Auswertung von Unterschieden der Androgene bei SBMA-Patienten

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Auswertung von Unterschieden der Androgene bei SBMA-Patienten"

Transkript

1 Auswertung von Unterschieden der Androgene bei SBMA-Patienten Nicholas Di Prospero, MD, PhD National Institute of Neurological Disorders and Stroke NIH

2 Von der Genetik zu einem Gen Spinale und Bulbäre Muskelatrophie (SBMA) beschrieben durch Kennedy et al. (1968): Ausbruch im Erwachsenenalter vererbt (X-Chromosom) Chronische, langsam fortschreitende Motoneuron-Erkrankung

3 Von der Genetik zu einem Gen Spinale und Bulbäre Muskelatrophie (SBMA) beschrieben durch Kennedy et al. (1968): Ausbruch im Erwachsenenalter vererbt (X-Chromosom) Chronische, langsam fortschreitende Motoneuron-Erkrankung Genetische Grundlage beschrieben durch La Spada et al. (1991) Proximaler Zweig des X-Chromosoms Erweiterung der CAG Wiederholung im Androgenrezeptor-Gen (AR-Gen) Erzeugt einen verlängerten Polyglutamin- Abschnitt im AR Protein 1st Mitglied einer Familie der Funktionsstörungen (family of disorders)

4 Von der Genetik zu einem Gen Spinale und Bulbäre Muskelatrophie (SBMA) beschrieben durch Kennedy et al. (1968): Ausbruch im Erwachsenenalter vererbt (X-Chromosom) Chronische, langsam fortschreitende Motoneuron-Erkrankung Genetische Grundlage beschrieben durch La Spada et al. (1991) Proximaler Zweig des X-Chromosoms Erweiterung der CAG Wiederholung im Androgenrezeptor-Gen (AR-Gen) Erzeugt einen verlängerten Polyglutamin- Abschnitt im AR Protein 1st Mitglied einer Familie der Funktionsstörungen (family of disorders)

5 Der Androgenrezeptor Bindet Androgene um ihre Auswirkungen zu beeinflussen (auszulösen): Entwicklung des männlichen Fötus Vermännlichung Muskelentwicklung Sexuelles Verhalten Spermatogenese

6 Der Androgenrezeptor Bindet Androgene um ihre Auswirkungen zu beeinflussen (auszulösen): Entwicklung des männlichen Fötus Vermännlichung Muskelentwicklung Sexuelles Verhalten Spermatogenese Testosteron Dihydrotestosteron (DHT)

7 Der Androgenrezeptor Bindet Androgene um ihre Auswirkungen zu beeinflussen (auszulösen): Entwicklung des männlichen Fötus Vermännlichung Muskelentwicklung Sexuelles Verhalten Spermatogenese Testosteron Abgesondert durch die Hoden Zirkuliert durch den ganze Körper Dihydrotestosteron (DHT)

8 Der Androgenrezeptor Bindet Androgene um ihre Auswirkungen zu beeinflussen (auszulösen): Entwicklung des männlichen Fötus Vermännlichung Muskelentwicklung Sexuelles Verhalten Spermatogenese Testosteron Abgesondert durch die Hoden Zirkuliert durch den ganze Körper Dihydrotestosteron (DHT) Erzeugt in speziellen Geweben Höhere Affinität zum AR Bindet länger am AR

9 Der Androgenrezeptor Bindet Androgene um ihre Auswirkungen zu beeinflussen (auszulösen): Entwicklung des männlichen Fötus Vermännlichung Muskelentwicklung Sexuelles Verhalten Spermatogenese Testosteron Abgesondert durch die Hoden Zirkuliert durch den ganze Körper Dihydrotestosteron (DHT) Erzeugt in speziellen Geweben Höhere Affinität zum AR Bindet länger am AR

10 AR und SBMA Androgenbindung an mutiertes AR verursacht Nervendegeneration Klinisch weibliche Träger haben geringe symptome, möglicherweise aufgrund des geringeren Androgenspiegels Zellmodelle: Aggregatbildung und Zelltod folgen auf Andogenbehandlung Mausmodelle: Symptome verringert durch Kastration (Katsuno 2002, Chevalier-Larsen 2004) Chemische Kastration (Leupron) verringert die Symptome (Katsuno 2003)

11 Das Paradoxe Klinische Studien bisher: 1. Fallbericht über Testosteron Therapie bei zwei Brüdern mit SBMA (Goldenberg 1996) 2. Leupron-Testosteron Kreuzstudie: (Abstract, Mendell 1996) 31 SBMA-Patienten, doppelblind, Kreuzstudie (6 months) 18 Patienten zeigten Besserung durch Testosteron; keiner durch Leupron 3. Laufender Leupron-Versuch in Japan (Sobue)

12 Unterschied aufgrund der Androgene? Testosteron Abgesondert durch die Hoden Zirkuliert durch den ganze Körper Dihydrotestosteron (DHT) Erzeugt in speziellen Geweben Höhere Affinität zum AR Bindet länger am AR

13 Unterschied aufgrund der Androgene? Testosteron Abgesondert durch die Hoden Zirkuliert durch den ganze Körper Anabolische Wirkung auf Muskeln! Dihydrotestosteron (DHT) Erzeugt in speziellen Geweben Höhere Affinität zum AR Bindet länger am AR

14 Unterschied aufgrund der Androgene? Testosteron Abgesondert durch die Hoden Zirkuliert durch den ganze Körper Anabolische Wirkung auf Muskeln! Dihydrotestosteron (DHT) Erzeugt in speziellen Geweben Höhere Affinität zum AR Bindet länger am AR T DHT 5-alpha-Reductase (Typ 1 & 2)

15 5-alpha Reductase 2 Isoforme: Typ 1 - Leber, Haut, Gehirn Typ 2 - Leber, Prostata, Hoden DHT wurde nachgewiesen im Gehirn und Rückenmark der erwachsenen Ratte (Sar 1977)

16 5-alpha Reductase 2 Isoforme: Typ 1 - Leber, Haut, Gehirn Typ 2 - Leber, Prostata, Hoden DHT wurde nachgewiesen im Gehirn und Rückenmark der erwachsenen Ratte (Sar 1977) Hohes Niveau an 5-alpha Reductase (Typ 2) in Motoneuronen des Rückenmarks der Ratte (Pozzi 2003)

17 5-alpha Reductase 2 Isoforme: Typ 1 - Leber, Haut, Gehirn Typ 2 - Leber, Prostata, Hoden DHT wurde nachgewiesen im Gehirn und Rückenmark der erwachsenen Ratte (Sar 1977) Hohes Niveau an 5-alpha Reductase (Typ 2) in Motoneuronen des Rückenmarks der Ratte (Pozzi 2003)

18 Ist 5-alpha Reductase (Typ 2) im menschlichen Gehirn und Rückenmark? Pons Medulla Rückenmark Prostate Anmerkung: Über die Medulla und den Pons (Brücke) ist das Rückenmark mit dem Gehirn verbunden

19 Klinischer Nutzen Wenn es möglich ist, das Enzym 5-alpha Reductase (Typ 2) zu blockieren, so können wir vielleicht das Fortschreiten der Krankheit in den Motoneuronen verlangsamen und trotzdem die Wirkung des Testosterons auf Muskeln und anderes Gewebe erhalten.

