Drosophila melanogaster

Save this PDF as:

Größe: px
Ab Seite anzeigen:

Download "Drosophila melanogaster"


1 Modul biol113 Zellbiologie Drosophila melanogaster Komponenten der angeborenen Immunabwehr

2 Experimente 1) RT (Reverse Transkriptase)-PCR zum Nachweis einer AMP- Expression nach Infektion 1.1 PCR-Reaktion 1.2 Gel-Elektrophorese (klassisch) 2) LacZ-Färbung infizierter Drosophila- Larven

3 Versuchsansatz Kontrolle Infektion 24 h Analysen 1) Änderungen in den Transkriptmengen antimikrobieller Peptidgene à RT-PCR 2) Histologische Analyse der induzierten Expression antimikrobieller Peptidgene mittels Reporterstämmen à Enzymfärbung

4 1) Kontrolle Infektion mrna mrna ss-cdna ss-cdna RT-PCR RT-PCR

5 Kontrolle Infektion mrna mrna ss-cdna ss-cdna RT-PCR RT-PCR

6 3 unterschiedliche cdnas als Template A B C RT-PCR wird pipettiert (ACHTUNG 6 Reaktionen in kleinen Tubes) Kontrollgen = rpl32 AMPgen = dipt PCR-reaktion 45 min PCR-Proben für das Gel vorbereiten (+5 µl Ldye pro Reaktion) Gel laufen lassen (ca. 20 min) & analysieren

7 DNA-Elektrophorese Ethidiumbromid Ethidium bromide

8 DNA-Elektrophorese Alternative Färbung mit MidoriGreen Anregung mit blauem Licht Direkte Ansicht der Proben Ungiftig, nicht mutagen ABER: Nitrilhandschuhe verwenden Sie bitte trotzdem zur Sicherheit.

9 Analytische Gelelektrophorese µl PCR Produkt inkl. Ladepuffer 2. Geben Sie DNA-Mix in die Taschen des Gels 3. Legen Sie ein Spannungsfeld an. Run to Red (Anode +) 4. Aufnahme des Gels

10 Ablauf/Pipettierschema RT-PCR 1 Mastermix vorbereiten Menge Substanz 2 Eppis beschriften 6 Tubes á 0,2 ml 6 4 1,5 ml Probe A B C je 2 µl 70 µl 5 X-Puffer 14 µl dntps (2,5 µm each) 3,5 µl Taq-Polymerase 220 µl H 2 O Auf EIS halten!!!! 5 Kontrollgen LDye je +5 µl rpl32 44 µl DECKEL auch beschriften AMPgen dipt R = rpl32 je 10 µl 1-A-R 7 Primerpaarung Probe Gruppennummer D = dipt 3 RS RAS Primer DS DAS je 0,5 µl

11 Pipettierschema Gelelektrophorese Kammer 1 50bp 50bp rpl32 dipt rpl32 dipt Gruppe 1 Gruppe 2 50bp 50bp rpl32 dipt rpl32 dipt Gruppe 3 Gruppe 4 50bp 2 µl je 10 µl (inkl. LDye)

12 Pipettierschema Gelelektrophorese Kammer 2 50bp 50bp rpl32 dipt rpl32 dipt Gruppe 5 Gruppe 6 50bp 50bp rpl32 dipt rpl32 dipt Gruppe 7 Gruppe 8 50bp 2 µl je 10 µl (inkl. LDye)

13 Versuchsansatz Dipt-Promotor Lac-Z (ß-Galactosidase) Kontrolle Infektion I Infektion II 24 h 24 h

14 LacZ-Färbung X-Gal 5-Brom-4-chlor-3-indoxyl-β-Dgalactopyranosid 5-Brom-4-chlor-indoxyl 5, 5 -Dibrom-4,4 -dichlor-indigo Blauer Farbniederschlag ß-Galaktosidasen spalten ß-glycosidische Bindungen X-Gal ist ein Farbstoff, der nach Umsetzung einen blauen Niederschlag liefert

15 3 unterschiedliche Schalen/Proben mit Larven 1 a) b) c) d) e) f) 2 3 Färbelösung ansetzen Larven präparieren (aufreißen, Gewebe freilegen) Fixieren der Larven (ca. 20 min) Waschen mit Puffer (2-3 X) Färben mit Färbelösung Analysieren/Skizzieren Dipt-Promotor Lac-Z (ß-Galactosidase)

16 Ablauf LacZ-Färbung 1 Färbelösung vorbereiten 2 Fixierlösung vorbereiten 300 µl 3 Gewebe präparieren 4 20 min fixieren 6 Färbung 37 C (5-10 min) je 300 µl 5 1xPBS Waschen 3x 5 min je 300 µl 1

