I. Historischer Überblick

Save this PDF as:

Größe: px
Ab Seite anzeigen:

Download "I. Historischer Überblick"


1 Philipps-Universität Marburg Fachbereich Chemie Wintersemester 1999/2000 SE 15561: Übungen im Experimentalvortrag Seminarleitung: Dr. J. Butenuth; Dr. E. Gerstner; Prof. U. Müller; Prof.. Perst Forensische Chemie Referentin: Andrea Groß ckershäuser Str Marburg Vortrag vom 19. Januar 2000

2 Inhaltsverzeichnis I. Die Geschichte der Forensischen Chemie Seite 1 Versuch 1: Mitscherlich-Probe Seite 3 II. Arsen und Spitzenhäubchen - Toxikologie Seite 6 Demonstration 1: Drogen-Screening Seite 6 Versuch 2: Photometrische Bestimmung des Cyanid-Gehaltes in Blut Seite 9 III. Kein Verbrechen ohne Spuren... Seite 14 Daktyloskopie Seite 14 Versuch 3: Fingerabdrücke - Eine chemische Methode Seite 16 Demonstration 2: Fingerabdrücke - Eine physikalische Methode Seite 17 Serodiagnostik Seite 18 Versuch 4: Blut als leuchtendes Indiz Seite 19 Der Genetische Fingerabdruck Seite 21 Versuch 5: Der Genetische Fingerabdruck Seite 22 IV. Fatale Fehlinterpretationen - Justizirrtümer Seite 28 Der Fall John Priss Seite 28 Die Birmingham Six - Kein Spiel mit offenen Karten Seite 28 Versuch 6: Die Birmingham Six - Ein Justizirrtum Seite 29 V. Literatur- und Bildverzeichnis Seite 32

3 Die omenklatur Forensik leitet sich ab vom lateinischen Wort forensis, das übersetzt zum Forum, zum Gericht gehörend bedeutet. Dies rührt daher, daß im alten Rom auf dem Marktplatz, also dem Forum, Recht gesprochen wurde. Die Forensische Wissenschaft besteht aus verschiedenen Teilgebieten: Medizin mit der Pathologie oder der istologie Biologie mit Aspekten der Immunologie oder Serologie Physik mit den Bereichen der Ballistik, Werkstoff- und Elektrotechnik Chemie mit Toxikologie, Daktyloskopie und Sprengstoffanalytik Diese genannten Einteilungen sind natürlich nicht eindeutig, denn Überschneidungen finden sich zwischen allen genannten Gebieten, hauptsächlich jedoch zwischen der Chemie und der Physik. Aus diesem Grunde besteht zum Beispiel auch im Kriminaltechnischen Institut des Bundeskriminalamtes (BKA) die Arbeitsgruppe Chemie/Physik. I. istorischer Überblick Die Anfänge der Forensik Bereits 2000 v.chr. war der individualisierende Wert von Fingerabdrücken eines jeden Menschen in China bekannt, so daß dort sogar Verträge mit Fingerabdrücken unterzeichnet wurden. In der Antike wurde die toxische Wirkung von Schierlingsaft zur Vollstreckung von Todesstrafen oder auch zum Verüben von Morden ausgenutzt; die Toxine im Schierlingsaft sind Cicutoxin und das Alkaloid Coniin. Die erste gerichtliche bduktion zur Klärung einer Vergiftung erfolgte 1302 in Bologna. Dies ist besonders erwähnenswert, da zu jener Zeit jegliche bduktionen von kirchlicher Seite untersagt waren. Durch Paracelsus folgte im 16. Jahrhundert die Eingliederung der Giftlehre in die Medizin; er prägte auch das Wort Dosis sola facit venenum. (zu Deutsch: Die Dosis allein macht das Gift ). Im 17.Jahrhundert war die Entwicklung schließlich soweit fortgeschritten, daß es zu systematischen Giftmorden in Italien und Frankreich v.a. durch Aqua della Tofnina (Toxin: Arsen) kam.

4 Trotz hoher Strafandrohungen -die Todesstrafe stand bereits auf das Aufbewahren, den Kauf und den Verkauf von Giftstoffen sowie auf nicht angezeigte Giftmorde- gab es kaum Möglichkeiten diese Delikte einzugrenzen, da keine zuverlässigen chemischen achweise zur Aufklärung von Giftmorden bekannt waren. inrichtung des Giftmischers Derues in Frankreich 1777 Die chemische Wende Im 19. Jahrhundert kam es endlich zur Etablierung erster chemischer achweismethoden gab rfila das erste toxikologische Lehrbuch Traité des Poisons heraus, das schnell Grundlage systematischer, toxikologischer Untersuchungen wurde. Die Entwicklung der Marsh schen Probe durch den Engländer James Marsh im Jahre 1836 stellte die erste Möglichkeit zum achweis von Arsen-Morden dar (och um 1840 waren 90 bis 95% aller Morde auf Arsen-Vergiftungen zurückzuführen!) gelang dem Chemiker Stas die Abtrennung von Alkaloiden von körpereigenen, hydrophilen Stoffen durch Etherextraktion. Eine genaue Charakterisierung der Alkaloide erfolgte schließlich durch Geschmacks- oder Geruchsproben, physiologische Tests, Farbreaktionen, Kristalluntersuchungen oder Schmelzpunktbestimmungen. Zur Überführung von möglichen Tatverdächtigen machte im Jahre 1880 der

5 Engländer enry Faulds erstmals den Vorschlag, vom Täter hinterlassene Fingerabdrücke auszunutzen (Daktyloskopie). Versuch 1: Mitscherlich-Probe An dieser Stelle wird die Mitscherlich-Probe, der toxikologische achweis von Phosphor, aus der Zeit der Chemischen Wende vorgestellt. Versuchsbeschreibung: Materialien: eizpilz 500mL Dreihalskolben S 29 mit zwei Glasstopfen und Keck-Klemmen Siedesteine Steigrohr Stativmaterial Sicherheitsschüssel Verwendete Chemikalien: Weißer Phosphor (1/4 Erbsengroß) Ca. 250mL Wasser Gesättigte CuS 4 -Lösung (Sicherheitsaspekt!) Durchführung: Bereits vor Zugabe des weißen Phosphors wird das Wasser im Rundkolben fast bis zum Sieden erhitzt. Schließlich gibt man ein Stück weißen Phosphor in das Wasser und verschließt den Kolben umgehend mit einem Glasstopfen. Die Lösung wird wiederum bis zum Sieden erhitzt. Versuchsauswertung: Die Mitscherlich-Probe ist ein Beispiel für eine Chemolumineszenz, die in der Gerichtsmedizin genutzt wurde, um Phosphor-Vergiftungen nachzuweisen. Man kann z.b. wenig Gehirnsubstanz oder auch Mageninhalt des pfers bei Verdacht auf eine

6 Phosphorvergiftung wie beschrieben in Wasser aufkochen. Mögliche Phosphorreste werden durch den Wasserdampf ausgetrieben und reagieren mit dem Sauerstoff der Luft im Steigrohr, so daß es zur Erscheinung eines im Dunkeln leuchtenden Ringes kommt, der am oberen Ende des Steigrohres als kalte Phosphorflamme heraustritt. Reaktionsmechanismus: P P 4 10 Bildung von Phosphorwasserstoff: P P P Bildung der lichtemittierenden Teilchen: P P P P* P P* Lichtemittierende Prozesse: P* P 2 + h* ν λ = nm P* P 2 + h* ν λ = nm Die Reaktionen zur Bildung der lichtemittierenden Teilchen wie auch die der lichtemittierenden Prozesse selbst sind bis heute nicht genau geklärt. Die

7 beschriebenen Reaktionen sind daher lediglich als Möglichkeiten anzusehen, die ablaufenden, komplexen Vorgänge zu erklären. Physiologische Wirkung von elementarem weißen Phosphor: Die tödliche Dosis des Phosphors liegt bei mg. Es tritt zuerst eine lokale Reizwirkung des Magens auf, die durch Übelkeit und Erbrechen erkennbar wird. ach zwei bis drei Tagen sind bereits schwere Leberschädigungen, blutiges Erbrechen, hypoglykämische Krämpfe sowie Blutungen an Schleimhäuten zu beobachten. ach fünf bis zehn Tagen tritt schließlich der Tod unter Schwäche und Benommenheit ein. Im 19. Jahrhundert fand Phosphor aufgrund des Auslösens von Blutungen an Schleimhäuten vielfache Verwendung als Abtreibungsmittel. eute besitzt weißer Phosphor jedoch keine toxikologische Bedeutung mehr. Falls es jedoch trotzdem zur einer Kontamination mit weißem Phosphor kommen sollte, sind folgende Therapiemaßnahmen einzuhalten: Auslösen von Erbrechen bzw. Magenspülung mit KMn 4 Einnahme von Aktivkohle zur Adsorption des Phosphors Verbrennungen: Behandlung mit CuS 4, das zur Bildung von Kupferphosphid führt.