20 Phase II Klinischer Versuch Ausführung: doppel-blind, Placebo kontrolliert (natürlicher Verlauf) Patienten: 20 pro Zweig Medikament: Finasteride 5 mg/tag (oral) Dauer: 2 Jahre; Überprüfung alle 6 Monate Bewertung: Verlauf & körperliche Untersuchung Laborwerte/Endokrinologie (CK, Testosteron, DHT, Lipide, Glukose, etc.) Neuromuskolär (EMG/NC) Funtionsuntersuchung Befragung/Überwachung der Lebensqualität Quantitative Muskeluntersuchung (QMT) Primärer Endpunkt: Veränderung der Kraft ggü. dem Beginn bewertet durch QMT Anmerkung: QMT = Quantitative myometry testing

21 Danke!

Kennedy Syndrom: Maus-Modelle und Mechanistische Studien

Kennedy Syndrom: Maus-Modelle und Mechanistische Studien Kennedy Syndrom: Maus-Modelle und Mechanistische Studien Kennedy Syndrom - SBMA Kennedy Syndrom Spinobulbäre Muskelatrophie (SBMA) Mausmodelle der SBMA Transkriptionale Regulationsstörung - Motoneuronverlust

Mehr

Kein Hinweis für eine andere Ursache der Demenz

Kein Hinweis für eine andere Ursache der Demenz die später nach ihm benannte Krankheit. Inzwischen weiß man, dass die Alzheimer-Krankheit eine sogenannte primär-neurodegenerative Hirnerkrankung ist. Das bedeutet, dass die Erkrankung direkt im Gehirn

Mehr

Biologische Psychologie II

Biologische Psychologie II Fetale Hormone und die Entwicklung der Fortpflanzungsorgane: Noch 6 Wochen nach der Befruchtung liegen im Fetus unabhängig vom genetischen Geschlecht dieselben beiden gonadalen Strukturen vor! Diese Strukturen

Mehr

Testosteron. und benigne Prostatahyperplasie

Testosteron. und benigne Prostatahyperplasie Testosteron und benigne Prostatahyperplasie Behauptung Testosteronsubstitution bewirkt Eine Vergrößerung der Prostata Verstärktes Wachstum eines Prostatakarzinoms In den letzten Jahren wurde nach einem

Mehr

Das klinische Spektrum der ALS. Albert C. Ludolph, Ulm

Das klinische Spektrum der ALS. Albert C. Ludolph, Ulm Das klinische Spektrum der ALS Albert C. Ludolph, Ulm Die häufigste Motoneuronerkrankung: die amyotrophe Lateralsklerose (ALS) Rasch fortschreitende, erst fokale, sich kontinuierlich ausbreitend, dann

Mehr

Fettmoleküle und das Gehirn

Fettmoleküle und das Gehirn Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Spezielle "Gehirn Fett Injektion hilft Huntington Mäusen Direktes

Mehr

The Journal Club. Resistenzmechanismen unter antihormoneller Therapie des fortgeschrittenen Prostatakarzinoms

The Journal Club. Resistenzmechanismen unter antihormoneller Therapie des fortgeschrittenen Prostatakarzinoms The Journal Club Resistenzmechanismen unter antihormoneller Therapie des fortgeschrittenen Prostatakarzinoms Kastrationsresistentes metastasierendes P-Ca (mcrpca) Es gibt unterschiedliche Resistenzmechanismen

Mehr

Mann oh Mann. Mein TESTOSTERON. Wissenswertes über Testosteron. Deutsche Gesellschaft für Mann und Gesundheit e. V.

Mann oh Mann. Mein TESTOSTERON. Wissenswertes über Testosteron. Deutsche Gesellschaft für Mann und Gesundheit e. V. Mann oh Mann Mein TESTOSTERON Wissenswertes über Testosteron Deutsche Gesellschaft für Mann und Gesundheit e. V. www.mann-und-gesundheit.com Inhalt dieser Broschüre Testosteron Jeder Mann sollte darüber

Mehr

Biopsychologie als Neurowissenschaft Evolutionäre Grundlagen Genetische Grundlagen Mikroanatomie des NS

Biopsychologie als Neurowissenschaft Evolutionäre Grundlagen Genetische Grundlagen Mikroanatomie des NS 1 25.10.06 Biopsychologie als Neurowissenschaft 2 8.11.06 Evolutionäre Grundlagen 3 15.11.06 Genetische Grundlagen 4 22.11.06 Mikroanatomie des NS 5 29.11.06 Makroanatomie des NS: 6 06.12.06 Erregungsleitung

Mehr

Dr. Marianne Legato. Evas Rippe

Dr. Marianne Legato. Evas Rippe Dr. Marianne Legato Evas Rippe Warum Frauen manche Krankheiten ' ganz anders erfahren Warum erst jetzt die weibliche Seite der Medizin entdeckt wird Warum viele Medikamente für Frauen gefährlich sind Aus

Mehr

Intersexualität. Prof. Dr.med. Susanne Krege Klinik für Urologie und Kinderurologie Alexianer Krankenhaus Maria-Hilf GmbH, Krefeld

Intersexualität. Prof. Dr.med. Susanne Krege Klinik für Urologie und Kinderurologie Alexianer Krankenhaus Maria-Hilf GmbH, Krefeld Intersexualität Prof. Dr.med. Susanne Krege Klinik für Urologie und Kinderurologie Alexianer Krankenhaus Maria-Hilf GmbH, Krefeld Sexuelle Differentierungsstörungen XY XX SRY/TDF Hoden Eierstöcke Testosteron

