurteilung: Vorteil für die Rechts-Ertaubten? Erste postoperative Kontrolle mittels PET bei 2 Kandidaten erfolgt 4 potentielle und interessierte Kandidaten im Screening Nach Einschluss aller Implant-Kandidaten Auswahl der hörgesunden Kontrollen CI-Forum

22 Erste Resultate der Studie (praeop) Funktionelle PET-CT: SPM output auf einem Standard T1 MRI Stimulus links bei Ertaubung rechts Stimulus links gesunde Testperson CI-Forum

23 Erste Resultate der Studie (praeop) EEG bei zweidimensional verzerrten Wörtern : Peak bei 275ms Stimulus links bei Ertaubung rechts Stimulus links gesunde Testperson Electric Potential (uv) CI-Forum

24 PET praeop (Stimulus links, rechts ertaubt) PET postop (Stimulus links, rechts CI) CI-Forum

25 Zusammenfassung Einseitige Ertaubung stellt ein relativ häufiges Ereignis dar (1/1000 kongenital, 0.2/1000 postlingual erworben). Einschränkung der Hörfunktion teils erheblich (Richtungsgehör, Hören im Störgeräusch, Tinnitus, etc.). Erste klinische Eindrücke deuten auf einen grösseren Benefit der CI-Implantation bei rechtsseitiger Ertaubung hin. CI- Implantation bei einseitiger Taubheit wird gut akzeptiert. CI-Forum

26 Herzlichen Dank für die Aufmerksamkeit CI-Forum

Mit zwei Ohren hört man besser: Behandlung einer einseitigen Taubheit mit einem Cochlea-Implantat

Mit zwei Ohren hört man besser: Behandlung einer einseitigen Taubheit mit einem Cochlea-Implantat Mit zwei Ohren hört man besser: Behandlung einer einseitigen Taubheit mit einem Cochlea-Implantat Stefanie Günther, Thomas Wesarg, Antje Aschendorff, Roland Laszig, Susan Arndt HNO-Klinik, Universitätsklinikum

Mehr

Implantierbare Hörsysteme. Dr. med. M. Gärtner Leitender Arzt HNO Klinik Luzern

Implantierbare Hörsysteme. Dr. med. M. Gärtner Leitender Arzt HNO Klinik Luzern Implantierbare Hörsysteme Dr. med. M. Gärtner Leitender Arzt HNO Klinik Luzern Implantierbare Hörsysteme Ponto Cochlea-Implantat Implantierbare Hörsysteme Wann werden sie eingesetzt? Implantierbare Hörsysteme

Mehr

Die vielen Möglichkeiten der Versorgung bei einseitiger Taubheit

Die vielen Möglichkeiten der Versorgung bei einseitiger Taubheit Die vielen Möglichkeiten der Versorgung bei einseitiger Taubheit Prof. Dr. Dr. M. Kompis Leitender Arzt Audiologie Universitäts-HNO Klinik, Inselspital, Bern Vorteile von 2 Ohren gegenüber nur 1 Ohr Besseres

Mehr

2 Theorie Gehörlosigkeit

2 Theorie Gehörlosigkeit Theorie 3 2 Theorie Gehörlosigkeit 2.1 Definition und Abgrenzung des Begriffes Gehörlosigkeit Der Begriff Gehörlosigkeit wird in der Literatur von verschiedenen Standpunkten aus unterschiedlich definiert.

Mehr

Hören mit High-Tech. HNO-Klinik der Medizinischen Hochschule Hannover Hörzentrum Hannover. Direktor: Prof. Dr. Th. Lenarz

Hören mit High-Tech. HNO-Klinik der Medizinischen Hochschule Hannover Hörzentrum Hannover. Direktor: Prof. Dr. Th. Lenarz Hören mit High-Tech HNO-Klinik der Medizinischen Hochschule Hannover Hörzentrum Hannover Direktor: Prof. Dr. Th. Lenarz Mitarbeiter im Ideenpark: Prof. Dr. med. A. Lesinski-Schiedat, Dr. A. Büchner, S.

Mehr

Das Cochlea-Implantat Basisinformation zum CI

Das Cochlea-Implantat Basisinformation zum CI 20 CI IG Schweiz Impressum CI Interessengemeinschaft Schweiz Herausgeber: CI IG Schweiz, CI Interessengemeinschaft Schweiz Das Cochlea-Implantat Basisinformation zum CI Lektorat: PD Dr. med. Thomas Linder,

Mehr

Neuromodulation und Tinnitus

Neuromodulation und Tinnitus Symposium und Nachsorgetreffen Bad Arolsen 21. September 2013 Neuromodulation und Tinnitus Gerhard Hesse, Bad Arolsen Chronischer Tinnitus Auf der Suche nach dem verlorenen Schalter Die Hörbahn vom Innenohr

Mehr

Sprachentwicklung bei CI-Kindern

Sprachentwicklung bei CI-Kindern Sprachentwicklung bei CI-Kindern Annerose Keilmann, Mainz 1 Sprachentwicklung bei Kindern mit CI manche CI-Kinder entwickeln Sprache ebenso gut wie normalhörige Kinder Sprachentwicklung verläuft sehr unterschiedlich

Mehr

Entdeckungen unter der Schädeldecke. Jean-Marc Fritschy Institut für Pharmakologie und Toxikologie

Entdeckungen unter der Schädeldecke. Jean-Marc Fritschy Institut für Pharmakologie und Toxikologie Entdeckungen unter der Schädeldecke Jean-Marc Fritschy Institut für Pharmakologie und Toxikologie Inhalt 1. GFP, das Wunderprotein 2. Die Nervenzellen bei der Arbeit beobachten 3. Nervenzellen mit Licht

