Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem

Größe: px
Ab Seite anzeigen:

Download "Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem"

Transkript

1 3 Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem 3.1 Pharmakologische Aspekte des Alkohols 3.2 Pharmakologische Aspekte des Nikotins 3.3 Tiermodelle zur Alkohol abhängigkeit 3.4 Tiermodelle zur Nikotin abhängigkeit 3.5 Neuroimaging und Alkohol 3.6 Neuroimaging und Tabak 3.7 Genetik der Alkoholabhängigkeit 3.8 Genetik der Nikotinabhängigkeit 3.9 Psychiatrische Komorbidität bei Alkohol- und Tabakabhängigkeit 3.10 Hirnorganische Erkrankungen und peripheres Nervensystem

2

3 Pharmakologische Aspekte des Alkohols Rainer Spanagel Einleitung Alkohol folgt dem pharmakologischen Leitmotiv Dosis sola venenum facit (deutsch: Allein die Menge macht das Gift ). In geringen Mengen genossen kann Alkohol durchaus eine Reihe von positiven Wirkungen erzielen. Große epidemiologische Datensätze belegen protektive Effekte von geringem bis moderaten Alkoholkonsum bei koronaren Herzerkrankungen, Typ-2-Diabetes und einigen Krebserkrankungen (Spanagel 2009). Dies soll jedoch nicht darüber hinweg täuschen, dass es gerade bei gesteigertem Alkoholkonsum akut zur Intoxikation und bei chronischer Aufnahme von größeren Alkoholmengen zu multiplen Organschädigungen kommen kann. Die Pharmakologie beschäftigt sich sowohl mit pharmakokinetischen als auch mit pharmakodynamischen Aspekten. Dieses Kapitel beschränkt sich auf die Darstellung der Wirkung von Alkohol auf Neurotransmitter und Neuropeptidsystemen und den hiermit assoziierten Veränderungen in neuronalen Signaltransduktionskaskaden. Diese neuropharmakodynamischen Aspekte von Alkohol stehen auch exemplarisch für pharmakologische Wirkmechanismen in peripheren Organen Primäre Angriffsstellen des Alkohols Welche Mechanismen sind dafür verantwortlich, dass Alkohol auf das Zentralnervensystem (ZNS) einwirkt? Erst in letzter Zeit hat sich die so genannte Proteintheorie (die besagt, dass Ethanol in erster Linie Membranproteine angreift) gegen die Lipidtheorie (der zufolge Ethanol in erster Linie auf Membranlipide einwirkt) durchgesetzt (Peoples et al. 1996). Bis in die 1990er-Jahre postulierte eine Reihe von Lipidtheorien, dass die Wirkung von Alkohol dadurch zustande kommt, dass er eine Störung bei den Membranlipiden der Neuronen des ZNS verursacht. Eine besonders attraktive Hypothese zur Wirkung von Alkohol postulierte ursprünglich Effekte auf die Membranfluidität und dadurch eine Störung der Ordnung des Lipidzustands von Membranen. Durch diese primäre Aktion von Alkohol auf Membranlipide könnte auch die Wirkung auf eingelagerte Membranproteine wie Ionenkanäle erklärt werden. Diese Hypothese hat jedoch wesentliche Einschränkungen. Zunächst ist es grundsätzlich nur möglich, die Entstehung von Membranstörungen durch Alkohol bei Alkoholkonzentrationen zu bestimmen, die deutlich über 500 mg/ dl Blutalkohol und somit nahe an der LD 50 von Ethanol beim Menschen liegen. Aus historischen Gründen wird die Blut- alkoholkonzentration in g/kg Blutplasma berechnet und in angegeben. Da Plasma ein spezifisches Gewicht von 1,23 hat, entsprechen 500 mg/dl einer Blutalkoholkonzentration von 4,06. Signifikante Effekte von Membranstörungen auf die Funktion von eingelagerten Membranproteinen kann man sich bei pharmakologisch relevanten Alkoholkonzentrationen sogar noch schwerer vorstellen. Zum Beispiel bei extrem hohen berauschenden Blutalkoholkonzentrationen (~300 mg/ dl), bei denen Bewusstlosigkeit auftritt, käme lediglich ein Alkoholmolekül auf etwa 200 Lipidmoleküle (Peoples et al. 1996). Weiterhin können alkoholinduzierte Wirkungen auf Membranen bei Konzentrationen oberhalb des pharmakologischen Bereichs von einem Temperaturanstieg von nur wenigen Zehntelgrad Celsius simuliert werden (Peoples et al. 1996), wobei allerdings nicht die Verhaltensmerkmale festzustellen sind, die mit einem Alkoholrausch assoziiert sind; ebenso wird die Funktion von Membranproteinen wie neurotransmittergesteuerten Ionenkanälen nicht merkbar verändert. Das führt zu der Schlussfolgerung, dass die beobachtete Wirkung von Alkohol auf Membranfluidität und -organisation ausschließlich biophysikalischer Natur ist und mit der pharmakologischen Wirkung von Alkohol auf das ZNS nichts zu tun hat. Spezifische alkoholsensitive Angriffsstellen auf Rezeptoren und Ionenkanälen Die Proteintheorie sagt voraus, dass Alkohol spezifisch auf Membranproteine wie Rezeptoren und Ionenkanäle einwirkt. Den Hauptgrund für eine Bevorzugung der Proteintheorie stellt der Befund dar, dass Alkohol bereits bei Konzentrationen von mm direkt die Funktion verschiedener Ionenkanäle und Rezeptoren stört (zum Vergleich: eine berauschende Blutalkoholkonzentration von 50 mg/dl entspricht einer Ethanolkonzentration von 10,6 mm). NMDA-Rezeptor. In einer Schlüsselpublikation haben Lovinger et al. (1989) gezeigt, dass die Funktion von NMDA- Glutamatrezeptoren von Ethanol konzentrationsabhängig zwischen 5 und 50 mm inhibiert wurde; in diesem Konzentrationsbereich kommt es auch zu Rauschzuständen. Die Amplitude des NMDA-aktivierten Stroms nahm bei 50 mm Ethanol auf 6 % ab. Überdies besteht zwischen der Fähigkeit verschiedener Alkohole zur Inhibierung NMDA-ak-

4 114 3 Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem tivierten Stroms und der berauschenden Wirkung ein linearer Zusammenhang. Dieser Befund legt nahe, dass die ethanolinduzierte Inhibierung des NMDA-Rezeptors zu den neuralen und kognitiven Schädigungen beitragen kann, die mit einer Alkoholintoxikation assoziiert sind (Lovinger et al. 1989). Aber wie ist es möglich, dass Ethanol die Funktion des NMDA-Rezeptors direkt beeinflusst? Der NMDA-Rezeptor ist ein ligandengesteuerter Ionenkanal und ist heteromer aus NR1-, NR2- (A D) und NR3- Untereinheiten zusammengesetzt. Die NR1-Untereinheit ist entscheidend für die Kanalfunktion, die NR2-Untereinheiten enthalten die Glutamat-Bindungsstelle, und die NR3-Untereinheiten modulieren die Kanalaktivität, vor allem unter pathologischen Bedingungen. Elektrophysiologische Untersuchungen haben gezeigt, dass Ethanol mit Domänen interagiert, die die Kanalaktivität beeinflussen. Das könnte bedeuten, dass Aminosäurenreste in Transmembran-(TM-)Domänen beteiligt sind. Bei der Suche nach einer möglichen Bindungsstelle für Alkohol am NMDA-Rezeptor wurden verschiedene Untersuchungen vorgenommen, die mithilfe gezielter Mutagenese potenzielle Bindungsstellen in den TM3- und TM4-Domänen der NR1- und NR2A-Untereinheiten fanden (Ren et al. 2003, Ren et al. 2007, Ronald et al. 2001, Smothers u. Woodward 2006). Insbesondere führte eine Substitution von Phenylalanin durch Alanin in der TM3-Domäne der NR1-Untereinheit zu einer stark verminderten Ethanolempfindlichkeit (Ronald et al. 2001). GABA A -Rezeptoren. Neben dem NMDA-Rezeptor haben noch weitere Rezeptoren bzw. Ionenkanäle, die im ZNS exprimiert werden, mutmaßliche Bindungsstellen für Alkohol. Insbesondere wird die Funktion von GABA A -Rezeptoren durch Ethanol verstärkt. Der GABA A -Rezeptor-Chloridkanal-Komplex ist ein pentamerer ligandengesteuerter Ionenkanal und der bedeutendste inhibierende Neurotransmitter-Rezeptor im Säugerhirn. Verschiedene Untereinheiten wurden gefunden; die meisten GABA A -Rezeptoren setzen sich aus α, β-, γ- und δ-untereinheiten zusammen. Mithilfe verschiedener Rezeptorkonstrukte konnte eine Region in den TM-Domänen der α- und β-untereinheit des GABA A -Rezeptors gefunden werden, die an der Wirkung von Ethanol beteiligt ist (Mihic et al. 1997); hier kann Ethanol wahrscheinlich an eine wassergefüllte Proteinkavität binden, die sich zwischen TM-Segment 2 und 3 dieser Rezeptoruntereinheiten befindet. Glycinrezeptoren. Aber Ethanol wirkt nicht nur auf GA- BA A -Rezeptoren, sondern auch direkt auf Glycinrezeptoren. Hierzu gibt es sehr überzeugende Hinweise, die zeigen, dass Ethanol spezifische Stellen in den TM-Domänen und gleichfalls in der extrazellulären Domäne der Glycinrezeptoren beeinflusst und dass der Gesamteffekt auf die Rezeptorfunktion die Summe positiver und negativer modulierender Effekte von Ethanol auf eine Reihe ethanolempfindlicher Bindungsstellen ist (Mihic et al. 1997). Acetylcholin-, Serotoninrezeptoren. Außerdem potenziert Ethanol die Wirkung von nikotinischen Acetylcholinrezeptoren (nach) (Narahashi et al. 1999) und Serotoninrezeptoren (5-HT 3 ) (Lovinger u. White 1991). Der 5-HT 3 -Rezeptor vermittelt eine schnelle synaptische Übertragung zu postsynaptischen Stellen und reguliert präsynaptisch die Neurotransmitterausschüttung; auch seine Alkoholsensitivität wurde übereinstimmend bei verschiedenen In-vitro-Präparationen nachgewiesen (McBride et al. 2004). Ionenkanäle. Nicht ligandengesteuerte Ionenkanäle sind ebenfalls ein primäres Angriffsziel von Ethanol. Folglich inhibiert Ethanol dihydropyridinsensitive Kalziumkanäle vom L-Typ. Einkanalmessungen legen nahe, dass die Wirkung von Ethanol auf die Steuerung mit der Interaktion eines einzigen Alkoholmoleküls mit einer einzigen Bindungsstelle am Angriffspunkt, höchstwahrscheinlich dem L-Kanal selbst, erklärt werden kann (Wang et al. 1994). Weiterhin öffnet Ethanol G-Protein-aktivierte einwärtsgerichtete Kaliumkanäle (GIRK; Kobayashi et al. 1999, Lewohl et al. 1999). Die selektive Verstärkung der GIRK2- Funktion durch Ethanolkonzentrationen im berauschenden Bereich wurde an homomeren und heteromeren Kanälen nachgewiesen. Außerdem wurde eine Region mit 43 Aminosäuren im Carboxylende gefunden, die von entscheidender Bedeutung für die Wirkung von Ethanol auf diese Kanäle ist (Kobayashi et al. 1999, Lewohl et al. 1999). Rezeptor zusammensetzung und Empfindlichkeit gegenüber Ethanol GABA A -Rezeptoren. Die beschriebenen grundlegenden inhibitorischen und stimulatorischen Wirkungen von Ethanol auf Ionenkanäle und Rezeptoren werden von verschiedenen Variablen beeinflusst, insbesondere der Ethanolkonzentration und der Kombination von Untereinheiten bei einem bestimmten Kanal oder Rezeptor, wie zum Beispiel bei der Wirkung auf GABA A -Rezeptoren. Die meisten Kombinationen von GABA A -Rezeptor-Untereinheiten zeigen erst bei hohen Ethanolkonzentrationen (>60 mm) eine Reaktion. Enthalten die GABA A -Rezeptoren allerdings δ-untereinheiten, wird deren Aktivität schon bei sehr niedrigen Ethanolkonzentrationen (1 3 mm) beeinflusst. In vivo sind diese GAB A -Rezeptoren ausschließlich mit α4- bzw. α6-untereinheiten und der β-untereinheit assoziiert. Bei α4βδ-kombinationen, die eine β3-untereinheit enthalten, findet sich eine beinahe zehnmal höhere Empfindlichkeit gegenüber Ethanol als bei Rezeptoren, die die β2-untereinheit enthalten, sodass vermutlich auch die β3- Untereinheit eine ethanolempfindliche Bindungsstelle hat (Wallner et al. 2003). Glycin-, Acetylcholin-, Serotoninrezeptoren. Auch die Zusammensetzung der Untereinheiten von Glycin- und anderen Rezeptoren ist von entscheidender Bedeutung für die Reaktion auf Ethanol. Glycinrezeptoren, die α1 enthalten, reagieren empfindlicher auf niedrige Ethanolkonzentrationen als Rezeptoren mit α2 (Mihic 1999).

5 3.1 Pharmakologische Aspekte des Alkohols 115 Außerdem weiß man, dass Ethanolkonzentrationen unter 100 mm nur nach-rezeptoren der Subtypen α2β4, α4β4, α2β2 und α4β2 stimulieren, nicht aber die Subtypen α3β2 und α3β4 (Harris 1999). Höhere Ethanolkonzentrationen sind weniger selektiv und stimulieren nahezu alle nach-rezeptoren. Aufgrund der unterschiedlichen Verteilung der beschriebenen Rezeptoren und ihrer Untereinheiten im Hirn (z. B. werden 5-HT 3 - und neuronale nach-rezeptoren primär im Kortex und einigen limbischen Regionen exprimiert, der NR1/NR2B-Subtyp des NMDA-Rezeptors hingegen im Vorderhirn) kann Ethanol unterschiedlich stark auf verschiedene Hirnregionen einwirken. LUSH Bindungsstelle für Alkohol. Es gibt zurzeit noch keine biophysikalischen Methoden, mit denen man die Bindung von Ethanolmolekülen an diese Rezeptoren oder Ionenkanäle messen kann, weil das Ethanolmolekül zu klein ist und eine geringe Bindungsenergie aufweist und außerdem nur im mittleren Molbereich wirksam ist. Diese pharmakologischen Eigenschaften schließen eine direkte Bestimmung einer ethanolbindenden Proteinstelle aus. Andererseits hat die Entdeckung des LUSH-Proteins in der Fruchtfliege Drosophila melanogaster ermöglicht, ein Modell aufzustellen, wie TM-Reste eine spezifisch ethanolbindende Proteintasche bilden können. Hochauflösende Kristallstrukturen von einem Komplex von LUSH mit verschiedenen kurzkettigen Alkoholen konnten im Jahre 2003 von der Arbeitsgruppe von Jones erhalten werden (Kruse et al. 2003). Die Struktur von LUSH enthält eine spezifische Bindungsstelle für Alkohol. LUSH liegt partiell geschmolzen globulär vor. In Gegenwart von Ethanol in pharmakologisch relevanten Konzentrationen (<50 mm) verschiebt sich das Konformationsgleichgewicht hin zu einem kompakteren Zustand (Bucci et al. 2006), womit gezeigt ist, dass Ethanol eine Konformationsänderung des bindenden Moleküls verursacht eine wichtige Voraussetzung für eine funktionierende Bindungsstelle. Eine Gruppe von Aminosäuren bildet ein Netzwerk konzertierter Wasserstoffbrücken zwischen Proteinund Ethanolmolekül und erzeugt damit ein strukturelles Motiv, mit dem die Affinität für die Bindung von Alkohol in dieser Position verstärkt wird. Dieses Motiv scheint bei Säugern bei einer Reihe von ligandengesteuerten Ionenkanälen konserviert zu sein. Deswegen wird angenommen, dass die Alkoholbindungsstelle in LUSH ein allgemeines Modell für putative Alkoholbindungsstellen bei Proteinen wie NMDA- oder auch GABA A -Rezeptoren darstellt. Bedeutung von LUSH für Fruchtfliegen. Ein interessanter Hinweis zum Schluss: Alkohol ist im Sinnesspektrum von Fruchtfliegen ein wichtiges Geruchssignal; Wildtypfliegen haben einen aktiven olfaktorischen Vermeidungsmechanismus, der dafür sorgt, dass sie nicht von konzentriertem Alkohol angezogen werden, während LUSH-Mutanten anomal von hohen Konzentrationen von Ethanol, Propanol und Butanol angezogen werden, während sie auf andere Geruchsstoffe chemosensorisch normal reagieren (Kim et al. 1998). Die Fähigkeit von Fruchtfliegen, Ethanol festzustellen, ist wichtig für die Chemotaxis in Richtung auf Nahrungsquellen. Allerdings sind adulte Fruchtfliegen auch rauschgefährdet und können durch erhöhte Ethanolkonzentrationen sterben; der Konzentrationsbereich ist dem des Menschen ähnlich, sodass Drosophila das ideale Tiermodell für die Untersuchung der Alkoholwirkung ist (Moore et al. 1998). Für Fruchtfliegen stellt es also einen Selektionsvorteil dar, dass sie in der Lage sind, gefährlich hohe Alkoholkonzentrationen zu meiden; für dieses Vermeidungsverhalten wird LUSH benötigt. Funktionelle Bedeutung der primären Angriffsstellen des Alkohols Insgesamt zeigen die Daten der letzten 20 Jahre, dass Ethanol direkt Membranrezeptoren und Ionenkanäle angreift. Das spricht zugunsten der Proteintheorie, und gegenwärtig wird allgemein angenommen, das Ethanol nur wenige bekannte primäre Angriffsstellen hat wie NMDA-, GABA A -, 5-HT 3 - und nach-rezeptoren; dazu gehören auch Kalziumkanäle vom L-Typ und GIRK, bei denen Ethanolkonzentrationen von nur 1 mm die Funktion dieser Rezeptoren und Ionenkanäle beeinflussen (Spanagel 2009). Zwar wächst das Wissen über die mutmaßlichen Bindungsstellen von Alkohol an Proteine wie den NMDA-Rezeptor kontinuierlich; dennoch steht noch nicht fest, welche Bedeutung diesen Bindungsstellen in funktioneller Hinsicht zuzurechnen ist. Fortschritte in dieser Richtung sind auf neuartige Knockin-Modelle angewiesen, wie sie bereits für den GABA A -Rezeptor beschrieben wurden (Jurd et al. 2003), bei dem die Wildtyp-Rezeptoruntereinheiten durch solche mit alkoholinsensitiven oder -hypersensitiven Stellen ersetzt wurden. Bis dahin müssen wir uns damit begnügen, entweder mit Knockout-Mäusen oder spezifischen pharmakologischen Wirkungen zu arbeiten und dies mit einem geeigneten Verhaltenstest auf die akute berauschende Wirkung von Alkohol zu kombinieren. Ein übliches Verfahren ist der Verlust des Umdrehreflex (Loss of Righting Reflex; LORR), ein Verhaltenstest, mit dem die Relevanz eines bestimmten Rezeptors für die Alkoholintoxikation untersucht wird. Bei diesem Test wird einer Ratte oder Maus eine hohe Ethanoldosis (3 4 g/kg intraperitoneal) injiziert; das Auftreten von Ataxie gilt als Verlust des Stellreflexes. Das Tier wird dann auf den Rücken gelegt, und die Zeitdauer des LORR wird berechnet als die Zeit, die vergeht, bis das Tier sich selbst wieder aufrichten kann. Während der LORR einerseits ein geeigneter Test ist, um zu bestimmen, wie empfindlich das ZNS auf Alkohol reagiert, kann er andererseits nur Verhaltensänderungen bei hypnotisch wirkenden Alkoholkonzentrationen von mindestens 50 mm feststellen, was einer Blutalkoholkonzentration von mehr als 250 mg/dl entspricht. Wie aber bereits