Mehr

Mittwoch: Medikamente zur Huntingtin- Absenkung

Mittwoch: Medikamente zur Huntingtin- Absenkung Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Huntington-Therapie-Konferenz 2015: Tag 2 Tag 2 über Aktuelles

Mehr

Mann oh Mann Mein TESTOSTERON

Mann oh Mann Mein TESTOSTERON Mann oh Mann Mein TESTOSTERON Wissenswertes über Testosteron Deutsche Gesellschaft für Mann und Gesundheit e. V. www.mann-und-gesundheit.com Inhalt dieser Broschüre Testosteron Jeder Mann sollte darüber

Mehr

Vital sein, aktiv leben Die Bedeutung von Testosteron für Ihr körperliches, geistiges und sexuelles Wohlbefinden

Vital sein, aktiv leben Die Bedeutung von Testosteron für Ihr körperliches, geistiges und sexuelles Wohlbefinden Vital sein, aktiv leben Die Bedeutung von Testosteron für Ihr körperliches, geistiges und sexuelles Wohlbefinden Voraussetzungen für Ihr Wohlbefinden Zwischen dem jungen und dem älteren Mann steht, chronologisch

Mehr

Wie steht es um mein Sexualleben?

Wie steht es um mein Sexualleben? 1 Informationsbroschüre für Patienten mit Prostatakrebs * Wie steht es um mein Sexualleben? *Männer, die mit einem LHRH-Analogon zur Testosteronsuppression behandelt werden. » Hilfe! Mein Sexualleben ist

Mehr

Haben Sie externe Hilfestellungen in Anspruch genommen? Wenn ja, bitte geben Sie an, welche Hilfestellung Sie in Anspruch genommen haben?

Haben Sie externe Hilfestellungen in Anspruch genommen? Wenn ja, bitte geben Sie an, welche Hilfestellung Sie in Anspruch genommen haben? Haben Sie externe Hilfestellungen in Anspruch genommen? Wenn ja, bitte geben Sie an, welche Hilfestellung Sie in Anspruch genommen haben? 1.1 Angefragte Untersuchungs- und Behandlungsmethode (Kurzbezeichnung

Mehr

Geschlechtsunterschiede und der Einfluss von Steroidhormonen auf das sich entwickelnde menschliche Gehirn

Geschlechtsunterschiede und der Einfluss von Steroidhormonen auf das sich entwickelnde menschliche Gehirn Kerstin Konrad LFG Klinische Neuropsychologie des Kindes- und Jugendalters Klinik für Kinder- und Jugendpsychiatrie und psychotherapie Universitätsklinikum der RWTH Aachen Geschlechtsunterschiede und der

Mehr

Bayer und Orion erweitern klinisches Studienprogramm für BAY (ODM-201) bei Prostatakrebs

Bayer und Orion erweitern klinisches Studienprogramm für BAY (ODM-201) bei Prostatakrebs Investor News Bayer AG Investor Relations 51368 Leverkusen Deutschland www.investor.bayer.de Onkologie bei Bayer: Bayer und Orion erweitern klinisches Studienprogramm für BAY- 1841788 (ODM-201) bei Prostatakrebs

Mehr

Amerikanische Chiropraktik. Workshop: Was kann Amerikanische Chiropraktik für mich tun?

Amerikanische Chiropraktik. Workshop: Was kann Amerikanische Chiropraktik für mich tun? Amerikanische Chiropraktik Workshop: Was kann Amerikanische Chiropraktik für mich tun? Im Moment der Befruchtung einer Eizelle durch eine Samenzelle bildet sich unsere genetische Individualität. Sie legt

Mehr

Pathohysiologie und Androgendeprivationtstherapie(ADT) des kastrationsresistenten Prostatakarzinoms

Pathohysiologie und Androgendeprivationtstherapie(ADT) des kastrationsresistenten Prostatakarzinoms Pathohysiologie und Androgendeprivationtstherapie(ADT) des kastrationsresistenten Prostatakarzinoms KASTRATIONSRESISTENTES PROSTATAKARZINOM (CRPC) Patienten sprechen im Allgemeinen gut auf eine ADT an.

Mehr

Daten bestätigen Bedeutung einer frühen Behandlung von Patienten mit Multipler Sklerose (MS)

Daten bestätigen Bedeutung einer frühen Behandlung von Patienten mit Multipler Sklerose (MS) Europäischer Multiple-Sklerose-Kongress ECTRIMS: Daten bestätigen Bedeutung einer frühen Behandlung von Patienten mit Multipler Sklerose (MS) - Studienergebnisse belegen kognitive Funktionseinschränkungen

Mehr

MORBUS FABRY Morbus Fabry ist eine seltene und schwere, aber behandelbare Krankheit

MORBUS FABRY Morbus Fabry ist eine seltene und schwere, aber behandelbare Krankheit MORBUS FABRY Morbus Fabry ist eine seltene und schwere, aber behandelbare Krankheit Diese Broschüre möchte Sie über die Entstehung, Vererbung und Behandlung der Fabry-Erkrankung informieren. Hier finden

Mehr

Prostataerkrankungen

Prostataerkrankungen Wenn s s einmal nicht mehr läuft: Prostataerkrankungen Prof. Dr. med. K.D. Sievert Stellvertretender Direktor Klinik für f r Urologie Universität t T Ablauf Anatomie & Physiologie Benignes Prostatasyndrom

Mehr

OZONTHERAPIE BEI SSPE

OZONTHERAPIE BEI SSPE OZONTHERAPIE BEI SSPE Dr. Murat BAS OZON KLINIK - BURSA, Türkei Deutsche Übersetzung: R.Schönbohm 1 SSPE (subakut sklerosierende Panenzephalitis) ist eine seltene Komplikation der Masern. Sie gehört zu

Mehr

Informationen zur Hormontherapie des Prostatakarzinoms mittels LHRH-Agonisten

Informationen zur Hormontherapie des Prostatakarzinoms mittels LHRH-Agonisten Informationen zur Hormontherapie des Prostatakarzinoms mittels LHRH-Agonisten Inhaltsverzeichnis Einleitung... Seite 3 LHRH-Agonisten... Seite 4 Antiandrogene... Seite 6 Lieber Patient, bei Ihnen ist kürzlich

Mehr

Grundlegendes zur Genetik

Grundlegendes zur Genetik Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Die genetische 'Grauzone' der Huntington Krankheit: Was bedeutet