17 Zeitplan 1) Vorbesprechung 2) Ansetzen der PCR 3) Start der PCR 4) X-Gal in die Färbelösung geben (37 C) 5) Präparation der Gewebe für die histologische Analyse 6) Fixierung der Gewebe (15-20 min) 7) Waschen der Gewebe (3 X 2 min) 8) Färbelösung auf die Gewebe (s.4) 9) Vorbereitung der PCR-Proben für die DNA Elektrophorese 10) Beladen der Gele (Gele laufen lassen) 11) Analyse der Färbungen 12) Analyse der Gele

18 Modul biol113 Zellbiologie Drosophila melanogaster Komponenten der angeborenen Immunabwehr NACHBESPRECHUNG

19 cdna-sythese (mittels RT) & anschließende PCR = hier RT-PCR

20 Unterschiede: PCR Drosophila vs PCR C. elegans Einsatz des Templates Drosophila PCR - cdna (aus mrna geschrieben) C.ele. PCR - genomische DNA PCR mit cdna Ermöglicht die Analyse exprimierter Gene Überprüfung ob Transkripte vorhanden sind PCR mit gdna Ermöglicht genomische Unterschiede zu identifizieren z.b. Deletionen, Duplikationen

21 Auswertung Gelelektrophorese rpl32 dipt 50bp A B C A B C

22 Auswertung Gelelektrophorese rpl32 dipt 50bp A B C A B C

23 Auswertung LacZ-Färbung???

24 Auswertung LacZ-Färbung keine bis leichte Färbung Färbung im Darm Färbung des Fettkörpers

25 Auswertung LacZ-Färbung keine bis leichte Färbung Färbung im Darm Färbung des Fettkörpers???

26 Auswertung LacZ-Färbung keine bis leichte Färbung Färbung im Darm Färbung des Fettkörpers nur geringe Konz. an AMPS Orale Infektion LOKALE IA Infektion Hämolymphe SYSTMISCHE IA

27 Auswertung LacZ-Färbung keine bis leichte Färbung Färbung im Darm Färbung des Fettkörpers nur geringe Konz. an AMPS Orale Infektion LOKALE IA Infektion Hämolymphe SYSTMISCHE IA

28 Immunabwehr in Drosophila - ein kleiner Überblick zum Schluss - NUR ein angeborenes Immunsystem vorhanden Unterscheidung in à Humorale Abwehr AMPs ROS à Zelluläre Abwehr ROS Plasmatozyten (Phagozytose) Lamellozyten (Einkapselung) Kristallzellen (Melanisierung) Abbildungen-The Host Defense of Drosophila melanogaster Bruno Lemaitre & Jules Hoffmann, 2006


SCRIPTUM HIGH PRECISE Nur für Forschungszwecke Datenblatt Artikel BS.50.020 = 20 Reaktionen x 50 µl Artikel BS.50.100 = 100 Reaktionen x 50 µl Artikel BS.50. 500 = 500 Reaktionen x 50 µl Haltbarkeit: 12 Monate Lagerung bei


F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR

F-I Molekulare Zoologie: Teil I: Expressionsanalysen. Expressionsanalyse mittels RT-PCR F-I Molekulare Zoologie: Teil I: Expressionsanalysen Expressionsanalyse mittels RT-PCR Inhalt: Seite I. Generelles 1 II. RNA-Aufreinigung mit EZNA Total RNA Kit (PeqLab)...2 III. Umschreiben von RNA in


Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR

Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Praktikum: Nachweis einer gentechnischen Veränderung in Lebensmitteln durch PCR Vorbereitung Lehrer Für jede Arbeitsgruppe werden 550 µl InstaGene-Matrix aliquotiert! Das Tube wird mit IG beschriftet!


Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen

Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Squish PCR: Zeitsparende Methode zur Genotypisierung von Drosophila Stämmen Einleitung: Drosophila melanogaster hat sich als Modellorganismus in der Entwicklungsbiologie und der Genetik bewährt, und findet


Protokoll Praktikum für Humanbiologie Studenten

Protokoll Praktikum für Humanbiologie Studenten Protokoll Praktikum für Humanbiologie Studenten Teil A: Charakterisierung der Auswirkungen von γ Interferon auf die Protein und mrna Mengen in humanen A549 Lungenepithelzellen. Studentenaufgaben Tag 1


Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt.