8 II. Arsen und Spitzenhäubchen Toxikologie Die Toxikologie ist ein Teilgebiet der Pharmakologie, das sich mit Giften und ihren Wirkungsweisen beschäftigt. Die omenklatur stammt aus dem Griechischen: toxikon Pfeilgift. Toxine selbst sind physiologisch wirksame Stoffe, die entweder körperfremd sind oder in unphysiologisch hohen Konzentrationen vorliegen (Wiederum der Verweis auf Paracelsus: Dosis sola facit venenum!). Außerdem bewirken Toxine Funktionsstörungen im lebenden rganismus. Moderne achweisverfahren müssen bestimmte Voraussetzungen erfüllen, um als Analyseverfahren für eine Screening-Untersuchung eingesetzt zu werden: Universalität Toxikologisch relevante Substanzen unterschiedlichster Struktur sollten in einem Analysenverlauf erfaßt werden. Empfindlichkeit Quantitative Bestimmungen sollten bis in den unteren anogramm pro Milliliter-Bereich gehen. ohes Auflösungsvermögen der chromatographischen Methoden Demonstration 1: Drogen-Screening Versuchsbeschreibung: Materialien: 250mL Becherglas Drug-Screen-Card Multi 5 der Firma Von Minden Gmb Verwendete Chemikalien: Testurin mit nachweisbaren Substanzen

9 Durchführung: Man taucht die Streifen der Testkarte für ca. zehn bis fünfzehn Sekunden in den Testurin; dabei darf der Plastikrand den Urin nicht berühren. ach drei bis acht Minuten ist das Ergebnis ablesbar. Versuchsauswertung: Durchgeführt wird ein immunchemischer Test auf Grundlage von Antigen-Antikörper- Reaktionen, der dem qualitativen achweis verschiedener Drogen im menschlichen Urin dient. Die Vorteile dieses Analysenverfahrens sind die hohe Empfindlichkeit und die schnelle sowie einfache andhabung. In den Sichtfenstern der Testkarte befinden sich Testzonen (T) der nachweisbaren Substanzen sowie eine Kontrollzone (C). Bei einem negativen Test sind ein pinkfarbener Streifen in der Testzone (T) wie auch einer in der Kontrollzone (C) erkennbar. Ein positiver Test besitzt dagegen nur einen pinkfarbenen Streifen in der Kontrollzone (C). Zur Funktionsweise des immun-chemischen Schnelltests: Droge im Urin In der Reaktionszone gebundene Droge Spezifische AK für das Konjugat Immunisiertes, farbmarkiertes Konjugat

10 Mögliche Strukturen der nachweisbaren Drogengruppen: C 2 2 C C 3 2-Amino-1-phenyl-propan (Amphetamin) Br Bromazepam (Benzodiazepin) CC 3 3 C Kokain C C 2 5 C C C 2 C 3 C Methadon C 3 C 3 3 C 3 C C C C 3 eroin (piat) Schwellwert-Konzentrationen der nachweisbaren Drogen: Amphetamin 1000 ng/ml Benzodiazepine 300 ng/ml Kokain 300 ng/ml Methadon 300 ng/ml piate/morphin 300 ng/ml Die achweiszeit von Drogen im Urin liegt bei circa zwei bis vier Tagen.

11 Versuch 2: Photometrische Bestimmung des Cyanid-Gehaltes in Blut Versuchsbeschreibung: Materialien: Fünf Widmark-Kolben (100mL) Eppendorf-Pipetten Fünf 100mL Meßkolben 50mL Meßkolben 100mL Meßzylinder Photometer mit Küvetten Verwendete Chemikalien: Schwefelsäure (100g/L) atronlauge (0,1mol/L) atriumdihydrogenphosphat-lösung (1mol/L) Chloramin-T-Lösung (250mg/100mL) Pyridin-Barbitursäure-Reagenz (3g Barbitursäure, 3mL Salzsäure und 15mL Pyridin mit 2 auf 50mL auffüllen) Kaliumcyanid-Stammlösung (50mg/L) Durchführung: Man befüllt die Widmarkkolben nach folgendem Pipettierschema: Wasser 4000µL 4000µL 4000µL 4000µL 4000µL Zink-Granalien atronlauge 20µL 15µL 10µL 5µL - KC-Lösung - 5µL 10µL 15µL 20µL Im äpfchen des Stopfens: atronlauge 500µL 500µL 500µL 500µL 500µL Im Kolben: Schwefelsäure 500µL 500µL 500µL 500µL 500µL

12 Die Kolben werden sofort nach Zugabe der Schwefelsäure fest verschlossen; man schwenkt vorsichtig und läßt die Kolben drei Stunden bei Raumtemperatur stehen. Im Anschluß daran pipettiert man jeweils 400µL des Inhalts des äpfchens, 800 µl atriumdihydrogenphosphatlösung und 400µL Chloramin-T- Lösung in eine Küvette und wartet zwei bis drei Minuten. ach Zugabe von 1200µL Pyridin-Barbitursäure-Reagenz in jede Küvette und einer weiteren Wartezeit von zehn Minuten kann man die Extinktionen der Lösungen gegen den Reagenzienleerwert messen. Versuchsauswertung: Die beschriebene Vorgehensweise beruht auf dem Prinzip der Mikrodiffusion. Die aus der Probe durch Zusatz von Schwefelsäure freigesetzte Blausäure wird nach Mikrodiffusion in atronlauge adsorbiert. Um die Diffusion zu beschleunigen, werden dem Analysenansatz Zinkgranalien zur Wasserstoffentwicklung hinzugefügt. ach Reaktion eines Aliquots der atronlauge mit Chloramin-T und der Pyridin- Barbitursäure-Lösung kommt es zur Bildung eines violetten Polymethinfarbstoffes. Anhand der mit ilfe des Photometers gemessenen Extinktionen sind Rückschlüsse auf die Cyanid- Konzentrationen möglich. Reaktionsmechanismus: 1. Reaktionsschritt: Reaktion mit Chloramin-T 3 C S Cl a C 3 C S Cl a C ClC + 3 C S a

13 2. Reaktionsschritt: Öffnung des Pyridin-Rings ClC + + C - Cl Cl C Cl C 3. Reaktionsschritt: Bildung des Polymethin-Farbstoffs C + 2 Cl 2 C + Cl + C C C C C 2 C + Cl + C C C C C

14 Die Absorptionsmessung erfolgt bei einer Wellenlänge von 585nm. Eine Probe einer Cyanid-haltigen Lösung wird photometriert und eine Extinktion von 0,774 ermittelt. Mit ilfe der aufgenommenen Kalibriergerade läßt sich nun die Konzentration an Milligramm Cyanid pro Liter Lösung (bzw. Blut ) bestimmen. 2 Kalibriergerade Cyanid-Bestimmung Extinktion Cyanid [mg/l] ach Auftragen des erhaltenen Extinktionswertes ist ein Cyanid-Gehalt von ca. 1,3mg pro Milliliter Blut ablesbar. Im Vergleich dazu die entsprechenden Literaturwerte: Leichte Blausäurevergiftung < 2,0 mg/l Mittelschwere Blausäurevergiftung 2-3 mg/l Schwere Blausäurevergiftung > 3-4 mg/l Physiologische Wirkung von Cyaniden: Die tödliche Dosis von Blausäure bzw. Cyaniden liegt bei ppm bzw. ca. 60mg. Die hohe Toxizität der Cyanide ist auf ihre starke Affinität an das Fe 3+ des Cytochroms und der Cytochromoxidase in der Atmungskette zurückzuführen. Es kommt zur emmung des Elektronentransports der Atmungskette und somit zu einer

15 Inneren Erstickung. Akute Symptome sind Brechreiz, Atemnot und Krämpfe; der Tod tritt schließlich durch Erregungsleitungsstörungen am erz und Atemlähmung ein. Bei Auftreten einer Cyanidvergiftung müssen folgende Therapiemaßnahmen getroffen werden: Intravenöse Gabe von atriumnitrit, Amylnitrit oder Dimethylaminophenol, was zur Bildung von Methämoglobin und schließlich Cyan-Methämoglobin führt. Es kommt so zur Entfernung des Cyanids aus der Atmungskette. atriumthiosulfat, das das Cyanid in Thiocyanat umwandelt. Auf diese Weise ist es möglich, die 20-fache tödliche C - -Dosis zu entgiften. Ergänzungen zum beschriebenen Reaktionsmechanismus: Cl C Cl C C - 2 Cl C - C

16 III. Kein Verbrechen ohne Spuren Daktyloskopie In der Daktyloskopie (Fingerabdrucknahme) verwendet man Verfahren zur Auswertung von Papillarlinienbildern der Finger zur Identifizierung von Personen. Die omenklatur stammt aus dem Griechischen: Daktylos-skopein; dies bedeutet übersetzt Fingerschau. Die Verfahren wurden in Deutschland erstmals am 1.April 1903 in Dresden eingeführt (in Gesamtdeutschland jedoch erst 1914; in England und Wales bereits 1901). Aufgaben der Daktyloskopie sind: die erkennungsdienstliche Behandlung von Straftätern sowie Spurensuche und Spurensicherung das Führen von Fingerabdruckblatt-Sammlungen und Spurensammlungen (Das BKA besitzt ca. 4,1 Millionen Fingerabdruckblätter von ca. 2,2 Millionen Personen) die Identifizierung von Spurenverursachern Die Daktyloskopie beruht auf folgenden Kriterien: Einmaligkeit Papillarleistengebilde sind individuell und nicht vererbbar. Unveränderlichkeit Papillarleistengebilde sind vom Zeitpunkt der Ausbildung im Embryonalstadium bis zur Auflösung nach dem Tod relativ unveränderlich. Klassifizierbarkeit der Papillarleistenstrukturen Fingerabdrücke sind nach bestimmten Grundprinzipien klassifizierbar und daher auch registrierbar.