6 116 3 Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem festgestellt wurde, sind die meisten mutmaßlichen Membranbindungsstellen für Alkohol bereits gegenüber weit niedrigeren Ethanolkonzentrationen empfindlich. Daher stellt sich die Frage, wie sich bestimmen lässt, ob die Bindung von Alkohol an diese Stellen eine psychotrope Wirkung hat? Drogen-Diskriminationsverfahren zur Untersuchung der psychotropen Wirkung von Ethanol Drogen-Diskriminationsstudien mit Ethanol als Trainingsdroge stellen eine unschätzbare Hilfe dar, um die psychotropen Effekte bei Alkoholexposition zu untersuchen. Sie können sowohl am Menschen als auch an Versuchstieren durchgeführt werden. Seit mehr als 20 Jahren werden sie dazu herangezogen zu erkennen, ob eine spezifische Bindungsstelle auf einem Protein einen mit Ethanol vergleichbaren interozeptiven Stimulus vermittelt (eine Übersicht über die zahlreichen Studien findet sich unter dd-database.org). Bei einem Diskriminierungstest fragt der Experimentator: Fühlen Sie sich, als wenn Sie Alkohol getrunken hätten?. In der Tat entspricht der diskriminierende Ethanolstimulus weitgehend der subjektiven Wirkung bei Gelegenheitstrinkern und tritt bereits bei Blutalkoholkonzentrationen von 30 mg/dl auf (Jackson et al. 2001). Tiere können in einer operanten Aufgabe dazu trainiert werden, Ethanol von Kochsalzlösung (Plazebo) zu unterscheiden. Anschließend wird in einem so genannten Substitutions-/Generalisierungstest ein spezifischer pharmakologischer Wirkstoff (z. B. ein NMDA-Rezeptor-Blocker wie Memantin oder Ketamin) verabreicht, um festzustellen, inwieweit diese Substanz einen mit Ethanol vergleichbaren Stimulus vermittelt. Bemerkenswert ist, dass in Diskriminationsstudien vom Experimentator verabreichtes Ethanol durch selbst verabreichten Alkohol ersetzt werden kann, denn dies zeigt, dass die psychotrope Wirkung in beiden Fällen gleich ist (Macenski u. Shelton 2001). Überdies trat auch bei gesunden Gelegenheitstrinkern, denen computergesteuert Alkohol intravenös injiziert wurde, eine ähnliche Alkoholwirkung wie beim Trinken ein (Zimmermann et al. 2008). Demnach ist davon auszugehen, dass die psychotrope Wirkung von Alkohol vom Weg der Verabreichung weitgehend unabhängig ist. Wie man aus Substitutionsstudien weiß, können NM- DA-Rezeptor-Antagonisten sowie bestimmte GABA-mimetische Drogen, die an verschiedenen Bindungsstellen des GABA A -Rezeptor-Komplexes wirken, Ethanol vollständig substituieren (Hodge et al. 2006, Kostowski u. Bienkowski 1999). Übereinstimmend wurde an Mäusen, Ratten und Affen gezeigt, dass am NMDA-Rezeptoren ansetzende nicht kompetitive Antagonisten wie Dizocilpin (MK-801), Phencyclidin (PCP), Ketamin und Memantin, die alle als Ionenkanalblocker wirken, in dieselbe Richtung wie Ethanol generalisieren, während für kompetitive NMDA-Antagonisten oft nur eine partielle Substitution von Ethanol festgestellt wurde (Colombo u. Grant 1992, Grant u. Colombo 1993, Hölter et al. 2000, Hundt et al. 1998, Shelton u. Balster 1994). Außerdem wurde nachgewiesen, dass Ketamin eine dosisabhängige ethanolähnliche subjektive Wirkung bei trockenen Alkoholikern hervorrief (Krystal et al. 1998), was darauf hindeutet, dass NMDA-Rezeptoren beim Menschen zumindest zum Teil die subjektive Alkoholerfahrung vermitteln. Der Ethanolstimulus kann von Substanzen, die auf Nikotinrezeptoren und 5-HT 3 -Rezeptorn wirken (Kostowski u. Bienkowski 1999), verstärkt werden (d. h. stärkere Erkennung). Außerdem sind je nach Ethanoltrainingsdosis verschiedene Rezeptoren an der Vermittlung der diskriminierenden stimulierenden Eigenschaften dieser Droge beteiligt (Grant 1994). Daraus ergibt sich insgesamt, dass sich der Ethanolstimulus aus mehreren Komponenten zusammensetzt, wobei der NMDA-Rezeptor- und GABA A -Rezeptor-Komplex eine besondere Bedeutung haben. Folglich sind die primären Ansatzstellen der Alkoholwirkung nicht ausschließlich für die körperliche Wirkung zuständig, sondern sie vermitteln auch subjektive Wirkungen. Daher ist es schließlich möglich, das Verständnis der Mechanismen an den Rezeptoren, die die diskriminierenden stimulierenden Wirkungen von Alkohol vermitteln, dazu heranzuziehen, um Arzneimittel zu entwickeln, die die subjektive Alkoholwirkung reduzieren. Ethanol greift primär an bestimmten Membranrezeptoren und Ionenkanäle an (Proteintheorie). Durch diesen First Hit werden insbesondere die Funktion von NMDA-, GA- BA A -, 5-HT3- und nach-rezeptoren beeinflusst sowie Kalziumkanäle vom L-Typ und GIRK, bei denen bereits Ethanolkonzentrationen von 1 mm die Kanalfunktion verändern. Dieser First Hit auf Rezeptor und Kanalebene führt direkt zur körperlichen Intoxikation und vermittelt auch subjektive Alkoholwirkungen Neurochemische Systeme und Signaltransduktionswege Bereits das erste Auftreffen von Alkohol auf die spezifischen Zielstellen im Hirn führt zu den typischen akuten subjektiven Wirkungen, aus denen die Eigenschaften des diskriminierenden Stimulus dieser Droge bestehen. Assoziiert mit diesen psychotropen Wirkungen ist das Intoxikationssignal mit seiner Spannbreite von Enthemmung bis zu Sedierung und letztendlich gar Hypnose bei ansteigender Alkoholkonzentration. Dem schließt sich eine zweite Welle indirekter Wirkungen auf eine Reihe von Neurotransmitter-/Neuropeptid- Systemen an (Vengeliene et al. 2008). Man nimmt an, dass diese zweite Welle, an der in erster Linie Monoamine, Opioide und Endocannabinoide beteiligt sind, entscheidend ist für die verstärkenden und belohnenden Eigenschaften von Alkohol.

7 3.1 Pharmakologische Aspekte des Alkohols 117 Mesolimbisches Dopaminsystem Die Regionen des Gehirns, die bei der Vermittlung der Verstärkerwirkung ( reinforcing effects ) bei Drogengebrauch/-missbrauch so auch von Alkohol eine Rolle spielen, konnten in neuropharmakologischen Studien ermittelt werden, deren Methodik Läsionen, Mikroinjektionen und Mikrodialyse umfasste. Die bahnbrechende Arbeit hierzu wurde 1954 von Olds und Millner veröffentlicht (Olds u. Millner 1954). Sie arbeiteten mit elektrischer Hirnstimulation. Die Ergebnisse zeigten, dass bestimmte Regionen des Gehirns auf Reinforcement und Belohnungsgefühle spezialisiert sind. Diese Experimente konnten auch entsprechende Regionen identifizieren, bei denen die elektrische Stimulation als Belohnung empfunden wurde, was daran zu erkennen war, dass Ratten sich selbst über lange Zeiträume oft und regelmäßig stimulierten (diese Arbeitstechnik ist bei Sanchis-Segura und Spanagel [2006] eingehender beschrieben). Suchtmittel verstärken die Empfindlichkeit dieser Tiere gegenüber elektrischer Stimulation. Bei Ethanol gilt dies allerdings nur bei Selbstverabreichung und nicht bei Verabreichung durch den Experimentator (Moolten u. Kornetsky 1990). Insbesondere das Dopaminsystem (DA) des Mesenzephalons ist empfindlich gegenüber elektrischer Selbststimulation und wurde als neurochemisches Substrat der Verstärkerwirkung identifiziert (Wise u. Rompre 1989, Wise 2004, Schultz 2007). A10-Dopaminneuronen des Mesenzephalons, die an der Initiierung der Verstärkerwirkung beteiligt sind, haben ihren Ursprung in der Area tegmentalis ventralis (VTA), von der aus sie sich zu Strukturen hin projizieren, die mit dem limbischen System in engem Zusammenhang stehen, insbesondere mit dem Nucleus accumbens (NAC) und dem präfrontalen Kortex. Bei Menschen und Tieren wurde für alle Verstärker eine Aktivierung des Dopaminsystems des Mesenzephalons nachgewiesen. Zum Beispiel konnte mithilfe von Neuroimaging am Menschen nachgewiesen werden, dass Attraktivität (Kampe et al. 2001), Sex und Orgasmus (Georgiadis et al. 2006, Holstege et al. 2003) und sogar klassische Musik (allerdings nur bei Musikern; Blood u. Zatorre 2001) die Aktivität im NAC verstärken kann. Außerdem verstärkt eine Reihe von Missbrauchsdrogen unter anderem Alkohol die mesolimbische dopaminerge Aktivität, vor allem im NAC-Shell (Di Chiara u. Imperato 1988, Löf et al. 2007a). Modulatorische neurochemische Systeme Im Folgenden werden Tiermodelle dargestellt, in denen der Zusammenhang zwischen Alkohol und Dopaminsystem des Mesenzephalons untersucht wird. GABAerge Rückkopplung. Durch die Anwendung verschiedener Arbeitstechniken kam man zu dem Schluss, dass das mesolimbische dopaminerge System bei Versuchstieren durch die Verabreichung von Alkohol aktiviert wird. Insbesondere die VTA wurde mit der Wirkung von Alkohol in Verbindung gebracht, zunächst durch die Schlüsselpublikation von Gessa et al. (1985). Es wurde gezeigt, dass niedrige systemische Ethanoldosierungen einen dosisabhängigen Anstieg der Feuerrate dopaminerger Neuronen bewirken; später kam man übereinstimmend zu dem Ergebnis, dass Alkohol die Dopaminfreisetzung im mesolimbischen System stimuliert (Di Chiara u. Imperato 1988). Mit Mikrodialyseexperimenten wurde nachgewiesen, dass durch die akute Verabreichung von Alkohol Dopamin vorzugsweise im NAC-Shell freigesetzt wird (Pontieri et al. 1995). Daher kann man davon ausgehen, dass eine akute Verabreichung von Alkohol den extrazellulären Dopaminspiegel im NAC erhöht, indem sich die GABAerge Rückkopplung in der VTA verändert. Alkohol erniedrigt möglicherweise die Aktivität dieser GABAergen Neuronen, was zu einer anschließenden Disinhibierung mesolimbischer Dopaminneuronen führt (Spanagel u. Weiss 1999). Dieser vorgeschlagene Wirkungsmechanismus wird durch die Beobachtung gestützt, dass die Dopaminkonzentration im NAC nach systemischer Verabreichung von Alkohol anstieg, während die somatodendritische Ausschüttung in die VTA bereits gesunken war. Dies impliziert, dass Alkohol auch im NAC lokal wirkt (Kohl et al. 1998). Die lokale Infusion eines Dopamin-Reuptake-Inhibitors durch eine Dialysesonde in den NAC erhöhte hier den Dopaminspiegel und senkte gleichzeitig die Dopaminkonzentration in der VTA (Kohl et al. 1998). Man nimmt daher an, dass eine Erhöhung des Dopaminspiegels im NAC eine negative GABAerge Long-Loop-Rückkopplung in die VTA aktiviert, mit der die neuronale Aktivität der Zellkörper durch Dopamin reguliert wird (Kalivas 1993, Kohl et al. 1998, Luscher u. Ungless 2006, Spanagel u. Weiss 1999). Inzwischen wurde endgültig nachgewiesen, dass der Nucleus accumbens der wichtigste Hot Spot für die Dopaminausschüttung durch Ethanol ist und in der Area tegmentalis ventralis ein sekundärer Effekt auftritt (Ericson et al. 2008, Löf et al. 2007). Glutamatrezeptoren. Andererseits wird die dopaminerge Aktivität nicht ausschließlich durch negative GABAerge- Long-Loop-Rückkopplug und GABAerge Interneuronen in der VTA reguliert. Auch andere Systeme sind beteiligt. Insbesondere eine glutamatergische Aktivität scheint das mesolimbische dopaminerge System zu steuern (Gass u. Olive 2008, Luscher u. Ungless 2006). Die VTA wird auch vom präfrontalen Kortex, vom bed nucleus der Stria terminalis, vom laterodorsalen tegmentalen Nukleus und vom lateralen Hypothalamus mit Glutamat versorgt (Omelchenko u. Sesack 2007). Auch in den NAC wird von Afferenzen vom präfrontalen Kortex, vom Hippocampus, von der Amygdala und vom Nucleus paraventricularis Glutamat ausgeschüttet. Gleichgültig, von welcher dieser Stellen Glutamat ausgeschüttet wird, wirkt es auf die ionotropischen Glutamatrezeptoren im NAC-Shell und induziert die Ausschüttung von Dopamin (Blaha et al. 1997, Howland et al. 2002, Parsons et al. 2007).

8 118 3 Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem Weiterhin wurden glutamaterge Neurone in der VTA gefunden (Yamaguchi et al. 2007), die ebenfalls die dopaminerge Aktivität über verschiedene Glutamatrezeptoren beeinflussen können. Mithilfe von Mikrodialysetechniken konnte gezeigt werden, dass Ethanol eine biphasische Wirkung auf die Glutamatausschüttung im NAC hat. Das bedeutet, dass Ethanol in geringen Dosierungen möglicherweise in der Lage ist, die extrazelluläre Glutamatkonzentration im NAC zu erhöhen, während größere Mengen einen Glutamatüberschuss reduzieren (Gass u. Olive 2008). Weniger bekannt ist, inwieweit diese Wirkung von Alkohol auf die glutamaterge Übertragung im mesolimbischen Dopaminsystem die Aktivität der Dopamin-A10-Neuronen beeinflusst. Zum Beispiel hatte eine Infusion eines NMDA- Rezeptor-Antagonisten in die VTA keine Auswirkungen auf die dopaminverstärkende Wirkung von Ethanol (Ericson et al. 2003). Dies ist überraschend, denn im Gegensatz dazu beeinflussen verschiedene andere Missbrauchsdrogen über Glutamatausschüttung die Dopaminneurone des Mesenzephalons (Gass u. Olive 2008, Kauer u. Malenka 2007). Daher besteht auf diesem Gebiet eindeutig weiterer Forschungsbedarf. Serotoninrezeptoren. Das 5-HT-System des Nucleus raphe dorsalis moduliert ebenfalls die dopaminerge Aktivität der VTA und des NAC (Mylecharane 1996). Der 5-HT-Effekt wird in erster Linie über den 5-HT 3 -Rezeptor vermittelt. Eine Blockade der 5-HT 3 -Rezeptoren verhindert selektiv sowohl eine ethanolinduzierte Dopaminausschüttung im NAC als auch die somatodentritische Ausschüttung von Dopamin in die VTA (Carboni et al. 1989). Andererseits erhöht die Aktivierung von 5-HT 3 -Rezeptoren die Dopaminausschüttung in der VTA bei Wistar-Ratten und alkoholbevorzugenden P-Ratten (Liu et al. 2006). 5-HT 3 -Rezeptor-vermittelte Effekte auf die Dopaminausschüttung könnten durch die Kombination einer vorwiegenden Wirkung von Ethanol auf diesen Rezeptor und einer sekundären Wirkung von ethanolinduzierter Serotoninausschüttung zu erklären sein. Acetylcholinrezeptoren. Neuronale nach-rezeptoren sind ebenfalls wie bereits beschrieben ein primärer Angriffspunkt für Ethanol; außerdem modulieren sie die Ausschüttung von Dopamin. Der nach-rezeptor-antagonist Mecamylamin hemmt bei systemischer Verabreichung die dopaminausschüttenden Eigenschaften von Ethanol (Blomqvist et al. 1993), und eine Blockade der nach-rezeptoren in der VTA inhibiert die stimulierende Wirkung von konditionierten Ethanolreizen auf dopaminerge Neurone (Löf et al. 2007). Daher ist es nahe liegend, dass die vom nach- Rezeptor vermittelte Acetylcholin-Dopamin-Wechselwirkung ein wichtiger neurochemischer Ansatzpunkt für die Konditionierung von alcohol reinforcement ist. Überdies weist diese neurochemische Wechselwirkung auf die synergistischen Verstärkerwirkungen von Alkohol und Nikotin hin. Dies stellt somit ein neurochemisches Korrelat für die Tatsache dar, dass Alkoholgenuss stark mit Rauchen assoziiert ist. Ghrelin. Auch zwischen der Acetylcholin-Dopamin-Wechselwirkung und den am Essverhalten beteiligten Neuropeptiden wie Ghrelin scheint es einen interessanten Zusammenhang zu geben. Zentral verabreicht stimuliert Ghrelin das Dopamin (Jerlhag et al. 2006, 2007), vermutlich über nach-rezeptoren, sodass Ghrelin wahrscheinlich über den cholinergen Input in Dopaminneuronen wirkt. Es gibt cholinergen Input vom laterodorsalen tegmentalen Gebiet in die VTA, und die GHSR-1A Rezeptoren die funktionellen Ghrelinrezeptoren werden an beiden Orten exprimiert (Jerlhag et al. 2007). Die lokale Verabreichung von Ghrelin in die VTA oder in das laterodorsale tegmentale Gebiet verstärkt die Dopaminausschüttung im NAC (Jerlhag et al. 2007). Somit stimuliert Ghrelin das mesolimbische dopaminerge System über Aktivierung von GHSR-1A in der VTA und im laterodorsalen tegmentalen Gebiet. Zwar liegen noch keine Untersuchungen zu einem direkten Zusammenhang zwischen Ethanol, Ghrelin und Dopamin vor, man weiß aber, dass Ghrelin nicht nur das Energiegleichgewicht und das Essverhalten reguliert, sondern auch wahrscheinlich an Reinforcement durch Drogen (Cummings et al. 2007, Tessari et al. 2007) und Alkohol (Schneider et al. 2007) beteiligt ist. Orexin. Zurzeit ist noch unbekannt, inwieweit andere Neuropeptide, die am Essverhalten beteiligt sind, die Wirkung von Ethanol auf dopaminerge Neuronen modulieren. Zu diesen Neuropeptiden könnten Orexin A und B gehören, die beide ausschließlich in Neuronen des lateralen Hypothalamus synthetisiert (Sakurai et al. 1998) und als Antwort auf natürliche Verstärker und Drogenverstärker (Harris u. Aston-Jones 2006) einschließlich Alkohol aktiviert werden (Lawrence et al. 2006, Schneider et al. 2007). Außerdem aktivieren Stimuli, die das Vorhandensein von Alkohol signalisieren, die Orexinneuronen im Hypothalamus (Dayas et al. 2008). Da es vom Hypothalamus aus eine laterale Orexinprojektion zur VTA und zum NAC gibt (Baldo et al. 2003), gibt es wahrscheinlich über diese Neuropeptide auch für Ethanol einen Zugangspunkt zum mesolimbischen Verstärkungssystem. Glycinrezeptoren. Auch sie modulieren die Freisetzung von Dopamin in A10-Neuronen. So erniedrigt umgekehrte Dialyse des kompetitiven Glycinrezeptorantagonisten Strychnin in den NAC die akkumbale extrazelluläre Dopaminkonzentration, wohingegen umgekehrte Mikrodialyse eines entsprechenden Antagonisten diese erhöht (Molander u. Söderpalm 2005). Außerdem senkt die lokale Infusion von Strychnin nicht nur die akkumbale Dopaminkonzentration per se, sondern sie unterbindet auch vollständig einen Anstieg der akkumbalen Dopaminkonzentration nach Verabreichung von Ethanol (Molander u. Söderpalm 2005).