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt. Western Blot Der Western Blot ist eine analytische Methode zum Nachweis bestimmter Proteine in einer Probe. Der Nachweis erfolgt mit spezifischen Antikörpern, die das gesuchte Protein erkennen und daran


Auf der Suche nach der Wundermedizin

Auf der Suche nach der Wundermedizin Auf der Suche nach der Wundermedizin Experimente im Schullabor 1 Herausgeber Novartis Pharma AG, CH-4002 Basel Autoren: Dr. Gesche Standke und Dr. Christiane Röckl Michel Zeichnungen: Fonds der Chemischen


Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983


Etablierung einer. Homemade - PCR

Etablierung einer. Homemade - PCR Etablierung einer Homemade - PCR Anja Schöpflin Institut für Pathologie Universitätsklinikum Freiburg Überblick: Anwendungsgebiete der PCR Anforderungen an Primer Auswahl geeigneter Primer / Primerdesign


Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf


Borrelia burgdorferi s.l.

Borrelia burgdorferi s.l. BACTOTYPE PCR Amplification Kit Borrelia burgdorferi s.l. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis


Mycoplasma gallisepticum

Mycoplasma gallisepticum BACTOTYPE PCR Amplification Kit Mycoplasma gallisepticum Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis


Auf der Suche nach der Wundermedizin

Auf der Suche nach der Wundermedizin Auf der Suche nach der Wundermedizin Experimente im Schullabor 1 Herausgeber Novartis Pharma AG, CH-4002 Basel Autoren: Dr. Gesche Standke und Dr. Christiane Röckl Michel Zeichnungen: Fonds der Chemischen


Produktkatalog 2010. Molekularbiologische Reagenzien

Produktkatalog 2010. Molekularbiologische Reagenzien Produktion, Vertrieb und Serviceleistung im Bereich der Molekularbiologie und Medizin Produktkatalog 2010 Molekularbiologische Reagenzien Molegene GmbH Bienenweg 28 35764 Sinn Tel. 02772-570952 Fax 02772-570945


Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig

Chlamydia sp. BACTOTYPE PCR Amplification Kit. Gebrauchsanweisung. Labor Diagnostik Leipzig BACTOTYPE PCR Amplification Kit Chlamydia sp. Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen


Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint

Versuchsanleitung: RFLP als Modell für einen DNA-Fingerprint RFLP als Modell für einen DNA-Fingerprint Teil 1: Restriktionsverdau 1.1: Thermoblock / Wasserbad auf 37 C vorheizen 1.2: Puffer Y+/Tango auftauen und auf Eis stellen 1.3: 4 Proben, RSA I und H 2 O demin.


Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten

Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten Praktikumsteil Charakterisierung und Genotypisierung floraler homöotischer Mutanten Im diesem Praktikumsteil sollen homöotische Mutanten von Arabidopsis untersucht werden. Abb 1, Aufbau einer Blüte einer


Gentechnologie: Isolierung und Charakterisierung von DNA

Gentechnologie: Isolierung und Charakterisierung von DNA Genetisches Grundpraktikum 9. Kurstag 23.06.2005 Gentechnologie: Isolierung und Charakterisierung von DNA Lerninhalte: Klonierung, Plasmid, Polylinker ( multiple cloning site ), Restriktionsendonuklease,


Protokoll zur Übung PCR

Protokoll zur Übung PCR Protokoll zur Übung PCR im Rahmen des Praktikums Labor an der TU Wien Durchgeführt bei Ao.Univ.Prof. Mag. Dr.rer.nat. Robert Mach Verfasser des Protokolls: Gwendolin Korinek 0625083 & Daniel Bomze 0726183


Inhaltsverzeichnis. Polymerase Chain Reaction Theoretischer Hintergrund - 2 -

Inhaltsverzeichnis. Polymerase Chain Reaction Theoretischer Hintergrund - 2 - Inhaltsverzeichnis 1 Theoretischer Hintergrund - 2-1.1 Die Komponenten der PCR - 2-1.2 Das Verfahren der PCR - 3-1.3 Die Gelelektrophorese - 5-2 Material und Methoden - 6-3 Ergebnisse - 7-3.1 Ergebnisse


Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein

Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein Molekulare Verfahren im Kontext mit klinischer Praxis und Bestandsbetreuung beim Schwein DNA-Extraktion Photometrie Polymerase-Kettenreaktion (PCR) Restriktionsanalyse Agarose-Gelelektrophorese Polyacrylamid-Gelelektrophorese


Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers FIGURE 20.1 Biology 6/e Biotechnologie Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli


Mycobacterium paratuberculosis

Mycobacterium paratuberculosis BACTOTYPE PCR Amplification Kit Mycobacterium paratuberculosis Labor Diagnostik Leipzig Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE PCR Amplification Kit umfasst optimierte Systeme zum Nachweis