17 Grundmusterarten der Papillarlinien: Bogenmuster (ca. 5%) keine Deltabildung Schleifenmuster (ca. 60%) ein Deltabereich gegenüber dem Schleifenauslauf Wirbelmuster (ca. 35%) mindestens zwei Deltabereiche Ein Identitätsnachweis gilt als erbracht, wenn acht Minutien (d.h. anatomische Merkmale) beim Merkmalsvergleich übereinstimmen. Der Beweiswert dieser Methode wurde durch den Bundesgerichtshof 1952 uneingeschränkt anerkannt.

18 Versuch 3: Fingerabdrücke Eine chemische Methode Versuchsbeschreibung: Materialien: Papier mit nachzuweisenden Fingerabdrücken 100mL Sprühflasche mit Gummigebläse Fön UV-Lampe Verwendete Chemikalien: Silbernitrat Methanol Durchführung: Man löst 1g Silbernitrat in 50mL Methanol und besprüht das Papier mit dieser Lösung. ach Trocknen des Papiers mit einem Fön wird dieses mit einer UV- Lampe bei 366nm bestrahlt. ach einigen Minuten werden mögliche Fingerabdrücke sichtbar. Versuchsauswertung: Grundlage für die Detektion von Fingerabdrücken mittels chemischer Methoden ist die Abgabe bestimmter Stoffe über die aut. So ist es möglich, Aminosäuren ( µg pro mm² aut) mit ilfe von inhydrin oder Chlorid-Ionen (im menschlichen Schweiß vorhanden; 10 µg pro mm² aut) durch Ag 3 -Lösung und anschließender Reduktion der Silber-Ionen zu Silber nachzuweisen. Reaktionsmechanismus: Ag + (aq) + Cl - (aq) AgCl (s) + 2 aq λ = 366nm 2 AgCl (s) 2 Ag (s) + Cl 2

19 Demonstration 2: Fingerabdrücke Eine physikalische Methode Versuchsbeschreibung: Materialien: Papier (4 x 6cm) mit nachzuweisenden Fingerabdrücken Zwei Messing-Elektroden (5x 10cm); isoliert durch Plexiglas-Kasten Gleichspannungsgerät mit entsprechender Anschlußbuchse Verwendete Chemikalien: Feines Graphit-Pulver Durchführung: Ein auf Fingerabdrücke zu untersuchendes Papier wird an der oberen Elektrode befestigt, während die untere Elektrode mit feinem Graphit-Pulver bedeckt ist. Beide Elektroden sind mit einer Gleichspannungsquelle (ca. 8kV) verbunden. Durch Anlegen von Spannung an das System können latente Fingerabdrücke entwickelt werden. Schaltskizze: Versuchsauswertung: Es ist das Prinzip der Elektrostatik zu Grunde gelegt. Durch Anlegen der ochspannung kommt es zur Aufladung des Graphits und zur Bewegung zwischen den Elektroden mit sehr hoher Geschwindigkeit. Aufgrund von Feuchtigkeit und von Fettbestandteilen eines Fingerabdrucks bleiben die Graphit-Partikel an den Linien des Fingerabdrucks haften. Auf diese Weise lassen sich qualitativ besonders hochwertige Fingerabdrücke entwickeln.

20 2. Serodiagnostik Die Stimme des Blutes deines Bruders schreit zu mir von der Erde Erstes Buch Mose, Kapitel 4, Vers 10 Welche Informationen schreit nun dieses Blut einem Kriminalisten der polizeilichen Spurensicherung entgegen? Mit ilfe der Blutspuren ist es möglich Aussagen über beteiligte Personen, Tatort und Tathergang eines Verbrechens zu treffen. Die Vorgehensweise der Spurensicherung kann man daher folgendermaßen beschreiben: a) Der prinzipielle achweis einer Blutspur b) Klärung der möglichen erkunft einer Blutspur Stammt die Spur an einem Mensch oder einem Tier? Verfahrenstechniken: Antigen-Antikörper-Reaktionen (Immunoassays) c) Zuordnung zu den an der Tat beteiligten Personen Verfahrenstechniken: Anwendung des AB0-Blutgruppensystems Genetischer Fingerabdruck d) Sicherung von Informationen aus dem am Tatort vorgefundenen Blutmuster, v.a. zum Tathergang

21 Versuch 4: Blut als leuchtendes Indiz Versuchsbeschreibung: Materialien: 100mL Sprühflasche mit Gummigebläse z.b. mit Blut kontaminierter Stoff oder mögliche Tatwaffe Verwendete Chemikalien: atriumperoxid (100mL 1%ige Lösung) Luminol (0,2g) Durchführung: Man löst in der atriumperoxid-lösung (1%ig) 0,2g Luminol. Mit der Sprühflasche verteilt man diese Lösung auf den zu untersuchenden bjekten. ach Abdunkeln des Raumes ist eine blau-weiße Lumineszenz zu beobachten. Versuchsauswertung: Luminol (β-aminophthalsäure-hydrazid) wird unter Einwirkung von Wasserstoffperoxid in alkalischer Lösung zum Diazachinon oxidiert. Im weiteren Verlauf kommt es zur xidation zu einem Peroxodianion. ach Abspaltung eines Stickstoff-Moleküls aufgrund der katalysierenden Wirkung des im Blut enthaltenen Protohäms bildet sich das Aminophthalsäuredianion in einem angeregten Zustand. Durch Abgabe von Lichtenergie wird der energetische Grundzustand wieder erreicht. Bereits sehr geringe Mengen von Blut katalysieren die beschriebene Luminol- achweisreaktion. ierbei ist für die Spurensicherung vor allem wichtig, daß diese Lumineszenz charakteristisch für Blut ist, da andere Körperflüssigkeiten nicht das im Blutfarbstoff ämoglobin enthaltene Protohäm besitzen (ämoglobin: bestehend aus Protein-Molekül und Protohäm).

22 Reaktionsmechanismus: a a / [ - ] / Katalysator: äm 2 * 2 h ν Struktur des katalysierenden äms 2 C C C 3 3 C Fe 2+ C C 2 3 C C 3 C C 2 C 2 2 C 2 C C

23 3. Der Genetische Fingerabdruck Entwickelt wurde die Methode des Genetischen Fingerabdrucks durch Alec Jeffries und Karry Mullis Mitte der 80er Jahre. Als Grundlage dient die charakteristische und unverwechselbare Sequenz der DA -der Erbanlageneines jeden Menschen. Die Abbildung zeigt das Watson-Crick-Modell einer DA-Doppelhelix; dieses Strukturmodell wurde 1953 aufgestellt. Zur Erstellung des Genetischen Fingerabdrucks analysiert man zumeist Abschnitte ohne Erbinformationen im DA-Molekül, sog. Introns. Die Anzahl, die Länge und die Position dieser DA-Sequenzen sind bei jedem Menschen verschieden; so kann man die Wahrscheinlichkeit, daß zwei Menschen komplett gleiche Introns besitzen, auf 1 : 50 Mrd. beziffern. Die Anwendungsmöglichkeiten des Genetischen Fingerabdrucks sind z.b. die Überführung von Mördern und Sexualstraftätern oder auch der achweis von Vaterschaften (Vaterschaftstests).

24 Versuch 5: Der Genetische Fingerabdruck Versuchsbeschreibung: Materialien: Thermocycler Spannungsgerät Gelelektrophorese-Apparatur Eppendorf-Zentrifuge ettich-tischzentrifuge Eppendorf-Pipetten Eppendorf-Gefäße (1,5mL und 0,5mL) 50mL Falcon-Röhrchen Färbeschalen Verwendete Chemikalien: PCR-Mastermix (bestehend aus PCR-Puffer (20mM Tris/Cl [p 8,4], 50mM KCl); 1,5mM MgCl 2 ; je 200µM dtps (datp, dctp, dgtp, dttp); 25 pm Primer D1S80 und 1,5 units Taq-Polymerase in 50µL Reaktionsvolumen) Laufpuffer TBE (89mM Tris; 89mM Borsäure; 2,5mM EDTA) Auftragspuffer (0,2mL 0,5M EDTA; eine Mikrospatelspitze Bromphenolblau; eine Mikrospatelspitze Xylenxyanol ad 10mL Formamid) Lysepuffer (50mM Tris/Cl [p 8,0]; 10mM EDTA; 2% SDS) Fällungspuffer (8M Kaliumacetat) 70% Ethanol Isopropanol Denaturierendes ukleinsäure-gel (10% Polyacrylamid aus 40% Acrylamid- Bisacrylamid 19:1) Gelfixierer (100mL 10% Ethanol; 5mL 0,5% Eisessig ad 1000mL 2 ) Färbelösung (0,19g Silbernitrat/L 2 ) Entwickler (15g a; 4mL 37% Formaldehyd ad 1000mL 2 ) Färbefixierer (7,5g atriumcarbonat/l 2 )