Mehr

Cochlea Implant oder/und Hörgerät - Indikationen und Entwicklungen

Cochlea Implant oder/und Hörgerät - Indikationen und Entwicklungen Stimmheilzentrum Bad Rappenau Cochlea Implant oder/und Hörgerät - Indikationen und Entwicklungen Annerose Keilmann Stimmheilzentrum Bad Rappenau Tagung des BDH auf der Burg Feuerstein vom 26. - 29.9.2016

Mehr

Biologische Psychologie II Peter Walla

Biologische Psychologie II Peter Walla Kapitel 16 Lateralisierung, Sprache und das geteilte Gehirn Das linke und das rechte Gehirn: Das menschliche Gehirn besteht aus 2 cerebralen Hemisphären, die voneinander getrennt sind, abgesehen von den

Mehr

PD Dr. Christof Stieger Leiter Audiologie/CI 9. November 2015

PD Dr. Christof Stieger Leiter Audiologie/CI 9. November 2015 Powerversorgung - wie viel geht noch? PD Dr. Christof Stieger Leiter Audiologie/CI 9. November 2015 Wann «lohnt» es sich den Kunden an eine CI-Klinik zu überweisen? Makroskopische Sicht Mikroskopische

Mehr

Anwendung. Transkranielle Gleichstromstimulation. von neuroconn

Anwendung. Transkranielle Gleichstromstimulation. von neuroconn Anwendung Transkranielle Gleichstromstimulation von neuroconn Fragen, Anregungen, Bestellungen Mo-Do: 8.00-17.00 Uhr, Fr: 8.00-16.00 Uhr Tel.: +49 391 6107 650 Mail: info@hasomed.de Web: www.hasomed.de

Mehr

One Brain or Two? ReferentInnen: Miriam Balt, Johanna Ruge, Moritz Matejka. Die Split-Brain-Problematik

One Brain or Two? ReferentInnen: Miriam Balt, Johanna Ruge, Moritz Matejka. Die Split-Brain-Problematik One Brain or Two? ReferentInnen: Miriam Balt, Johanna Ruge, Moritz Matejka Die Split-Brain-Problematik Gliederung Teil I Das Corpus Callosum Was ist ein Split-brain? Die Gazzaniga Testreihe Ergebnisse

Mehr

Wie Tier und Mensch das Hören lernten... 1 Trommelfell an Schläfen und Knien... 2 Navigation mit Ultraschall... 2

Wie Tier und Mensch das Hören lernten... 1 Trommelfell an Schläfen und Knien... 2 Navigation mit Ultraschall... 2 1 Was man so alles hört... 1 Wie Tier und Mensch das Hören lernten... 1 Trommelfell an Schläfen und Knien........................... 2 Navigation mit Ultraschall... 2 Was ist Schall?... 3 Schall in Wasser

Mehr

Bilder des Gehirns Bilder der Psyche

Bilder des Gehirns Bilder der Psyche Bilder des Gehirns Bilder der Psyche Prof. Stefan Borgwardt Universitäre Psychiatrische Kliniken Basel (UPK) Die Hirnforschung sucht tatsächlich ohne Rücksicht auf die Klinik und ohne je von der Psychopathologie

Mehr

Das Cochlea-Implantat in Zürich. Information zur Versorgung mit dem Cochlea-Implantat (CI) am CI-Zentrum Zürich

Das Cochlea-Implantat in Zürich. Information zur Versorgung mit dem Cochlea-Implantat (CI) am CI-Zentrum Zürich Das Cochlea-Implantat in Zürich Information zur Versorgung mit dem Cochlea-Implantat (CI) am CI-Zentrum Zürich Liebe Patientin, lieber Patient, liebe Eltern und Angehörige Es gibt Hörstörungen, die so

Mehr

Indikation zu Cochlea-Implantaten und implantierbaren Hörgeräten

Indikation zu Cochlea-Implantaten und implantierbaren Hörgeräten Indikation zu Cochlea-Implantaten und implantierbaren Hörgeräten D. Koutsimpelas Hals-, Nasen-, Ohrenklinik und Poliklinik Direktor: Prof. Dr. Dr. h.c. mult. W. Mann 2 Indikationen CI 1984 1990 1998 Heute

Mehr

Sprachen im Gehirn. Marco Monachino. Christina Backes

Sprachen im Gehirn. Marco Monachino. Christina Backes Sprachen im Gehirn Marco Monachino Christina Backes Überblick Allgemeines und Aufbau Sprachzentren Neurolinguistische Verarbeitung Methoden der Neurolinguistik 2 Allgemeines Das Gehirn wiegt bei einem

Mehr

Die Schwerhörigkeit im Alter. Martin Burian KH der Barmherzigen Schwestern Linz Abteilung für Hals Nasen Ohrenheilkunde

Die Schwerhörigkeit im Alter. Martin Burian KH der Barmherzigen Schwestern Linz Abteilung für Hals Nasen Ohrenheilkunde Die Schwerhörigkeit im Alter Martin Burian KH der Barmherzigen Schwestern Linz Abteilung für Hals Nasen Ohrenheilkunde Definition: Presbyakusis ( Altersschwerhörigkeit, englisch presbycusis, auch presbyacusis)

Mehr

Akustische CR Neuromodulation Neue Wege in der Tinnitus-Therapie

Akustische CR Neuromodulation Neue Wege in der Tinnitus-Therapie Akustische CR Neuromodulation Neue Wege in der Tinnitus-Therapie Einfach nur Ruhe finden. Neue Wege in der Tinnitus-Therapie Nach neuen wissenschaftlichen Erkenntnissen wird das unangenehme Geräusch im

Mehr

Vorlesung: Kognitive Neuropsychologie

Vorlesung: Kognitive Neuropsychologie Vorlesung: Kognitive Neuropsychologie Do: 10-12; Geb. A1-3 HS http://www.neuro.psychologie.unisaarland.de/downloads.html 1 24.04. Geschichte der kognitiven Neurowissenschaft (1) 2 8.05. Funktionelle Neuroanatomie