9 3.1 Pharmakologische Aspekte des Alkohols 119 Kurz zusammengefasst, wirkt systemischer Alkohol auf verschiedene Weisen auf den NAC, die VTA und ihre Afferenzen. Das bedeutet, dass er mehrere neurochemische Ansatzpunkte zur Verfügung hat, um auf dopaminerge A10-Neuronen einzuwirken. Die Mehrzahl dieser neurochemischen Ansatzpunkte sind primäre Angriffsstellen von Alkohol. Interessanterweise wird die Aktivität von A10- Neuronen auch von Endocannabinoiden und endogenen Opioidsystemen moduliert. Leider bleiben zunächst die wichtigsten Fragen unbeantwortet, nämlich welche Folgen Aktivierung und Modulation der dopaminergen A10-Neuronen durch Alkohol auf das Verhalten hat und ob die verstärkenden und belohnenden Eigenschaften von Alkohol eng mit der dopaminergen Aktivität verknüpft sind. Entwicklung von Alkohol-Reinforcement Mesolimbische Dopaminneuronen Die durch Alkohol induzierte Aktivierung mesolimbischer A10-Neuronen scheint mit dem durch ihn verursachten Verstärkungsverhalten tatsächlich zusammenzuhängen, denn Ratten verabreichen sich selbst direkt Alkohol in die VTA (Gatto et al. 1994). Eine weitere, ausführlichere Untersuchung von Rodd et al. (2004) zeigte, dass Ratten sich selbst Ethanol direkt in die posteriore, nicht aber in die anteriore VTA verabreichen. Die gleichzeitige Verabreichung des Dopamin-D2/3-Agonisten Quinpirol in die VTA bei einer Konzentration, die Dopamin-D2-Autorezeptoren aktiviert und dadurch die Feuerrate der VTA-Dopaminneuronen verringert, verhinderte die Entwicklung eines Intra-VTA-Selbstverabreichungsverhaltens. Die Quinpirolwirkung konnte durch die Infusion des Dopamin-D2- Antagonisten Sulpirid in die VTA aufgehoben werden (Rodd et al. 2004). Das bedeutet, dass Alkohol in der posterioren VTA einen Verstärkungseffekt über die Aktivierung der Dopaminneurone des VTA bewirkt (Rodd et al. 2004). In zahlreichen pharmakologischen Studien wurde eingehender untersucht, welche Rolle das Dopamin im Mesenzephalon bei der Entwicklung von Alkoholverstärkung spielt, aber die Ergebnisse sind zunächst widersprüchlich. Zwar konnte eine durch 6-Hydroxydopamin induzierte Schädigung der Dopaminzellkörper eine bereits etablierte Selbstverabreichung von Alkohol nicht unterbinden (Ikemoto et al. 1997, Lyness u. Smith 1992, Rassnick et al. 1993), jedoch verringerte diese Manipulation die Akquisition eines Alkoholtrinkverhaltens (Ikemoto et al. 1997, Rassnick et al. 1993). Diese Ergebnisse weisen darauf hin, dass Entstehung und Aufrechterhaltung eines primären Alkohol-Reinforcement verschiedenen neuronalen Mechanismen zuzuordnen sind und funktionale Dopaminneuronen im Mesenzephalon nicht notwendigerweise daran beteiligt sind, dass die Selbstverabreichung von Alkohol fortgesetzt wird. Allerdings scheint es, dass postsynaptische Komponenten, wie zum Beispiel Dopaminrezeptoren, an der Aufrechterhaltung freiwilligen Alkoholkonsums beteiligt sind, weil Dopamin- D1- und D2-Rezeptor-Knockout-Mäuse ein verändertes Alkoholkonsumverhalten zeigen (Crabbe et al. 2006). Insbesondere war die operante Alkoholselbstverabreichung bei Dopamin-D2-Rezeptor-defizienten Mäusen deutlich reduziert (Phillips et al. 1998, Risinger et al. 2000). QTL-Analysen. Durch Anwendung von QTL-Analysen (QTL: quantitative trait locus) an rekombinanten Inzuchtstämmen von Mäusen war man in der Lage, einen QTL für Alkoholpräferenz an der Position des Dopamin-D2-Rezeptors auf dem Mauschromsom 9 zu lokalisieren (Tarantino et al. 1998). Außerdem ist es möglich, mit D1-, D2- und D3-Rezeptor-Agonisten und -antagonisten das Ethanolkonsumverhalten normaler Laborratten (Cohen et al. 1998, Pfeffer u. Samson 1988) und alkoholbevorzugender Ratten zu verändern (Dyr et al. 1993, McBride u. Li 1998, Thanos et al. 2005). Innerhalb der letzten 50 Jahre wurden verschiedene Rattenlinien entwickelt, die entweder Alkohol präferieren oder nicht bevorzugen. Je nach Linie konsumieren sie täglich entweder 5 9 g/kg/tag Ethanol oder weniger als 1 g/ kg/tag. Diese Tierlinien stellen sehr aussagekräftige Tiermodelle für die Untersuchung der neurochemischen Substrate von Alkohol-Reinforcement dar (zur Übersicht über die verschiedenen Linien vgl. Bell et al. 2006, Ciccocioppo et al. 2006, Colombo et al. 2006, Overstreet et al. 2006, Quintanilla et al. 2006, Sommer et al. 2006). Dopaminbestimmungen. Auch die Ergebnisse von Dopaminbestimmungen bei verschiedenen alkoholbevorzugenden Rattenstämmen sind widersprüchlich. Es wurde nachgewiesen, dass bei Selbstverabreichung von Alkohol die relative Stimulierung der mesolimbischen Dopaminausschüttung bei Alkohol bevorzugenden P-Ratten deutlich höher ist als bei Wistar-Ratten, die als Kontrolle dienten (Bell et al 2006, Katner et al. 1996, Weiss et al. 1993). Im Gegensatz dazu fanden Kiianmaa et al. (1995) eine ähnliche dosisabhängige Zunahme der mesolimbischen Dopaminausschüttung bei finnischen alkoholbevorzugenden AA- Ratten und entsprechenden alkoholvermeidenden ANA- Ratten (Sommer et al. 2006). In einem anderen gut angelegten Versuch derselben Autoren (Nurmi et al. 1996) konsumierte eine Gruppe von AA-Ratten freiwillig 10 %iges Ethanol in einem Limited- Access -Paradigma (d. h. wenn sie jeden Tag nur kurz Zugang zu Alkohol erhalten), während zwei Kontrollgruppen (AA- und ANA-Ratten) dieselbe Ethanolmenge intragastral intubiert wurde. Anschließend wurden die Tiere einem Mikrodialyseexperiment unterzogen. Dabei wurde die Dopaminausschüttung im NAC nach einer intraperitonealen Gabe von Alkohol gemessen. Sowohl AA- als auch ANA-Ratten, denen Ethanol forciert intragastral verabreicht wurde, zeigten dieselbe Dopaminrespons im Ethanolchallengetest (Kiianmaa et al. 1995). Bei den AA-Ratten, die das Ethanol freiwillig konsumiert hatten, war der Dopaminanstieg nach dem Ethanolchallenge sogar signifikant geringfügig kleiner (Nurmi et al. 1996). Das letzte Ergebnis lässt darauf schließen, dass sich bei AA-Ratten, die freiwillig Ethanol konsu-

10 120 3 Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem mieren, eine Toleranz gegenüber der Dopaminausschüttung entwickelt. Diese Annahme wird zusätzlich von einem anderen Experiment gestützt, bei dem bei AA-Ratten die Dopaminausschüttung im NAC vor und nach dem Alkoholkonsum bestimmt wurde. Bei Selbstverabreichung der Ethanollösung war die Wirkung auf die Dopaminkonzentration 10 Minuten nach Trinkbeginn nur gering (Nurmi et al. 1998). Bei dem Präsentieren eines konditionierten Reizes, der routinemäßiger Teil der täglichen Flüssigkeitszufuhr war, erhöhte sich die Dopaminkonzentration nicht, bevor die Ratten Gelegenheit zum Ethanolkonsum erhielten (also in der Erwartungsphase ) (Nurmi et al. 1998). In ihrer Gesamtheit zeigen diese in sich schlüssigen Befunde, dass mesolimbisches Dopamin nicht das zentrale Substrat ist, das bei AA-Ratten Reinforcement durch Ethanol hervorruft. Ähnliche Ergebnisse ergaben sich auch bei einer anderen alkoholbevorzugenden Rattenlinie. Bei alkoholnaiven Ratten, die genetisch hohen (HAD) bzw. niedrigen Alkoholkonsum (LAD) aufweisen, zeigte die Dosis-Wirkungs- Kurve in Bezug auf extrazelluläre Dopaminspiegel keine unterschiedliche Alkoholempfindlichkeit der beiden Linien (Overstreet et al. 2006, Yoshimoto et al. 1992). In einer weiteren vergleichenden Studie wurden bei alkoholnaiven HAD-/LAD- und AA/ANA-Ratten mittels quantitativer No- Net-Flux -Mikrodialyse basale und ethanolstimulierte Ausschüttung von Dopamin im NAC bestimmt. Nach Beendigung des Mikrodialyseexperiments wurden bei den Ratten, die in ihrem ursprünglichen Käfig gehalten wurden, über einen Monat der freiwillige Alkoholkonsum und die Präferenz getestet (Katner u. Weiss 2001). Die vergleichende Analyse der Daten verschiedener Tiere und Linien zeigte, dass der extrazelluläre Dopaminspiegel und die ethanolabhängige prozentuale Zunahme gegenüber der Basislinie signifikante Prädiktoren einer Ethanolpräferenz waren (Katner u. Weiss 2001). Angesichts der nicht übereinstimmenden Schlussfolgerungen der hier dargestellten Untersuchungen zur Dopaminausschüttung darf man nicht vergessen, dass in den meisten Versuchen der Alkohol vom Experimentator verabreicht wurde. Dies könnte erklären, warum zwischen den alkoholbevorzugenden und nicht bevorzugenden AA-/ANA- und HAD-/LAD-Linien keine Unterschiede zu finden sind. Eindeutig besteht auf dem Gebiet der operanten Selbstverabreichung von Ethanol bei genetisch selektierten Rattenlinien noch Forschungsbedarf, insbesondere mit zeitlich hoch auflösender Bestimmung der Dopaminkonzentration während der Selbstverabreichung. Jedoch fehlen geeignete Kontrollen für die Versuche, weil bei den Linien, die kein Ethanol bevorzugen, wohl kaum Veränderungen in der Dopaminfreisetzung zu erwarten sind. Die vergleichende Studie von Katner und Weiss (2001) legt allerdings nahe, dass eine Erhöhung der extrazellulären Dopaminkonzentration im NAC und eine erhöhte Empfindlichkeit gegenüber durch Ethanol verstärkte Dopaminausschüttung Faktoren sein könnten, die zu einer Bevorzugung größerer Alkoholmengen beitragen. Außerdem kann man aus den Daten schließen, dass Alkohol eher bei solchen Tieren zum Reinforcement führt, bei denen die dopaminerge Antwort auf anfängliche Ethanolexposition erhöht und in der Folge mit der Aufnahme größerer Alkoholmengen und einer entsprechenden Präferenz assoziiert ist. Untersuchungen am Menschen. Auch für das menschliche Gehirn wurde untersucht, welche Rolle Dopamin bei der Heranbildung von Verstärkungsprozessen spielt. Eine erste Studie von Ahlenius et al. (1973) wies nach, dass α-methylp-tyrosin ein Hemmer der Dopaminsynthese die von Ethanol induzierte Psychostimulierung beim Menschen reduziert. Anhand von Positronenemissionstomografie fanden Boileau et al. (2003) eine signifikante Reduktion der Bindung von [ 11 C]-Racloprid im NAC gesunder Probanden nach Alkoholkonsum. Bei dieser Studie korrelierten die Größenordnung der Bindung von [ 11 C]-Racloprid und die psychostimulierende Wirkung von Alkohol. Dies ist ein Hinweis darauf, dass als Respons auf Alkoholgenuss eine verstärkte Dopaminausschüttung auftritt und die Intensität der Psychostimulierung zumindest zu einem gewissen Maß von der Erhöhung der extrazellulären Dopaminkonzentration abhängt. Modulatorische neurochemische Systeme Wenn Dopamin wirklich eine entscheidende Rolle bei der Heranbildung von Alkohol-Reinforcement bei Tieren und Menschen spielt, kann man ebenfalls postulieren, dass neurochemische Systeme, über die das Dopaminsystem direkt aktiviert wird (z. B. GABA, Glutamat, Serotonin, Acetylcholin, Glycin) für dessen Heranbildung genau so wichtig sind. GABA A -Rezeptoren. Sie sind möglicherweise von großer Bedeutung, weil sie nicht nur primäre Angriffsstellen für Alkohol sind, sondern auch einen direkten neurochemischen Zugangspunkt zum mesolimbischen Dopaminsystem darstellen. Zum Beispiel wird durch pharmakologische Manipulation von GABA A -Rezeptoren mit negativen allosterischen Modulatoren der Alkoholkonsum bei einer Reihe von Alkohol bevorzugenden Rattenlinien reduziert (Rassnick et al. 1993, Wegelius 1994). Auch konnte durch antagonistische Einwirkung auf GABA A -Rezeptoren in der VTA bzw. agonistische Verstärkung der Aktivität von GABA A -Rezeptoren im NAC (June et al. 1998) der Alkoholkonsum bei einer Reihe Alkohol bevorzugender P-Ratten unterdrückt werden, sodass eine Beteiligung von GABA A -Rezeptoren beider Nuclei an der Entwicklung von Alkohol-Reinforcement nahe liegt. Auch Knockout-Mäuse, denen verschiedene GABA A -Rezeptor-Untereinheiten fehlen, wurden in einer Reihe von Alkoholexperimenten untersucht, mit dem Ergebnis, dass eine Deletion in den Untereinheiten α1, α2, α5 und δ den Alkoholkonsum reduziert (Boehm et al. 2004, Crabbe et al. 2006, June et al. 2007, Mihalek et al. 2001). Außerdem tragen eine sardische Rattenlinie, die auf geringe Alkoholpräferenz und niedrigen Alkoholkonsum selektiert wurde (Colombo et al. 2006), und auch ANA-Ratten eine Punktmutation (R100Q) in dem Gen, das für die GABA A -Rezeptor- Untereinheit α6 kodiert, sodass wahrscheinlich das Fehlen

11 3.1 Pharmakologische Aspekte des Alkohols 121 bzw. eine Funktionsstörung dieser Untereinheit ebenfalls zu reduziertem Alkoholkonsum beiträgt (Carr et al. 2003, Saba et al. 2001). Glutamat- und andere Rezeptoren. Weniger schlüssig sind die Ergebnisse von pharmakologischen Studien, bei denen der Einfluss von Glutamatrezeptor-Antagonisten auf die Selbstverabreichung von Alkohol untersucht wurde. Verschiedene NMDA-Rezeptor-Antagonisten wurden systemisch oder lokal in den NAC verabreicht, wodurch der Alkoholkonsum entweder reduziert wurde oder unbeeinflusst blieb (Bienkowski et al. 1999, Rassnick et al. 1992, Shelton u. Balster 1994). Der AMPA/Kainate-Rezeptor-Antagonist GYKI veränderte nicht selektiv das operante Verhalten auf Alkohol (Stephens u. Brown 1999). Auch Versuche mit Knockout-Mäusen gaben keinen Hinweis auf die Beteiligung von AMPA-Rezeptoren auf die Aufrechterhaltung von Alkoholkonsum, denn weder GluR1- noch GluR3-Deletionen hatte bei Tieren, die in ihrem ursprünglichen Käfig gehalten wurden, Einfluss auf Alkoholkonsumverhalten oder operante Selbstverabreichung (Cowen et al. 2003, Sanchis-Segura et al. 2006). Serotoninrezeptoren. Das 5-HT-System des Nucleus raphe dorsalis beeinflusst, wie bereits beschrieben, ebenfalls die dopaminerge Aktivität der VTA und des NAC. Modelle mit Knockout-Mäusen verschiedener Komponenten des 5-HT-Systems geben Hinweise darauf, dass 5-HT generell eine modulatorische Rolle bei freiwilligem Alkoholkonsum spielt. Durch Deletion von 5-HT-Transportern (Kelaï et al. 2003) oder Überexpression von 5-HT 3 -Rezeptoren (Engel et al. 1998) nimmt die Alkoholselbstverabreichung im Vergleich zu Kontrollmäusen ab. Die pharmakologische Manipulation der Aktivität des 5-HT-Systems führt dazu, dass die Verabreichung verschiedener serotonerger Substanzen den Alkoholkonsum sowohl bei laborüblichen als auch bei Alkohol bevorzugenden Tieren reduziert (Lê u. Funk 2005, Overstreet et al. 2006, Zhou et al. 1998). Zum Beispiel unterdrücken 5-HT 3 -Rezeptor-Antagonisten die Entwicklung von freiwilligem Alkoholkonsum bei Alkohol präferierenden P-Ratten. Außerdem ist für die Entwicklung eines Alkoholtrinkverhaltens erforderlich, dass lokale 5-HT 3 -Rezeptoren in der posterioren VTA aktiviert werden (Rodd- Henricks et al. 2003). Diese Befunde sprechen dafür, dass 5-HT 3 -Rezeptoren auf dopaminerge Neuronen in der VTA in engem Zusammenhang mit der Ausbildung von Alkohol-Reinforcement stehen. Acetylcholin- und Glycinrezeptoren. Es wurde auch gezeigt, dass an der alkoholinduzierten Stimulation dopaminerger A10-Neuronen zentrale nach- und strychninsensitive Glycinrezeptoren beteiligt sind; ein Hinweis auf die mögliche Beteiligung dieser Rezeptoren an Alkohol-Reinforcement. Durch Infusion von Mecamylamin in die VTA lässt der freiwillige Alkoholkonsum nach (Ericson et al. 1998); allerdings muss noch geklärt werden, welche Kombination von Untereinheiten des nach-rezeptors dabei die wichtigste Rolle spielt. Wie man weiß, sind die Subtypen α4β2 und α7 von nach-rezeptoren für den Alkoholgenuss nur von untergeordneter Bedeutung (Ericson et al. 2003, Lê e al. 1999). Antagonisten gegen die Untereinheiten α3β2 und β3 von nach-rezeptoren hingegen reduzieren den freiwilligen Alkoholkonsum sowohl bei Ratten als auch bei Mäusen (Jerlhag et al. 2006, Larsson et al. 2004). Durch Modulation der Aktivität des glycinergen Systems kann der Alkoholkonsum ebenfalls reduziert werden. Wie Molander et al. (2007) zeigen konnten, erniedrigt der Glycin-Reuptake-Inhibitor Org der spezifisch auf Glycintransporter 1 wirkt Alkoholpräferenz und -aufnahme bei Ratten, indem er die extrazelluläre Glycinkonzentration erhöht, die in erster Linie inhibitorische strychninsensitive Glycinrezeptoren aktiviert. Das sich daraus ergebende Bild betont erneut die wichtige Rolle, von cholinergen und glycinergen Afferenzen zu dopaminergen Neuronen in Zusammenhang mit Verstärkungsprozessen. In Kürze: An Tiermodellen konnte gezeigt werden, dass Dopamin-A10-Neuronen des Mesenzephalons und eine Reihe modulatorischer neurochemischer Angriffspunkte, darunter Rezeptoren für GABA A, 5-HT 3, nach und Glycin, eine essenzielle Bedeutung für die ersten Schritte bei der Heranbildung von Alkohol-Reinforcement haben. Folglich ist die Aktivierung des mesolimbischen Dopaminsystems eine Eigenschaft von Ethanol, die möglicherweise für dessen verhaltensverstärkende Wirkung verantwortlich ist. Allerdings ist zu betonen, dass diese primären Vorgänge nicht notwendigerweise die emotionellen hedonistischen Aspekte des Belohnungsgefühls durch Ethanol reflektieren. Wahrscheinlicher ist, dass ein erhöhte Dopaminfreisetzung als ein neurochemisches Lernsignal für Verstärkungsstimuli fungiert (Schultz 2007, Spanagel u. Weiss 1999). Unbekannt ist, inwieweit Dopamin ebenfalls eine Rolle bei der Vermittlung der hedonistischen Aspekte von Alkohol spielt. Es ist durchaus möglich, dass das Endocannabinoid- und das endogene Opioidsystem neurochemische Substrate darstellen, die an der Vermittlung dieser positiven Gemütszustände beteiligt sind. Entstehung des Belohnungsund Wohlgefühls Es gibt immer mehr Hinweise darauf, dass das Endocannabinoidsystem eine zentrale Rolle bei der Regulation der belohnenden Eigenschaften von Missbrauchsdrogen einschließlich Alkohol spielt (Maldonado et al. 2006). Diese Wirkung könnte auf die Ausschüttung von Endocannabinoiden in die VTA zurück zuführen sein. Alternativ sind Endocannabinoide jedoch auch über Dopamin unabhängige Mechanismen am Drogensuchverhalten beteiligt (Maldonado et al. 2006). Zum Belohnungsgefühl, das durch die Anwendung von Drogen entsteht, wurde deshalb alternativ zur Dopamin- die Endocannabinoidhypothese aufgestellt.