25 Durchführung: 1. Präparation von DA aus Mundschleimhaut Man spült den Mund mit 50mL Mineralwasser gründlich aus und überführt dieses Wasser in ein 50mL Falcon-Röhrchen. Anschließend wird bei 4.000rpm fünf Minuten zentrifugiert. Der Überstand wird verworfen und das Pellet weiter aufgearbeitet. Dazu gibt man nun 500µL Lysepuffer und überführt die erhaltene Lösung in ein Eppendorf-Gefäß (1,5mL). ach Zugabe von 100µL Fällungspuffer schüttelt man das Gefäß und legt es für fünf Minuten auf Eis. un wird fünf Minuten bei rpm in der Eppendorf-Zentrifuge zentrifugiert. 500µL der klaren Lösung werden vorsichtig abgenommen und in ein neues Eppendorf- Gefäß (1,5mL) überführt. Man gibt 300µL Isopropanol hinzu, schüttelt gut durch und zentrifugiert für fünf Minuten bei rpm in der Eppendorf-Zentrifuge. Der Überstand wird abdekantiert, zum Pellet 1mL 70% Ethanol gegeben, gründlich gemischt und bei rpm für drei Minuten zentrifugiert. Das Ethanol wird wieder abdenkantiert, das Pellet gründlich getrocknet (ca. 15 Minuten) und schließlich wieder in 50µL Wasser gelöst. Bis zum Beginn der PCR wird das Eppendorf-Gefäß mit der präparierten DA eingefroren. 2. Polymerase-Kettenreaktion (PCR) Jeweils 10µL der DA-Proben werden in ein Eppendorf-Cup (0,5mL) gegeben. 40µL des PCR-Mastermix pipettiert man zu den DA-Proben, mischt gründlich und startet die PCR im Thermocycler. Die Schritte der PCR sind wie folgt: 1. Schritt 5 min 95 C Denaturieren 40 sec 65 C Primerhybridisierung ( Annealing ) 80 sec 72 C Elongation insgesamt 10 Zyklen 2. Schritt 60 sec 95 C Denaturieren 40 sec 65 C Primerhybridisierung ( Annealing ) 80 sec 72 C Elongation insgesamt 20 Zyklen 3. Schritt 60 sec 95 C Denaturieren

26 40 sec 65 C Primerhybridisierung ( Annealing ) 5 min 72 C Final-Elongation 3. Gelelektrophoretische Auftrennung der DA ach Abschluß der PCR werden die Eppendorf-Gefäße aus der Apparatur entnommen und die Proben mit 100µL Denaturierungs-Auftragspuffer versetzt. Die Gefäße werden nun wieder für fünf Minuten bei 95 C in den Thermocycler gegeben. Bis zum Auftragen auf das Gel werden die Proben auf Eis gestellt. Die Elektrophorese erfolgt bei ca Volt für ca. 30 bis 60 Minuten bis der zum Auftragspuffer gegebene Farbstoff am Ende des Gels angelangt ist. Zum Sichtbarmachen der DA erfolgt nun eine Silberfärbung. ach Plazierung in einer Färbeschale wird das Gel 15 Minuten in der Fixierlösung geschüttelt. Diese wird abgegossen und das Gel nun 20 Minuten in der Silberlösung geschüttelt. Mit frisch angesetztem Entwickler wird schließlich gefärbt und in 0,75% atriumcarbonat-lösung neutralisiert. Versuchsauswertung: 1. Präparation von DA Für die Präparation von DA können Speichelreste (sogar von Zigarettenfiltern!), Blut- und Spermaspuren oder auch aare Verwendung finden. Im Verlauf der Präparation müssen bestimmte Kriterien erfüllt werden: die Verhinderung des DA-Abbaus durch ukleasen, die Vermeidung von DA-brechenden Scherkräften sowie die Abtrennung von Proteinen. Kurz beschrieben entspricht die Reihenfolge der DA-Präparation den folgenden Schritten: Aufbrechen der Zellstrukturen durch Lysepuffer Abtrennung von Proteinen mittels Fällungspuffer Fällung der ukleinsäuren mit Isopropanol 2. Polymerase-Kettenreaktion (PCR) Die PCR kann man als eine sehr schlagkräftige Methode zur Vermehrung von DA in vitro bezeichnen: Von bestimmten DA-Abschnitten kann auf diese Weise innerhalb weniger Stunden eine sehr hohe Anzahl von Kopien gemacht werden,

27 die durch elektrophoretische Auftrennung in Gelen sichtbar gemacht werden können. Prinzipien der Polymerase-Kettenreaktion sind: Relativ kurze einzelsträngige ligonukleotide (Primer) hybridisieren mit komplementären Sequenzen des Genoms. Voraussetzungen sind: eine einzelsträngige Zielsequenz, geeignete Temperatur sowie Pufferbedingungen. Eine freie DA-Polymerase (Startpunkt ist die freie -Gruppe des Primers (3 -Ende)) synthetisiert den komplementären Strang. Zur Erfüllung dieser beschriebenen Prinzipien verwendet man einen PCR- Mastermix mit Primer (D1S80), Taq-Polymerase (Polymerase des thermophilen Bakteriums Thermus aquaticus) und Desoxynukleotid-Triphosphaten (datp, dctp, dgtp, dttp) Schematische Darstellung der PCR: 1. Zyklus:

28 2. Zyklus: Informationen zum Primer D1S80 Primer ame: D1S80.PCR1.1 Länge: 28 bp rientierung: 5-3 Sequenz: GAAACTGGCCTCCAAACACTGCCCGCCG Primer ame: D1S80.PCR1.2 Länge: 29 bp rientierung: 3-5

29 Sequenz: GTCTTGTTGGAGATGCACGTGCCCCTTGC Größe der amplifizierten Sequenzen: 0,430 0,750 kb 3. Gelelektrophoretische Auftrennung der DA Verwendet wird ein 7,5%iges denaturierendes Polyacrylamid-Gel mit Elektrolyt- Puffer, da dieses Gel aufgrund seiner großen Vernetzung als besonders gutes Molekularsieb wirken kann. Die präparierte DA liegt unter den herrschenden p-bedingungen als Polyanion vor, so daß es im elektrischen Feld zur Anode (Plus-Pol) wandert. Die Auftrennung der amplifizierten Sequenzen erfolgt anhand der Fragment-Länge (Die Wanderungsstrecke der DA-Fragmente ist umgekehrt proportional zum Logarithmus ihrer Größe bzw. ihres Molekulargewichts). Da DA nicht im sichtbaren Wellenlängenbereich absorbiert, werden die Fragmente mittels Silbernitrat angefärbt. Ergebnis eines Vaterschaftstests anhand des Genetischen Fingerabdrucks: M K V Aufgrund des Fragment-Musters des Kindes ist zu erkennen, daß das obere Fragment von der Mutter vererbt wurde, während das untere nur der Vater aufweist, dies weitergegeben hat und so die Vaterschaft nachgewiesen ist.

30 IV. Fatale Fehlinterpretationen Justizirrtümer Ein Zitat eines Kriminalisten: Anwälte geben häufig zu, daß sie bei forensischen Beweisen in einem Gerichtsverfahren geistig abschalten und keine detaillierten Fragen an forensische Zeugen richten, aus Angst eine Frage zuviel zu stellen. M. amer, Der Fall John Priss Im Jahre 1973 wurde der Engländer John Priss wegen Vergewaltigung und Ermordung einer Frau zu einer langjährigen aftstrafe verurteilt. Im Verlauf des Prozesses stammte schließlich der wichtigste Beweis aus forensischen Untersuchungen: Blutzellen der Blutgruppe A wurden in einem Samenfleck auf der ose der Ermordeten gefunden. Dies war die Blutgruppe des Verdächtigen; was jedoch von der Rechtswissenschaftlern verschwiegen wurde: dies war auch die Blutgruppe des pfers. Da es nun keinerlei Beweise gegen John Priss mehr gab, wurde er im Berufungsverfahren freigesprochen. 2. Die Birmingham Six Kein Spiel mit offenen Karten Mitte der 70er Jahre kam es in Großbritannien zur Verurteilung von sechs Iren, die im ovember 1974 durch einen Bombenschlag der IRA 21 Personen getötet haben sollten. eben Geständnissen, die wie die Beschuldigten behaupteten, unter Schlägen herausgepreßt wurden, führte folgender chemischer achweis zur Verurteilung:

31 Versuch 6: Die Birmingham Six Ein Justizirrtum Versuchsbeschreibung: Materialien: Großer Reagenzglasständer Vier Demo-Reagenzgläser mit Stopfen 20mL Vollpipette 10mL Vollpipette Zehn PE-Flaschen Verwendete Chemikalien: 1mL itroglycerin (1mg/mL) itrocellulose atronlauge (2mol/L) Lunges Reagenz I (1g Sulfanilsäure in 100mL 30%iger Essigsäure) Lunges Reagenz II (0,3g α-aphthylamin in 100mL 30%iger Essigsäure) itrat- und itrit-lösungen als Blindproben Durchführung: Zur itroglycerin-lösung (in einem Demo-Reagenzglas) gibt man 20mL atronlauge, vermischt und fügt schließlich nacheinander aus den PE-Flaschen Lunges Reagenz I sowie Lunges Reagenz II hinzu. Zur Bestätigung des vermuteten Reaktionsmechanismus behandelt man die Blindproben der itritund itrat-lösungen (jeweils 10mL, stark verdünnt) ebenfalls mit Lunges Reagenz. Zuletzt vergleicht man die Reaktionen von itroglycerin und der itrocellulose, indem man die itrocellulose entsprechend der itroglycerin- Lösung behandelt. Versuchsauswertung: Die Spurensicherung von Scotland Yard nahm Proben von den änden der Birmingham Six und untersuchte diese wie oben erläutert auf itroglycerin. Im alkalischen Milieu sind jedoch nicht die möglicherweise erwarteten Produkte der alkalischen Esterverseifung des itroglycerins bzw. der itrocellulose zu

32 beobachten, denn die itrat-ionen werden durch die folgend beschriebene ydrid- Übertragung über zwei mögliche Zwischenstufen zu itrit reduziert. Die itrit-ionen sind durch die Bildung eines charakteristischen roten Azofarbstoffes mit ilfe von Lunges Reagenz nachzuweisen. Reaktionsmechanismus: 2 C 2 C 2 C 2 2 itroglycerin C + C C - 2

PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen


Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt.

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt. Western Blot Der Western Blot ist eine analytische Methode zum Nachweis bestimmter Proteine in einer Probe. Der Nachweis erfolgt mit spezifischen Antikörpern, die das gesuchte Protein erkennen und daran


Demonstrationsvorträge in Anorganischer Chemie für Studierende des Lehramtes an Gymnasien. Der Photographische Prozess

Demonstrationsvorträge in Anorganischer Chemie für Studierende des Lehramtes an Gymnasien. Der Photographische Prozess Universität Regensburg Naturwissenschaftliche Fakultät IV Institut für Anorganische Chemie - Lehrstuhl Prof. Dr. A. Pfitzner Dozentin: Dr. M. Andratschke Demonstrationsvorträge in Anorganischer Chemie


Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005

Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005 Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005 F1 Molekulare Zoologie Teil II: Expressionsanalyse Proteinexpressionsanalyse


Wasser Kaffeefilter ein Streifen Filterpapier als Docht Schere Tasse

Wasser Kaffeefilter ein Streifen Filterpapier als Docht Schere Tasse Trennen von Farben Was Du brauchst: schwarzfarbige Filzstifte Wasser Kaffeefilter ein Streifen Filterpapier als Docht Schere Tasse Wie Du vorgehst: Schneide einen Kreis aus dem Kaffeefilter. Steche mit


Fingerabdrücke stempeln

Fingerabdrücke stempeln Name: Datum: stempeln Materialien: Weißes Papier, Musterkarte mit Fingerabdrucktypen, Karte zum Abnehmen aller, Stempelkissen, Lupe Bei diesem Versuch musst du besonders sauber arbeiten. 1. Drücke das


Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1


Methoden zur Untersuchung von Papier, Karton und Pappe für Lebensmittelverpackungen und sonstige Bedarfsgegenstände

Methoden zur Untersuchung von Papier, Karton und Pappe für Lebensmittelverpackungen und sonstige Bedarfsgegenstände Methoden zur Untersuchung von Papier, Karton und Pappe für Lebensmittelverpackungen und sonstige Bedarfsgegenstände 5. Bestimmung von Einzelsubstanzen 5.19 Levanase 1. Allgemeine Angaben Bezeichnung in


Gentechnologie: Isolierung und Charakterisierung von DNA

Gentechnologie: Isolierung und Charakterisierung von DNA Genetisches Grundpraktikum 9. Kurstag 23.06.2005 Gentechnologie: Isolierung und Charakterisierung von DNA Lerninhalte: Klonierung, Plasmid, Polylinker ( multiple cloning site ), Restriktionsendonuklease,


Lebensmittelanalytisches Praktikum für Ernährungswissenschaftler

Lebensmittelanalytisches Praktikum für Ernährungswissenschaftler 1 Lebensmittelanalytisches Praktikum für Ernährungswissenschaftler NACHWEIS DER ART DER WÄRMEBEHANDLUNG VN MILCH I. Einleitung Zum Nachweis der erfolgreichen Wärmebehandlung von Milch wird routinemäßig


Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung


Proteinbestimmung. Diese Lerneinheit befasst sich mit der Beschreibung von verschiedenen Methoden der Proteinbestimmung mit den folgenden Lehrzielen:

Proteinbestimmung. Diese Lerneinheit befasst sich mit der Beschreibung von verschiedenen Methoden der Proteinbestimmung mit den folgenden Lehrzielen: Diese Lerneinheit befasst sich mit der Beschreibung von verschiedenen Methoden der mit den folgenden Lehrzielen: Verständnis der Prinzipien der sowie deren praktischer Durchführung Unterscheidung zwischen


Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Versuch 2: Polymerasekettenreaktion Betreuer: Knut Jahreis Versuchsinhalt Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Zwei verschiedene Plasmide werden als Matrizen für eine Polymerasekettenreaktion


Tierartbestimmung mittels spezifischer Polymerasekettenreaktion

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion Einleitung Der Tierart-Kit SK1-12 enthält die notwendigen Materialien, um verarbeitete Tierarten in gängigen Fleisch- und Milchprodukten, z.b. Wurst oder Käse zu bestimmen. Ein Lehrerheft und fünf Schülerhefte,



SCRIPTUM HIGH PRECISE Nur für Forschungszwecke Datenblatt Artikel BS.50.020 = 20 Reaktionen x 50 µl Artikel BS.50.100 = 100 Reaktionen x 50 µl Artikel BS.50. 500 = 500 Reaktionen x 50 µl Haltbarkeit: 12 Monate Lagerung bei


Forensik. Verbrecherjagd mit wissenschaftlichen Methoden. Ergebnisse der Laboruntersuchungen der Spurensicherung

Forensik. Verbrecherjagd mit wissenschaftlichen Methoden. Ergebnisse der Laboruntersuchungen der Spurensicherung Forensik Verbrecherjagd mit wissenschaftlichen Methoden Ergebnisse der Laboruntersuchungen der Spurensicherung Fingerabdrücke Im Labor konnte die Spurensicherung keine verwertbaren Fußabdrücke sichern.


SingleQuant Assay Kit

SingleQuant Assay Kit GEBRAUCHSANLEITUNG SingleQuant Assay Kit Kit für die Proteinkonzentrationsbestimmung (Kat.-Nr. 39226) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 Heidelberg Phone +49-6221-138400, Fax +49-6221-1384010


1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli


F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in


Plasmidpräparation aus Bakterien Inhalt

Plasmidpräparation aus Bakterien Inhalt Inhalt Einleitung... 2 Materialien... 4 Gewinnung der Bakterien... 6 Zerstörung der Bakterien... 7 Trennung von Plasmid-DNA und genomischer DNA... 8 Reinigung der Plasmid-DNA... 10 Elution der gereinigten


Lernzirkel WAS Station 1 Herstellung von Seife aus Kokosfett

Lernzirkel WAS Station 1 Herstellung von Seife aus Kokosfett Station 1 Herstellung von Seife aus Kokosfett Zeitbedarf: 35 min. Durchführung 10 g Kokosfett und 5 ml destilliertes Wasser werden langsam in einem Becherglas erhitzt. Unter Rühren werden 10 ml Natronlauge


3 150 ml-bechergläser als Wasserbäder Thermometer 2 ml-plastikpipetten Parafilm

3 150 ml-bechergläser als Wasserbäder Thermometer 2 ml-plastikpipetten Parafilm Nachweis der Enzymaktivität und Enzymhemmung Chemikalien: Harnstofflösung (10% w/v) Phenolphtalein-Lösung Urease rohe Kartoffel Wasserstoffperoxid-Lösung (30 % w/v) Bäckerhefe verdünnte Lösung von Methylenblau


Ein Fall für CSI? Forensik an der Hochschule Fresenius. www.hs-fresenius.de

Ein Fall für CSI? Forensik an der Hochschule Fresenius. www.hs-fresenius.de Ein Fall für CSI? Forensik an der Hochschule Fresenius www.hs-fresenius.de AVAVA/Fotolia.com, victorpr/fotolia.com, Fotolia.com und Photosani/Fotolia.com Forensik was ist das? Forensik ist in aller Munde


Waschmittel. 1. Inhaltsstoffe der Waschmittel. 1.1. Tenside

Waschmittel. 1. Inhaltsstoffe der Waschmittel. 1.1. Tenside Universität Regensburg 06.11.2009 Institut für Anorganische Chemie Lehrstuhl Prof. Dr. A. Pfitzner Wintersemester 2009/2010 Gruppenversuche in Anorganischer Chemie mit Demonstrationen Betreuung: Dr. M.