Mehr

Der Musikverstand. Der Mozart-Effekt

Der Musikverstand. Der Mozart-Effekt Studienseminar Koblenz Der Musikverstand Der Mozart-Effekt Die Lösungsrate bei Aufgaben eines Intelligenztests, der eine räumliche Vorstellung erfordert liegt nach Anhören einer Mozartsonate um 8 Punkte

Mehr

mental moving integra Stefan Eidenschink

mental moving integra Stefan Eidenschink integra 2014 mental moving mental moving! Die Idee! Das Prinzip! Inhalte! Hintergründe zu Methodik und Didaktik mental moving! Die Idee Ein Konzept für Übungen zum Training von sensomotorischen Fähigkeiten

Mehr

Hörgeräte nicht mehr helfen...

Hörgeräte nicht mehr helfen... Cochlea-Implantate Wenn Hörgeräte nicht mehr helfen... Schon heute hören etwa 25 000 bis 30 000 Bundesbürger mit einem Cochlea-Implantat. Erwartet wird, dass diese Zahl in den kommenden Jahren noch erheblich

Mehr

Inhaltsverzeichnis. Bibliografische Informationen http://d-nb.info/992492254. digitalisiert durch

Inhaltsverzeichnis. Bibliografische Informationen http://d-nb.info/992492254. digitalisiert durch Inhaltsverzeichnis 1 Einleitung 1.1 Die transkranielle Magnetstimulation (TMS) - allgemeine Einführung 1.1.1 Die TMS - technisches Prinzip 17-18 1.1.2 Einsatz der TMS in der neuro-psychiatrischen Forschung

Mehr

Indikationskriterien für implantierbare Hörgeräte

Indikationskriterien für implantierbare Hörgeräte Indikationskriterien für implantierbare Hörgeräte Eine vereinfachte Übersicht für praktizierende ORL-Kollegen von Thomas Linder, Marcel Gärtner und Peter Oppermann, Stand 2010 1. BAHA (Bone Anchored Hearing

Mehr

Der Weg ins Innenohr Schalltrichter

Der Weg ins Innenohr Schalltrichter Der Weg ins Innenohr Schalltrichter 1 Quelle: Schmidt + Thews (1997) Physiologie des Menschen. Springer Verlag Mittelohr Trommelfell: Luft festere Körper Hammer, Amboss, Steigbügel: Schallleitung;

Mehr

INFORMATIONSBLATT FÜR TEILNEHMER UND INTERESSENTEN

INFORMATIONSBLATT FÜR TEILNEHMER UND INTERESSENTEN Neurologische Klinik mit Klinischer Neurophysiologie Direktor: Prof. Dr. med. R. Dengler Prof. P. Sandmann Telefon: (0511) 532-7293 Fax: (0511) 532-3115 INFORMATIONSBLATT FÜR TEILNEHMER UND INTERESSENTEN

Mehr

Hörstörungen im Kindesalter und deren Einfluss auf die Entwicklung HT DER FOLIENTITEL

Hörstörungen im Kindesalter und deren Einfluss auf die Entwicklung HT DER FOLIENTITEL HI Hörstörungen im Kindesalter und deren Einfluss auf die Entwicklung HT DER FOLIENTITEL angeborene Hörstörungen etwa 2 von 1000 Neugeborenen kommen schwerhörig oder gehörlos zur Welt viele Kinder sind

Mehr

Basisinformationen. Cochlea- Implantat

Basisinformationen. Cochlea- Implantat Basisinformationen Cochlea- Implantat 02 Basisinformationen Cochlea-Implantat Inhaltsverzeichnis Das Cochlea-Implantat 04 Für wen ist ein Cochlea-Implantat geeignet? 06 Voraussetzungen für eine Implantation

Mehr

Tinnitus aus HNO-ärztlicher Sicht. Antje Welge-Lüssen HNO Klinik, Universitätsspital Basel

Tinnitus aus HNO-ärztlicher Sicht. Antje Welge-Lüssen HNO Klinik, Universitätsspital Basel Tinnitus aus HNO-ärztlicher Sicht Antje Welge-Lüssen HNO Klinik, Universitätsspital Basel Tinnitus 95 98% hören nach 20 Minuten «ein Geräusch» Tinnitus = normal? Tinnitus Sicht des Bundesgerichtes 8C_498/2011

Mehr

Sitzung 3: Das handelnde Gehirn

Sitzung 3: Das handelnde Gehirn Sitzung 3: Das handelnde Gehirn 2./3.11. 2015 Irgendwelche Fragen?? 1 Ziele der heutigen Sitzung 1. Wiederholung Methoden 2. Wie trägt der Frontalkortex zu Handlungen bei? 3. Was macht uns zu (bewußten)

Mehr

Das Cochlea-Implantat in Zürich

Das Cochlea-Implantat in Zürich Das Cochlea-Implantat in Zürich Information zur Versorgung mit dem Cochlea-Implantat (CI) am CI-Zentrum Zürich Klinik für Ohren-, Nasen-, Hals- und Gesichtschirurgie UniversitätsSpital Zürich www.ci-zentrum.com

Mehr

Logopädische Differentialdiagnostik bei Auditiven Verarbeitungs- und Wahrnehmungsstörungen Dr. phil. P. Sandrieser Abteilung Logopädie Katholisches Klinikum Koblenz Einführung Auditive Verarbeitungs- und

Mehr

II. Forum Gesundheitswirtschaft Münsterland

II. Forum Gesundheitswirtschaft Münsterland II. Forum Gesundheitswirtschaft Münsterland 17.02.2009 Hörscreening Antoinette am Zehnhoff-Dinnesen Peter Matulat Claus-Michael Schmidt Klinik und Poliklinik für II. Forum Gesundheitswirtschaft Münsterland