12 122 3 Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem Endocannabinoidsystem Endocannabinoide vermitteln eine retrograde Signalübertragung in neuronalem Gewebe mithilfe präsynaptischer Cannabinoid-(CB-)Rezeptoren und sind aus diesem Grund an der Regulation der synaptischen Übermittlung beteiligt, indem sie die klassische Transmitterübertragung unterdrücken. Diese mächtige modulatorische Wirkung auf die synaptische Übertragung hat wichtige Folgen auf die Funktion und interagiert mit den Wirkungen von Missbrauchsdrogen einschließlich Alkohol. Zum Endocannabinoidsystem gehören CB1, CB2 und der Orphan-Rezeptor GPR55 als neu entdeckter CB-Rezeptor (Lauckner et al. 2008), Endocannabinoide wie 2-Arachidonylglycerin (2-AG) und Anandamid, deren biosynthetische Enzyme und Inaktivatoren sowie möglicherweise Transporter für Endocannabinoide (Freund et al. 2003). Reinforcement durch Alkohol ist von der Aktivität des CB1-Rezeptors abhängig. So ist zum Beispiel die CB1-Rezeptor-vermittelte Effizienz bei alkoholvermeidenden DBA/2-Mäusen geringer als bei alkoholbevorzugenden C57BL/6-Mäusen (Hungund u. Basavarajappa 2000). Genetisch selektierte Marchigian Sardische alkoholbevorzugende (msp) Ratten und AA-Rattenlinien unterscheiden sich bei der Organisation des zerebralen Endocannabinoidsystems spezifisch in mehreren Hirnregionen von unselektierten Wistar- und alkoholvermeidenden ANA-Ratten (Cippitelli et al. 2005, Hansson et al. 2007). Auch wurde nach spezifischer pharmakologischer CB1-Rezeptor-Blockade die Heranbildung von Alkoholkonsum bei Nagetieren unterdrückt (Colombo et al. 2005). Allgemein gesehen, beeinflusst die pharmakologische Manipulation des CB1-Rezeptors Ethanolaufnahme und Präferenzverhalten (Colombo et al. 2002, Gessa et al. 2005). Entsprechend neigen CB1-Rezeptor-Knockout-Mäuse zu reduzierter Alkoholselbstverabreichung (Thanos et al. 2005, Wang et al. 2003). Wang et al. (2003) konnten darüber hinaus zeigen, dass Ethanolpräferenz und -aufnahme bei Wildtyp-, nicht aber bei CB1-Knockout-Mäusen altersabhängig abnehmen. Dies ist im Einklang mit belohnungsabhängigen Mechanismen, die mit zunehmendem Alter an Bedeutung verlieren ein Phänomen, das mit der Abnahme der Aktivität des Endocannabinoidsystems korreliert. Ein direkter Zusammenhang zwischen Alkoholverstärkung und Änderungen bei der Produktion von Endocannabinoiden im Hirn wurde nachgewiesen. An Mikrodialysaten wurde gezeigt, dass die Selbstverabreichung von Alkohol zu einem signifikanten Anstieg der 2-AG-Konzentration im NAC führte und die relative Änderung des 2-AG-Gehalts im Dialysat signifikant mit der konsumierten Alkoholmenge korrelierte (Caillé et al. 2007). Zusammenfassend ist das Endocannabinoidsystem an dopaminabhängigen belohnenden Wirkungen von Alkohol beteiligt, aber auch an dopaminunabhängigen Wirkungen auf das Belohnungsgefühl. Ob diese Wirkungen alle mit dem durch Alkohol verursachten hedonistischen Wohlgefühl in Verbindung stehen, ist noch unbekannt. Die Stimulierung des CB1-Rezeptors beim Menschen kann euphorische Zustände hervorrufen. Es ist allerdings von entscheidender Wichtigkeit zu untersuchen, inwieweit die Verabreichung eines selektiven CB1-Rezeptor-Antagonisten an Probanden, die kleine, aber stimulierend wirkende Mengen Alkohol trinken, die euphorisch stimulierende Wirkung von Alkohol abschwächt. Opioidsystem Solch ein Alkoholchallengeexperiment wurde als Doppelblindstudie mit einem Opioidrezeptorantagonisten bei Gelegenheitstrinkern durchgeführt. Mithilfe von Naltrexon wurde untersucht, ob das endogene Opioidsystem subjektive euphorische Wirkungen vermittelt (Doty u. de Wit 1995). Die Probanden erhielten entweder Naltrexon oder Plazebo. Eine Stunde danach tranken sie ein ethanolhaltiges Getränk (0,5 g/kg). Nach dem Alkoholkonsum wurde 3 Stunden lang der Atemalkoholspiegel bestimmt; zusätzlich füllten die Probanden in regelmäßigen Abständen einen standardisierten Fragebogen zu den subjektiven Wirkungen aus. In der Plazebogruppe wirkte das Ethanol prototypisch, einschließlich subjektiver positiver Wirkungen wie Euphorie. Überraschenderweise wurden weder die subjektiven noch andere Wirkungen des Ethanols durch vorherige Gabe von Naltrexon verändert (Doty u. de Wit 1995). Dieses Experiment wurde mit leichten und mittleren Trinkern mit demselben Ergebnis wiederholt, nämlich dass die Verabreichung von Naltrexon vor dem Trinken die subjektiven Wirkungen der Probanden durch Ethanol nicht dämpft (Doty et al. 1997). Bei starken Alkoholikern gilt dies allerdings nicht. Wiederholt wurde gezeigt, dass Naltrexon bei diesen sowohl subjektive als auch psychomotorische Reaktionen auf Alkohol abschwächt (Drobes et al. 2004, McCaul et al. 2000, Ray et al. 2008). Es wurde lange vermutet, dass Opioidpeptide wie Endorphine und Enkephaline die neurochemischen Substrate von Belohnungsereignissen und wichtig für die Vermittlung der damit verbundenen euphorisierenden Wirkung sind. Frühe Studien kamen zu dem Ergebnis, dass sowohl Endorphine als auch Enkephaline intrinsische belohnende Eigenschaften haben; Nagetiere verabreichen sie sich selbst direkt in die Hirnventrikel (van Ree et al. 1979) und in den NAC (Goeders et al. 1984). Die VTA ist ein weiterer Hot Spot für die Induktion eines Belohnungsgefühls durch Opioide, weil Verabreichung von Opioidrezeptoragonisten in die VTA zu einer konditionierten Platzpräferenz führte (Herz 1997) und weil außerdem diese Substanzen in die VTA selbst appliziert wurden (Devine u. Reis 1994).

13 3.1 Pharmakologische Aspekte des Alkohols 123 Aus diesen Gründen erscheint es wahrscheinlich, dass die Opioidrezeptoren µ und δ, die Ziele von Enkephalinen und Endorphinen also in der VTA und im NAC in wichtiger Weise an den neurobiologischen Mechanismen beteiligt sind, die ein Belohnungsgefühl hervorrufen (Spanagel et al. 1991). Weiter konnte gezeigt werden, dass die basale Dopaminkonzentration im NAC von endogenen Opioidsystemen verändert wird (Spanagel et al. 1992). Es blieb allerdings noch viele Jahre ungeklärt, ob Missbrauchsdrogen wirklich Belohnungsgefühle durch die Ausschüttung von Endorphinen und Enkephalinen auslösen. Anhand von In-vivo-Mikrodialyseexperimenten zeigten Olive et al. (2001) in einer Schlüsselpublikation endgültig, dass Missbrauchsdrogen, darunter auch Ethanol, eine Ausschüttung von Endorphinen in den NAC bewirken. Bemerkenswerterweise stellte man anhand der gleichzeitigen Messung der Dopaminkonzentration fest, dass nach der Verabreichung von Alkohol das extrazelluläre Dopamin früher als die Endorphinkonzentration anstieg. Daher scheint es, dass Alkohol zwar sowohl Dopamin als auch Endorphine im NAC stimuliert, dass dies aber vermutlich durch voneinander unabhängige Mechanismen geschieht (Marinelli et al. 2004). Es gibt Studien, in denen die positiven verstärkenden Eigenschaften von µ/δ-agonisten bei Injektion in diesen Teil des Hirns nachgewiesen wurden (Goeders et al. 1984). Daher kann man durchaus annehmen, dass ein Anstieg der extrazellulären Endorphinkonzentration an der Vermittlung des Belohnungsgefühls durch Ethanol und andere Missbrauchsdrogen beteiligt ist. Die Endorphine im NAC stammen von Proopiomelanocortin (POMC) enthaltenden Neuronen im Nucleus arcuatus des Hypothalamus (Bloom et al. 1978, Finley et al. 1981). Es ist zum heutigen Zeitpunkt jedoch nicht sicher geklärt, ob der ethanolinduzierte Anstieg der extrazellulären Endorphinkonzentration im NAC ein Ergebnis der direkten Aktivierung des Endorphinsystems im Nucleus arcuatus ist. So gibt es zwar Untersuchungen, in denen gezeigt wurde, dass bei akuter Verabreichung von Ethanol die POMC-mRNA im Nucleus arcuatus zunimmt (Madeira u. Paula-Barbosa 1999, Rasmussen et al. 1998), während es aber anderen Forschern nicht gelungen ist, eine akute Wirkung von Ethanol auf den POMC-mRNA-Gehalt im Nucleus arcuatus zu finden (Kinoshita et al. 2000). Bei Versuchen an Ratten wurde eine wichtige Funktion von Naltrexon gefunden, nämlich dass es die alkoholinduzierte Dopaminausschüttung im NAC unterdrückt; weiterhin ist die Suppression von operanter Alkoholselbstverabreichung durch Naltrexon mit einer Abschwächung des alkoholinduzierten Anstiegs der Dopaminkonzentration im NAC assoziiert (Gonzalez u. Weiss 1998). Diese Ergebnisse beweisen nicht nur, dass Alkoholverstärkungsprozesse der Aktivität endogener Opioidsysteme unterworfen sind, sondern auch, dass die Ausschüttung von Dopamin im NAC mit diesem Verstärkungsprozess assoziiert ist (Herz 1997). Auch konnte gezeigt werden, dass alkoholbevorzugende AA-Ratten eine geringere opioiderge Aktivität in den Regionen aufweisen, die an Alkohol-Reinforcement beteiligt sind (Nylander et al. 1994), und viele andere Untersuchungen wiesen bei anderen alkoholbevorzugenden und alkoholvermeidenden Tierlinien angeborene Unterschiede im Opioidsystem nach (Herz 1997, Vengeliene et al. 2008). Schließlich wäre noch darauf hinzuweisen, dass μ-opioidrezeptor- Knockout-Mäuse sich unter unterschiedlichen Testbedingungen keinen Alkohol selbst verabreichen (Roberts et al. 2000) und dass entsprechend selektive Antagonisten, die selektiv auf μ-opioidrezeptoren wirken, den Alkoholkonsum reduzieren können (Hyytiä u. Kiianmaa 2001). Insgesamt belegen die Ergebnisse von Tierversuchen eindeutig, dass Endocannabinoide und endogene Opioide eine entscheidende Rolle bei Belohnungsgefühlen durch Alkohol spielen. Sie weisen auch Wechselwirkungen mit dem mesolimbischen Dopaminsystem und dopaminunabhängigen Prozessen nach. (Weiterhin wurde bei der gegenseitigen Modulation von Drogen- und Alkoholverstärkungs- sowie -belohnungsgefühlen ein funktioneller Crosstalk zwischen Endocannabinoid- und Opioidsystem gefunden [Fattore et al. 2004]). Leider ist es im Tiermodell nicht möglich, subjektive Erfahrungen in angemessener Weise zu untersuchen, sodass die Übertragung der Erkenntnisse auf den Menschen schwierig ist, und sie tragen nur wenig zum Verständnis subjektiver euphorischer und hedonistischer Aspekte des Ethanolkonsums beim Menschen bei. Man mag darüber spekulieren, ob Wohlbefinden und Euphorie nicht viel komplexeren Prozessen als nur der zentralen Aktivierung von CB1- und µ/δ-opioidrezeptoren unterworfen sind, an denen wahrscheinlich der gesamte Organismus beteiligt ist, einschließlich eines Gleichgewichts zwischen Stresssystem und den physiologischen Parametern, die von autonomen Nervensystem kontrolliert werden. In dieser Hinsicht ist es durchaus möglich, dass zukünftige Untersuchungen feststellen werden, dass der Hypothalamus in seiner Rolle, Schnittstelle zwischen Hirn und Körper zu sein, eine wichtige Rolle spielt. In Kürze: Alkohol beeinflusst über mehrere neurochemische Ansatzpunkte sprich NMDA-, GABA A -, 5-HT 3 - und nach- Rezeptoren die Aktivität des mesolimbischen dopaminergen Systems. Die Aktivierung des mesolimbischen dopaminergen Systems ist eine Eigenschaft von Ethanol, die für die Initiierung der verhaltensverstärkenden (Alkohol-Reinforcement) Wirkung verantwortlich ist und somit das Trinkverhalten reguliert. Dopamin spielt jedoch keine Rolle bei der Vermittlung hedonistischer Aspekte des Alkoholkonsums. Viel mehr scheinen das Endocannabinoid- und das endogene Opioidsystem neurochemische Substrate darzustellen, die bei der Vermittlung positiver Gemütszustände durch Alkohol eine Rolle spielen.

14 124 3 Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem Signaltransduktionswege Angesichts der Rolle, die Dopamin bei Alkohol-Reinforcement spielt, haben mehrere Forschergruppen in den letzten 20 Jahren die Signaltransduktion im NAC und anderen Regionen, die von A10-Neuronen gespeist werden, untersucht (Diamond u. Gordon 1997, Ron u. Jurd 2005; ). camp-pka Signaltransduktion Im Anschluss an die Ausschüttung von Dopamin werden verschiedene Dopaminrezeptoren aktiviert. Die D1-ähnlichen Rezeptoren, zu denen die Dopaminrezeptoren D1 und D5 gehören, verstärken die Aktivität von Adenylylzyklase (AC) durch Kopplung an stimulatorische G-Proteine (Gαs). Im Gegensatz dazu inhibieren die D2-ähnlichen Rezeptoren (D2 D4) Adenylylzyklase durch inhibitorische Gαi- Stimulation. Dies führt zu einer Konzentrationserhöhung von Adenosin-3,5 -Monophosphat (camp) und der Aktivierung der camp-abhängigen Proteinkinase-A-(PKA-)Signaltransduktion, die wiederum zu Substratphosphorylierung führt. Ein Substrat der PKA ist das Transcription Factor camp Response Element-Binding Protein (CREB), das nach und nach die Transkription von Genen verstärkt, die in der Promoterregion camp Response Elements (CRE) enthalten (Lonze u. Ginty 2002). Die camp-pka-kaskade ist ein primärer Signaltransduktionsweg, der durch Alkoholexposition induziert wird (Diamond u. Gordon 1997, Ron u. Jurd 2005; Abb. 3.1), und die Expression zahlreicher auf Ethanol reagierender Gene wird von PKA reguliert. Durch freiwilligen Alkoholkonsum werden die Expression von kalzium-/calmodulinabhängiger Proteinkinase IV (CaMKIV) und die Phosphorylierung von CREB spezifisch im NAC-Shell abgeschwächt (Misra et al. 2001). Die wichtigste Aufgabe von CaMKIV ist vermutlich die Aktivierung von CREB, aber es wurde gezeigt, dass sie auch Histondeacetylase-(HDAC-)Trafficking reguliert (Tsankova et al. 2007). Interessanterweise erniedrigt Alkohol die Aktivität der HDAC und verstärkt somit die Azetylierung von Histonen (Pandey et al. 2008). Ferner führt die Verabreichung eines HDAC-Inhibitors zur verstärkten transkriptionellen und Verhaltensantwort nach einer Alkoholchallenge (Sanchis-Segura et al. 2009; Abb. 3.1). Die Bedeutung der camp-pka-signaltransduktion wurde am Beispiel von Mäusen mit genetisch modifizierter Gα s -Funktion gezeigt. Mäuse, denen ein Gα s -Allel fehlt, haben eine niedrige Adenylylzyklaseaktivität im NAC, und ihr freiwilliger Alkoholkonsum ist niedriger als bei ihren Wildtypkontrollen (Wand et al. 2001). Damit vergleichbar senkt ein durch Viren in das NAC übertragenes dominant-negatives Peptid, das die βγ-untereinheiten von G-Proteinen inhibiert, die operante Alkoholselbstverabreichung bei Ratten (Yao et al. 2002). Diese Daten implizieren, dass eine Reduktion der camp- PKA-Signaltransduktion den Alkoholkonsum erniedrigt. Daher ist es überraschend, dass Knockout-Mäuse, denen eine regulatorische Untereinheit von PKA fehlt, erhöhte Alkoholmengen konsumieren (Thiele et al. 2000). Bei ihnen ist ebenfalls die camp-stimulierte PKA-Aktivität im NAC und der Amygdala erniedrigt. In Übereinstimmung mit dieser genetischen Manipulation der PKA-Aktivität erhöht die Infusion eines PKA-Inhibitors in den NAC-Shell den freiwilligen Alkoholkonsum (Misra u. Pandey 2006). Außerdem erniedrigt PKA-Inhibierung die Konzentration der α-katalytischen Untereinheit von PKA (PKA-Cα) und von phospho-creb. Es scheint somit, dass weniger PKA/CREB- Aktivität an einer erhöhten Alkoholpräferenz beteiligt ist (Misra u. Pandey 2006). Beeinträchtigung der CREB-Funktion. In der Tat sind im Vergleich zu NP-Ratten hohe Alkoholpräferenz und exzessiver Alkoholkonsum, wie sie bei P-Ratten auftreten (Bell et al. 2006), mit einer erniedrigten Konzentration von phospho-creb in der zentralen Amygdala verbunden. Bei P-Ratten erhöht die Infusion eines PKA-Aktivators in die zentrale Amygdala die CREB-Funktion und reduziert dabei die aufgenommene Alkoholmenge. Im Gegensatz dazu revertierte die Infusion eines PKA-Inhibitors in die zentrale Amygdala den Phänotyp von NP-Ratten; nach dieser Behandlung zeigen sie gesteigerten Alkoholkonsum durch veränderte CREB-Funktion (Pandey et al. 2005). Aufgrund dieser Ergebnisse wäre es möglich, dass eine Beeinträchtigung der CREB-Funktion in der zentralen Amygdala am erhöhten Alkoholkonsum von P-Ratten beteiligt ist. Dies stimmt mit dem Befund überein, dass bei heterozygoten CREB-Knockout-Mäusen der Alkoholkonsum ebenfalls erhöht ist (Pandey et al. 2005). Es stellt sich allerdings die Frage, ob dieses Ergebnis schlüssig ist, denn der Verlust von CREB wird schnell durch Überexpression von CREM (Hummler et al. 1994, Valverde et al. 2004), einem anderen Mitglied der CREB-Familie, kompensiert. Trotz einiger Ungereimtheiten zwischen verschiedenen Knockout-Modellen und deren Alkoholkonsumverhalten belegen die Daten überzeugend, dass die PKA-Signaltransduktion Alkohol-Reinforcement moduliert und dass chronische Alkoholexposition zu einer Abschwächung der CREB- Funktion führt. Erwähnenswert in diesem Zusammenhang ist der fundamentale Unterschied zwischen der von Alkohol und der von anderen Missbrauchsdrogen abhängigen camp-pka-signaltransduktion, bei der es sich um eine Hochregulation der CREB handelt, wie sie üblicherweise nach chronischer Exposition gegenüber Drogen wie Kokain auftritt (Carlezon et al. 2005, Ron u. Jurd 2005). Beeinträchtigung der DARPP-32-Funktion. Neben CREB wird auch DARPP-32, ein 32-kD-Protein, das vorwiegend in striatalen Projektionsneuronen exprimiert wird, bei der Aktivierung der D1-cAMP-PKA-Signaltransduktion phosphoryliert, was es zu einem starken Inhibitor der Proteinphosphatase-1 (PP1) und damit zu einem wichtigen Regulator der dopaminergen Signaltransduktion macht (Greengard et al. 1999). PP1 dephosphoryliert die NR1-Untereinheit des NMDA-Rezeptors. Folglich resultiert die Inhibierung von PP1 durch DARPP-32 zu verstärkter Phosphorylierung des NMDA-Rezeptors, die wiederum die Kanalfunktion verstärkt und der akuten Inhibierung dieses Rezeptors durch Ethanol entgegenwirkt (Maldve et al. 2002).

15 3.1 Pharmakologische Aspekte des Alkohols 125 Bemerkenswerterweise tritt diese durch Ethanol induzierte Verstärkung der NMDA-Rezeptor-Aktivität nur in dopaminozeptiven Neuronen auf, die neben der DARPP-32/ PP1-Kaskade D1-Rezeptoren enthalten. Es ist daher möglich, dass diese Kaskade entscheidend für die synaptische Plastizität ist, die durch Alkoholexposition induziert wird, denn die striatale DARPP-32-vermittelte Verstärkung der NMDA-Rezeptor-Funktion ist wahrscheinlich wichtig für die NMDA-abhängige Long-Term Potentiation (LTP). Als Ergebnis dieser zellulären Änderungen sollte DARPP-32 an der Regulation von Alkohol-Reinforcement beteiligt sein. In der Tat konsumieren DARPP-32-Knockout-Mäuse freiwillig weniger Alkohol als die entsprechenden Wildtyptiere (Risinger et al. 2001; Abb. 3.1). Verstärkung der GABA A -Rezeptor-Funktion. Neben dem Wissen über die camp-pka-signaltransduktion weisen auch die Ergebnisse älterer Zellkulturversuche darauf hin, dass Proteinkinase C (PKC) an der Vermittlung akuter und chronischer Alkoholeffekte beteiligt ist (Diamond u. Gordon 1997, Newton u. Ron 2007). PKC ist eine Familie von Kinasen, die durch Kalziumionen aktiviert werden. Im Gehirn wurden verschiedene Isoformen der PKC nachgewiesen. Nach ihrer Aktivierung binden sie an Gerüstproteine, also Proteine, die Kinasen in die Lage versetzen, effizient an bestimmte Ziele wie Rezeptoren oder Ionenkanäle zu binden. Wichtige Vertreter der Gerüstproteine, die an der akuten Wirkung von Alkohol und den neuroadaptiven Veränderungen nach chronischem Gebrauch beteiligt sind, sind Homer (Szumlinski et al. 2008), RACK1 (Vagts et al. 2003) und β-arrestin 2 (Björk et al. 2008). Abb. 3.1 Nach der durch Alkohol hervorgerufenen Freisetzung von Dopamin werden auf dopaminozeptiven Neuronen D1-Rezeptoren aktiviert. Durch die Kopplung von stimulatorischen G-Proteinen (Gα S ) wird die Adenylylzyklase aktiviert, die die Synthese von zyklischem Adenosinmonophosphat (camp) aus Adenosintriphosphat (ATP) katalysiert. Die erhöhte camp-konzentration wiederum aktiviert die Proteinkinase A (PKA). Diese Aktivierung findet statt durch die Dissoziation der regulatorischen Untereinheit (R) von der katalytischen Untereinheit PKA-Cα. Die Freisetzung der katalytischen Untereinheit führt dann zu einer Phosphorylierung von CREB. Alkohol kann die CREB-Aktivität über den D1-cAMP/PKA-Weg beeinflussen bzw. kann auch die Expression von kalzium-/calmodulinabhängiger Proteinkinase IV (CaMKIV) modulieren und so einen Einfluss auf den Phosphorylierungsstatus von CREB nehmen. Diese molekularen Ereignisse beeinflussen schließlich die Transkription einer Vielzahl von Genen, die ein camp-response-element (CRE) in ihrer Promotorregion haben, insbesondere CRH, NPY, PDYN und BDNF. Neben der Phosphorylierung von CREB wird auch ein 32-KD-Protein (DARPP-32) phosphoryliert, das hauptsächlich in Medium-spiny-Neuronen exprimiert wird. In seiner phosphorylierten Form agiert es als ein potenter Inhibitor von der Proteinphosphatase 1 (PP1). Die Funktion von PP1 ist wiederum die Dephosphorylierung der NR1-Untereinheit des NMDA. Deshalb führt PP1-Inhibition durch DARPP-32 zu einer gesteigerten Phosphorylierung und somit zu einer erhöhten Kanalfunktion, die wiederum der primären inibitorischen Wirkung von Ethanol am NMDA-Rezeptor entgegenwirkt. Genetische Deletion bzw. pharmakologische Manipulation von Gα S, βγ, PKA oder DARPP-32 führt zu signifikanten Veränderungen der freiwilligen Alkoholaufnahme (in der Abbildung durch Pfeile gekennzeichnet; Quelle: Spanagel 2009).