Mehr

Beurteilungen von Veränderungen in der Protein-Elektrophorese

Beurteilungen von Veränderungen in der Protein-Elektrophorese 1 Beurteilungen von Veränderungen in der Protein-Elektrophorese Darstellung - Kurvenbild (Pherogramm) - Quantitative Veränderungen Interpretation - Bewertung der Relevanz - Kommentierung Protein-Elektrophorese

Mehr

mglu5 Antagonisten zur Behandlung des Fragilen X Syndroms

mglu5 Antagonisten zur Behandlung des Fragilen X Syndroms mglu5 Antagonisten zur Behandlung des Fragilen X Syndroms Georg Jaeschke, F. Hoffmann La Roche Fragiles X Syndrom mglur Theorie Martin-Bell Syndrom Fmr1 Gen identifiziert mglu5 MPEP FMRP hemmt Translation

Mehr

Effekte eines Trainings mit Hilfe von Nintendo Wii Fit Plus bei Patienten mit Multipler Skleroseeine prospektive, kontrollierte, randomisierte Studie.

Effekte eines Trainings mit Hilfe von Nintendo Wii Fit Plus bei Patienten mit Multipler Skleroseeine prospektive, kontrollierte, randomisierte Studie. Effekte eines Trainings mit Hilfe von Nintendo Wii Fit Plus bei Patienten mit Multipler Skleroseeine prospektive, kontrollierte, randomisierte Studie. IQMG JAHRESTAGUNG 17.11.2016, Physiotherapeutin B.A.

Mehr

Systemische Mastozytose

Systemische Mastozytose Systemische Mastozytose auf dem 5. Aachener Patienten- und Angehörigensymposium 2014 Aachen, 17.05.2014 Karla Bennemann & Jens Panse Blutbildung dynamischer Prozess täglich > 7 x 10 9 Blutzellen pro kg

Mehr

Testosteron bei Metabolischem Syndrom

Testosteron bei Metabolischem Syndrom Testosteron bei Metabolischem Syndrom Status, Bedeutung, Empfehlungen Dr. Harald Fischer, Frankfurt am Main 2015 Testosteron bei Metabolischem Syndrom Physiologie Ernst Laqueur isolierte 1935 Testosteron

Mehr

Menschen mit Demenz - Krankheitsbilder und Behandlungsoptionen

Menschen mit Demenz - Krankheitsbilder und Behandlungsoptionen 5. Fachveranstaltung der STGAG/PKM und des Spitex Verbandes Thurgau am 14.05.2013 Menschen mit Demenz - Krankheitsbilder und Behandlungsoptionen Dr. med. Jacques-Emmanuel Schaefer Demenz, eine Alterskrankheit...!?

Mehr

BEISPIELFRAGEN zum ÜBEN...ähnliche Fragen könnten zum Test kommen

BEISPIELFRAGEN zum ÜBEN...ähnliche Fragen könnten zum Test kommen BIOLOGIETEST Sommersemester 3. Klasse Teststoff: Meiose Intersexualität Transsexualität Pubertät und Hormone Menstruationszyklus Embryonalentwicklung Plazenta BEISPIELFRAGEN zum ÜBEN...ähnliche Fragen

Mehr

remittierender Multipler Sklerose

remittierender Multipler Sklerose PLEGRIDY : Erstes pegyliertes Interferon alle 2 Wochen s.c. für erwachsene Patienten mit schubförmig r PLEGRIDY Erstes pegyliertes Interferon alle 2 Wochen s.c. für erwachsene Patienten mit schubförmig

Mehr

Autoimmunerkrankung Erkrankung, bei der sich das Immunsystem gegen körpereigenes Gewebe richtet.

Autoimmunerkrankung Erkrankung, bei der sich das Immunsystem gegen körpereigenes Gewebe richtet. Glossar Adhärenz Therapietreue: Konsequentes Einhalten der Therapie. Autoimmunerkrankung Erkrankung, bei der sich das Immunsystem gegen körpereigenes Gewebe richtet. Axon Fortsatz einer Nervenzelle, der

Mehr

Pharmazeutische Biologie Genetik

Pharmazeutische Biologie Genetik Pharmazeutische Biologie Genetik N230-Raum 306 Tel. (069) 798-29650 dingermann@em.uni-frankfurt.de Dominanter Erbgang +/+ +/A männlich weiblich krank Typisch: auch heterozygote Träger sind krank kranke

Mehr

Medienmitteilung. Basel, 28. September 2015

Medienmitteilung. Basel, 28. September 2015 Medienmitteilung Basel, 28. September 2015 Ocrelizumab von Roche zeigt als erstes Prüfmedikament Wirkung bei Menschen mit primär progredienter multipler Sklerose in einer grossen Phase-III-Studie Phase-III-Studie

Mehr

ALLES ÜBER SCHMERZEN. Solutions with you in mind

ALLES ÜBER SCHMERZEN.  Solutions with you in mind ALLES ÜBER SCHMERZEN www.almirall.com Solutions with you in mind WAS IST DAS? Schmerzen werden beschrieben als unangenehmes Sinnes- und Emotionserleben in Verbindung mit einem schädlichen Reiz. Schmerzen

Mehr

Hormonablation: Wann und wie?

Hormonablation: Wann und wie? Das Prostatakarzinom im Wandel der Zeit: Hirslanden Academy 23.06.2011 Hormonablation: Wann und wie? Prof. Dr. med. Tullio Sulser Klinik für Urologie UniversitätsSpital Zürich Hintergrund Nobelpreis für

Mehr

Die Prostata und BPH. BPH = Benigne Prostata Hyperplasie (gutartige Vergrößerung der Prostata)

Die Prostata und BPH. BPH = Benigne Prostata Hyperplasie (gutartige Vergrößerung der Prostata) Die Prostata Die Prostata und BPH BPH = Benigne Prostata Hyperplasie (gutartige Vergrößerung der Prostata) Die Prostata Eine walnussgroße Drüse am Boden der männlichen Blase Umgibt die Harnröhre Produziert

Mehr

Wissenswertes zur Spinalen Muskelatrophie

Wissenswertes zur Spinalen Muskelatrophie Wissenswertes zur Spinalen Muskelatrophie Rudolf Korinthenberg, Janbernd Kirschner Klinik für Neuropädiatrie und Muskelerkrankungen Zentrum für Kinderheilkunde und Jugendmedizin Universitätsklinikum Freiburg/Brsg.