Mehr

Phonak CROS II Die intelligente Lösung bei einseitiger Taubheit

Phonak CROS II Die intelligente Lösung bei einseitiger Taubheit Phonak CROS II Die intelligente Lösung bei einseitiger Taubheit Einseitige Taubheit - was ist das? Einseitige Taubheit (Single Sided Deafness, SSD), auch einseitiger oder asymmetrischer Hörverlust genannt,

Mehr

Biologische Psychologie II Peter Walla

Biologische Psychologie II Peter Walla Bei der vorher erwähnten Untersuchung (Apfel und Löffel!) durfte ein visueller Reiz nur für 0.1s gezeigt werden, da durch auftretende Augenbewegungen sonst nicht mehr davon auszugehen ist, dass der entsprechende

Mehr

6 höhere Funktionen der Wahrnehmung - Teil 2. Referent: Philipp Schneider

6 höhere Funktionen der Wahrnehmung - Teil 2. Referent: Philipp Schneider 6 höhere Funktionen der Wahrnehmung - Teil 2 Referent: Philipp Schneider Überblick Agnosien Warringtons zweistufiges Objekterkennungsmodell Prosopagnosie Unterschiede zwischen Gesichts- und Objekterkennung

Mehr

Cochlear Patientenhörreise. Feuersteintagung 2014 Maik Gerlach

Cochlear Patientenhörreise. Feuersteintagung 2014 Maik Gerlach Cochlear Patientenhörreise Feuersteintagung 2014 Maik Gerlach Australisches Unternehmen mit Sitz in Sydney 1982 gegründet In mehr als 100 Ländern weltweit vertreten Über 2500 Mitarbeiter weltweit Mehr

Mehr

Die Entwicklung der Gefühle: Aspekte aus der Hirnforschung. Andreas Lüthi, Friedrich Miescher Institut, Basel

Die Entwicklung der Gefühle: Aspekte aus der Hirnforschung. Andreas Lüthi, Friedrich Miescher Institut, Basel Die Entwicklung der Gefühle: Aspekte aus der Hirnforschung Andreas Lüthi, Friedrich Miescher Institut, Basel Wie lernen wir Angst zu haben? Wie kann das Gehirn die Angst wieder loswerden? Angst und Entwicklung

Mehr

9/9/2013. Hirnfunktionelle und Hirnstrukturelle Befunde zu Sprachentwicklung und Sprachentwicklungsstörungen. Jens Brauer. Hinweis

9/9/2013. Hirnfunktionelle und Hirnstrukturelle Befunde zu Sprachentwicklung und Sprachentwicklungsstörungen. Jens Brauer. Hinweis Hirnfunktionelle und Hirnstrukturelle Befunde zu Sprachentwicklung und Sprachentwicklungsstörungen Hinweis Diejenigen Teile des Vortrags, die noch unveröffentlichte Daten und Ergebnisse enthalten, sind

Mehr

Neuronale Kodierung. Jutta Kretzberg. Lehrprobe Oldenburg,

Neuronale Kodierung. Jutta Kretzberg. Lehrprobe Oldenburg, Neuronale Kodierung Jutta Kretzberg Lehrprobe Oldenburg, 2.10.2008 http://www.uni-oldenburg.de/sinnesphysiologie/download/lehrprobe.pdf Vorlesung zum Master-Modul Neurobiologie Neuroanatomie Neurophysiologie

Mehr

Kinder mit geringgradiger Schwerhörigkeit

Kinder mit geringgradiger Schwerhörigkeit Kinder mit geringgradiger Schwerhö Erfahrungen in der Diagnostik, Beratung und prothetischen Versorgung Doris Nekahm- Heis, Kurt Stephan Univ.-Klinik für Hör-, Stimm- und Sprachstörungen Univ.-Klinik Medizinische

Mehr

Kraft und funktionelle Leistung im Alter

Kraft und funktionelle Leistung im Alter Kraft und funktionelle Leistung im Alter Heicumed Ausbildungscurriculum der medizinischen Fakultät der Universität Heidelberg Dr. Klaus Hauer Bethanien-Krankenhaus am Klinikum der Universität Heidelberg

Mehr

Transkranielle Magnetstimulation: Hokuspokus oder Therapie der Zukunft?

Transkranielle Magnetstimulation: Hokuspokus oder Therapie der Zukunft? Transkranielle Magnetstimulation: Hokuspokus oder Therapie der Zukunft? Thomas Kammer Psychiatrische Universitätsklinik Ulm d'arsonval 1896 1 1985: moderne TMS Motorkortex: Muskelzuckung Visueller Kortex:

Mehr

Neurolinguistische Grundlagen der Gebärdensprache

Neurolinguistische Grundlagen der Gebärdensprache 25.Internationale Fachtagung für Psychologinnen und Psychologen an Einrichtungen für Hör-und Sprachgeschädigte RWTH Aachen, 7.-9. Oktober 2009 Neurolinguistische Grundlagen der Gebärdensprache Walter Huber,

Mehr

Frequenz Einheit Hörbereich größte Empfindlichkeit Unterschiedsschwelle. Schalldruck. Einheit. Unterschiedsschwelle

Frequenz Einheit Hörbereich größte Empfindlichkeit Unterschiedsschwelle. Schalldruck. Einheit. Unterschiedsschwelle Frequenz Einheit Hörbereich größte Empfindlichkeit Unterschiedsschwelle Schalldruck Einheit Unterschiedsschwelle Abkürzungen db SPL OAE TEOAE SOAE DPOAE BERA CERA ITD ILD Schalldruckpegel Einheit Berechnung