GEBRAUCHSANLEITUNG. Glutatione Agarose Resin

GEBRAUCHSANLEITUNG. Glutatione Agarose Resin GEBRAUCHSANLEITUNG Glutatione Agarose Resin Agarose zur Affinitätsreinigung von GST-Tag-Fusionsproteinen und anderen Glutathion-Bindungsproteinen (Kat.-Nr. 42172) SERVA Electrophoresis GmbH - Carl-Benz-Str.


Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch

Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch (Fotos vom 6. März 2013 Molekularbiologisches Praktikum 12 G-Kurs Biologie Herr Korne - am KOMM Homburg/Saar unter Anleitung von Frau Dr. Amoroso)


Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf


Auswertung der Versuche mit Aminosäuren und Proteinen (Eiweiß)

Auswertung der Versuche mit Aminosäuren und Proteinen (Eiweiß) Auswertung der Versuche mit Aminosäuren und Proteinen (Eiweiß) Vorbereitung: Für die folgenden Versuche wird eine Eiweißlösung aus dem Eiklar eines ühnereis hergestellt, indem man dieses in 60 ml dest.


Protokoll zur Übung PCR

Protokoll zur Übung PCR Protokoll zur Übung PCR im Rahmen des Praktikums Labor an der TU Wien Durchgeführt bei Ao.Univ.Prof. Mag. Dr.rer.nat. Robert Mach Verfasser des Protokolls: Gwendolin Korinek 0625083 & Daniel Bomze 0726183


Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Vorbereitung Lehrer Für jede Arbeitsgruppe werden 550 µl InstaGene-Matrix aliquotiert! Das Tube wird mit IG beschriftet!


Seminar zum Quantitativen Anorganischen Praktikum WS 2013/14

Seminar zum Quantitativen Anorganischen Praktikum WS 2013/14 Seminar zum Quantitativen Anorganischen Praktikum WS 2013/14 Teil des Moduls MN-C-AlC S. Sahler, M. Wolberg Inhalt Mittwoch, 08.01.2014, Allgemeine Einführung in die Quantitative Analyse Glasgeräte und


6. Tag: Chemisches Gleichgewicht und Reaktionskinetik

6. Tag: Chemisches Gleichgewicht und Reaktionskinetik 6. Tag: Chemisches Gleichgewicht und Reaktionskinetik 1 6. Tag: Chemisches Gleichgewicht und Reaktionskinetik 1. Das chemische Gleichgewicht Eine chemische Reaktion läuft in beiden Richtungen ab. Wenn


Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner

Bayerische Landesanstalt für Landwirtschaft. Institut für Pflanzenschutz Luitgardis Seigner Bayerische Landesanstalt für Landwirtschaft Institut für Pflanzenschutz Luitgardis Seigner Schaderregernachweis mit der Polymerase-Kettenreaktion (PCR) Schaderregernachweis mit der Polymerase- Kettenreaktion


Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich?

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Im Unterricht habt ihr bereits einige Methoden und Vorgehensweisen der Molekularbiologie kennengelernt. Aber wo finden diese Methoden im täglichen


Bestimmung des Stickstoffgehalts von Erde

Bestimmung des Stickstoffgehalts von Erde Bestimmung des Stickstoffgehalts von Erde Schülerversuch, ca. 25 Minuten Experiment Teil 1 Material und Chemikalien: Ofentrockene Erde Kaliumchloridlösung (c = 2 mol/l) Flasche (250 ml) Trichter Filterpapier


Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983


Europäischer Chemielehrerkongress Leoben Österreich im April 2007

Europäischer Chemielehrerkongress Leoben Österreich im April 2007 Einfache und erprobte Experimente für den Anfangsunterricht im Fach Chemie 1. Stoffumwandlung Stoffe reagieren Aggregatzustandsänderung Zusammensetzung der Luft Gesetz von der Erhaltung der Masse Reaktion


Versuch Blut Hämoglobin

Versuch Blut Hämoglobin Versuch Blut Hämoglobin Dieser Versuchstag soll ihnen eine Reihe unterschiedlicher Techniken sowie Eigenschaften von Blutfarbstoffen nahebringen. Blutfarbstoffe dienen im nahezu gesamten Tierreich dem


Bestimmung des Paracetamolgehalts in Vivimed von Natalie Rotermel und Katharina Juhasz-Dora

Bestimmung des Paracetamolgehalts in Vivimed von Natalie Rotermel und Katharina Juhasz-Dora Bestimmung des Paracetamolgehalts in Vivimed von Natalie Rotermel und Katharina Juhasz-Dora Inhalt 1. Allgemeine Information zu den Chemikalien und den Bestandteilen einer Vivimed Tablette (Name, Wirkungsweise,


Experimente mit Gummibärchen

Experimente mit Gummibärchen JUSTUS-LIEBIG-UNIVERSITÄT GIESSEN INSTITUT FÜR DIDAKTIK DER CEMIE - Internes Arbeitsmaterial - Gießen, April 2007 Inhaltsverzeichnis Blue-Bottle Versuch mit Gummibärchen... 3 Silberspiegel mit Gummibärchen...


Gruppe 01: Verbesserung Weißer Zucker... Schwarze Kohle

Gruppe 01: Verbesserung Weißer Zucker... Schwarze Kohle Phillipps- Universität Marburg Isabelle Kuhn Organisch Chemisches Grundpraktikum Lehramt WS 2006/07 Praktikumsleiter: Herr Reiß Gruppe 01: Verbesserung Weißer Zucker... Schwarze Kohle Reaktion: Saccharose


Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase)

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase) Methodensammlung des LAG PCR-Nachweis der 35S-nptII-Übergangssequenz, der pnapin-bayte- Übergangssequenz und des plsc-gens erstellt vom Unterausschuss Methodenentwicklung des LAG Status: verabschiedet


Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien


Chemisches Grundpraktikum für Ingenieure. 2. Praktikumstag. Andreas Rammo

Chemisches Grundpraktikum für Ingenieure. 2. Praktikumstag. Andreas Rammo Chemisches Grundpraktikum für Ingenieure. Praktikumstag Andreas Rammo Allgemeine und Anorganische Chemie Universität des Saarlandes E-Mail: a.rammo@mx.uni-saarland.de Das chemische Gleichgewicht Säure-Base-Reaktionen


DNA Isolierung. Praktikum Dr. László Kredics

DNA Isolierung. Praktikum Dr. László Kredics Isolierung Praktikum Dr. László Kredics Aufgabe: Isolierung von Plasmid aus Bakterienzellen Plasmid : pbluescript Vektor, Gröβe: 2960 Bps 1. 1,5 ml Bakterienkultur in Eppendorf-Röhrchen pipettieren, 2


Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt


Auf der Suche nach der Wundermedizin

Auf der Suche nach der Wundermedizin Auf der Suche nach der Wundermedizin Experimente im Schullabor 1 Herausgeber Novartis Pharma AG, CH-4002 Basel Autoren: Dr. Gesche Standke und Dr. Christiane Röckl Michel Zeichnungen: Fonds der Chemischen


Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Versuch 1: Restriktionsenzyme als molekulare Werkzeuge Versuchsinhalt Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Zwei


Rein oder nicht rein?

Rein oder nicht rein? Station 1: Rein oder nicht rein? Versuche: 1 Bestimmen Sie experimentell die Löslichkeit von Kochsalz. [Hinweis: Unter der Löslichkeit versteht man die Masse eines Stoffes in Gramm, die sich gerade noch


ANALYTISCHE CHEMIE I Trennmethoden 6. Elektrophorese-Methoden Kapillarelektrophorese / Gelelektrophorese WS 2007/2008

ANALYTISCHE CHEMIE I Trennmethoden 6. Elektrophorese-Methoden Kapillarelektrophorese / Gelelektrophorese WS 2007/2008 ANALYTISCHE CHEMIE I Trennmethoden 6. Elektrophorese-Methoden Kapillarelektrophorese / Gelelektrophorese WS 2007/2008 Definition Elektrophorese bezeichnet die Wanderung elektrisch geladener Teilchen durch


Organisch-Chemisches Grundpraktikum. trans-1,2-cyclohexandiol

Organisch-Chemisches Grundpraktikum. trans-1,2-cyclohexandiol rganischhemisches Grundpraktikum Präparat 06: trans1,2yclohexandiol Gliederung: I. Literatur... 1 II. Präparateigenschaften... 1 III. Stöchiometrische Reaktionsgleichung... 1 IV. Reaktionsmechanismus...