Tierartbestimmung mittels spezifischer Polymerasekettenreaktion

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion Einleitung Der Tierart-Kit SK1-12 enthält die notwendigen Materialien, um verarbeitete Tierarten in gängigen Fleisch- und Milchprodukten, z.b. Wurst oder Käse zu bestimmen. Ein Lehrerheft und fünf Schülerhefte,


GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR)

GVO-Screening Kit. Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) GVO-Screening Kit Nachweis von gentechnischen Veränderungen mittels Polymerasekettenreaktion (PCR) I. Einführung Die Gentechnik stellt die Landwirtschaft vor neue Herausforderungen. Einerseits eröffnet


Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele

Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Versuch 1: Restriktionsenzyme als molekulare Werkzeuge Versuchsinhalt Restriktion zweier Plasmide zur Erstellung einer physikalischen Karte, Grundlagen der DNA- Trennung und Analyse über Agarosegele Zwei


Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert

Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert Aus dem Institut für Funktionelle und Klinische Anatomie der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Die Connexine Cx33 und Cx43 werden in der Retina der Ratte tageszeitlich reguliert


Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien


Charakterisierung von Transkripten mittels RT-PCR

Charakterisierung von Transkripten mittels RT-PCR Charakterisierung von Transkripten mittels RT-PCR Versuchsleiter: Ulrike Gerischer Protokollführung: Karl Varadi Gruppe: 11 Durchführung: 18.11 22.11.2002 Protokoll testiert: WS02 Universität Ulm Inhaltsverzeichnis


Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Zellzyklus- und neuronale Gene in Trichoplax adhaerens S. Sagasser Praktikanten: Patrick Reinke und Jan Kleveman Betreuerin: Karolin von der Chevallerie


4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien

4. ERGEBNISSE. 4.2. Untersuchung des umgelagerten IgH Gens in Hodgkinzelllinien 36 4. ERGEBNISSE 4.1. Immunglobulin Gentranskripte in Hodgkinzelllinien Mit Hilfe der RT PCR untersuchten wir die Expression umgelagerter Ig Gene in den Hodgkinzelllinien L1236, L428, L591 und KM-H2 sowie


Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................


3 GFP green fluorescent protein

3 GFP green fluorescent protein SCHNUPPERKURS GENTECHNIK 1 ExploHeidelberg 2 Klonierung des Phagen Lambda 3 GFP green fluorescent protein 4 Gens in a bottle Vanessa Hecht 1 ExploHeidelberg Stiftung Jugend und Wissenschaft GmbH Technologiepark


AdnaTest ER/PR-Detect

AdnaTest ER/PR-Detect PCR-Expressionsanalyse der Östrogen- und Progesteron- Hormonrezeptoren in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-532 Inhaltsverzeichnis Bestellinformation... 3 Anwendungszweck...


Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung Sequenzierung von Thomas Grunwald Abteilung für Med. und Mol. Virologie Sequenzierung Hintergrund Allgemeiner Überblick Funktionsweise der Sequenzierung Sequenzierungsprotokoll Auswertung der Daten Probleme


Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48

Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 Gebrauchsanleitung ChromoQuant QF-PCR Kit P/N 412.001-48 ChromoQuant Das ChromoQuant in vitro Diagnose-Set QF-PCR 1 zur Analyse von häufigen chromosomalen Erkrankungen der Chromosomen 13, 18 und 21 412.001-48u


Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt.

Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. - 22-4 Ergebnisse 4.1 RT-PCR Die RT-PCR Untersuchungen wurden anhand 27 Struma nodosa- (siehe Tab. 7) und 15 Adenom- (siehe Tab. 11) Präparaten durchgeführt. 4.1.1 Struma nodosa Histologie Fas Fas CD 97


Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich?

Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Qualitätskontrolle von Lebensmitteln: Was esse ich wirklich? Im Unterricht habt ihr bereits einige Methoden und Vorgehensweisen der Molekularbiologie kennengelernt. Aber wo finden diese Methoden im täglichen


Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Monokotylen Vorbereitung auf diesen Praktikumsteil: Organisation - Für den Bioinformatik-Teil benötigen Sie pro Gruppe einen Laptop -


AdnaTest EMT-2/StemCell Add-on ProstateDetect

AdnaTest EMT-2/StemCell Add-on ProstateDetect AdnaTest EMT-2/StemCell Add-on ProstateDetect RT-PCR-Nachweis von Prostatakrebs-assoziierter Genexpression in angereicherten Tumorzellen Nur für Forschungszwecke Gebrauchsanweisung T-1-537-PP Inhaltsverzeichnis


'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?


Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR

Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Protokoll Versuch A1 Klonierung des Tyro3-D1D2-Fragments mittels PCR Gruppe 8 Susanne Duncker und Friedrich Hahn Einleitung und Aufgabenstellung Ziel dieses Versuchs ist es, das Gen für ein bestimmtes


Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS

Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Anwendungsbericht zur Herstellung des Proteins GST-GFP-NLS Von: Andreas Tschammer, Fachhochschule Aalen-Hochschule f. Technik und Wirtschaft, Fachbereich Chemie, Schwerpunkt Molekulare Biotechnologie Material


Medizinische Fakultät Auswertestrategien von Microarrays Einführung

Medizinische Fakultät Auswertestrategien von Microarrays Einführung Medizinische Fakultät Auswertestrategien von Microarrays Einführung PD Dr. Knut Krohn IZKF Leipzig Dr. Markus Eszlinger Med. Klinik III Forschungslabor DNA RNA Hintergrund Charakteristisches Muster der


Plasmidpräparation aus Bakterien Inhalt

Plasmidpräparation aus Bakterien Inhalt Inhalt Einleitung... 2 Materialien... 4 Gewinnung der Bakterien... 6 Zerstörung der Bakterien... 7 Trennung von Plasmid-DNA und genomischer DNA... 8 Reinigung der Plasmid-DNA... 10 Elution der gereinigten


PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen


Entwicklungsbiologie der Pflanzen biol 117

Entwicklungsbiologie der Pflanzen biol 117 Entwicklungsbiologie der Pflanzen biol 117 WS 2015/2016 Prof. Dr. Margret Sauter und Mitarbeiter Inhaltsverzeichnis Versuchsplan der einzelnen Kurstage 3 Seite Versuch 1 Auftrennung von Proteinen über


Integron und Integrase

Integron und Integrase Integron und Integrase Ein Versuch zum Nachweis von Antibiotikaresistenzen. Ein NUGI-Projekt am Albert-Einstein-Gymnasium, Wiblingen These Der Einsatz von Antibiotika führt zu einer erhöhten Resistenzbildung


Genetik Praktikumsklausur SS2005

Genetik Praktikumsklausur SS2005 Genetik Praktikumsklausur SS2005 1. Aufgabe: Der Genotyp AbaB wird geselbstet, dabei werden 256 Nachkommen gebildet. Davon erhalten 16 Pflanzen den Genotyp ABAB a) gekoppelt b) nicht gekoppelt c) teilweise


Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch

Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch (Fotos vom 6. März 2013 Molekularbiologisches Praktikum 12 G-Kurs Biologie Herr Korne - am KOMM Homburg/Saar unter Anleitung von Frau Dr. Amoroso)


Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers

Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers Praktikum Biochemie Einführung in die Molekularbiologie Bettina Siebers Rekombinante Expression einer Esterase aus Pseudomonas aeruginosa in E. coli Polyacrylamide Gelelektrophorese (PAGE) Denaturierende


Molekulare Mechanismen der Signaltransduktion

Molekulare Mechanismen der Signaltransduktion Molekulare Mechanismen der Signaltransduktion 07 - Identifizierung von ARF1 + Hinweise für Vorträge Folien: http://tinyurl.com/modul-mms http://www.pnas.org/content/111/14/5427/f1.large.jpg neues Modell


Transcriptomics: Analysis of Microarrays

Transcriptomics: Analysis of Microarrays Transcriptomics: Analysis of Microarrays Dion Whitehead dion@uni-muenster.de Division of Bioinformatics, Westfälische Wilhelms Universität Münster Microarrays Vorlesungsüberblick : 1. Überblick von Microarray


Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR

Genexpressionsanalyse von DNA-Reparaturgenen in primären. Fibroblasten von Tumorpatienten mittels Real Time-PCR Aus dem Institut für Humangenetik der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Genexpressionsanalyse von DNA-Reparaturgenen in primären Fibroblasten von Tumorpatienten mittels Real


Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 7 (11.07-15.07.) Methoden und Techniken II 1. Sie bekommen


AdnaTest ColonCancerDetect

AdnaTest ColonCancerDetect AdnaTest ColonCancerDetect RT-PCR-Nachweis von Darmkrebs-assoziierter Genexpression in angereicherten Tumorzellen Zur In-vitro-Diagnostik Gebrauchsanweisung T-1-505 Inhaltsverzeichnis Bestellinformation...


PCR. Inhalt. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR?