Mehr

Anamnese. Keine Voroperationen PA bland

Anamnese. Keine Voroperationen PA bland Fall 1 Anamnese 40 Jähriger Patient Kosovoalbaner, seit 15 Jahren in der Schweiz Berichtet über chronisch rezidivierende Schmerzen, intermittierende, teils fötide Otorrhoe und leichte Hörminderung links

Mehr

ETH Science City MRI Bilder aus dem Innern des Menschen

ETH Science City MRI Bilder aus dem Innern des Menschen MRI Bilder aus dem Innern des Menschen Prof. Peter Bösiger Institut für Biomedizinische Technik, UZH/ETH Zürich; Center for Image Science and Technology, ETH/UZH Zürich Magnetresonanz-Bildgebung MRI Magnetresonanz-Bildgebung

Mehr

Schizophrenie. Gliederung. Neuronale Dysfunktion & Gewalt

Schizophrenie. Gliederung. Neuronale Dysfunktion & Gewalt Schizophrenie Neuronale Dysfunktion & Gewalt Seminar: Forensische Neuropsychologie Dozent: Dr. B. Schiffer Referentin: Christine Heinemann SS09 Gliederung Einführung Methode Ergebnisse Fazit 23. Mai 2009

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

48. Fortbildungsveranstaltung für Hals-Nasen- Ohrenärzte

48. Fortbildungsveranstaltung für Hals-Nasen- Ohrenärzte Cochlea-Implantate: Aktuelle Aspekte, Indikationen und Operationstechniken von Prof. Dr. med. Timo Stöver Autor: Prof. Dr. med. Timo Stöver, Klinik für Hals-, Nasen-, Ohrenheilkunde, Universitätsklinikum

Mehr

1 Implantat-Akupunktur Einführung Die klassische Ohrakupunktur Die Suche nach Langzeitstimulation Implantat-Akupunktur 6

1 Implantat-Akupunktur Einführung Die klassische Ohrakupunktur Die Suche nach Langzeitstimulation Implantat-Akupunktur 6 Inhalt 1 Implantat-Akupunktur 2 1.1 Einführung 2 1.2 Die klassische Ohrakupunktur 4 1.3 Die Suche nach Langzeitstimulation 5 1.4 Implantat-Akupunktur 6 2 Die Implantate 10 2.1 Titan-Implantate 10 2.2 Resorbierbare

Mehr

Knochenverankerte Hörgeräte

Knochenverankerte Hörgeräte Manche Schwerhörigen können keine Hörgeräte tragen, zum Beispiel weil ihre Gehörgänge chronisch entzündet sind oder weil der äußere Gehörgang durch eine angeborene Fehlbildung verschlossen ist. Auch Folgeerscheinungen

Mehr

Allgemeine Psychologie: Sinnesphysiologie. Sommersemester 2008. Thomas Schmidt

Allgemeine Psychologie: Sinnesphysiologie. Sommersemester 2008. Thomas Schmidt Allgemeine Psychologie: Sinnesphysiologie Sommersemester 2008 Thomas Schmidt Folien: http://www.allpsych.uni-giessen.de/thomas Literatur Rosenzweig et al. (2005), Ch. 8-10 Sinnesphysiologie Prinzipien

Mehr

Schwerhörigkeit und Hörgeräte

Schwerhörigkeit und Hörgeräte Karl-Friedrich Hamann Katrin Hamann Schwerhörigkeit und Hörgeräte 125 Fragen und Antworten 2., aktualisierte und ergänzte Auflage W. Zuckschwerdt Verlag IV Bildnachweis Titelbild: Bilder im Innenteil:

Mehr

Der Schlaganfall wenn jede Minute zählt. Andreas Kampfl Abteilung Neurologie und Stroke Unit Krankenhaus der Barmherzigen Schwestern Ried im Innkreis

Der Schlaganfall wenn jede Minute zählt. Andreas Kampfl Abteilung Neurologie und Stroke Unit Krankenhaus der Barmherzigen Schwestern Ried im Innkreis Der Schlaganfall wenn jede Minute zählt Andreas Kampfl Abteilung Neurologie und Stroke Unit Krankenhaus der Barmherzigen Schwestern Ried im Innkreis Aufgaben des Großhirns Bewegung Sensibilität Sprachproduktion

Mehr

Richtlinien für Cochlea-Impantat-Versorgung und Nachbetreuung

Richtlinien für Cochlea-Impantat-Versorgung und Nachbetreuung Richtlinien für Cochlea-Impantat-Versorgung und Nachbetreuung Ausgearbeitet von der Konferenz der Cochlea-Implantat Kliniken der Schweiz CICH Zuhanden der Audiologischen Kommission der ORL-Gesellschaft

Mehr

Leichte kognitive Beeinträchtigung (mild cognitive impairment) und Differentialdiagnosen

Leichte kognitive Beeinträchtigung (mild cognitive impairment) und Differentialdiagnosen Leichte kognitive Beeinträchtigung (mild cognitive impairment) und Differentialdiagnosen Thomas Duning Andreas Johnen Klinik für Allgemeine Neurologie Department für Neurologie Westfälische Wilhelms-Universität

Mehr

Zentrales Nervensystem

Zentrales Nervensystem Zentrales Nervensystem Funktionelle Neuroanatomie (Struktur und Aufbau des Nervensystems) Neurophysiologie (Ruhe- und Aktionspotenial, synaptische Übertragung) Fakten und Zahlen (funktionelle Auswirkungen)

Mehr

Welche neuropsychologischen Störungsbilder sind nach Schädigungen des posterioren parietalen Cortex beobachtbar?