Anorganisches Praktikum 1. Semester. FB Chemieingenieurwesen. Labor für Anorg. Chemie Angew. Materialwiss. Versuchsvorschriften

Anorganisches Praktikum 1. Semester. FB Chemieingenieurwesen. Labor für Anorg. Chemie Angew. Materialwiss. Versuchsvorschriften Anorganisches Praktikum 1. Semester FB Chemieingenieurwesen Labor für Anorg. Chemie Angew. Materialwiss. Versuchsvorschriften 1 Gravimetrie Bestimmung von Nickel Sie erhalten eine Lösung, die 0.1-0.2g


Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans

Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans AVID X / 1998 Lawsonia intracellularis Seite -1- Klassifizierung: noch nicht abgeschlossen, Verwandtschaftsverhältnis zur Familie: Desulvovibrionaceae - Vertreter Desulvovibrio desulfuricans 1. ALLGEMEINES


Typische Fragen für den Gehschul-Teil: Typ 1: Mengen und Konzentrationen:

Typische Fragen für den Gehschul-Teil: Typ 1: Mengen und Konzentrationen: Die Gehschule ist ein Teil der Biochemischen Übungen für das Bakkalaureat LMBT. Aus organisatorischen Gründen wird dieser Test gleichzeitig mit der Prüfung aus Grundlagen der Biochemie angeboten. Das Abschneiden


Anlage zur Akkreditierungsurkunde D-PL-13258-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13258-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13258-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 15.03.2012 bis 16.12.2013 Urkundeninhaber: Institut für Rechtsmedizin


Probe und Probenmenge Wassermenge Auftragspuffermenge 5 µl Kaninchenmuskelextrakt 50 µl 100 µl

Probe und Probenmenge Wassermenge Auftragspuffermenge 5 µl Kaninchenmuskelextrakt 50 µl 100 µl Arbeitsgruppe D 6 Clara Dees Susanne Duncker Anja Hartmann Kristin Hofmann Kurs 3: Proteinanalysen Im heutigen Kurs extrahierten wir zum einen Proteine aus verschiedenen Geweben eines Kaninchens und führten


Saurer Regen, was ist das?

Saurer Regen, was ist das? Saurer Regen, was ist das? 1. SO x (x=2,3) => SO 2 und SO 3 SO 2 + H 2 O H 2 SO 3 (schwefelige Säure) SO 3 + H 2 O H 2 SO 4 (Schwefelsäure) 2. NO x (x=1,2) 2 NO + H 2 O + ½O 2 2 H NO 2 (salpetrige Säure)


Vom Ei zum Proteinkristall. Reinigung und Kristallisation von Lysozym

Vom Ei zum Proteinkristall. Reinigung und Kristallisation von Lysozym Vom Ei zum Proteinkristall Reinigung und Kristallisation von Lysozym Isolierung von Lysozym aus Hühnereiweiß (Protokoll adaptiert von www.biochemie.uni-jena.de/files/praktikum/lysozym.pdf) Einführung in


SERVALight EosUltra Western Blot Chemilumineszenz HRP Substrat Kit

SERVALight EosUltra Western Blot Chemilumineszenz HRP Substrat Kit GEBRAUCHSANLEITUNG SERVALight EosUltra Western Blot Chemilumineszenz HRP Substrat Kit (Kat.-Nr. 42586) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 Heidelberg Phone +49-6221-138400, Fax +49-6221-1384010


Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC

Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC Wolferner Analytik GmbH Untersuchung der Absorption von Schwermetallen und Ammonium durch MAC 1 Veröffentlichung 15.12.2004, Studie Zusammenfassung: Im Auftrag der ASTRA GmbH, einer Vorgesellschaft der


2. DNA-Fingerprinting

2. DNA-Fingerprinting Obwohl die Untersuchung von Mikrosatelliteninstabilität und LOH nicht Ziel der vorliegenden Arbeit war, kann es im Rahmen der Vaterschaftsbegutachtung dazu kommen, dass von einem verstorbenen Putativvater


Zersetzung von Wasser LI

Zersetzung von Wasser LI Die Zersetzung von Wasser Zersetzung von Wasser LI Im Folgenden finden sich drei Ansätze zum Experiment Zersetzung von Wasser. Der Versuch eignet sich als Alternative zur Reaktion von Wasserdampf mit Magnesium.


Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign


6.1 Nachweis von Vitamin C. Aufgabe. Welche Lebensmittel enthalten Vitamin C? Naturwissenschaften - Chemie - Lebensmittelchemie - 6 Vitamine

6.1 Nachweis von Vitamin C. Aufgabe. Welche Lebensmittel enthalten Vitamin C? Naturwissenschaften - Chemie - Lebensmittelchemie - 6 Vitamine Naturwissenschaften - Chemie - Lebensmittelchemie - 6 Vitamine (P787800) 6. Nachweis von Vitamin C Experiment von: Anouch Gedruckt: 28.02.204 :2:46 intertess (Version 3.2 B24, Export 2000) Aufgabe Aufgabe


Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers

Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers Praktikum Biochemie Einführung in die Molekularbiologie Bettina Siebers (4) Rekombinante Expression einer Esterase aus Pseudomonas aeruginosa in E. coli Proteinreinigung Techniken & Methoden der Proteinreinigung


REDOXPROZESSE. Die Redoxreaktion setzt sich aus einer Oxidation und einer Reduktion zusammen. [1, 2]

REDOXPROZESSE. Die Redoxreaktion setzt sich aus einer Oxidation und einer Reduktion zusammen. [1, 2] Universität Regensburg Institut für Anorganische Chemie: Lehrstuhl Prof. Dr. A. Pfitzner Demonstrationsvorträge im Wintersemester 2012/13 23.11.2012 Dozentin: Dr. M. Andratschke Referentinnen: Stefanie


Fortbildung für Biologen an der Oranienschule

Fortbildung für Biologen an der Oranienschule Fortbildung für Biologen an der Oranienschule Am 28.01.08 fand die erste ganztägige schulinterne Lehrerfortbildung für Biologen an der Oranienschule unter der Leitung von Frau Dr. Wismar und Herrn Bender


7. Woche. Gesamtanalyse (Vollanalyse) einfacher Salze. Qualitative Analyse anorganischer Verbindungen

7. Woche. Gesamtanalyse (Vollanalyse) einfacher Salze. Qualitative Analyse anorganischer Verbindungen 7. Woche Gesamtanalyse (Vollanalyse) einfacher Salze Qualitative Analyse anorganischer Verbindungen Die qualitative Analyse ist ein Teil der analytischen Chemie, der sich mit der qualitativen Zusammensetzung


Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS

Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Von: Andreas Tschammer, Fachhochschule Aalen-Hochschule f. Technik und Wirtschaft, Fachbereich Chemie, Schwerpunkt Molekulare Biotechnologie Material


Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers FIGURE 20.1 Biology 6/e Biotechnologie Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli


Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR

Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR Zeitaufgelöste Fluoreszenzmessung zur Verwendung bei der Realtime-PCR Nils Scharke, inano Abstract Die Verwendung neuartiger Seltenerd-Komplexe in Verbindung mit zeitaufgelöster Fluoreszenzmessung liefert


Quantitative Analytik -231- Elektrophorese. Bei dieser Gruppe von Methoden werden Ionen durch Anlegen eines elektrischen Feldes transportiert.

Quantitative Analytik -231- Elektrophorese. Bei dieser Gruppe von Methoden werden Ionen durch Anlegen eines elektrischen Feldes transportiert. Quantitative Analytik -231- Elektrophorese 9. ELEKTROPHORESE Bei dieser Gruppe von Methoden werden Ionen durch Anlegen eines elektrischen Feldes transportiert. Elektrophoretische Mobilität von Ionen in


Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint

Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint RFLP als Modell für einen DNA-Fingerprint Teil 1: Restriktionsverdau 1.1: Thermoblock / Wasserbad auf 37 C vorheizen 1.2: Puffer Y+/Tango auftauen und auf Eis stellen 1.3: 4 Proben, RSA I und H 2 O demin.


Bradford Reagent, 5x

Bradford Reagent, 5x GEBRAUCHSANLEITUNG Bradford Reagent, 5x Reagenz für die Proteinkonzentrationsbestimmung (Kat.-Nr. 39222) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 HeidelbergPhone +49-6221-138400, Fax +49-6221-1384010


Messung des Vitamin C Gehaltes in Orangen mit und ohne Schalen written by Cyril Hertz, 3dMN, 25.11.2004

Messung des Vitamin C Gehaltes in Orangen mit und ohne Schalen written by Cyril Hertz, 3dMN, 25.11.2004 1. Fragestellung: Das Ziel des Versuches war, herauszufinden, ob sich die Ascorbinsäure 1 eher im Fruchtfleisch oder in der Schale von Orangen befindet. Zu diesem Zweck wurden Orangen mit und ohne Schale


Benennen Sie folgende Salze: 1. Li[AlCl 2 Br 2 ] 2. [Co(NH 3 ) 2 (H 2 O) 2 ][FeCl 6 ] 3. Na 2 S 2 O 4

Benennen Sie folgende Salze: 1. Li[AlCl 2 Br 2 ] 2. [Co(NH 3 ) 2 (H 2 O) 2 ][FeCl 6 ] 3. Na 2 S 2 O 4 ... Nomenklatur Frage 41... Nomenklatur Antwort 41 Benennen Sie folgende Salze: 1. Li[AlCl 2 Br 2 ] 2. [Co(NH 3 ) 2 (H 2 O) 2 ][FeCl 6 ] 3. Na 2 S 2 O 4 Kap. 4.9 Chalkogene Frage 42 Kap. 4.9 Chalkogene


Extraktion. Arbeitstechnik der Extraktion

Extraktion. Arbeitstechnik der Extraktion 1 Extraktion Die heute vielfach angewandte Trennung durch Extraktion basiert auf der unterschiedlichen Löslichkeit bestimmter Verbindungen in zwei nicht (od. begrenzt) mischbaren Lösungsmittel. (Das Lösungsmittesystem