Mehr

Firmenseminar der Firma Johnson & Johnson GmbH, Neuss. Medizin und Kosmetik Was Männern mit androgenetischer Alopezie hilft

Firmenseminar der Firma Johnson & Johnson GmbH, Neuss. Medizin und Kosmetik Was Männern mit androgenetischer Alopezie hilft Abstracts Firmenseminar der Firma Johnson & Johnson GmbH, Neuss Medizin und Kosmetik Was Männern mit androgenetischer Alopezie hilft Gesellschaft für Dermopharmazie Vorsitzende: Dr. Joachim Kresken, Viersen

Mehr

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Ein Vortrag von Univ. Prof. Dr. Johannes Drach Medizinische Universität Wien Univ. Klinik für Innere Medizin I Klinische Abteilung

Mehr

Der gleichzeitige Anti-Haarverlust und Haar Wachstums Complex

Der gleichzeitige Anti-Haarverlust und Haar Wachstums Complex Capixyl TM Der gleichzeitige Anti-Haarverlust und Haar Wachstums Complex Wie wichtig Haare in unserem Leben sind, kann nicht oft genug erwähnt werden. Wenn Männer, aber auch Frauen ihre Haare verlieren,

Mehr

Zusammenhänge zwischen Übergewicht / Gewichtszunahme und Stoffwechselerkrankungen

Zusammenhänge zwischen Übergewicht / Gewichtszunahme und Stoffwechselerkrankungen Zusammenhänge zwischen Übergewicht / Gewichtszunahme und Stoffwechselerkrankungen Robert A. Ritzel Klinik für Endokrinologie, Diabetologie und Suchtmedizin Nuklearmedizin Klinikum Schwabing Städtisches

Mehr

Leben mit Cystischer Fibrose

Leben mit Cystischer Fibrose Leben mit Cystischer Fibrose Schweizerische Gesellschaft für Cystische Fibrose (CFCH) Symptome 2 Cystische Fibrose (CF) oder Mukoviszidose: die häufigste Erbkrankheit. Cystische Fibrose (CF), auch Mukoviszidose

Mehr

DAUER DER STUDIE: Läuft seit Nov mindestens bis 2017.

DAUER DER STUDIE: Läuft seit Nov mindestens bis 2017. KLINISCHE STUDIE: Swiss Inflammatory Bowel Disease Cohort Study (SIBDCS) Multizentrische Beobachtungsstudie in der ganzen Schweiz (Basel, Bern, Genf, Lausanne, St-Gallen, Zürich) mit Patient die an einem

Mehr

Ein Rezept für eine Krankheit

Ein Rezept für eine Krankheit Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Bauen wir bessere Mäuse(fallen): Neues Modell für die Huntington-Krankheit

Mehr

Amyotrophe Lateralsklerose. Referat von Eva Montag

Amyotrophe Lateralsklerose. Referat von Eva Montag Amyotrophe Lateralsklerose Referat von Eva Montag http://p5.focus.de/img/incoming/origs3195325/5738838139-w630-h412-o-q75-p5/wissen-hawking.jpg Inhalt 1. Definition Was genau ist ALS? 2. Verlauf und Symptomatik

Mehr

Inhalt. Vorwort.

Inhalt. Vorwort. VII Inhalt Vorwort V Einleitung 1 Wozu brauchen wir Hormone? 3 Was sind naturidentische Hormone? 3 Wie kommt es zu Hormonstörungen? 4 Gibt es eine zeitliche Begrenzung für eine Therapie mit naturidentischen

Mehr

Haarausfall? Dank Pantogar im Griff! Ein Ratgeber für Patientinnen mit Haarausfall und Haarstrukturschäden

Haarausfall? Dank Pantogar im Griff! Ein Ratgeber für Patientinnen mit Haarausfall und Haarstrukturschäden Haarausfall? Dank Pantogar im Griff! Ein Ratgeber für Patientinnen mit Haarausfall und Haarstrukturschäden Lebenszyklus der Haare 1 Die Wachstumsphase (Anagenphase) Die Wachstumsphase dauert etwa 2 6 Jahre

Mehr

ÜBERSICHTSRASTER ZU DEN UNTERRICHTSVORHABEN IN BIOLOGIE IN DER EINFÜHRUNGSPHASE (EP)

ÜBERSICHTSRASTER ZU DEN UNTERRICHTSVORHABEN IN BIOLOGIE IN DER EINFÜHRUNGSPHASE (EP) ÜBERSICHTSRASTER ZU DEN UNTERRICHTSVORHABEN IN BIOLOGIE IN DER EINFÜHRUNGSPHASE (EP) THEMA Kein Leben ohne Zelle I KONTEXT Wie sind Zellen aufgebaut und organisiert? INHALTSFELD IF 1 (Biologie der Zelle)

Mehr

Medikamentöse Therapie: Aktuelle Möglichkeiten der Behandlung

Medikamentöse Therapie: Aktuelle Möglichkeiten der Behandlung Medikamentöse Therapie: Aktuelle Möglichkeiten der Behandlung Prostatakarzinom t Informationstag t 23.04.2016 2016 Dr. Robert Tauber Urologische Klinik und Poliklinik Klinikum rechts der Isar der TU München

Mehr

5 Zusammenfassung. Zusammenfassung 76

5 Zusammenfassung. Zusammenfassung 76 Zusammenfassung 76 5 Zusammenfassung 1. Aminosäuren sind als Bausteine der Proteine essentiell zur Aufrechterhaltung vitaler Prozesse. Eine besondere Rolle im Zellmetabolismus der Haut spielen dabei kationische

Mehr

Autoimmun-Lymphoproliferatives Syndrom (ALPS)

Autoimmun-Lymphoproliferatives Syndrom (ALPS) CC CI C Centrum für Chronische Immundefizienz Autoimmun-Lymphoproliferatives Syndrom (ALPS) 1. ALPS - was ist das? 2. Wie häufig ist die Erkrankung? 3. Was sind die Ursachen der Erkrankung? 4. Ist es eine

Mehr

Ell-Cranell Skincare for Hair

Ell-Cranell Skincare for Hair Ell-Cranell WIRKT STÄRKT VERSORGT Ell-Cranell mit Alfatradiol * Wirkt direkt gegen den Hauptgrund für Haarausfall. 1 Ell-Cranell re-balance Stärkt die Widerstandskraft der Haarwurzeln gegen innere und