PCR. Inhalt. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Eine Definition. Was ist PCR? Inhalt Was ist? Eine Definition Optimierung Anwendungsgebiete - in der Gentechnologie - in der Diagnostik Zusammenfassung von Christian Jogler (Abteilung für Mol. & Med. Virologie) Was ist? Eine Definition


Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers

Praktikum Biochemie Einführung in die Molekularbiologie. Bettina Siebers Praktikum Biochemie Einführung in die Molekularbiologie Bettina Siebers (4) Rekombinante Expression einer Esterase aus Pseudomonas aeruginosa in E. coli Proteinreinigung Techniken & Methoden der Proteinreinigung



VORANGEGANGENE MODELLE VORANGEGANGENE MODELLE UNSER THEMA HEUTE Ziel dieses Papers: - Nähere Charakterisierung der AuxREs - Analyse eines zu den AuxREs gehörenden Transkriptionsfaktors WAS BEREITS BEKANNT WAR: - Auxin moduliert


Western-Analyse Protein-Elektrophorese ELISA Protein-Chip

Western-Analyse Protein-Elektrophorese ELISA Protein-Chip Western-Analyse Protein-Elektrophorese ELISA Protein-Chip DNA-RNA RNA-Protein Die Struktur der DNA Ebene der Proteinstruktur Die Gruppen der Aminosäuren Darstellung Räumliche R Proteinstrukturen (Röntgen


Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik

Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Entwicklung und Validierung von multiplex real-time RT-PCR assays in der Virusdiagnostik Bernd Hoffmann, Klaus R. Depner, Horst Schirrmeier & Martin Beer Friedrich-Loeffler-Institut Greifswald-Insel Riems


Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese


Vorbereitungen. 1 Vortage: - Mit LehrerIn Kontakt aufnehmen: Schüler sollen Geranienblätter mitbringen!! - sonst: Geranienblätter besorgen!!

Vorbereitungen. 1 Vortage: - Mit LehrerIn Kontakt aufnehmen: Schüler sollen Geranienblätter mitbringen!! - sonst: Geranienblätter besorgen!! Vorbereitungen 1 Vortage: - Mit LehrerIn Kontakt aufnehmen: Schüler sollen Geranienblätter mitbringen!! - sonst: Geranienblätter besorgen!! 2 am Tag: - alle Reagenzien aus dem Kühlschrank holen: sie sollten


Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden Molbi Nachklausur 2009 Hier mal so die Fragen die mir noch so einfallen. Also es war gefragt: Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich


Inhalt 1 Das Immunsystem Rezeptoren des Immunsystems

Inhalt 1 Das Immunsystem Rezeptoren des Immunsystems Inhalt 1 Das Immunsystem 1.1 Bedeutung des Immunsystems..................................... 1 1.2 Das Immunsystem unterscheidet zwischen körpereigen und körperfremd.................................................


1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli





Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Inaugural-Dissertation zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen


Versuch Blut Hämoglobin

Versuch Blut Hämoglobin Versuch Blut Hämoglobin Dieser Versuchstag soll ihnen eine Reihe unterschiedlicher Techniken sowie Eigenschaften von Blutfarbstoffen nahebringen. Blutfarbstoffe dienen im nahezu gesamten Tierreich dem


Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen

Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Praktikumsteil: 3 - RACE-PCR und Klonierung von MADS-Box- Genen aus Tulpen Vorbereitung auf diesen Praktikumsteil: Organisation 2. Praktikumstag: - Für den Bioinformatik-Teil benötigen Sie am 2. Tag dieses


Genetik im Unterricht WS 01/02

Genetik im Unterricht WS 01/02 Fachdidaktisches Praktikum B.Durst, H-G.Edelmann Stand 24. 2. 02 Seite 32 AB 1 für LehrerInnen Seite 1/5 Vorbereitungen 1 Vortage: - Mit LehrerIn Kontakt aufnehmen: Schüler sollen Geranienblätter mitbringen!!


C V C. Gebrauchsanweisung für Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revision 2. Juli 2014

C V C. Gebrauchsanweisung für Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02. Revision 2. Juli 2014 DOT133v1 Instructions for Use Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Seite 1 von 7 Gebrauchsanweisung für Biofortuna SSPGo TM HLA No Template Control Kit BF-40-02 Revision 2 Juli 2014


Reagenzien-Wegweiser für das LightCycler 480 System

Reagenzien-Wegweiser für das LightCycler 480 System Reagenzien-Wegweiser für das LightCycler 480 System qpcr Reagenzien in Premium Qualität für jede Applikation die optimale Lösung www.roche-applied-science.com Roche Applied Science Haben Sie schon Ihr


AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig

AUFGABENSAMMLUNG. Restriktionsenzyme. Füllen Sie den Lückentext aus. Gentechnik Schroedel, Braunschweig Restriktionsenzyme Füllen Sie den Lückentext aus. PCR 1a Mit dem folgenden Quiz können Sie Ihr Wissen zum Thema PCR überprüfen. Klicken Sie jeweils die richtige Antwort an. PCR 1b Mit dem folgenden Quiz


Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose

Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen pulmonalen Fibrose und Sarkoidose Aus der Medizinischen Universitätsklinik und Poliklinik Abteilung für Pneumologie der Albert-Ludwigs-Universität Freiburg im Breisgau Die Rolle des NLRP3- Inflammasom in der Pathogenese der idiopathischen


Elektrophorese. Zentrum für Mikro- und Nanotechnologien http://www.tu-ilmenau.de/nano

Elektrophorese. Zentrum für Mikro- und Nanotechnologien http://www.tu-ilmenau.de/nano Elektrophorese Die SDS- Polyacrylamidgelelektrophorese ist eine schnelle und empfindliche Methode, die zudem eine hohe Auflösung erlaubt. Schon 1 μg (2 pmol) eines Proteins ergeben eine erkennbare Bande.


Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila

Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila Funktionelle Organisation des Zellkerns: DNA-Methylierung in Drosophila 01.-04.03.04 Joachim Marhold, Regine Garcia Boy, Natascha Kunert, Cora Mund, Frank Lyko Programm 01.03.04: Präparation genomischer


Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom...

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... Inhaltsverzeichnis Abkürzungsverzeichnis... 7 Inhaltsverzeichnis... 11 Abbildungsverzeichnis... 17 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... 21 1.1.2 Protein-Protein Interaktionen allgemein...


Platzhalter für Bild

Platzhalter für Bild Instrumentelle Bioanalytik in der Molekularbiologie Anke Neumann Platzhalter für Bild KIT die Kooperation von Forschungszentrum Karlsruhe GmbH und Universität Karlsruhe (TH) www.kit.edu Motivation und


1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II

1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II Arbeitsblatt 1 Analyse von DNA 1-A: Schneiden des Plasmids pucd-lacz mit dem Restriktionsenzym Ban II Bevor Sie anfangen: Alle Reagenzien müssen vor Gebrauch vollständig aufgetaut sein und durchmischt


Hochdurchsatz HLA-Typisierung mit Next Generation Sequencing und Hamilton Robotics

Hochdurchsatz HLA-Typisierung mit Next Generation Sequencing und Hamilton Robotics Hochdurchsatz HLA-Typisierung mit Next Generation Sequencing und Hamilton Robotics Dr. med. Kaimo Hirv Zentrum für Humangenetik und Laboratoriumsmedizin Dr. Klein & Dr. Rost Lochhamer Str. 29 D-82152 Martinsried


Zwischenbericht: Research Project on Sebaceous Adenitis (SA) Dr. Ina Pfeiffer Institute of Veterinary Medicine University of Göttingen

Zwischenbericht: Research Project on Sebaceous Adenitis (SA) Dr. Ina Pfeiffer Institute of Veterinary Medicine University of Göttingen Zwischenbericht: Research Project on Sebaceous Adenitis (SA) Dr. Ina Pfeiffer Institute of Veterinary Medicine University of Göttingen SA betroffene Akita Photograph: Joop & Astrid Ouwerkerk Photograph:


Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP

Informationsveranstaltung Heimtierfuttermittel. PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln. C. Haldemann, ALP Informationsveranstaltung Heimtierfuttermittel PCR-Analytik zur Bestimmung von GVOs in Heimtierfuttermitteln C. Haldemann, ALP Grundidee des Nachweises von GVOs mittels PCR Die Bestimmung genveränderter


Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Versuch 2: Polymerasekettenreaktion Betreuer: Knut Jahreis Versuchsinhalt Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Zwei verschiedene Plasmide werden als Matrizen für eine Polymerasekettenreaktion


In situ Hybridisierung

In situ Hybridisierung In situ Hybridisierung eine Methode zum direkten und spezifischen Nachweis von Nukleinsäuren (DNA und RNA) in Gewebe, Zellen, Zellkompartimenten und Chromosomen Was kann damit erreicht werden? direkte


Mikrotechnik schafft neue Diagnosemöglichkeiten

Mikrotechnik schafft neue Diagnosemöglichkeiten Mikrotechnik schafft neue Diagnosemöglichkeiten Dr. Klaus Stefan Drese Institut für Mikrotechnik Mainz GmbH IMM - 1 Typische Größen / Längenskalen Mt. Everest Eiffel Tower Eiffelturm Mount Everest Earth


Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005

Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005 Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005 F1 Molekulare Zoologie Teil II: Expressionsanalyse Proteinexpressionsanalyse


1 Einleitung... 1. 1.4 Glucoserepression...3. 1.8 Zielsetzung... 24. 2 Material und Methoden... 25

1 Einleitung... 1. 1.4 Glucoserepression...3. 1.8 Zielsetzung... 24. 2 Material und Methoden... 25 Inhaltsverzeichnis 1 Einleitung... 1 1.1 Zuckerstoffwechsel von Saccharomyces cerevisiae... 1 1.2 Glucoseinaktivierung... 2 1.3 Glucoseinduzierter gezielter mrna-abbau... 3 1.4 Glucoserepression...3 1.5


Hohe Sensitivität und Spezifität: Alle Komponenten sind genauestens aufeinander abgestimmt

Hohe Sensitivität und Spezifität: Alle Komponenten sind genauestens aufeinander abgestimmt BACTOTYPE PCR Amplification Kit Mycoplasma synoviae Gebrauchsanweisung Technologie Die Produktgruppe BACTOTYPE Amplification Kit umfasst optimierte Systeme zum Nachweis von pathogenen Bakterien mittels


Methodensammlung des LAG PCR-Nachweis der p35s / pat - Genkassette in transgenen Kulturpflanzen

Methodensammlung des LAG PCR-Nachweis der p35s / pat - Genkassette in transgenen Kulturpflanzen Methodensammlung des LAG PCR-Nachweis der p35s / pat - Genkassette in transgenen Kulturpflanzen erstellt vom Unterausschuß Methodenentwicklung des LAG Status: verabschiedet 1 Zweck und Anwendungsbereich


Transgene Organismen

Transgene Organismen Transgene Organismen Themenübersicht 1) Einführung 2) Komplementäre DNA (cdna) 3) Vektoren 4) Einschleusung von Genen in Eukaryontenzellen 5) Ausmaß der Genexpression 6) Genausschaltung (Gen-Knockout)


Projektskizze: Studie/ Auswertung/ Publikation

Projektskizze: Studie/ Auswertung/ Publikation Projektskizze: Studie/ Auswertung/ Publikation Name: PD Dr. Dr. Robert Bals, CAPNetz C11 Datum: 30. 8. 2007 Institution(en)/Autor(en): Klinikum der Universität Marburg Klinik für Innere Medizin mit Schwerpunkt


Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt


Alternative Energien das Solarhaus [BAD_ DOC]

Alternative Energien das Solarhaus [BAD_ DOC] Alternative Energien das Solarhaus [BAD_1093051.DOC] Brustkrebs und familiärer Brustkrebs In Deutschland erkranken jährlich rund 55.000 Frauen an Brustkrebs. Vor wenigen Jahren noch war diese Krankheit


Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32

Inhaltsverzeichnis. 1. Einleitung... 9. 2. Material und Methoden... 32 Inhaltsverzeichnis 1. Einleitung... 9 1.1 Posttranslationale Modifikationen... 10 1.2 N-Glykosylierung... 11 1.3 O-Glykosylierung... 12 1.4 Veränderungen der Glykosylierung bei der Tumorentstehung... 13


Rapid by Nature, Accurate by Design

Rapid by Nature, Accurate by Design LightCycler 480 System Rapid by Nature, Accurate by Design www.roche-applied-science-com www.roche-applied-science.com 1 LightCycler Systeme Technologische (R)evolutionen Genauigkeit Schnelligkeit Sensitivität


Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94.

Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94. In diesem Skript wird der Versuch unternommen, der Prozess Pyrosequencing so zu erklären, dass Schüler die Chance haben Pyrosequencing zu verstehen. Es basiert auf einem Vortrag im Rahmen des Science Bridge


SingleQuant Assay Kit

SingleQuant Assay Kit GEBRAUCHSANLEITUNG SingleQuant Assay Kit Kit für die Proteinkonzentrationsbestimmung (Kat.-Nr. 39226) SERVA Electrophoresis GmbH Carl-Benz-Str. 7 D-69115 Heidelberg Phone +49-6221-138400, Fax +49-6221-1384010


Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase)

Status: verabschiedet. Alternativ kann zur Kontrolle ein 248 bp-fragment aus dem Raps- spezifischen pepc-gen (Phosphoenolpyruvate-Carboxylase) Methodensammlung des LAG PCR-Nachweis der 35S-nptII-Übergangssequenz, der pnapin-bayte- Übergangssequenz und des plsc-gens erstellt vom Unterausschuss Methodenentwicklung des LAG Status: verabschiedet