Welche neuropsychologischen Störungsbilder sind nach Schädigungen des posterioren parietalen Cortex beobachtbar? Welche neuropsychologischen Störungsbilder sind nach Schädigungen des posterioren parietalen Cortex beobachtbar? Was sind Spiegelneurone? Wo im Gehirn findet man sie? 1 23.04.08 Messmethodische Grundlagen

Mehr

Störungen des Hörvermögens: Entstehung, Ursachen, Auswirkungen

Störungen des Hörvermögens: Entstehung, Ursachen, Auswirkungen Spektrum Patholinguistik 7 (2014) 1 11 Störungen des Hörvermögens: Entstehung, Ursachen, Auswirkungen Gottfried Aust Cochlear Implant Centrum Berlin-Brandenburg Abstract Schwerhörigkeiten treten beim Menschen

Mehr

Cochlea-Implantat-Therapie bei ertaubten oder hochgradig schwerhörigen Erwachsenen und Kindern

Cochlea-Implantat-Therapie bei ertaubten oder hochgradig schwerhörigen Erwachsenen und Kindern Cochlea-Implantat-Therapie bei ertaubten oder hochgradig schwerhörigen Erwachsenen und Kindern Diese Informationsschrift soll Sie über die Möglichkeiten und den Ablauf einer Cochlear Implantation informieren.

Mehr

Netzwerke. Marcus Kaiser International University Bremen

Netzwerke. Marcus Kaiser International University Bremen Netzwerke Marcus Kaiser International University Bremen Netzwerke Network Science Einzelne Bausteine 2 Welche Netzwerke gibt es? 3 Woraus bestehen Netzwerke? Gerichtete Kante Knoten 42 Ungerichtete Kante

Mehr

Bielefeld Graphics & Geometry Group. Brain Machine Interfaces Reaching and Grasping by Primates

Bielefeld Graphics & Geometry Group. Brain Machine Interfaces Reaching and Grasping by Primates Reaching and Grasping by Primates + 1 Reaching and Grasping by Primates Inhalt Einführung Theoretischer Hintergrund Design Grundlagen Experiment Ausblick Diskussion 2 Reaching and Grasping by Primates

Mehr

Sehr geehrte Kolleginnen und Kollegen,

Sehr geehrte Kolleginnen und Kollegen, Klinik für Hals-Nasen-Ohrenheilkunde Sehr geehrte Kolleginnen und Kollegen, Hörstörungen zählen in unserem Fachgebiet zu den häufigsten Krankheitsbildern und sind angesichts der großen Zahl betroffener

Mehr

Kognitive Störungen. Olivia Geisseler, MSc. Neuropsychologin, Universitätsspital Zürich

Kognitive Störungen. Olivia Geisseler, MSc. Neuropsychologin, Universitätsspital Zürich Kognitive Störungen bei MS Patienten Olivia Geisseler, MSc. Neuropsychologin, Universitätsspital Zürich Übersicht MS MS ist die häufigste neurologische Erkrankung des frühen Erwachsenenalters 2.5 Millionen

Mehr

Frühe Versorgung mit Hörgeräten / Cochlea Implantaten - Eine interdisziplinäre Aufgabe -

Frühe Versorgung mit Hörgeräten / Cochlea Implantaten - Eine interdisziplinäre Aufgabe - Frühe Versorgung mit Hörgeräten / Cochlea Implantaten - Eine interdisziplinäre Aufgabe - A. Bohnert Klinik für HNO und Kommunikationsstörungen, Universitätsmedizin Mainz Direktor: Univ Prof. Dr. Ch. Matthias

Mehr

neuronale Plastizität

neuronale Plastizität Neuroanatomie Forschung: Unter neuronaler Plastizität versteht man die Fähigkeit des Gehirns, seine strukturelle und funktionelle Organisation veränderten Bedingungen anzupassen. Neuronale Plastizität

Mehr

Der Aufbau des Gehirns und die Fähigkeit zur Sprachrezeption und Sprachproduktion. Prof. Dr. Christoph Herrmann. Neuronale Korrelate der Sprache

Der Aufbau des Gehirns und die Fähigkeit zur Sprachrezeption und Sprachproduktion. Prof. Dr. Christoph Herrmann. Neuronale Korrelate der Sprache : Der Aufbau des Gehirns und die Fähigkeit zur Sprachrezeption und Sprachproduktion Prof. Dr. Christoph Herrmann Übersicht Menschliche versus nicht-menschliche Sprache Sprache und Anatomie: - Peripheranatomische

Mehr

Mobil einsetzbare Medizintechnik am Beispiel von Hörimplantaten

Mobil einsetzbare Medizintechnik am Beispiel von Hörimplantaten Mobil einsetzbare Medizintechnik am Beispiel von Hörimplantaten Prof. Prof. h.c. Dr. med. Thomas Lenarz Direktor HNO-Klinik der MHH, Vorsitzender DGMBT VDE MedTech 2013, Frankfurt/Main, 26.9.2013 H4A The

Mehr

Beeinflusst Epilepsie das Gedächtnis?

Beeinflusst Epilepsie das Gedächtnis? Beeinflusst Epilepsie das Gedächtnis? Klinik für Epileptologie Universität Bonn Tag der offenen Tür, 14.4.2007 EPIxxxx/x Ursachen kognitiver Störungen bei Epilepsie Strukturell nicht variabel Funktionell

Mehr

BEDEUTUNG DES INTRAOPERATIVEN NEUROMONITORING DURCHFÜHRUNG UND RISIKEN. Kathleen Seidel

BEDEUTUNG DES INTRAOPERATIVEN NEUROMONITORING DURCHFÜHRUNG UND RISIKEN. Kathleen Seidel IG-NOPPS 2010 BEDEUTUNG DES INTRAOPERATIVEN NEUROMONITORING DURCHFÜHRUNG UND RISIKEN Kathleen Seidel Universitätsklinik für Neurochirurgie (Direktor: Prof. Dr. Andreas Raabe) Inselspital, Universität Bern

Mehr

Gibt es Frauen- oder Männermusik?