Mehr

Aktuelles zur Diagnose und Therapie von Alzheimer und anderen Demenzformen

Aktuelles zur Diagnose und Therapie von Alzheimer und anderen Demenzformen Aktuelles zur Diagnose und Therapie von Alzheimer und anderen Demenzformen Alexander Kurz Klinik für Psychiatrie und Psychotherapie Technische Universität München Hintergrund Nervenzelluntergang ist häufigste

Mehr

Das Sexualleben ist ohne Zweifel ein sehr vielschichtiges Phänomen, das sowohl körperliche,

Das Sexualleben ist ohne Zweifel ein sehr vielschichtiges Phänomen, das sowohl körperliche, Kapitel 10: Prostata und Sexualität Basiswissen Sexualität aus Sicht des Urologen Das Sexualleben ist ohne Zweifel ein sehr vielschichtiges Phänomen, das sowohl körperliche, seelische als auch verschiedene

Mehr

Schlafstörungen können Hinweise auf neurologische Leiden sein

Schlafstörungen können Hinweise auf neurologische Leiden sein ENS 2013 Schlafstörungen können Hinweise auf neurologische Leiden sein Barcelona, Spanien (10. Juni 2013) Schlafstörungen können das erste Anzeichen schwerer neurologischer Erkrankungen sein, betonten

Mehr

MS 10 Fragen und Antworten

MS 10 Fragen und Antworten Hintergrundinformation MS 10 Fragen und Antworten Was ist MS? Multiple Sklerose (MS) ist eine chronische Erkrankung des Zentralen Nervensystems (ZNS), d.h. des Gehirns und des Rückenmarks. Bei der MS handelt

Mehr

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms?

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Brustkrebs aktuell - OSP am 21.10.2015 Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Prof. Dr. German Ott, Institut für Pathologie Robert-Bosch-Krankenhaus

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

Lang wirksame Beta-Mimetika Long Acting Beta Agonists (LABAs) erhöhtes Risiko einer Exazerbation der Asthmasymptome

Lang wirksame Beta-Mimetika Long Acting Beta Agonists (LABAs) erhöhtes Risiko einer Exazerbation der Asthmasymptome Lang wirksame Beta-Mimetika Long Acting Beta Agonists (LABAs) erhöhtes Risiko einer Exazerbation der Asthmasymptome Basisinformation FACHINFORMATION Lang wirksame Beta-Mimetika - Long Acting Beta Agonists

Mehr

Genetische Unterschiede beeinflussen die Wirkung von Anti-Brechmitteln

Genetische Unterschiede beeinflussen die Wirkung von Anti-Brechmitteln Chemotherapie: Wenn die Übelkeit nicht aufhört Genetische Unterschiede beeinflussen die Wirkung von Anti-Brechmitteln Heidelberg (4. Januar 2011) Häufige Nebenwirkungen einer Chemotherapie sind Übelkeit

Mehr

Frauenkrebs Kommunikationsprojekt. Krebs und die genetische Verbindung

Frauenkrebs Kommunikationsprojekt. Krebs und die genetische Verbindung Frauenkrebs Kommunikationsprojekt Koordiniert durch das Europäische Institut für Frauengesundheit http://www.eurohealth.ie/cancom/ Krebs und die genetische Verbindung In Irland ist Brustkrebs eine der

Mehr

Fall einer hereditären Hämochromatose (HH) Dr. med. Carl M. Oneta Schaffhauserstrasse Winterthur

Fall einer hereditären Hämochromatose (HH) Dr. med. Carl M. Oneta Schaffhauserstrasse Winterthur Fall einer hereditären Hämochromatose (HH) Dr. med. Carl M. Oneta Schaffhauserstrasse 7 8400 Winterthur Fall (Klinik) 48 jähriger Patient, Wirtschaftsmanager, Vater von 3 Kindern, bisher immer bei guter

Mehr

Myelofibrose: Krankheit, Diagnose, Beschwerden

Myelofibrose: Krankheit, Diagnose, Beschwerden Myelofibrose: Krankheit, Diagnose, Beschwerden Wissenswertes über Myelofibrose Was ist eine Myelofibrose? Wie entsteht Myelofibrose? Welche Beschwerden verursacht die Erkrankung? Wie erkennt man die Myelofibrose?

Mehr

Die Genetik: Ein Überblick

Die Genetik: Ein Überblick Die Genetik: Ein Überblick SMA Takes the Hill 2003 Debra G.B. Leonard, M.D., Ph.D. Director, Molecular Pathology Laboratory University of Pennsylvania Health System Philadelphia, PA Ziele Die Möglichkeiten

Mehr

Wiederholung: Circadiane Rhythmus-Schlafstörungen

Wiederholung: Circadiane Rhythmus-Schlafstörungen 1. Extrinsisch Wiederholung: Circadiane Rhythmus-Schlafstörungen Klassifikation nach ICSD (International Classification of Sleep Disorders) Circadiane Rhythmus-Schlafstörung vom Typ Schichtarbeitersyndrom,

Mehr

WARUM FRAUEN GESÜNDER LEBEN & MÄNNER FRÜHER STERBEN. Inhalt

WARUM FRAUEN GESÜNDER LEBEN & MÄNNER FRÜHER STERBEN. Inhalt Inhalt 15 Zwei Gesundheitskulturen Männer sind anders, Frauen auch 16 Der Begriff Gender Medicine 18 Biologische Gegebenheiten 19 Frauen leben länger 21 Warum Frauen länger leben 22 Gesund oder krank?

Mehr

fightipf.de KÄMPFEN. ATMEN. LEBEN. AB HEUTE BIETE ICH IPF DIE STIRN Das Gespräch mit Ihrem Arzt über IPF und Ihre Behandlungsoptionen

fightipf.de KÄMPFEN. ATMEN. LEBEN. AB HEUTE BIETE ICH IPF DIE STIRN Das Gespräch mit Ihrem Arzt über IPF und Ihre Behandlungsoptionen fightipf.de KÄMPFEN. ATMEN. LEBEN. AB HEUTE BIETE ICH IPF DIE STIRN Das Gespräch mit Ihrem Arzt über IPF und Ihre Behandlungsoptionen WAS ES HEIßT, AN IPF ERKRANKT ZU SEIN Die idiopathische Lungenfibrose

Mehr

Ist er noch it für Leben und Liebe? WissensWertes zum testosteron-mangel - Für SIE.