Molekulare Spurenanalytik und Abstammungsbegutachtung. Dr. rer. nat. Micaela Poetsch, Institut für Rechtsmedizin, Universitätsklinikum Essen

Molekulare Spurenanalytik und Abstammungsbegutachtung. Dr. rer. nat. Micaela Poetsch, Institut für Rechtsmedizin, Universitätsklinikum Essen Molekulare Spurenanalytik und Abstammungsbegutachtung Spurenanalytik Ziel: Identifikation Also die Zuordnung einer bestimmten Spur zu einer bestimmten Person! Denn Spuren bei einer forensischen Untersuchung


Anlage zur Akkreditierungsurkunde D PL 13199 01 00

Anlage zur Akkreditierungsurkunde D PL 13199 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13199 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 01.02.2011 bis 31.01.2016 Urkundeninhaber: Institut für Rechtsmedizin


Europäisches Patentamt European Patent Office Dffice europeen des brevets 3> J ) 2) Veröffentlichungsnummer: 0 409 078 AZ

Europäisches Patentamt European Patent Office Dffice europeen des brevets 3> J ) 2) Veröffentlichungsnummer: 0 409 078 AZ 3> J ) Europäisches Patentamt European Patent Office Dffice europeen des brevets 2) Veröffentlichungsnummer: 0 409 078 AZ 3> EUROPAISCHE PATENTANMELDUNG Anmeldenummer: 90113328.0 ) Int. CIA C1 20. 1/68


Wasserstoffperoxid, Peroxide

Wasserstoffperoxid, Peroxide Universität Regensburg Institut für Anorganische Chemie Lehrstuhl Prof. Dr. A. Pfitzner Übungen im Vortragen mit Demonstrationen im Wintersemester 2012/2013 Dozentin: Dr. M. Andratschke Wasserstoffperoxid,


Gruppe 12: Untersuchungsabteilung Pharmazeutika Untersuchung von Maaloxan Magentabletten

Gruppe 12: Untersuchungsabteilung Pharmazeutika Untersuchung von Maaloxan Magentabletten Phillipps- Universität Marburg Isabelle Kuhn Organisch Chemisches Grundpraktikum Lehramt WS 2006/07 Praktikumsleiter: Herr Reiß Gruppe 12: Untersuchungsabteilung Pharmazeutika Untersuchung von Maaloxan


6. Woche. Reaktionen und Nachweis der Anionen. Klasse I

6. Woche. Reaktionen und Nachweis der Anionen. Klasse I 6. Woche Reaktionen und achweis der Anionen Klasse I Klassenreaktion: Die Anionen der I. Anionenklasse zeigen nach Zugabe verdünnter Salzsäure eine gut wahrnehmbare Veränderung (Gasentwicklung oder iederschlag


1. Qualitativer Nachweis von Anionen und Sodaauszug

1. Qualitativer Nachweis von Anionen und Sodaauszug Anionennachweis 1 1. Qualitativer Nachweis von Anionen und Sodaauszug Die moderne Analytische Chemie unterscheidet zwischen den Bereichen der qualitativen und quantitativen Analyse sowie der Strukturanalyse.


Photometrische Ammoniumbestimmung

Photometrische Ammoniumbestimmung Analytisches Grundpraktikum Teil II Photometrische Ammoniumbestimmung Aufgabe Ammonium ist einerseits ein wichtiger Pflanzennährstoff, andererseits als Produkt des anaeroben Abbaus von Biomasse in Gewässern


Gruppe 3 vorgegebener Versuch. Vergleich von PE-Pyrolysegas und Feuerzeuggas im Lowcost-GC

Gruppe 3 vorgegebener Versuch. Vergleich von PE-Pyrolysegas und Feuerzeuggas im Lowcost-GC Philipps- Universität Marburg FB 15 Chemie Organisch-Chemisches Grundpraktikum für das Lehramt Christian Lego Leitung: err Dr. Reiß Datum: 14.05.09 SS 09 Gruppe 3 vorgegebener Versuch Vergleich von PE-Pyrolysegas


Darstellung von Kaliumtetrachloroiodat(III) K[ICl 4 ]

Darstellung von Kaliumtetrachloroiodat(III) K[ICl 4 ] Darstellung von Kaliumtetrachloroiodat(III) K[ICl 4 ] Andreas J. Wagner 29. Juli 2004 1 Theorie Die Elemente der 17.Gruppe, die Halogene, treten in organischen und vielen anorganischen Verbindungen fast


Physikalische Chemie 19.06.2002 SS 2002. Versuch 7 : Aufnahme einer Adsorptionsisothermen

Physikalische Chemie 19.06.2002 SS 2002. Versuch 7 : Aufnahme einer Adsorptionsisothermen Physikalische Chemie 19.06.2002 SS 2002 Praktikumprotokoll Versuch 7 : Aufnahme einer Adsorptionsisothermen von Joanna Swidlinski Matrikelnr.: 200124158 Annika Dettloff Matrikelnr.: 200124116 1 Physikalische


4. Quantitative Bestimmung von Eisen(II) durch Redoxtitration mit Kaliumpermanganat

4. Quantitative Bestimmung von Eisen(II) durch Redoxtitration mit Kaliumpermanganat Redoxtitration 29. Quantitative Bestimmung von Eisen(II) durch Redoxtitration mit Kaliumpermanganat Einleitung Eisen ist das mit Abstand wichtigste Gebrauchsmetall. Aufgrund seines elektrochemisch sehr


NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts


Die sprühende Vereinigung von Aluminium und Brom

Die sprühende Vereinigung von Aluminium und Brom Reaktionsgleichung 3 2 l + 2 Al s 2 Al 3 solv Zeitbedarf Vorbereitung: 10 min. Durchführung: 5 min. Nachbereitung: 10 min. Chemikalienliste Edukte Chemikalien Summen- Menge R-Sätze S-Sätze formel Schuleinsatz


Trennungsverfahren Techniken (in der Biologie)

Trennungsverfahren Techniken (in der Biologie) Trennungsverfahren Techniken (in der Biologie)? Biomoleküle können getrennt werden aufgrund ihrer - chemischen Eigenschaften: Ladung, Löslichkeit, Wechselwirkung mit spezifischen Reagenzen, Molmasse -


Abituraufgaben Manganometrie 1979/I/4 1980/I/1 1982/I/1 1983/III/1 1984/I/1

Abituraufgaben Manganometrie 1979/I/4 1980/I/1 1982/I/1 1983/III/1 1984/I/1 Abituraufgaben Manganometrie 1979/I/4 4. Die Konzentration einer schwefelsauren Wasserstoffperoxidlösung soll manganometrisch bestimmt werden. 4.1 Leiten Sie die grundlegende Redoxgleichung aus Teilgleichungen





Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila 01.-04.03.04 Joachim Marhold, Regine Garcia Boy, Natascha Kunert, Cora Mund, Frank Lyko Programm 01.03.04: Präparation genomischer


Chemische Reaktionen ergeben neue Stoffe mit neuen Eigenschaften

Chemische Reaktionen ergeben neue Stoffe mit neuen Eigenschaften 1 Grundbegriffe 1.1 Die Entwicklung der Chemie Im Vergleich zu anderen Naturwissenschaften wie der Physik oder der Biologie ist die Chemie eine junge Wissenschaft. Denn erst vor etwa 200 Jahren gelangten


Analyse von Lupinenalkaloiden

Analyse von Lupinenalkaloiden Analyse von Lupinenalkaloiden Beitrag zur Lupinentagung 26./27. Nov. 2001, Heidelberg Dr. Joachim Emmert, Institut für Pharmazeutische Biologie, Universität Heidelberg Verschiedene Klassen von Alkaloiden


Vom Alkohol zum Alken

Vom Alkohol zum Alken 1 Schulversuchspraktikum Olga Streck Sommersemester 2012 Klassenstufe 9 & 10 Vom Alkohol zum Alken 2 Auf einem Blick: Diese Unterrichtseinheit für die Klasse 9 & 10 enthält Lehrerversuche und 1 Schülerversuch


ZHW / CB / AnP SS 03. Quantitative Bestimmung von Co- und Ni-Ionen im Gemisch Kinetische Untersuchungen an Farbstoffen

ZHW / CB / AnP SS 03. Quantitative Bestimmung von Co- und Ni-Ionen im Gemisch Kinetische Untersuchungen an Farbstoffen UV/VIS Methode: UV/VIS - Spektrometrie Themen: Analyte: Matrix: Quantitative Bestimmung von Co- und Ni-Ionen im Gemisch Kinetische Untersuchungen an Farbstoffen Ni 2+, 2+, Murexid Rostfreier Stahl, Wasser


Rost und Rostschutz. Beobachtung: Nach wenigen Momenten steigt das Wasser im Glasröhrchen an.

Rost und Rostschutz. Beobachtung: Nach wenigen Momenten steigt das Wasser im Glasröhrchen an. Universität Regensburg Institut für Anorganische Chemie Lehrstuhl Prof. Dr. A. Pfitzner Demonstrationsvortrag im Wintersemester 2010/2011 26.11.2010 Dozentin: Dr. M. Andratschke Referenten: Forster, Robert