Gibt es Frauen- oder Männermusik? Gibt es Frauen- oder Männermusik? Zur Neurobiologie geschlechtsspezifischer Merkmale bei Musikwahrnehmung und -produktion Eckart Altenmüller Institut für Musikphysiologie und Musiker-Medizin (IMMM) Hochschule

Mehr

Hirnstammdiagnostik FNTA Jahrestagung Regensburg 10 März 2006

Hirnstammdiagnostik FNTA Jahrestagung Regensburg 10 März 2006 www.foerderung-neurologie-recklinghausen.de Hirnstammdiagnostik FNTA Jahrestagung Regensburg 10 März 2006 Prof. Dr. Helmut Buchner Knappschaftskrankenhaus Recklinghausen Hirnstammdiagnostik Was wollen

Mehr

Neurofeedback --- Train your brain

Neurofeedback --- Train your brain Seminar Brain-Machine Interfaces Neurofeedback --- Train your brain 1 18.11.2009 Biofeedback...bezeichnet eine Methode, bei der eine Person die bewusste Selbstkontrolle über bestimmte Funktionen seines

Mehr

Hörhilfen eine Übersicht Vom konventionellen Hörgerät zum Cochleaimplantat

Hörhilfen eine Übersicht Vom konventionellen Hörgerät zum Cochleaimplantat Hörhilfen eine Übersicht Vom konventionellen Hörgerät zum Cochleaimplantat Die Prävalenz beidseitiger, wesentlicher Hörstörungen beträgt bereits bei Geburt etwas mehr als 1:1000. Für persistierende Schwerhörigkeiten,

Mehr

Präsentation zum Thema Cochlear-Implantat

Präsentation zum Thema Cochlear-Implantat Präsentation zum Thema Cochlear-Implantat anläßlich des Europäischen Tages der Logopädie März 2011 Das Ohr Das Ohr besteht aus drei Teilen: (1) Das Außenohr: Das Ohr bzw. die Ohrmuschel dient dem Richtungshören.

Mehr

Neuropsychologie des Hydrocephalus. Dr. Michael Lingen

Neuropsychologie des Hydrocephalus. Dr. Michael Lingen Neuropsychologie des Hydrocephalus Dr. Michael Lingen Was ist Neuropsychologie? interdisziplinäres Teilgebiet der Psychologie und der Neurowissenschaften befasst sich mit der Variation physiologischer

Mehr

Wie das Gehirn hören lernt Gehörlosigkeit und das bionische Ohr

Wie das Gehirn hören lernt Gehörlosigkeit und das bionische Ohr Übersichtsartikel Neuroforum 2015 21:22 29 DOI 10.1007/s12269-015-0001-9 Springer-Verlag Berlin Heidelberg 2015 Andrej Kral Thomas Lenarz Institut für Audioneurotechnologie (VIANNA), Hannover, Deutschland

Mehr

Menschen mit Hörbehinderungen

Menschen mit Hörbehinderungen Menschen mit Hörbehinderungen Gehörlosigkeit Als Taubheit oder Gehörlosigkeit wird der vollständige Ausfall des Hörsinns bezeichnet. Die Gehörlosigkeit kann vererbt, angeboren oder erworben sein. 1 Gehörlosigkeit

Mehr

Adipositas, Diabetes und Schlaganfall Prof. Dr. Joachim Spranger

Adipositas, Diabetes und Schlaganfall Prof. Dr. Joachim Spranger Adipositas, Diabetes und Schlaganfall Prof. Dr. Joachim Spranger Charité-Universitätsmedizin Berlin Adipositas- und Stoffwechselzentrum Campus Benjamin Franklin Hindenburgdamm 30 12200 Berlin The New Yorker

Mehr

Titel. Neuronale Grundlagen der Wahrnehmung die kritische Periode in der frühkindlichen Entwicklung

Titel. Neuronale Grundlagen der Wahrnehmung die kritische Periode in der frühkindlichen Entwicklung Titel Neuronale Grundlagen der Wahrnehmung die kritische Periode in der frühkindlichen Entwicklung Eckhard Friauf Neurobiologie/Tierphysiologie Fachbereich Biologie Universität Kaiserslautern Vortrags-Gliederung

Mehr

2 Der Einfluss von Sport und Bewegung auf die neuronale Konnektivität 11

2 Der Einfluss von Sport und Bewegung auf die neuronale Konnektivität 11 I Grundlagen 1 1 Neurobiologische Effekte körperlicher Aktivität 3 1.1 Einleitung 3 1.2 Direkte Effekte auf Neurone, Synapsenbildung und Plastizität 4 1.3 Indirekte Effekte durch verbesserte Hirndurchblutung,

Mehr

Proseminar Biologische Psychologie: Vom Hören zur Sprache

Proseminar Biologische Psychologie: Vom Hören zur Sprache Proseminar Biologische Psychologie: Vom Hören zur Sprache VL 1: Einführung, Grundlagen, Überblick 1. Die MR-Technik macht unterschiedliche Gewebe sichtbar. 2. Bildgebende Verfahren messen zeitlich-räumliche

Mehr

3. Burgenländische PsySoMed Tagung 9. Oktober 2010, Eisenstadt

3. Burgenländische PsySoMed Tagung 9. Oktober 2010, Eisenstadt 3. Burgenländische PsySoMed Tagung 9. Oktober 2010, Eisenstadt Altern ist kein Schicksal? Zur Plastizität des alternden Gehirns unter besonderer Berücksichtigung der Demenzprävention Prof. Dr. med. Johannes

Mehr

Frage: Führt die antibiotische Behandlung der Helicobacter pylori Infektion bei Patienten mit funktioneller Dyspepsie zur Beschwerdefreiheit?