16 126 3 Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem PKC-Signaltransduktion Die beiden Isoformen PKCγ und PKCε interagieren mit diesen Gerüstproteinen und scheinen eine wichtige Rolle bei der Vermittlung eines alkoholinduzierten Verhaltensresponses zu spielen. PKCγ-Knockout-Mäuse haben höhere Alkoholpräferenz (Boweres u. Wehner 2001) als Wildtyp- Mäuse; bei PKCε-Knock-outs hingegen ist die Alkoholpräferenz deutlich erniedrigt (Hodge et al. 1999). Ein Rescue des letzteren Phänotyps konnte durch die induzierbare Expression von PKCε im NAC bewirkt werden; auch in anderen Regionen des Vorderhirns konnte die Alkoholpräferenz adulter PKCε-Knockout-Mäuse auf das Niveau des Wildtyps wieder hergestellt werden (Choi et al. 2002). Daraus ist ersichtlich, dass die PKCε-Signaltransduktion im adulten Hirn Alkohol-Reinforcement reguliert. Bei beiden PKC-Isoformen scheint eine entgegengesetzte physikalische Interaktion via Phosphorylierung mit GA- BA A -Rezeptoren stattzufinden (Newton u. Ron 2007), sodass die Verstärkung der GABA A -Rezeptor-Funktion durch Ethanol bei PKCγ-Knockout-Mäusen reduziert (Harris et al. 1995) bzw. die Funktion bei PKCε-Knock-outs verstärkt ist (Hodge et al. 1999). NO/cGMP -Signaltransduktion Neben GABA A stellen Glutamatrezeptoren einen wichtigen Faktor bei der Vermittlung der Alkoholwirkung dar. Das glutamaterge System ist eng an den intra- und extrazellulären Messenger Stickstoffmonoxid (NO) gekoppelt (Bredt u. Snyder 1994). Das bedeutet, dass die Stimulierung von NM- DA-Rezeptoren einen Kalziuminflux bewirkt und die Bindung von Kalziumionen an Calmodulin unter anderem die neuronale NO-Synthase aktiviert, die NO aus Arginin synthetisiert. NO ist einer der wenigen bekannten gasförmigen Signaltransduktoren und kann als retrograder Messenger wirken. Die Aktivierung von Guanylylzyklase mit dem daraus resultieren Anstieg von zyklischem GMP ist ein wichtiges Downstreamsignal von NO in Neuronen. Die Signaltransduktion durch cgmp ist bislang noch nicht vollständig geklärt. cgmp wirkt auf verschiedene Ionenkanäle und Phosphodiesterasen in vivo. In vielen Zelltypen ist die Angriffsstelle von cgmp die cgmp-abhängige Proteinkinase I bzw. II (abgekürzt cgki und cgkii; Hofmann et al. 2006). Im Hirn sind NO, cgmp und cgkii eng miteinander gekoppelt, denn die beiden Enzyme nnos und cgkii werden häufig koexprimiert, sei es direkt oder indirekt über cgkii-exprimierende Neuronen, die über Afferenzen mit nnos enthaltender Neuronen verbunden sind (Hofmann et al. 2006). Aus pharmakologischen und Knockout-Studien kann man schließen, dass die Wirkung von Alkohol mit der Signaltransduktion von nnos/no/cgmp/cgkii zusammenhängt. Inhibitoren, die alle Isoformen von NOS hemmen, beeinflussen den Alkoholkonsum bei verschiedenen alkoholpräferierenden Rattenlinien (Calapai et al. 1996, Rezvani et al. 1995). Wichtiger noch ist, dass nnos-knockout- Mäuse sechsmal so hoch konzentrierte Alkohollösungen konsumieren wie der Wildtyp (Spanagel et al. 2002). Folglich ist die NO-Signaltransduktion ebenfalls entscheidend an der Regulation von Alkoholeinnahmeverhalten beteiligt. Da nnos-knockout-mäuse betont aggressiv sind (Nelson et al. 1995), wäre es sogar möglich, dass der Zusammenhang zwischen Aggressivität und Alkoholkonsum auf Änderungen im nnos-gen zurückzuführen sein könnte. Man sollte in diesem Zusammenhang berücksichtigen, dass aggressive Menschen häufig Alkoholiker sind (Jaffe et al. 1988) und dass umgekehrt Alkoholkonsum häufig mit aggressivem und gewalttätigem Verhalten in verschiedenen Erscheinungsformen verbunden ist (Pihl u. LeMarquand 1988). Schließlich vermitteln auch die downstream von NO in Neuronen gesteuerten Komponenten, also cgmp und cg- MP-Kinase, gewisse Aspekte des durch Alkohol hervorgerufenen Verhaltens. So konsumieren cgkii-knockout-mäuse freiwillig mehr Alkohol als die entsprechenden Wildtyptiere (Werner et al. 2004). In ihrer Gesamtheit lassen die Ähnlichkeiten im Verhalten von nnos- und cgmpii-knockouts- Tieren vermuten, dass der NO/cGMP/cGKII-Signaltransduktionsweg daran beteiligt ist, Alkohol-Reinforcement und andere Verhaltensweisen wie alkoholbedingte Aggressivität zu regulieren. Zusammenfassend ist die camp-pka-signaltransduktion nicht nur an der Vermittlung der akuten Alkoholwirkung beteiligt, sondern beeinflusst nach chronischer Aufnahme auch CREB-vermittelte Reaktionen. Diese veränderte CREB-Funktion beeinflusst eine Reihe von Alkoholzielgenen und führt somit zu lang anhaltenden, wenn nicht persistierenden neuroadaptiven Veränderungen im ZNS und anderen Organen. Außerdem beeinflusst die camp- PKA-Signaltransduktion in striatalen Projektionsneuronen die Funktion von DARPP-32, das wiederum ein bedeutender Regulator der NMDA-Rezeptor-Funktion innerhalb des Verstärkungssystems ist. NMDA-Rezeptoren stehen auch in engem Zusammenhang mit der NO/cGMP-Signaltransduktion, und diese Kaskade ist ebenfalls entscheidend involviert in die Regulation des freiwilligen Alkoholkonsums und anderer alkoholbedingter Verhaltensweisen (z. B. erhöhte Aggressivität). Auch die PKC-Signaltransduktion wird stark von Alkohol beeinflusst, wodurch wiederum die Funktion von GABA A - Rezeptoren betroffen ist. Alkohol entfaltet seine neuroplastischen Effekte über verschiedene Signaltransduktionskaskaden. Eine Reihe von CREB-regulierten Zielgenen (insbesondere CRH, NPY, PDYN und BDNF) werden über die camp- PKA-Kaskade beeinflusst. Zusätzlich wirkt der camp-pka-weg in striatalen Projektionsneuronen auf die DARPP-32-Funktion, einem wichtigen Regulator der Aktivität von NMDA-Rezeptoren. Ethanol wirkt ebenfalls auf PKC-vermittelte molekulare Veränderungen; z. B. wird über PKC die Aktivität von GA- BA A -Rezeptoren reguliert. Bestimmte Verhaltenseffekte (z. B. erhöhte Aggressivität nach Alkoholkonsum) könnten auch durch den NO/ cgmp-signaltransduktionsweg vermittelt werden.

17 3.1 Pharmakologische Aspekte des Alkohols 127 Zusammenfassung Dieser Übersichtsartikel vermittelt eine Gesamtsicht der akuten und chronischen zentralen Wirkungen von Alkohol. Die erste Interaktionsebene betrifft die primären Angriffsstellen im Gehirn und anderen Zielorganen. Ethanol hat nur wenige Angriffsstellen, darunter NMDA-, GABA A -, Glycin-, 5-HT 3 - und nach -Rezeptoren, außerdem Kalziumkanäle vom Typ L und G-Protein-Activated Inwardly Rectifying K + Channels (GIRK). Diese primäre Interaktion auf Rezeptor und Kanalebene führt zur Alkoholintoxikation und triggert die subjektiven Empfindungen. Nach dem First Hit von Ethanol auf diese Rezeptoren und Ionenkanäle setzt eine zweite Welle indirekter Wirkungen auf Monoamine, Opioide und Endocannabinoide ein, die von entscheidender Bedeutung für die Entwicklung eines Belohnungsgefühls durch Alkohol sind und so das Trinkverhalten beeinflussen. Sowohl an den primären als auch an den sekundären Ethanolwirkungen ist neben PKA- auch PKC-Signaltransduktion beteiligt. Als Folge der direkten Alkoholexposition erfolgt die Aktivierung der PKA-Signaltransduktion, wohingegen chronische Exposition zu einer adaptiven Herunterregulation dieser molekularen Kaskade, insbesondere der CREB-Funktion, führt. Zusätzlich wirkt die PKA-Signaltransduktion in striatalen Projektionsneuronen auf die DARPP-32-Funktion, einem wichtigen Regulator der Aktivität von NMDA-Rezeptoren, die am Verstärkungssystem beteiligt sind. NMDA-Rezeptoren sind ebenfalls eng mit der NO/cGMP-Signaltransduktion gekoppelt; über diesen molekularen Mechanismus werden einerseits die Alkoholaufnahme mit moduliert, aber auch andere durch Alkohol hervorgerufene Verhaltensweisen wie etwa erhöhte Aggressivität vermittelt. Ethanol wirkt ebenfalls signifikant auf die PKC-Signaltransduktion und diese wiederum auf die Funktion der GABA A -Rezeptoren. Alkohol wirkt daher auf die Aktivität von Rezeptoren, die wichtig für die synaptische Plastizität sind (also Glutamatund GABA-Rezeptoren) und beeinflusst außerdem CREB-vermittelte Reaktionen. Eine Änderung der CREB-Funktion wirkt sich auf eine Reihe alkoholempfindlicher Zielgene aus, deren bedeutendste CRH, Prodynorphin, BDNF und NPY sind. Jedoch wird auch über CREB-unabhängige Mechanismen eine Vielzahl weiterer alkoholresponsiver Gene reguliert, die maßgeblich an Neurotransmission und Signalübertragung beteiligt sind und zentrale Alkoholwirkungen vermitteln. Literatur Ahlenius S, Carlsson A, Engel J et al. Antagonism by alpha methyltyrosine of the ethanol-induced stimulation and euphoria in man. Clin Pharmacol Ther 1973; 14: Baldo BA, Daniel RA, Berridge CW et al. Overlapping distributions of orexin/ hypocretin- and dopamine-beta-hydroxylase immunoreactive fibers in rat brain regions mediating arousal, motivation, and stress. J Comp Neurol 2003; 464: Bell RL, Rodd ZA, Lumeng L et al. The alcohol-preferring P rat and animal models of excessive alcohol drinking. Addict Biol 2006; 11: Bienkowski P, Koros E, Kostowski W et al. Effects of N-methyl-Daspartate receptor antagonists on reinforced and nonreinforced responding for ethanol in rats. Alcohol 1999; 18: Björk K, Rimondini R, Hansson AC et al. Modulation of voluntary ethanol consumption by beta-arrestin 2. FASEB J 2008; 22: Blaha CD, Yang CR, Floresco SB et al. Stimulation of the ventral subiculum of the hippocampus evokes glutamate receptor-mediated changes in dopamine efflux in the rat nucleus accumbens. Eur J Neurosci 1997; 9: Blomqvist O, Engel JA, Nissbrandt H et al. The mesolimbic dopamineactivating properties of ethanol are antagonized by mecamylamine. Eur J Pharmacol 1993; 249: Blood AJ, Zatorre RJ. Intensely pleasurable responses to music correlate with activity in brain regions implicated in reward and emotion. Proc Natl Acad Sci U S A 2001; 98: Bloom F, Battenberg E, Rossier J, Ling N, Guillemin R. Neurons containing β-endorphin in rat brain exist separately from those containing enkephalin: immunocytochemical studies. Proc Natl Acad Sci USA 1978; 75: Boehm SL 2 nd, Ponomarev I, Jennings AW et al. γ-aminobutyric acid A receptor subunit mutant mice: new perspectives on alcohol actions. Biochem Pharmacol 2004; 68: Boileau I, Assaad JM, Pihl RO et al. Alcohol promotes dopamine release in the human nucleus accumbens. Synapse 2003; 49: Boweres BJ, Wehner JM. Ethanol consumption and behavioral impulsivity are increased in protein kinase Cgamma null mutant mice. J Neurosci 2001; 21: RC180 Bredt DS, Snyder SH. Nitric oxide: A physiologic messenger molecule. Ann Rev Biochem 1994; 6: Bucci BK, Kruse SW, Thode AB et al. Effect of n-alcohols on the structure and stability of the Drosophila odorant binding protein LUSH. Biochemistry 2006; 45: Caillé S, Alvarez-Jaimes L, Polis I et al. Specific alterations of extracellular endocannabinoid levels in the nucleus accumbens by ethanol, heroin, and cocaine self-administration. J Neurosci 2007; 27: Calapai G, Mazzaglia G, Sautebin L et al. Inhibition of nitric oxide formation reduces voluntary ethanol consumption in the rat. Psychopharmacology (Berl) 1996; 125: Carboni E, Acquas E, Frau R et al. Differential inhibitory effects of a 5-HT3 antagonist on drug-induced stimulation of dopamine release. Eur J Pharmacol 1989; 164: Carlezon jr. WA, Duman RS, Nestler EJ. The many faces of CREB. Trends Neurosci 2005; 28: Carr LG, Spence JP, Peter Eriksson CJ et al. AA and ANA rats exhibit the R100Q mutation in the GABAA receptor alpha 6 subunit. Alcohol 2003; 31: Choi DS, Wang D, Dadgar J et al. Conditional rescue of protein kinase C epsilon regulates ethanol preference and hypnotic sensitivity in adult mice. J Neurosci 2002; 22: Ciccocioppo R, Economidou D, Cippitelli A et al. Genetically selected Marchigian Sardinian alcohol-preferring (msp) rats: an animal model to study the neurobiology of alcoholism. Addict Biol 2006; 11: Cippitelli A, Bilbao A, Hansson AC et al. The European TARGALC Consortium. Cannabinoid CB1 receptor antagonism reduces conditioned reinstatement of ethanol-seeking behavior in rats. Eur J Neurosci 2005; 21: Cohen C, Perrault G, Sanger DJ. Preferential involvement of D3 versus D2 dopamine receptors in the effects of dopamine receptor ligands on oral ethanol self-administration in rats. Psychopharmacology (Berl) 1998; 140: Colombo G, Grant KA. NMDA receptor complex antagonists have ethanol-like discriminative stimulus effects. Ann NY Acad Sci 1992; 654: Colombo G, Serra S, Brunetti G et al. Stimulation of voluntary ethanol intake by cannabinoid receptor agonists in ethanol-preferring sp rats. Psychopharmacology (Berl) 2002; 159: Colombo G, Serra S, Vacca G et al. Endocannabinoid system and alcohol addiction: pharmacological studies. Pharmacol Biochem Behav 2005; 81: Colombo G, Lobina C, Carai MA et al. Phenotypic characterization of genetically selected Sardinian alcohol-preferring (sp) and -nonpreferring (snp) rats. Addict Biol 2006; 11:

18 128 3 Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem Cowen MS, Schroff KC, Gass P et al. Neurobehavioral effects of alcohol in AMPA receptor subunit (GluR1) deficient mice. Neuropharmacology 2003; 45: Crabbe JC, Phillips TJ, Harris RA et al. Alcohol-related genes: contributions from studies with genetically engineered mice. Addict Biol 2006; 11: Cummings DE, Naleid AM, Figlewicz Lattemann DP. Ghrelin: a link between energy homeostasis and drug abuse? Addict Biol 2007; 12: 1 5 Dayas CV, McGranahan TM, Martin-Fardon R et al. Stimuli linked to ethanol availability activate hypothalamic CART and orexin neurons in a reinstatement model of relapse. Biol Psychiatry 2008; 63: Devine DP, Wise RA. Self-administration of morphine, DAMGO, and DPDPE into the ventral tegmental area of rats. J Neurosci 1994; 14: Di Chiara G, Imperato A. Drugs abused by humans preferentially increase synaptic dopamine concentrations in the mesolimbic system of freely moving rats. Proc Natl Acad Sci USA 1988; 85: Diamond I, Gordon AS. Cellular and molecular neuroscience of alcoholism. Physiol Rev 1997; 77: 1 19 Doty P, de Wit H. Effects of naltrexone pretreatment on the subjective and performance effects of ethanol in social drinkers. Behav Pharmacol 1995; 6: Doty P, Kirk JM, Cramblett MJ et al. Behavioral responses to ethanol in light and moderate social drinkers following naltrexone pretreatment. Drug Alcohol Depend 1997; 47: Drobes DJ, Anton RF, Thomas SE et al. Effects of naltrexone and nalmefene on subjective response to alcohol among non-treatment-seeking alcoholics and social drinkers. Alcohol Clin Exp Res 2004; 28: Dyr W, McBride WJ, Lumeng L et al. Effects of D1 and D2 dopamine receptor agents on ethanol consumption in the high-alcoholdrinking (HAD) line of rats. Alcohol 1993; 10: Engel SR, Lyons CR, Allan AM. 5-HT3 receptor over-expression decreases ethanol self administration in transgenic mice. Psychopharmacology (Berl) 1998; 140: Ericson M, Blomqvist O, Engel JA et al. Voluntary ethanol intake in the rat and the associated accumbal dopamine overflow are blocked by ventral tegmental mecamylamine. Eur J Pharmacol 1998; 358: Ericson M, Molander A, Löf E et al. Ethanol elevates accumbal dopamine levels via indirect activation of ventral tegmental nicotinic acetylcholine receptors. Eur J Pharmacol 2003; 467: Ericson M, Lof E, Stomberg R et al. Nicotinic acetylcholine receptors in the anterior, but not posterior, VTA mediate ethanol induced elevation of accumbal dopamine levels. J Pharmacol Exp Ther 2008; 326: Fattore L, Cossu G, Spano MS et al. Cannabinoids and reward: interactions with the opioid system. Crit Rev Neurobiol 2004; 16: Finley JC, Lindstrom P, Petrusz P. Immunocytochemical localization of β-endorphin-containing neurons in the rat brain. Neuroendocrinology 1981; 33: Freund TF, Katona I, Piomelli D. Role of endogenous cannabinoids in synaptic signaling. Physiol Rev 2003; 83: Gass JT, Olive MF. Glutamatergic substrates of drug addiction and alcoholism. Biochem Pharmacol 2008; 75: Gatto GJ, McBride WJ, Murphy JM et al. Ethanol self-infusion into the ventral tegmental area by alcohol-preferring rats. Alcohol 1994; 11: Georgiadis JR, Kortekaas R, Kuipers R et al. Regional cerebral blood flow changes associated with clitorally induced orgasm in healthy women. Eur J Neurosci 2006; 24: Gessa GL, Muntoni F, Collu M et al. Low doses of ethanol activate dopaminergic neurons of the ventral tegmental area. Brain Res 1985; 348: Gessa GL, Serra S, Vacca G et al. Suppressing effect of the cannabinoid CB1 receptor antagonist, SR , on alcohol intake and motivational properties of alcohol in alcohol-preferring sp rats. Alcohol Alcohol 2005; 40: Goeders NE, Lane JD, Smith JE. Self-administration of methionine enkephalin into the nucleus accumbens. Pharmacol Biochem Behav 1984; 20: Gonzales RA, Weiss F. Suppression of ethanol-reinforced behavior by naltrexone is associated with attenuation of the ethanol-induced increase in dialysate dopamine levels in the nucleus accumbens. J Neurosci 1998; 18: Grant KA, Colombo G. Discriminative stimulus effects of ethanol: effect of training dose on the substitution of N-methyl-D-aspartate antagonists. J Pharmacol Exp Ther 1993; 264: Grant KA. Emerging neurochemical concepts in the actions of ethanol at ligand-gated ion channels. Behav Pharmacol 1994; 5: Greengard P, Allen PB, Nairn AC. Beyond the dopamine receptor: the DARPP-32/protein phosphatase-1 cascade. Neuron 1999; 23: Hansson AC, Bermudez-Silva FJ, Marinen H et al. Genetic impairment of frontocortical endocannabinoid degradation and high alcohol preference. Neuropsychopharmacology 2007; 32: Harris GC, Aston-Jones G. Arousal and reward: a dichotomy in orexin function. Trends Neurosci 2006; 29: Harris RA, McQuilkin SJ, Paylor R et al. Mutant mice lacking the gamma isoform of protein kinase C show decreased behavioral actions of ethanol and altered function of gamma-aminobutyrate type A receptors. Proc Natl Acad Sci USA 1995; 92: Harris RA. Ethanol actions on multiple ion channels: which are important? Alcohol Clin Exp Res 1999; 23: Herz A. Endogenous opioid systems and alcohol addiction. Psychopharmacology (Berl) 1997; 129: Hodge CW, Mehmert KK, Kelley SP et al. Supersensitivity to allosteric GABA(A) receptor modulators and alcohol in mice lacking PKCepsilon. Nat Neurosci 1999; 2: Hodge CW, Grant KA, Becker HC et al. Understanding how the brain perceives alcohol: neurobiological basis of ethanol discrimination. Alcohol Clin Exp Res 2006; 30: Hofmann F, Feil R, Kleppisch T et al. Function of cgmp-dependent protein kinases as revealed by gene deletion. Physiol Rev 2006; 86: 1 23 Holstege G, Georgiadis JR, Paans AM et al. Brain activation during human male ejaculation. J Neurosci 2003; 23: Hölter SM, Danysz W, Spanagel R. The non-competitive NMDA receptor antagonist MRZ 2/579 suppresses the alcohol deprivation effect in long-term alcohol drinking rats and substitutes the alcohol cue in a discrimination task. J Pharmacol Exp Ther 2000; 292: Howland JG, Taepavarapruk P, Phillips AG. Glutamate receptor-dependent modulation of dopamine efflux in the nucleus accumbens by basolateral, but not central, nucleus of the amygdala in rats. J Neurosci 2002; 22: Hummler E, Cole TJ, Blendy JA et al. Targeted mutation of the CREB gene: compensation within the CREB/ATF family of transcription factors. Proc Natl Acad Sci USA 1994; 91: Hundt W, Hölter SM, Spanagel R. Discriminative stimulus effects of glutamate release inhibitors in rats trained to discriminate ethanol. Pharmacol Biochem Behav 1998; 59: Hungund BL, Basavarajappa BS. Distinct differences in the cannabinoid receptor binding in the brain of C57BL/6 and DBA/2 mice, selected for their differences in voluntary ethanol consumption. J Neurosci Res 2000; 60: Hyytiä P, Kiianmaa K. Suppression of ethanol responding by centrally administered CTOP and naltrindole in AA and Wistar rats. Alcohol Clin Exp Res 2001; 25: Ikemoto S, McBride WJ, Murphy JM et al. 6-OHDA lesions of the nucleus accumbens disrupt the acquisition but not the maintenance of ethanol consumption in the alcohol-preferring P line of rats. Alcohol Clin Exp Res 1997; 21: Jackson A, Stephens DN, Duka T. A low dose alcohol drug discrimination in social drinkers: relationship with subjective effects. Psychopharmacology 2001; 157: Jaffe JH, Babor TF, Fischbein TH. Alcoholics, aggression and antisocial personality. J Stud Alcohol 1988; 49:

19 3.1 Pharmakologische Aspekte des Alkohols 129 Jerlhag E, Egecioglu E, Dickson SL et al. Ghrelin stimulates locomotor activity and accumbal dopamine-overflow via central cholinergic systems in mice: implications for its involvement in brain reward. Addict Biol 2006; 11: Jerlhag E, Egecioglu E, Dickson SL et al. Ghrelin administration into tegmental areas stimulates locomotor activity and increases extracellular concentration of dopamine in the nucleus accumbens. Addict Biol 2007; 12: 6 16 June HL Sr, Foster KL, Eiler WJ 2 nd et al. Dopamine and benzodiazepine-dependent mechanisms regulate the EtOH-enhanced locomotor stimulation in the GABAA alpha1 subunit null mutant mice. Neuropsychopharmacology 2007; 32: June HL, Torres L, Cason CR et al. The novel benzodiazepine inverse agonist RO antagonizes ethanol motivated behaviors: neuropharmacological studies. Brain Res 1998; 784: Jurd R, Arras M, Lambert S et al. General anesthetic actions in vivo strongly attenuated by a point mutation in the GABA(A) receptor beta3 subunit. FASEB J 2003; 17: Kalivas PW. Neurotransmitter regulation of dopamine neurons in the ventral tegmental area. Brain Res Rev 1993; 18: Kampe KK, Frith CD, Dolan RJ et al. Reward value of attractivness and gaze. Nature 2001; 413: 589 Katner SN, Kerr TM, Weiss F. Ethanol anticipation enhances dopamine efflux in the nucleus accumbens of alcohol-preferring (P) but not Wistar rats. Behav Pharmacol 1996; 7: Katner SN, Weiss F. Neurochemical characteristics associated with ethanol preference in selected alcohol-preferring and -nonpreferring rats: a quantitative microdialysis study. Alcohol Clin Exp Res 2001; 25: Kauer JA, Malenka RC. Synaptic plasticity and addiction. Nat Rev Neurosci 2007; 8: Kelaï S, Aïssi F, Lesch KP et al. Alcohol intake after serotonin transporter inactivation in mice. Alcohol Alcohol 2003; 38: Kiianmaa K, Nurmi M, Nykanen I et al. Effect of ethanol on extracellular dopamine in the nucleus accumbens of alcohol-preferrring AA and alcohol-avoiding ANA rats. Pharmacol Biochem Behav 1995; 52: Kim MS, Repp A, Smith DP. LUSH odorant-binding protein mediates chemosensory responses to alcohols in Drosophila melanogaster. Genetics 1998; 150: Kinoshita H, Jessop DS, Finn DP et al. Acute ethanol decreases NPY mrna but not POMC mrna in the arcuate nucleus. NeuroReport 2000; 11: Kobayashi T, Ikeda K, Kojima H et al. Ethanol opens G-protein activated inwardly rectifying K + channels. Nat Neurosci 1999; 2: Kohl RR, Katner JS, Chernet E et al. Ethanol and negative feedback regulation of mesolimbic dopamine release in rats. Psychopharmacology 1998; 139: Kostowski W, Bienkowski P. Discriminative stimulus effects of ethanol: neuropharmacological characterization. Alcohol 1999; 17: Kruse SW, Zhao R, Smith DP et al. Structure of a specific alcoholbinding site defined by the odorant binding protein LUSH from Drosophila melanogaster. Nat Struct Biol 2003; 10: Krystal JH, Petrakis IL, Webb E et al. Dose-related ethanol-like effects of the NMDA antagonist, ketamine, in recently detoxified alcoholics. Arch Gen Psychiatry 1998; 55: Larsson A, Jerlhag E, Svensson L et al. Is an alpha-conotoxin MIIsensitive mechanism involved in the neurochemical, stimulatory, and rewarding effects of ethanol? Alcohol 2004; 34: Lauckner JE, Jensen JB, Chen HY et al. GPR55 is a cannabinoid receptor that increases intracellular calcium and inhibits M current. Proc Natl Acad Sci USA 2008; 105: Lawrence AJ, Cowen MS, Yang HJ et al. The orexin system regulates alcohol-seeking in rats. Br J Pharmacol 2006; 148: Lê AD, Funk R. Serotonergic Compounds: preclinical Data. In: Spanagel R, Mann K, eds. Drugs for Relapse Prevention of Alcoholism. Basel: Birkhäuser; 2005: Lê AD, Poulos CX, Harding S et al. Effects of naltrexone and fluoxetine on alcohol self-administration and reinstatement of alcohol seeking induced by priming injections of alcohol and exposure to stress. Neuropsychopharmacology 1999; 21: Lewohl JM, Wilson WR, Mayfield RD et al. Gprotein- coupled inwardly rectifying potassium channels are targets of alcohol action. Nat Neurosci 1999; 2: Liu W, Thielen RJ, Rodd ZA et al. Activation of serotonin-3 receptors increases dopamine release within the ventral tegmental area of Wistar and alcohol-preferring (P) rats. Alcohol 2006; 40: Löf E, Ericson M, Stomberg R et al. Characterization of ethanol-induced dopamine elevation in the rat nucleus accumbens. Eur J Pharmacol 2007a; 555: Löf E, Olausson P, debejczy A et al. Nicotinic acetylcholine receptors in the ventral tegmental area mediate the dopamine activating and reinforcing properties of ethanol cues. Psychopharmacology (Berl) 2007b; 195: Lonze BE, Ginty DD. Function and regulation of CREB family transcription factors in the nervous system. Neuron 2002; 35: Lovinger DM, White G, Weight FF. Ethanol inhibits NMDA-activated ion current in hippocampal neurons. Science 1989; 243: Lovinger DM, White G. Ethanol potentiation of 5-hydroxytryptamine 3 receptor-mediated ion current in neuroblastoma cells and isolated adult mammalian neurons. Mol Pharmacol 1991; 40: Luscher C, Ungless MA. The mechanistic classification of addictive drugs. PLoS Med 2006; 3: e437 Lyness WH, Smith FL. Influence of dopaminergic and serotonergic neurons on intravenous ethanol self-administration in the rat. Pharmacol Biochem Behav 1992; 42: Macenski MJ, Shelton KL. Self-administered ethanol as a discriminative stimulus in rats. Drug Alcohol Depend 2001; 64: Madeira MD, Paula-Barbosa MM. Effects of alcohol on the synthesis and expression of hypothalamic peptides. Brain Res Bull 1999; 48: 3 22 Maldonado F, Valverde O, Berrendero F. Involvement of the endocannabinoid system in drug addiction. Trends Neurosci 2006; 29: Maldve RE, Zhang TA, Ferrani-Kile K et al. DARPP-32 and regulation of the ethanol sensitivity of NMDA receptors in the nucleus accumbens. Nat Neurosci 2002; 5: Marinelli PW, Quirion R, Gianoulakis C. An in vivo profile of betaendorphin release in the arcuate nucleus and nucleus accumbens following exposure to stress or alcohol. Neuroscience 2004; 127: McBride WJ, Li TK. Animal models of alcoholism: neurobiology of high alcohol-drinking behavior in rodents. Crit Rev Neurobiol 1998; 12: McBride WJ, Lovinger DM, Machu T et al. Serotonin-3 receptors in the actions of alcohol, alcohol reinforcement, and alcoholism. Alcohol Clin Exp Res 2004; 28: McCaul ME, Wand GS, Eissenberg T et al. Naltrexone alters subjective and psychomotor responses to alcohol in heavy drinking subjects. Neuropsychopharmacology 2000; 22: Mihalek RM, Bowers BJ, Wehner JM et al. GABA(A)-receptor delta subunit knockout mice have multiple defects in behavioral responses to ethanol. Alcohol Clin Exp Res 2001; 25: Mihic SJ, Ye Q, Wick MJ et al. Sites of alcohol and volatile anaesthetic action on GABA(A) and glycine receptors. Nature 1997; 389: Mihic SJ. Acute effects of ethanol on GABAA and glycine receptor function. Neurochem Int 1999; 35: Misra K, Pandey SC. The decreased cyclic-amp dependent-protein kinase A function in the nucleus accumbens: a role in alcohol drinking but not in anxiety-like behaviors in rats. Neuropsychopharmacology 2006; 31: Misra K, Roy A, Pandey SC. Effects of voluntary ethanol intake on the expression of Ca( 2+ ) /calmodulin-dependent protein kinase IV and on CREB expression and phosphorylation in the rat nucleus accumbens. Neuroreport 2001; 12:

20 130 3 Wirkungen von Alkohol und Tabak auf Gehirn und peripheres Nervensystem Molander A, Söderpalm B. Accumbal strychnine-sensitive glycine receptors: an access point for ethanol to the brain reward system. Alcohol Clin Exp Res 2005a; 29: Molander A, Söderpalm B. Glycine receptors regulate dopamine release in the rat nucleus accumbens. Alcohol Clin Exp Res 2005b; 29: Molander A, Lidö HH, Löf E et al. The glycine reuptake inhibitor Org decreases ethanol intake and preference in male wistar rats. Alcohol Alcohol 2007; 42: Moolten M, Kornetsky C. Oral self-administration of ethanol and not experimenter-administered ethanol facilitates rewarding electrical brain stimulation. Alcohol 1990; 7: Moore MS, DeZazzo J, Luk AY et al. Ethanol intoxication in Drosophila: Genetic and pharmacological evidence for regulation by the camp signaling pathway. Cell 1998; 93: Mylecharane EJ. Ventral tegmental area 5-HT receptors: mesolimbic dopamine release and behavioural studies. Behav Brain Res 1996; 73: 1 5 Narahashi T, Aistrup GL, Marszalec W et al. Neuronal nicotinic acetylcholine receptors: a new target site of ethanol. Neurochem Int 1999; 35: Nelson RJ, Demas GE, Huang PL et al. Behavioural abnormalities in male mice lacking neuronal nitric oxide synthase. Nature 1995; 378: Newton PM, Ron D. Protein kinase C and alcohol addiction. Pharmacol Res 2007; 55: Nurmi M, Ashizawa T, Sinclair JD et al. Effect of prior ethanol experience on dopamine overflow in accumbens of AA and ANA rats. Eur J Pharmacol 1996; 315: Nurmi M, Sinclair JD, Kiianmaa K. Dopamine release during ethanol drinking in AA rats. Alcohol Clin Exp Res 1998; 22: Nylander I, Hyytiä P, Forsander O et al. Differences between alcoholpreferring (AA) and alcohol-avoiding (ANA) rats in the prodynorphin and proenkephalin systems. Alcohol Clin Exp Res 1994; 8: Olds J, Millner P. Positive reinforcement produced by electrical stimulation of septal area and other regions of the rat brain. J Comp Physiol Psychol 1954; 47: Olive MF, Koenig HN, Nannini MA et al. Stimulation of endorphin neurotransmission in the nucleus accumbens by ethanol, cocaine, and amphetamine. J Neurosci 2001; 21: RC184 Omelchenko N, Sesack SR. Glutamate synaptic inputs to ventral tegmental area neurons in the rat derive primarily from subcortical sources. Neuroscience 2007; 146: Overstreet DH, Rezvani AH, Cowen M et al. Modulation of high alcohol drinking in the inbred Fawn-Hooded (FH/Wjd) rat strain: implications for treatment. Addict Biol 2006; 11: Pandey SC, Zhang H, Roy A et al. Deficits in amygdaloid camp-responsive element-binding protein signaling play a role in genetic predisposition to anxiety and alcoholism. J Clin Invest 2005; 115: Pandey SC, Ugale R, Zhang H et al. Brain chromatin remodeling: a novel mechanism of alcoholism. J Neurosci 2008; 28: Parsons MP, Li S, Kirouac GJ. Functional and anatomical connection between the paraventricular nucleus of the thalamus and dopamine fibers of the nucleus accumbens. J Comp Neurol 2007; 500: Peoples RW, Li C, Weight FF. Lipid vs protein theories of alcohol action in the nervous system. Annu Rev Pharmacol Toxicol 1996; 36: Pfeffer AO, Samson HH. Haloperidol and apomorphine effects on ethanol reinforcement in free feeding rats. Pharmacol Biochem Behav 1988; 29: Phillips TJ, Brown KJ, Burkhart-Kasch S et al. Alcohol preference and sensitivity are markedly reduced in mice lacking dopamine D2 receptors. Nat Neurosci 1998; 1: Pihl RO, LeMarquand D. Serotonin and aggression and the alcoholaggression relationship. Alcohol Alcohol 1988; 33: Pontieri FE, Tanda G, Di Chiara G. Intravenous cocaine, morphine, and amphetamine preferentially increase extracellular dopamine in the shell as compared with the core of the rat nucleus accumbens. Proc Natl Acad Sci USA 1995; 92: Quintanilla ME, Israel Y, Sapag A et al. The UChA and UChB rat lines: metabolic and genetic differences influencing ethanol intake. Addict Biol 2006; 11: Rasmussen DD, Bryant CA, Boldt BM et al. Acute alcohol effects on opiomelanocortinergic regulation. Alcohol Clin Exp Res 1998; 22: Rassnick S, Stinus L, Koob GF. The effects of 6-hydroxydopamine lesions of the nucleus accumbens and the mesolimbic dopamine system on oral self-administration of ethanol in the rat. Brain Res 1993a; 623: Rassnick S, D Amico E, Riley E et al. GABA antagonist and benzodiazepine partial inverse agonist reduce motivated responding for ethanol. Alcohol Clin Exp Res 1993b; 17: Rassnick S, Pulvirenti L, Koob GF. Oral ethanol self-administration in rats is reduced by the administration of dopamine and glutamate receptor antagonists into the nucleus accumbens. Psychopharmacology (Berl) 1992; 109: Ray LA, Hutchison KE, MacKillop J et al. Effects of naltrexone during the descending limb of the blood alcohol curve. Am J Addict 2008; 17: Ren H, Honse Y, Peoples RW. A site of alcohol action in the fourth membrane-associated domain of the N-methyl-D-aspartate receptor. J Biol Chem 2003; 278: Ren H, Salous AK, Paul JM et al. Mutations at F637 in the NMDA receptor NR2A subunit M3 domain influence agonist potency, ion channel gating and alcohol action. Br J Pharmacol 2007; 151: Rezvani AH, Grady DR, Peek AE et al. Inhibition of nitric oxide synthesis attenuates alcohol consumption in two strains of alcoholpreferring rats. Pharmacol Biochem Behav 1995; 50: Risinger FO, Freeman PA, Rubinstein M et al. Lack of operant ethanol self-administration in dopamine D2 receptor knockout mice. Psychopharmacology (Berl) 2000; 152: Risinger FO, Freeman PA, Greengard P et al. Motivational effects of ethanol in DARPP-32 knockout mice. J Neurosci 2001; 21: Roberts AJ, Heyser CJ, Cole M et al. Excessive ethanol drinking following a history of dependence: animal model of allostasis. Neuropsychopharmacology 2000a; 22: Roberts AJ, McDonald JS, Heyser CJ et al. mu-opioid receptor knockout mice do not self-administer alcohol. J Pharmacol Exp Ther 2000b; 293: Rodd ZA, Melendez RI, Bell RL et al. J Neurosci 2004; 24: Rodd-Henricks ZA, McKinzie DL, Melendez RI et al. Effects of serotonin-3 receptor antagonists on the intracranial self-administration of ethanol within the ventral tegmental area of Wistar rats. Psychopharmacology (Berl) 2003; 165: Ron D, Jurd R. The ups and downs of signaling cascades in addiction. SciSTKE 2005; 309: re14 Ronald KM, Mirshahi T, Woodward JJ. Ethanol inhibition of N-methyl-D-aspartate receptors is reduced by site-directed mutagenesis of a transmembrane domain phenylalanine residue. J Biol Chem 2001; 276: Saba L, Porcella A, Congeddu E et al. The R100Q mutation of the GABA(A) alpha(6) receptor subunit may contribute to voluntary aversion to ethanol in the snp rat line. Brain Res Mol Brain Res 2001; 87: Sakurai T, Amemiya A, Ishii M et al. Orexins and orexin receptors: a family of hypothalamic neuropeptides and G proteincoupled receptors that regulate feeding behavior. Cell 1998; 92: Sanchis-Segura C, Spanagel R. Behavioural assessment of drug reinforcement and addictive features in rodents: an overview. Addict Biol 2006; 11: 2 38 Sanchis-Segura C, Borchardt T, Vengeliene V et al. Involvement of the AMPA receptor GluR-C subunit in alcohol-seeking behavior and relapse. J Neurosci 2006; 26: Sanchis-Segura C, Lopez-Atalaya JP, Barco A. Selective boosting of transcriptional and behavioral responses to drugs of abuse by histone deacetylase inhibition. Neuropsychopharmacology 2009; 34:

Herzlich willkommen! Sucht und Gehirn 17. Jan. 2007. PD Dr. Bernd Grünewald PD Dr. Petra Skiebe-Corrette

Herzlich willkommen! Sucht und Gehirn 17. Jan. 2007. PD Dr. Bernd Grünewald PD Dr. Petra Skiebe-Corrette Herzlich willkommen! Sucht und Gehirn 17. Jan. 2007 PD Dr. Bernd Grünewald PD Dr. Petra Skiebe-Corrette Wie wirken Drogen im Gehirn? http://www.gfs-ebs.de/index.htm PD Dr. Bernd Grünewald Institut für

Mehr

Das Nervensystem. Die Unterteilung des ZNS

Das Nervensystem. Die Unterteilung des ZNS Das Nervensystem Die Unterteilung des ZNS 1. Vorderhirn 1a. Telencephalon 1. Neocortex, Basalggl. Seitenventrikel (Prosencephalon) (Endhirn) limbisches System Bulbus olfact 1b. Diencephalon 2. Thalamus

Mehr

Angst und Sucht aus neurobiologischer Perspektive: Einblicke in die moderne Hirnforschung

Angst und Sucht aus neurobiologischer Perspektive: Einblicke in die moderne Hirnforschung Fakultät Mathematik und Naturwissenschaften, Fachrichtung Psychologie Dr. Markus Mühlhan Angst und Sucht aus neurobiologischer Perspektive: Einblicke in die moderne Hirnforschung Warum sind neurobiologische

Mehr

Zwanghaftes Verlangen und Einnahme der Droge Kontrollverlust über den Drogenkonsum Ist die Droge nicht zugänglich, erhöht sich der

Zwanghaftes Verlangen und Einnahme der Droge Kontrollverlust über den Drogenkonsum Ist die Droge nicht zugänglich, erhöht sich der Suchterkrankungen Definition iti der Sucht Drogensucht ist eine chronisch rezidivierende Erkrankung Zwanghaftes Verlangen und Einnahme der Droge Kontrollverlust über den Drogenkonsum Ist die Droge nicht

Mehr

Neurobiologie der Abhängigkeit

Neurobiologie der Abhängigkeit Neurobiologie der Abhängigkeit Grundlagen und Konsequenzen für Diagnose und Therapie von Suchterkrankungen Bearbeitet von Andreas Heinz, Anil Batra, Norbert Scherbaum, Euphrosyne Gouzoulis-Mayfrank, Ulrich

Mehr

Was versteht man unter einer Depolarisation bzw. einer Hyperpolarisation des Membranpotentials?