Ist er noch it für Leben und Liebe? WissensWertes zum testosteron-mangel - Für SIE. Ist er noch it für Leben und Liebe? WissensWertes zum testosteron-mangel - Für SIE. www.mannvital.de Inhaltsverzeichnis 1. Was ist mit meinem Partner los?...4 5 2. Wie spreche ich das Problem an?...6 7

Mehr

Aspekte der Eisenresorption. PD Dr. F.S. Lehmann Facharzt für Gastroenterologie FMH Oberwilerstrasse Binningen

Aspekte der Eisenresorption. PD Dr. F.S. Lehmann Facharzt für Gastroenterologie FMH Oberwilerstrasse Binningen Aspekte der Eisenresorption PD Dr. F.S. Lehmann Facharzt für Gastroenterologie FMH Oberwilerstrasse 19 4102 Binningen Chemische Eigenschaften Fe-II wird leichter aufgenommen als Fe-III wegen der besseren

Mehr

Volkskrankheit Osteoporose

Volkskrankheit Osteoporose Volkskrankheit Osteoporose Volkskrankheit Osteoporose Definition Problem und Prävalenz Einfluss von Frakturen Mortalitätsdaten Osteoporose in Deutschland Kosten der Osteoporose Anforderungen an eine Osteoporosetherapie

Mehr

Allgemeine Pathologie. Störungen im Kupfer- Stoffwechsel

Allgemeine Pathologie. Störungen im Kupfer- Stoffwechsel Allgemeine Pathologie Störungen im Kupfer- Stoffwechsel Physiologie (1): - das Übergangsmetall Kupfer ist als essentielles Spurenelement Bestandteil einer Reihe wichtiger Enzyme: - Ferro-oxidase I (Coeruloplasmin),

Mehr

Cimicifuga racemosa. Die Wirksamkeit ist dosisabhängig. Prof. Dr. med. Reinhard Saller Abteilung Naturheilkunde Universitätsspital Zürich

Cimicifuga racemosa. Die Wirksamkeit ist dosisabhängig. Prof. Dr. med. Reinhard Saller Abteilung Naturheilkunde Universitätsspital Zürich Prof. Dr. med. Reinhard Saller Abteilung Naturheilkunde Universitätsspital Zürich Folie 1 Menopause relevante Beschwerden Hitzewallungen Schweissausbrüche Schlafstörungen Nervosität, Gereiztheit Depression

Mehr

Vorzeichen von Multiple Sklerose früh erkennen

Vorzeichen von Multiple Sklerose früh erkennen Sehstörungen bei Kindern und Jugendlichen Vorzeichen von Multiple Sklerose früh erkennen München (29. August 2012) Multiple Sklerose (MS), eine chronisch-entzündliche Erkrankung von Gehirn und Rückenmark,

Mehr

Periodisches Fieber mit Aphthöser Stomatitis, Pharyngitis und Adenitis (PFAPA)

Periodisches Fieber mit Aphthöser Stomatitis, Pharyngitis und Adenitis (PFAPA) www.printo.it/pediatric-rheumatology/de/intro Periodisches Fieber mit Aphthöser Stomatitis, Pharyngitis und Adenitis (PFAPA) Version von 2016 1. ÜBER PFAPA 1.1 Was ist das? PFAPA steht für periodisches

Mehr

Wirkungen auf die Blut-Hirn-Schranke, DNA-Schädigung

Wirkungen auf die Blut-Hirn-Schranke, DNA-Schädigung Wirkungen auf die Blut-Hirn-Schranke, DNA-Schädigung Dr. Monika Asmuß Bundesamt für Strahlenschutz Mobilfunk und Gesundheit BfS-Informationsveranstaltung, 25. Juni 2009, München 1 Blut-Hirn-Schranke (BHS)

Mehr

Ernährungsaspekte bei chronischen Wunden. Jan Köllner - Ernährungsteam

Ernährungsaspekte bei chronischen Wunden. Jan Köllner - Ernährungsteam Ernährungsaspekte bei chronischen Wunden Jan Köllner - Ernährungsteam Was hat dieses Thema in einer Veranstaltung zur Ernährung geriatrischer Patienten zu suchen? 12.01.2016 J. Köllner / Ernährungsteam

Mehr

Osteoporose, Spondylarthropathien

Osteoporose, Spondylarthropathien KLINIK UND POLIKLINIK FÜR INNERE MEDIZIN I Osteoporose, Spondylarthropathien Dr. med. Nadine Schneider Teriparatid oder Alendronat bei Glukokortikoidinduzierter Osteoporose? (Saag et al. NEJM 2007; 357:2028-39)

Mehr

Haarausfall? Dünner werdendes Haar? Ein Ratgeber für Patientinnen mit Haarausfall oder dünnem, brüchigem Haar

Haarausfall? Dünner werdendes Haar? Ein Ratgeber für Patientinnen mit Haarausfall oder dünnem, brüchigem Haar Haarausfall? Dünner werdendes Haar? Ein Ratgeber für Patientinnen mit Haarausfall oder dünnem, brüchigem Haar Medizin für für Ihr Ihr Haar Haar Lebenszyklus der Haare 1 Die Wachstumsphase (Anagenphase)

Mehr

Grundlagen der evidenzbasierten neurologischen Rehabilitation

Grundlagen der evidenzbasierten neurologischen Rehabilitation Grundlagen der evidenzbasierten neurologischen Rehabilitation Prof. Dr. phil. Helmut Hildebrandt Klinikum Bremen-Ost, Neurologie Universität Oldenburg, Psychologie email: helmut.hildebrandt@uni-oldenburg.de

Mehr

Zwerchfellstimulation zur Therapie der Ateminsuffizienz bei Motoneuronerkrankungen

Zwerchfellstimulation zur Therapie der Ateminsuffizienz bei Motoneuronerkrankungen 12. Innovationsgipfel der Medizinischen Hochschule Hannover Dienstag 01. März 2011 Zwerchfellstimulation zur Therapie der Ateminsuffizienz bei Motoneuronerkrankungen Susanne Petri, Anna-Lena Cordes Amyotrophe

Mehr

OSTEOPOROSE SELBSTHILFE bei Osteoporose.