Frage: Führt die antibiotische Behandlung der Helicobacter pylori Infektion bei Patienten mit funktioneller Dyspepsie zur Beschwerdefreiheit? Funktionelle Dyspepsie: Bei Patienten mit positivem Helicobacter pylori Nachweis hilft eine Eradikation, wenn überhaupt nur wenigen Patienten (Resultate von 2 Studien) Frage: Führt die antibiotische Behandlung

Mehr

Intentionen Umwelt. Sender. Situation

Intentionen Umwelt. Sender. Situation Intentionen Umwelt Intentionen Umwelt Intentions Environment Intentions Environment Sender Kanal Sender Sender Sender Situation Störungen Situation Situation Spurious Signals Situation Brain A Gehirn sensorische

Mehr

Phonologische Bewusstheit bei deutschsprachigen Kindern mit bilateraler Cochlea-Implantat Versorgung: Eine Pilotstudie

Phonologische Bewusstheit bei deutschsprachigen Kindern mit bilateraler Cochlea-Implantat Versorgung: Eine Pilotstudie Spektrum Patholinguistik 7 (2014) 117 122 Phonologische Bewusstheit bei deutschsprachigen Kindern mit bilateraler Cochlea-Implantat Versorgung: Eine Pilotstudie Bianka Wachtlin 1 & Blanca Schäfer 2 1 Katholische

Mehr

Omega-3-Fettsäuren. aus biochemischer und medizinischer Sicht 4. ERNÄHRUNGSSYMPOSIUM 28. APRIL 2016

Omega-3-Fettsäuren. aus biochemischer und medizinischer Sicht 4. ERNÄHRUNGSSYMPOSIUM 28. APRIL 2016 4. ERNÄHRUNGSSYMPOSIUM 28. APRIL 2016 Omega-3-Fettsäuren aus biochemischer und medizinischer Sicht PD Dr. med. Philipp A. Gerber, MSc Klinik für Endokrinologie, Diabetologie und Klinische Ernährung UniversitätsSpital

Mehr

Akustische Analyse der Vokalartikulation von Cochlear Implantat Trägern

Akustische Analyse der Vokalartikulation von Cochlear Implantat Trägern Akustische Analyse der Vokalartikulation von Cochlear Implantat-Trägern Veronika Neumeyer, Florian Schiel, Phil Hoole Institut für Phonetik und Sprachverarbeitung, LMU München Einleitung Die Sprache von

Mehr

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Ein Vortrag von Univ. Prof. Dr. Johannes Drach Medizinische Universität Wien Univ. Klinik für Innere Medizin I Klinische Abteilung

Mehr

Gehirn und Verhaltenssucht

Gehirn und Verhaltenssucht Forum für Suchtfragen; Basel, 15. November 2012 Gehirn und Verhaltenssucht Prof. Dr. med. Gerhard Wiesbeck Ärztlicher Leiter des Zentrums für Abhängigkeitserkrankungen Gliederung meines Vortrags Das «klassische»

Mehr

Visuelles Bewusstsein und unbewusste Wahrnehmung. Thomas Schmidt Justus-Liebig-Universität Gießen Abteilung Allgemeine Psychologie 1

Visuelles Bewusstsein und unbewusste Wahrnehmung. Thomas Schmidt Justus-Liebig-Universität Gießen Abteilung Allgemeine Psychologie 1 Visuelles Bewusstsein und unbewusste Wahrnehmung Thomas Schmidt Justus-Liebig-Universität Gießen Abteilung Allgemeine Psychologie 1 Judas Priest, Stained Class (1978) Hemineglekt Nach Läsionen des rechten

Mehr

ATOSnews. ATOS Kliniken: Ihr Vorteil Unsere Spezialisten. Schwerpunkt Osteotomien. Bei posttraumatischer Fehlstellung. Potential nicht ausgeschöpft

ATOSnews. ATOS Kliniken: Ihr Vorteil Unsere Spezialisten. Schwerpunkt Osteotomien. Bei posttraumatischer Fehlstellung. Potential nicht ausgeschöpft Schwerpunkt Osteotomien ::... am Humerus: Bei posttraumatischer Fehlstellung ::... hüftgelenknah: Potential nicht ausgeschöpft ::... an der Tibia: Vorteilhaft für Knorpel- und Meniskusersatz ::... am Sprunggelenk:

Mehr

Schmerz, Grundlagen AB 1-1, S. 1

Schmerz, Grundlagen AB 1-1, S. 1 Schmerz, Grundlagen AB 1-1, S. 1 Text 1: Schmerzqualitäten Zunächst einmal unterscheidet man zwischen somatischen und visceralen Schmerzen. Somatischer Schmerz geht von der Haut, von Muskeln, Gelenken,

Mehr

Resektionstechniken bei kolorektalen Lebermetastasen. Klaus Kaczirek Universitätsklinik für Chirurgie Wien

Resektionstechniken bei kolorektalen Lebermetastasen. Klaus Kaczirek Universitätsklinik für Chirurgie Wien Resektionstechniken bei kolorektalen Lebermetastasen Klaus Kaczirek Universitätsklinik für Chirurgie Wien Resektabilität European Colorectal Metastases Treatment Group (ECMTG): Alle Läsionen sicher entfernbar,

Mehr

Geschlechtsunterschiede und der Einfluss von Steroidhormonen auf das sich entwickelnde menschliche Gehirn

Geschlechtsunterschiede und der Einfluss von Steroidhormonen auf das sich entwickelnde menschliche Gehirn Kerstin Konrad LFG Klinische Neuropsychologie des Kindes- und Jugendalters Klinik für Kinder- und Jugendpsychiatrie und psychotherapie Universitätsklinikum der RWTH Aachen Geschlechtsunterschiede und der

Mehr