Was versteht man unter einer Depolarisation bzw. einer Hyperpolarisation des Membranpotentials? 1 Was versteht man unter einer Depolarisation bzw. einer Hyperpolarisation des Membranpotentials? 2 Was ist der Unterschied zwischen der absoluten und der relativen Refraktärzeit eines Aktionspotentials?

Mehr

Neurobiologie der Alkoholabhängigkeit

Neurobiologie der Alkoholabhängigkeit Neurobiologie der Alkoholabhängigkeit Andreas Heinz Klinik für Psychiatrie und Psychotherapie Charité Universitätsmedizin Berlin Charité Campus Mitte & St. Hedwig Krankenhaus Schädlicher Gebrauch z.b.

Mehr

Was geschieht im Gehirn süchtiger Patienten?

Was geschieht im Gehirn süchtiger Patienten? Wege aus der Alkoholabhängigkeit: Lernbezogene neuroadaptive Veränderungen bei Alkoholabhängigkeit Miriam Sebold Klinik für Psychiatrie und Psychotherapie, Charité- Universitätsmedizin Berlin, Campus Mitte

Mehr

Allgemeine Pharmakologie

Allgemeine Pharmakologie Allgemeine Pharmakologie Pharmakologie Arzneistoff: Wirkstoff, der zur Vorbeugung, Linderung, Heilung oder Erkennung von Erkrankungen dient Pharmakon: biologisch Wirksame Substanz Lehre von den Wirkungen

Mehr

Plate Test) Opioid-Rezeptor Bindung in. ex vivo Audioradiographie mit μ- Ligand ([3H]DAMGO. Autoradiography)

Plate Test) Opioid-Rezeptor Bindung in. ex vivo Audioradiographie mit μ- Ligand ([3H]DAMGO. Autoradiography) Tabelle: Tierstudien zum Effekt von Schlafdeprivation auf die Schmerzwahrnehmung Tierstudien Autor Tiere Behandlung a Maße Ergebnisse Nascimento Wistar Kontrolle vs. REM-SD über 4 Tage Schmerzschwellen

Mehr

Accelerated Neuroregulation - ANR

Accelerated Neuroregulation - ANR Accelerated Neuroregulation - ANR Das Funktionsprinzip von ANR - erklärt anhand eines stark vereinfachten Modells Hier werden schematisch die verschiedenen möglichen Interaktionen der Agonisten (Opiat

Mehr

Substitutionstherapien bei Alkoholabhängigkeit. Priv.-Doz. Dr. med. Monika Ridinger

Substitutionstherapien bei Alkoholabhängigkeit. Priv.-Doz. Dr. med. Monika Ridinger Substitutionstherapien bei Alkoholabhängigkeit Priv.-Doz. Dr. med. Monika Ridinger Inhalt Definition von Substitutionstherapie bei Abhängigkeit Substitution bei Alkoholabhängigkeit? Pharmakologische Aspekte

Mehr

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch

Wissenschaftliche Angestellte, Laborleitung Geburtsdatum, Nationalität: 28.04.1973, deutsch Forschungsbericht über das Projekt Einfluss der TLR3-Aktivierung des retinalen Pigmentepithels auf das Verhalten von Makrophagen, gefördert durch die DOG im Rahmen der Forschungsförderung innovativer wissenschaftlicher

Mehr

Entstehung von Abhängigkeit: Neue Erkenntnisse aus Medizin und Pharmakologie im Überblick

Entstehung von Abhängigkeit: Neue Erkenntnisse aus Medizin und Pharmakologie im Überblick Entstehung von Abhängigkeit: Neue Erkenntnisse aus Medizin und Pharmakologie im Überblick Prof. Dr. F.X. VOLLENWEIDER Psychiatrische Universitätsklink Zürich (PUK) Behavioral Pharmacology and Brain Imaging

Mehr

Die Suchtfalle. hirnforschung ı Drogenwirkung

Die Suchtfalle. hirnforschung ı Drogenwirkung hirnforschung ı Drogenwirkung Die Suchtfalle Rauschgifte wie Kokain und Heroin blockieren über neuronale Lernmechanismen die Fähigkeit, bewusste Entscheidungen zu treffen. Der Genfer Neurobiologe Christian

Mehr

Die Entwicklung der Gefühle: Aspekte aus der Hirnforschung. Andreas Lüthi, Friedrich Miescher Institut, Basel

Die Entwicklung der Gefühle: Aspekte aus der Hirnforschung. Andreas Lüthi, Friedrich Miescher Institut, Basel Die Entwicklung der Gefühle: Aspekte aus der Hirnforschung Andreas Lüthi, Friedrich Miescher Institut, Basel Wie lernen wir Angst zu haben? Wie kann das Gehirn die Angst wieder loswerden? Angst und Entwicklung

Mehr

Psychiatrische Erkrankungen. KL Pharmazie

Psychiatrische Erkrankungen. KL Pharmazie Psychiatrische Erkrankungen KL Pharmazie Chronisches Müdigkeitssyndrom Keine psychiatrische Krankheit!!! Ursache unbekannt, persistierende Müdigkeit, schwere Störung der Leistungsfähigkeit, Schmerzen,

Mehr

Gehirn und Verhaltenssucht

Gehirn und Verhaltenssucht Forum für Suchtfragen; Basel, 15. November 2012 Gehirn und Verhaltenssucht Prof. Dr. med. Gerhard Wiesbeck Ärztlicher Leiter des Zentrums für Abhängigkeitserkrankungen Gliederung meines Vortrags Das «klassische»

Mehr

Autismus. autism spectrum disorders

Autismus. autism spectrum disorders Autismus autism spectrum disorders Index Was ist Autismus? Wissenschaftliche Grundlagen Phelan-McDermid-Syndrome (PMDS) Pharmakologische Tests Zusammenfassung Schlussfolgerungen Methoden Elektrophysiologische

Mehr

Abhängigkeit von Pharmaka

Abhängigkeit von Pharmaka Abhängigkeit von Pharmaka Zahlen 1,5 Millionen Menschen sind in Deutschland von psychotropen Medikamenten abhängig 1,0 1,2 Millionen nehmen Benzodiazepine 1,7 Millionen sind alkoholabhängig Abhängigkeitssyndrom

Mehr

1 25.10.06 Biopsychologie als Neurowissenschaft. 2 8.11.06 Evolutionäre Grundlagen. 3 15.11.06 Genetische Grundlagen. 4 22.11.06 Mikroanatomie des NS

1 25.10.06 Biopsychologie als Neurowissenschaft. 2 8.11.06 Evolutionäre Grundlagen. 3 15.11.06 Genetische Grundlagen. 4 22.11.06 Mikroanatomie des NS 1 25.10.06 Biopsychologie als Neurowissenschaft 2 8.11.06 Evolutionäre Grundlagen 3 15.11.06 Genetische Grundlagen 4 22.11.06 Mikroanatomie des NS 5 29.11.06 Makroanatomie des NS: 6 06.12.06 Erregungsleitung

Mehr

Entwicklung von Sucht im Alter

Entwicklung von Sucht im Alter www.mutterhaus.de Entwicklung von Sucht im Alter 19.11.2014 Version 1.4 Dr. Dr. med. Dipl.-Psych. Wilhelm Classen Arzt für Psychiatrie und Psychotherapie, Neurologie, Suchtmedizinische Grundversorgung,

Mehr

Was ist Wirkstoffdesign?

Was ist Wirkstoffdesign? Was ist Wirkstoffdesign? Eine Einführung für Nicht-Fachleute Arzneimittel hat vermutlich schon jeder von uns eingenommen. Vielleicht hat sich der eine oder andere dabei gefragt, was passiert eigentlich

Mehr

Limbische Hirnzentren

Limbische Hirnzentren Dr.Dr.R.Beck Wie das Gehirn die Seele macht (G. Roth, Neurobiologie der Pschotherapie, Schattauer, 2003, S. 28 ff. Neurobiologie:Limbisches Sstem Ventrales tegmentales Areal (VTA), entrales Höhlengrau

Mehr

Tabelle 6a: Deskriptive Statistiken der metrischen Variablen

Tabelle 6a: Deskriptive Statistiken der metrischen Variablen Ergebnisse 77 5 Ergebnisse Das folgende Kapitel widmet sich der statistischen Auswertung der Daten zur Ü- berprüfung der Hypothesen. Die hier verwendeten Daten wurden mit den in 4.3 beschriebenen Instrumenten

Mehr

Angstkrankheiten II. Verhaltenspharmakologische und genetische Methoden

Angstkrankheiten II. Verhaltenspharmakologische und genetische Methoden Angstkrankheiten II Verhaltenspharmakologische und genetische Methoden Tiermodelle Annäherungs Vermeidungs-Paradigma di Instinktives Verhalten o Schock-induziert o Isolations-induziert Interaktion mit

Mehr

Folgen des Alkoholkonsums

Folgen des Alkoholkonsums Gruppe 1: Auswirkungen von Alkohol auf die Leber Info: Das am meisten gefährdete Organ bei Alkoholkonsum ist die Leber. Bei häufigem Alkoholkonsum kommt es zur Fetteinlagerung in den Leberzellen, was als

Mehr

Bipolare Störungen. Praxisrelevante Aspekte der Neurobiologie bipolarer Störungen. Schläper,T., Winkler, R. Nernvenheilkunde 3/2008, S.

Bipolare Störungen. Praxisrelevante Aspekte der Neurobiologie bipolarer Störungen. Schläper,T., Winkler, R. Nernvenheilkunde 3/2008, S. Praxisrelevante Aspekte der Neurobiologie bipolarer Störungen. Schläper,T., Winkler, R. Nernvenheilkunde 3/2008, S. 127-132 Lebenszeitprävalenz für beide Geschlechter 1 % Bei ca. 20% rezidiv depressiver

Mehr

Wege in die Frühpension -

Wege in die Frühpension - Wege in die Frühpension - Der Übergang in den Ruhestand in Osterreich Zusammenfassung der Ergebnisse Eines der wichtigsten Ziele der österreichischen Sozialpolitik ist die langfristige Sicherung der Finanzierbarkeit

Mehr

Die erste randomisierte und placebokontrollierte Studie mit hoch dosiertem Baclofen (bis 270 mg / Tag).

Die erste randomisierte und placebokontrollierte Studie mit hoch dosiertem Baclofen (bis 270 mg / Tag). Behandlung der Alkoholabhängigkeit mit hoch dosiertem Baclofen. Eine randomisierte und placebokontrollierte Studie (BACLAD) (European Neuropsychopharmacology, 2015) Autoren: Christian A. Müller, Olga Geisel,

Mehr

Allgemeine Pathologie. Störungen im Kupfer- Stoffwechsel

Allgemeine Pathologie. Störungen im Kupfer- Stoffwechsel Allgemeine Pathologie Störungen im Kupfer- Stoffwechsel Physiologie (1): - das Übergangsmetall Kupfer ist als essentielles Spurenelement Bestandteil einer Reihe wichtiger Enzyme: - Ferro-oxidase I (Coeruloplasmin),

Mehr

4. Quantitative Analyse der Ligand-Bindungsstudien

4. Quantitative Analyse der Ligand-Bindungsstudien 4. Quantitative Analyse der Ligand-Bindungsstudien Im folgenden apitel sollen die grundlegenden analytischen Methoden zur Interpretation der experimentell gewonnenen Bindungsdaten vorgestellt werden. ie

Mehr

Epilepsie und Endocannabinoide

Epilepsie und Endocannabinoide Gesellschaft zur Förderung Kynologischer Forschung Abschlussbericht Epilepsie und aus der gkf-info 39 Juni 2014 Abschlussbericht Epilepsie und Felix Gesell und Andrea Tipold von der Tierärztlichen Hochschule

Mehr

Dr. Thomas Nauert, Sozialministerium Kiel

Dr. Thomas Nauert, Sozialministerium Kiel Dr. Thomas Nauert, Sozialministerium Kiel Graphikphoto.de Lfz Tag.Monat.Jahr 1 Alkohol Medikamente Drogen Nikotin Nahrung 2 Suchtkriterien Starkes Verlangen: Craving Kontrollverlust körperliche Entzugserscheinungen

Mehr

Jugend + Alkohol = Gewalt?

Jugend + Alkohol = Gewalt? Unterstützt vom BMBF Jugend + Alkohol = Gewalt? Stadt Freiburg, Fachtagung am 13. März 28 Dr. Michael Berner Universitätsklinikum Freiburg, Abteilung Psychiatrie und Psychotherapie 1999 21 27 3.1.28 Epidemiologie

Mehr

Neurobiologische Grundlagen der Psychotherapie

Neurobiologische Grundlagen der Psychotherapie Neurobiologische Grundlagen der Psychotherapie Marc-Andreas Edel Übersicht 1. Psychotherapie ist ein komplexes System aus Gen-Umwelt- Interaktionen Sie wirkt auf das Produkt aus genetischen Voraussetzungen

Mehr

5 Zusammenfassung und Schlussfolgerung

5 Zusammenfassung und Schlussfolgerung 5 Zusammenfassung und Schlussfolgerung Einleitung In der Schwangerschaft vollziehen sich Veränderungen des Kohlenhydratstoffwechsels im Sinne einer Insulinresistenz sowie eines Anstieges der Blutfettwerte.

Mehr

APP-GFP/Fluoreszenzmikroskop. Aufnahmen neuronaler Zellen, mit freund. Genehmigung von Prof. Stefan Kins, TU Kaiserslautern

APP-GFP/Fluoreszenzmikroskop. Aufnahmen neuronaler Zellen, mit freund. Genehmigung von Prof. Stefan Kins, TU Kaiserslautern Über die Herkunft von Aβ42 und Amyloid-Plaques Heute ist sicher belegt, dass sich die amyloiden Plaques aus einer Vielzahl an Abbaufragmenten des Amyloid-Vorläufer-Proteins (amyloid-precursor-protein,

Mehr

Lern-und Gedächtnisprozesse Plastizität des Gehirns

Lern-und Gedächtnisprozesse Plastizität des Gehirns Fortbildungsveranstaltung im Rahmen des Programms Neurowissenschaften in der gymnasialen Oberstufe der Neurowissenschaftlichen Gesellschaft e.v. zum Thema Lern-und Gedächtnisprozesse Plastizität des Gehirns

Mehr

Wiederholung: Dendriten

Wiederholung: Dendriten Wiederholung: Dendriten Neurone erhalten am Dendriten und am Zellkörper viele erregende und hemmende Eingangssignale (Spannungsänderungen) Die Signale werden über Dendrit und Zellkörper elektrisch weitergeleitet.

Mehr

Biochemie der Sucht Suchterkrankungen

Biochemie der Sucht Suchterkrankungen Fortbildungsveranstaltung im Rahmen des Programms Neurowissenschaften in der gymnasialen Oberstufe der Neurowissenschaftlichen Gesellschaft e.v. zum Thema Biochemie der Sucht Suchterkrankungen 9. März

Mehr

Kaffee und Gesundheit. das sagen neue Studien

Kaffee und Gesundheit. das sagen neue Studien Kaffee und Gesundheit das sagen neue Studien Kaffee Vorurteile und Fakten 73 % der Bundesbürger über 18 Jahren trinken täglich Kaffee. Kaffee zählt weltweit zu den beliebtesten Getränken. Doch trotz der

Mehr

Das Paper von heute. Samuel Grimm & Jan Kemna

Das Paper von heute. Samuel Grimm & Jan Kemna Das Paper von heute Samuel Grimm & Jan Kemna Bisheriges Modell Was bereits bekannt war - TIR1 ist an Auxinantwort (Zellteilung, Elongation, Differenzierung) beteiligt, im selben Signalweg wie AXR1 - TIR1

Mehr

Behandlung der Multiplen Sklerose durch Inhibition von Adhäsionsmolek. sionsmolekülen len. Dr. Martin Berghoff

Behandlung der Multiplen Sklerose durch Inhibition von Adhäsionsmolek. sionsmolekülen len. Dr. Martin Berghoff Behandlung der Multiplen Sklerose durch Inhibition von Adhäsionsmolek sionsmolekülen len Dr. Martin Berghoff Immunmodulierende Basistherapie (1) Interferon-β (IFN-β)1b (Betaferon) und 1a (Rebif / Avonex)

Mehr

Alkohol aus der Sicht des. Psychiaters

Alkohol aus der Sicht des. Psychiaters Alkohol aus der Sicht des Psychiaters A.-Univ.-Prof. Dr. Barbara Sperner-Unterweger Univ.-Klinik für Psychiatrie Abt. für Biologische Psychiatrie Die Welt in der wir leben Wir leben in der Ersten Welt

Mehr

Stress & kognitive Flexibilität (Aufgabenwechsel) Luca Spliethoff

Stress & kognitive Flexibilität (Aufgabenwechsel) Luca Spliethoff Stress & kognitive Flexibilität (Aufgabenwechsel) Dresden, 08.12.2015 Luca Spliethoff Franziska Keßler Gliederung 1. Einleitung: Was ist kognitive Flexibilität? 2. Metaanalyse von Shields et al. (2015)

Mehr

brainbus 2013 Konfusion im Kopf Posten Pubertät Was passiert mit Kindern während der Pubertät?

brainbus 2013 Konfusion im Kopf Posten Pubertät Was passiert mit Kindern während der Pubertät? brainbus Konfusion im Kopf Was passiert mit Kindern während der Pubertät? Wissenschaftler sind dem Phänomen auf der Spur, das das Leben von Teenagern und ihrer Eltern so radikal auf den Kopf stellt: der

Mehr

Second Messenger keine camp, cgmp, Phospholipidhydrolyse (Prozess) Aminosäuren (Glutamat, Aspartat; GABA, Glycin),

Second Messenger keine camp, cgmp, Phospholipidhydrolyse (Prozess) Aminosäuren (Glutamat, Aspartat; GABA, Glycin), Neurotransmitter 1. Einleitung 2. Unterscheidung schneller und langsamer Neurotransmitter 3. Schnelle Neurotransmitter 4. Acetylcholin schneller und langsamer Neurotransmitter 5. Langsame Neurotransmitter

Mehr

Workshop: Sportmedizin und Psychiatrie, Psychosomatik, Sucht im Dialog

Workshop: Sportmedizin und Psychiatrie, Psychosomatik, Sucht im Dialog vb Workshop: Sportmedizin und Psychiatrie, Psychosomatik, Sucht im Dialog Folie 1 vb1 HL bitte ändern analog Vortrag in Einladung Verena Baernwick; 31.01.2011 Chronischer Alkoholkonsum führt zu Hirnorganischen

Mehr

Die spezifische Vitaminkombination in nur einer Tablette.

Die spezifische Vitaminkombination in nur einer Tablette. Die spezifische Vitaminkombination in nur einer Tablette. Die gezielte Vitaminergänzung bei medikamentös behandelter Epilepsie. Schließen Sie Ihre Vitaminlücken ganz gezielt. Hinweis EPIVIT ist ein ernährungsmedizinisch

Mehr

Suchtgedächtnis. Selbsthilfethemennachmittag FSHG 23.April 2010. Bezirksverband Potsdam e.v.