OSTEOPOROSE SELBSTHILFE bei Osteoporose. OSTEOPOROSE SELBSTHILFE bei Osteoporose. 9 SÄULEN DER OSTEOPOROSETHERAPIE EIGENVERANT WORTUNG Osteoporose ist kein altersbedingtes Schicksal, das man ohne Gegenmaßnahmen erdulden muss. Durch eine optimale

Mehr

Faktenbox Medikamentöse Therapie bei Agoraphobie mit und ohne Panikstörung

Faktenbox Medikamentöse Therapie bei Agoraphobie mit und ohne Panikstörung Faktenbox Medikamentöse Therapie bei Agoraphobie mit und ohne Panikstörung Nutzen und Risiken im Überblick Jede medizinische Behandlung bringt Nutzen und Risiken mit sich. Diese Faktenbox kann Sie bei

Mehr

DIABETES: IM GRIFF. UND TROTZDEM ANTRIEBSLOS? SCHLAFLOS? LUSTLOS?

DIABETES: IM GRIFF. UND TROTZDEM ANTRIEBSLOS? SCHLAFLOS? LUSTLOS? DIABETES: IM GRIFF. UND TROTZDEM ANTRIEBSLOS? SCHLAFLOS? LUSTLOS? Ein Testosteronmangel könnte die Ursache sein. Machen Sie den Test! www.testosteron.de MÄNNERN MIT DIABETES * FEHLT OFT TESTOSTERON. Diabetiker

Mehr

Bösartige Neubildung des Retroperitoneums und des Peritoneums

Bösartige Neubildung des Retroperitoneums und des Peritoneums C17.- Bösartige Neubildung des Dünndarmes C17.0 Bösartige Neubildung: Duodenum C17.1 Bösartige Neubildung: Jejunum C17.2 Bösartige Neubildung: Ileum C17.3 Bösartige Neubildung: Meckel-Divertikel C17.8

Mehr

Hereditäre spastische Spinalparalysen (= HSP = familiäre spastische Spinalparalysen = FSP = spastische Spinalparalysen = SSP)

Hereditäre spastische Spinalparalysen (= HSP = familiäre spastische Spinalparalysen = FSP = spastische Spinalparalysen = SSP) Dr. Michaela Auer-Grumbach, Graz Institut für Medizinische Biologie und Humangenetik Graz, Harrachgasse 21/8, 8010 Graz; Tel: ++43-316-380-4111; E-Mail auer-grumbach@aon.at Hereditäre spastische Spinalparalysen

Mehr

ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie)

ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie) ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie) Als Erbkrankheit werden Erkrankungen und Besonderheiten bezeichnet, die entweder durch ein Gen (monogen)

Mehr

Autosomal-rezessiver Erbgang

Autosomal-rezessiver Erbgang 12 Autosomal-rezessiver Erbgang Bearbeitetes Informationsblatt herausgegeben vom Guy s and St. Thomas Hospital, London und dem London IDEAS Genetic Knowledge Park, entsprechend deren Qualitätsstandards.

Mehr

Wie ist die Datenlage zur Früherkennung des Prostatakarzinoms

Wie ist die Datenlage zur Früherkennung des Prostatakarzinoms Wie ist die Datenlage zur Früherkennung des Prostatakarzinoms mittels PSA-Test? Marcel Zwahlen Institut für Sozial- und Präventivmedizin, Universität Bern zwahlen@ispm.unibe.ch Beurteilungskriterien für

Mehr

Jahrgangsstufe 9. Inhaltsfeld Individualentwicklung des Menschen. Unterrichtsverlauf Inhalte Fortpflanzung, Entwicklung und Geburt (s.

Jahrgangsstufe 9. Inhaltsfeld Individualentwicklung des Menschen. Unterrichtsverlauf Inhalte Fortpflanzung, Entwicklung und Geburt (s. Jahrgangsstufe 9 Inhaltsfeld Individualentwicklung des Menschen Fortpflanzung, Entwicklung und Geburt (s. Sexualkunde) Grundlagen gesundheitsbewusster Ernährung Bau und Funktion der Niere Bedeutung der

Mehr

Finasterid-ratiopharm 5 mg-filmtabletten 2. Qualitative und quantitative Zusammensetzung Sonstiger Bestandteil mit bekannter Wirkung:

Finasterid-ratiopharm 5 mg-filmtabletten 2. Qualitative und quantitative Zusammensetzung Sonstiger Bestandteil mit bekannter Wirkung: Finasterid-ratiopharm 5 mg-filmtabletten 2. Qualitative und quantitative Zusammensetzung 1 Filmtablette enthält 5 mg Finasterid. Sonstiger Bestandteil mit bekannter Wirkung: 108 mg Lactose-Monohydrat.

Mehr

In unseren Beispielen bilden Valeria und Arnold ein theoretisches Paar - und geben wir zu, ein Paar das viel Pech im Leben hat das selber und auch

In unseren Beispielen bilden Valeria und Arnold ein theoretisches Paar - und geben wir zu, ein Paar das viel Pech im Leben hat das selber und auch Praktikum In unseren Beispielen bilden Valeria und Arnold ein theoretisches Paar - und geben wir zu, ein Paar das viel Pech im Leben hat das selber und auch Ihre Familien unter zahlreichen genetischen

Mehr

Steroidlabor des Pharmakologischen Institutes Normalbereiche

Steroidlabor des Pharmakologischen Institutes Normalbereiche Glucocorticoide im Plasma Cortisol (F) 5,6-20 µg/100ml Morgenwert

Mehr

Watchful waiting- Strategie

Watchful waiting- Strategie Watchful waiting- Strategie Individualisierte Behandlung beim lokalisierten Prostatakarzinom- Welche Kriterien erlauben den Entscheid für eine watch und wait Strategie? Dr. Rudolf Morant, ärztlicher Leiter

Mehr

Effektgrößen. Evidenz-basierte Medizin und Biostatistik, Prof. Andrea Berghold

Effektgrößen. Evidenz-basierte Medizin und Biostatistik, Prof. Andrea Berghold Effektgrößen 2x2Tafel Therapie Medikament 1 Medikament 2 Summe Misserfolg 450 = a 300 = c 750 = (a+c) Endpunkt Erfolg 550 = b 700 = d 1250 = (b+d) Vergleich von 2 Therapien; Endpunkt binär Summe 1000 =

Mehr

Therapie der Demenz Was bringt die Zukunft?

Therapie der Demenz Was bringt die Zukunft? Therapie der Demenz Was bringt die Zukunft? G. Lueg Klinik für Allgemeine Neurologie Department für Neurologie Westfälische Wilhelms-Universität Münster Die Amyloidhypothese BACE1 ( beta-site APP cleaving

Mehr