Suchtgedächtnis. Selbsthilfethemennachmittag FSHG 23.April 2010. Bezirksverband Potsdam e.v. Selbsthilfethemennachmittag FSHG 23.April 2010 Suchtgedächtnis Suchtgedächtnis 1. Definitionen 2. Grundlagen 3. Gedächtnis & Lernen 4. Neurobiologisches Belohungssystem 5. Besonderheiten des Suchtgedächtnisses

Mehr

Zelluläre Kommunikation

Zelluläre Kommunikation Zelluläre Kommunikation 1. Prinzipien der zellulären Kommunikation?? 2. Kommunikation bei Nervenzellen Die Zellen des Nervensystems Nervenzellen = Neuronen Gliazellen ( Glia ) Astrozyten Oligodendrozyten

Mehr

Gene, Umwelt und Aktivität

Gene, Umwelt und Aktivität Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Ein aktiver Lebensstil beeinflusst vielleicht die Krankheitssymptome

Mehr

4. Diskussion. 4.1. Polymerase-Kettenreaktion

4. Diskussion. 4.1. Polymerase-Kettenreaktion 59 4. Diskussion Bei der Therapie maligner Tumoren stellt die Entwicklung von Kreuzresistenz gegen Zytostatika ein ernstzunehmendes Hindernis dar. Im wesentlich verantwortlich für die so genannte Multidrug

Mehr

EINLEITUNG. Zusammenfassung

EINLEITUNG. Zusammenfassung EINLEITUNG Jeder, der einmal beobachtet hat, wie ein wenige Wochen altes Baby seine Umgebung erkundet, hat sicherlich bemerkt, daß sich das Blickverhalten eines Babys stark von dem eines Erwachsenen unterscheidet.

Mehr

Medikamentöse Abstinenzunterstützung bei Alkoholabhängigkeit. Ein praktisches Update für die Grundversorgung. 13.11.2014 FOSUMOS

Medikamentöse Abstinenzunterstützung bei Alkoholabhängigkeit. Ein praktisches Update für die Grundversorgung. 13.11.2014 FOSUMOS Medikamentöse Abstinenzunterstützung bei Alkoholabhängigkeit. Ein praktisches Update für die Grundversorgung. 13.11.2014 FOSUMOS Dr. Herbert Leherr Leitender Arzt Bereich Abhängigkeitserkrankungen / Forensik

Mehr

Klaus Hentrich (Autor) BKAP, ein neu entdecktes Protein, das mit dem C-Terminus des calcium-und spannungsabhängigen Kaliumkanals der Ratte interagiert

Klaus Hentrich (Autor) BKAP, ein neu entdecktes Protein, das mit dem C-Terminus des calcium-und spannungsabhängigen Kaliumkanals der Ratte interagiert Klaus Hentrich (Autor) BKAP, ein neu entdecktes Protein, das mit dem C-Terminus des calcium-und spannungsabhängigen Kaliumkanals der Ratte interagiert https://cuvillier.de/de/shop/publications/3280 Copyright:

Mehr

Häufigkeit und mögliche klinische Relevanz von Koinfektionen mit Borrelien und Anaplasma phagocytophilum.

Häufigkeit und mögliche klinische Relevanz von Koinfektionen mit Borrelien und Anaplasma phagocytophilum. Häufigkeit und mögliche klinische Relevanz von Koinfektionen mit Borrelien und Anaplasma phagocytophilum. Kurzdarstellung Die sichere Diagnose einer Borrelieninfektion stellt die Laboratoriumsmedizin trotz

Mehr

Ausgabe: April 1997. o-phenylendiamin (CAS-Nr.: 95-54-5) und o-phenylendiamin-dihydrochlorid (CAS-Nr.: 615-28-1)

Ausgabe: April 1997. o-phenylendiamin (CAS-Nr.: 95-54-5) und o-phenylendiamin-dihydrochlorid (CAS-Nr.: 615-28-1) Ausgabe: April 1997 o-phenylendiamin (CAS-Nr.: 95-54-5) und o-phenylendiamin-dihydrochlorid (CAS-Nr.: 615-28-1) Zu o-phenylendiamin und zu o-phenylendiamin-dihydrochlorid liegt eine ausführliche toxikologisch-arbeitsmedizinische

Mehr

Pharmakologie - Lehrbücher

Pharmakologie - Lehrbücher - Lehrbücher Aktories Förstermann Hofmann Starke Allgemeine und spezielle Pharmakologie und Toxikologie Begründet von W. Forth, D. Henschler, W. Rummel, Urban & Urban & Fischer München Jena 9. völlig überarbeitete

Mehr

Wirkung und Nachweis von Alkohol im menschlichen Körper

Wirkung und Nachweis von Alkohol im menschlichen Körper Wirkung und Nachweis von Alkohol im menschlichen Körper Agenda Wirkung des Alkohols auf den menschlichen Körper Messsysteme Anwendungsempfehlungen zu Atemalkoholmessgeräten 0 Alkohol und Drogentestgeräte

Mehr

Phrasensammlung für wissenschaftliches Arbeiten

Phrasensammlung für wissenschaftliches Arbeiten Phrasensammlung für wissenschaftliches Arbeiten Einleitung In diesem Aufsatz/dieser Abhandlung/dieser Arbeit werde ich... untersuchen/ermitteln/bewerten/analysieren... Um diese Frage zu beantworten, beginnen

Mehr

SUCHT: DIE DUNKLE SEITE DES LERNENS. Christian Lüscher

SUCHT: DIE DUNKLE SEITE DES LERNENS. Christian Lüscher SUCHT: DIE DUNKLE SEITE DES LERNENS Christian Lüscher Drogen wie Kokain, Nikotin oder Heroin werden konsumiert, weil sie ein Belohungsgefühl vermitteln. Bei gewissen Konsumenten führt dies zu grundlegenden

Mehr

Im Fokus: Neuro Sciences

Im Fokus: Neuro Sciences Im Fokus: Neuro Sciences 24 q&more 02.13 Koffein- Kick Wirkung im menschlichen Gehirn Prof. Dr. Andreas Bauer, Dr. David Elmenhorst Institut für Neurowissenschaften und Medizin (INM-2), Forschungszentrum

Mehr

SYSTEMBIOLOGIE DER SUCHT. F. Tretter Psychologisches Institut (LMU) und Isar Amper Klinikum Klinikum München Ost

SYSTEMBIOLOGIE DER SUCHT. F. Tretter Psychologisches Institut (LMU) und Isar Amper Klinikum Klinikum München Ost SYSTEMBIOLOGIE DER SUCHT F. Tretter Psychologisches Institut (LMU) und Isar Amper Klinikum Klinikum München Ost 1.GEHIRN-GEIST-PROBLEM - Neuropsychologie / Neuropsychiatrie - WENIG GEHIRN, trotzdem GENUG

Mehr

Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen

Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen Quelle: scientopia.org Über Synapsen, Intelligenz und Gedächtnis von Menschen und Mäusen 30. Januar 2014 ChrisEna Spilker Intelligenz Charakter Gedächtnis Plas5zität beruht auf der chemischen Zwiesprache

Mehr

Chronopharmakologie des Magen-Darm-Traktes

Chronopharmakologie des Magen-Darm-Traktes 8 Chronopharmakologie des Magen-Darm-Traktes 1 Einleitung Der Magen-Darm-Trakt ist in allen seinen Funktionen ausgeprägt tagesrhythmisch organisiert. Dies betrifft die Motilität, die Magenentleerungsgeschwindigkeit,

Mehr

Stand von letzter Woche

Stand von letzter Woche RUB ECR1 AXR1 Stand von letzter Woche E2 U? E1-like AXR1 Repressor ARF1 Proteasom AuxRE Repressor wird sehr schnell abgebaut notwendig für Auxinantwort evtl. Substrat für SCF Identifikation des SCF-Ubiquitin

Mehr

Die spezifische Vitaminkombination in nur einer Tablette.

Die spezifische Vitaminkombination in nur einer Tablette. Die spezifische Vitaminkombination in nur einer Tablette. Die gezielte Vitaminergänzung bei medikamentös behandeltem Morbus Parkinson. Schließen Sie Ihre Vitaminlücken ganz gezielt. Hinweis PARKOVIT ist

Mehr

Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden

Stammzellenmanipulation. Stammzellen können in Zellkultur manipuliert werden Stammzellenmanipulation Hämatopoietische Stammzellen können gebraucht werden um kranke Zellen mit gesunden zu ersetzen (siehe experiment bestrahlte Maus) Epidermale Stammzellpopulationen können in Kultur

Mehr

Schließen Sie gezielt Vitaminlücken bei Epilepsie.

Schließen Sie gezielt Vitaminlücken bei Epilepsie. Schließen Sie gezielt Vitaminlücken bei Epilepsie. Weitere Fragen zum Thema Vitaminlücken bei Epilepsie beantworten wir Ihnen gerne: Desitin Arzneimittel GmbH Abteilung Medizin Weg beim Jäger 214 22335

Mehr

Entstehung chronischer Schmerzen

Entstehung chronischer Schmerzen Entstehung chronischer Schmerzen.1 Was ist Schmerz eigentlich?. Schmerzkrankheit.3 Akuter Schmerz und chronischer Schmerz 5. Schmerzverarbeitung auf neuronaler Ebene 6..1 Der Weg vom Schmerzreiz zum Gehirn

Mehr

Anstieg der Fehlzeiten wegen Psychischer Störungen - Realität oder verzerrte Darstellung?

Anstieg der Fehlzeiten wegen Psychischer Störungen - Realität oder verzerrte Darstellung? Anstieg der Fehlzeiten wegen Psychischer Störungen - Realität oder verzerrte Darstellung? Heinz.Kowalski@bgf-institut.de zww-veranstaltung BGM: Ein Weg aus der Krise! Bielefeld, 6. Oktober 2009 INFORMATION

Mehr

Das Dreieck des Lebens

Das Dreieck des Lebens Leseprobe aus: Uwe Karstädt Das Dreieck des Lebens Mehr Informationen zum Buch finden Sie hier. Copyright 2005 by Titan Verlag, München 16 HOMOCYSTEIN UND VIELE NEUE FAKTEN Homocystein ist eine schwefelhaltige

Mehr

Fette, Sojalebensmittel und Herzgesundheit Was sagt die Wissenschaft?

Fette, Sojalebensmittel und Herzgesundheit Was sagt die Wissenschaft? Fette, Sojalebensmittel und Herzgesundheit Was sagt die Wissenschaft? Thesenpapier des wissenschaftlichen Beirats der ENSA Einführung Es ist seit vielen Jahren wissenschaftlich anerkannt, dass die Ernährung

Mehr

Biologische Psychologie I

Biologische Psychologie I Biologische Psychologie I Kapitel 7 Mechanismen der Wahrnehmung, des Bewusstseins und der Aufmerksamkeit Organisationsprinzipien eines sensorischen Systems: Primärer und sekundärer sensorischer Kortex

Mehr

EINFLUSS DER ZELLMEMBRAN UND EINIGER ZELLAKTOREN AUF DEN ALTERUNGSPROZESS

EINFLUSS DER ZELLMEMBRAN UND EINIGER ZELLAKTOREN AUF DEN ALTERUNGSPROZESS EINFLUSS DER ZELLMEMBRAN UND EINIGER ZELLAKTOREN AUF DEN ALTERUNGSPROZESS Der Kern steuert die Proteinsynthese durch Synthese der Boten-RNA (mrna) gemäß den von der DNA gelieferten Informationen Die mrna

Mehr

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner

Ergebnisse. I. Identifizierung intrazellulärer Interaktionspartner. Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Ergebnisse I. Identifizierung intrazellulärer Interaktionspartner Es sollten mithilfe des Yeast-Two-Hybrid-Systems Proteine identifiziert werden, die mit der zytoplasmatischen Domäne von CEACAM1-4L aus

Mehr

Genregulation bei Eukaryoten II

Genregulation bei Eukaryoten II Genregulation bei Eukaryoten II Aktivierung und Repression der Transkription erfolgen durch Protein-Protein-Wechselwirkungen Protein-Protein-Wechselwirkungen spielen bei der Genregulation der Eukaryoten

Mehr

Erklärt die Neurobiologie den Rausch? Felix Tretter 1. NEUROBIOLOGIE

Erklärt die Neurobiologie den Rausch? Felix Tretter 1. NEUROBIOLOGIE Erklärt die Neurobiologie den Rausch? Felix Tretter 1. NEUROBIOLOGIE Reduktionismus und das Makro Mikro Problem V E R H A L T E N Imaging Methoden, (MRI, PET, SPECT) and EEG, MEG G E H IR N S C H A L T

Mehr

Inhaltsverzeichnis. Vorwort... 7. 1 Wissen Sie schon alles über das Rauchen?... 9

Inhaltsverzeichnis. Vorwort... 7. 1 Wissen Sie schon alles über das Rauchen?... 9 Inhaltsverzeichnis Vorwort................................................ 7 1 Wissen Sie schon alles über das Rauchen?......... 9 2 Frau Schmitt und die Zigaretten und Sie?......... 23 2.1 Erste Phase:

Mehr

Alkohol und Gehirn. Vortrag im Rahmen der Gesundheitsschulung Fachklinik Hansenbarg. Dr. Stracke. www.hansenbarg.de

Alkohol und Gehirn. Vortrag im Rahmen der Gesundheitsschulung Fachklinik Hansenbarg. Dr. Stracke. www.hansenbarg.de Alkohol und Gehirn Vortrag im Rahmen der Gesundheitsschulung Fachklinik Hansenbarg Dr. Stracke www.hansenbarg.de Wie entsteht Sucht? Mensch Sinn? Spiritualität? Umwelt Droge Genauer betrachtet : Entstehungsbedingung

Mehr

Volkswirtschaftliche Effekte der Alkoholkrankheit Teil 1: Kosten für das Gesundheitswesen

Volkswirtschaftliche Effekte der Alkoholkrankheit Teil 1: Kosten für das Gesundheitswesen Presseinformation 18.04.2013 Volkswirtschaftliche Effekte der Alkoholkrankheit Teil 1: Kosten für das Gesundheitswesen T. Czypionka, M. Pock, G. Röhrling, C. Sigl Institut für Höhere Studien (IHS), Wien

Mehr

MS 10 Fragen und Antworten

MS 10 Fragen und Antworten Hintergrundinformation MS 10 Fragen und Antworten Was ist MS? Multiple Sklerose (MS) ist eine chronische Erkrankung des Zentralen Nervensystems (ZNS), d.h. des Gehirns und des Rückenmarks. Bei der MS handelt

Mehr

HMPAO-SPECT bei Major Depression. H. Brockmann, H.-J. Biersack Klinik und Poliklinik für Nuklearmedizin

HMPAO-SPECT bei Major Depression. H. Brockmann, H.-J. Biersack Klinik und Poliklinik für Nuklearmedizin HMPAO-SPECT bei Major Depression H. Brockmann, H.-J. Biersack Klinik und Poliklinik für Nuklearmedizin Einfluss einer antidepressiven Therapie mit Citalopram auf den regionalen zerebralen Blutfluss Typische

Mehr

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60

Kaninchen: 1 cagattgaggagagcaccaccatcgtcacctcgcagttggcggaggtcagcgcagccgag 60 Ergebnisse 6 3. Ergebnisse 3. Charakterisierung der zelllinienspezifischen cdn Die Entwicklung zweier Zelllinien, des epithelialen Trophoblasten und des pluripotenten Embryoblasten, ist der erste Differenzierungsschritt

Mehr

Instruktor Guide. www.fitvibe.com

Instruktor Guide. www.fitvibe.com Instruktor Guide 1 Vorwort Diese Anleitung richtet sich an Benutzer des fitvibe Excel und beinhaltet leicht verständliche Erläuterungen, wie die Leistung des Körpers durch vertikale Vibrationsstimulierung

Mehr

Marktliquidität von Aktien

Marktliquidität von Aktien Marktliquidität von Aktien Inauguraldissertation zur Erlangung der Würde eines Doctor rerum oeconomicarum der Wirtschafts- und Sozialwissenschaftlichen Fakultät der Universität Bern Lukas Roth Die Fakultät

Mehr

Gezielte Aminosäuretherapie

Gezielte Aminosäuretherapie Gezielte Aminosäuretherapie Die Neuroendokrine Stressachse des Menschen dient der Bewältigung aller physischen, mentalen, emotionalen oder psychischen Belastungen, die akut, vorübergehend oder länger anhaltend

Mehr

To sleep or not to sleep

To sleep or not to sleep Manfred Hallschmid Institut für Neuroendokrinologie, Universität Lübeck Ernährung, Bewegung, Entspannung alles zu seiner Zeit München, 31. März 2011 To sleep or not to sleep Der Einfluss des Schlafs auf

Mehr

Im Verlauf von Demenzerkrankungen treten sehr häufig Verhaltensauffälligkeiten auf. Diese können das Zusammenleben mit Demenzerkrankten massiv

Im Verlauf von Demenzerkrankungen treten sehr häufig Verhaltensauffälligkeiten auf. Diese können das Zusammenleben mit Demenzerkrankten massiv Im Verlauf von Demenzerkrankungen treten sehr häufig Verhaltensauffälligkeiten auf. Diese können das Zusammenleben mit Demenzerkrankten massiv belasten. Im Vordergrund der Behandlung von Verhaltensauffälligkeiten

Mehr

Das Sexualleben ist ohne Zweifel ein sehr vielschichtiges Phänomen, das sowohl körperliche,

Das Sexualleben ist ohne Zweifel ein sehr vielschichtiges Phänomen, das sowohl körperliche, Kapitel 10: Prostata und Sexualität Basiswissen Sexualität aus Sicht des Urologen Das Sexualleben ist ohne Zweifel ein sehr vielschichtiges Phänomen, das sowohl körperliche, seelische als auch verschiedene

Mehr

9 Experimentelle Modelle der Alkoholsucht

9 Experimentelle Modelle der Alkoholsucht 99 9 9 Experimentelle Modelle der Alkoholsucht Daniel Bachteler und Rainer Spanagel 9.1 Alkoholforschung und Tierversuche 99 9.2 Alkoholaufnahme beim Labortier 99 9.3 Alkohol-Präferenz-Modelle 100 9.4

Mehr

Verstärkungspläne. Verstärkungspläne. Verstärkungspläne. Verstärkungspläne. Seminar Lernen und Gedächtnis

Verstärkungspläne. Verstärkungspläne. Verstärkungspläne. Verstärkungspläne. Seminar Lernen und Gedächtnis Seminar Lernen und Gedächtnis Wie kann man vorhersagen, was als Verstärker dienen wird? Definition Bedürfnisreduktions-Hypothese Referenten: Tarek Huzail, Hassan Elkohmri Treibreduktions-Hypothese Transsituationalitätsprinzip

Mehr

Beispielbild. Lernen & Gedächtnis. Operante Konditionierung: Verstärkung. SoSe 2007

Beispielbild. Lernen & Gedächtnis. Operante Konditionierung: Verstärkung. SoSe 2007 Beispielbild Lernen & Gedächtnis Operante Konditionierung: Verstärkung SoSe 2007 Einführung Belohnung ist das einfachste Prinzip, um ein erwünschtes Verhalten häufiger auftreten zu lassen! Oder? Lernen

Mehr

"Sucht und Abhängiges Verhalten

Sucht und Abhängiges Verhalten "Sucht und Abhängiges Verhalten Prof. Dr. F. Kiefer Klinik für Abhängiges Verhalten und Suchtmedizin Zentralinstitut für Seelische Gesundheit Mannheim 163 000 in Behandlung 1,77 Mio. Alkoholabhängig 1,61

Mehr

Inhaltsverzeichnis. Grundlagen. II Präparate VII

Inhaltsverzeichnis. Grundlagen. II Präparate VII VII Inhaltsverzeichnis I Grundlagen 1 Pharmakologische Grundlagen........ 3 1.1 Pharmaka......................... 4 1.1.1 Pharmakologisch wirksame Stoffe......... 4 1.1.2 Wirkstoffentwicklung.................

Mehr

Beobachtungsergebnisse über die Wirksamkeit von Schaukelbewegungen bei Demenzpatienten. Veröffentlicht durch Sagepublications

Beobachtungsergebnisse über die Wirksamkeit von Schaukelbewegungen bei Demenzpatienten. Veröffentlicht durch Sagepublications Beobachtungsergebnisse über die Wirksamkeit von Schaukelbewegungen bei Demenzpatienten Veröffentlicht durch Sagepublications Schaukelstuhltherapie für Demenzpatienten Studie über die Auswirkung auf das

Mehr

Bei Depressionen. schnell wirksam, stark 2

Bei Depressionen. schnell wirksam, stark 2 Bei Depressionen schnell wirksam, stark 2 Cipralex - der RI der zweiten Generation 1 Wie wichtig ist Ihnen der bleibende Erfolg? Effektivität mit guter Verträglichkeit kombiniert 3 Und wie wichtig ist

Mehr

Sozialisation und Identität

Sozialisation und Identität Universität Augsburg Lehrstuhl für Soziologie Übung: Grundkurs Soziologie Dozent: Sasa Bosancic, M.A. Sebastian Schmidt, Marion Röder, Hanna Heß Sozialisation und Identität Inhaltsverzeichnis Biographie

Mehr