1 von :09

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "1 von :09"

Transkript

1 1 von :09

2 2 von :09 Klinische Studien CAI Prüfplancode ISRCTN EudraCT Clinicaltrials.gov DRKS CAI n/a NCT Therapie von Patienten mit rezidivierter akuter myeloischer Leukämie mit Cladribin, hochdosiertem Cytarabin und Idarubicin Studienziel / Fragestellung Primäres Prüfziel Status: Aktiv 1. Ermittlung der Verträglichkeit des geprüften Therapieprotokolles durch Erfassung der Toxizität nach NCI/CTC, insbesondere der Rate schwerwiegender Infektionen und der Frühtodesfälle 2. Ermittlung der Wirksamkeit des geprüften Therapieprotokolles durch Bestimmung der Remissionsrate Sekundäre Prüfziele 1. Ermittlung der Remissionsdauer (abhängig von der Postremissionstherapie) 2. Ermittlung des Gesamtüberlebens der Patienten 3. Ermittlung des Einflusses zytogenetischer Aberrationen (insbesondere komplexer Aberrationen [ 3]) auf Remissionsrate, Remissionsdauer und Gesamtüberleben 4. Verlauf der CD3/CD4+-Subpopulation der Lymphozyten nach der Therapie Diagnose

3 3 von :09 Akute Leukämien: Akute myeloische Leukämien (AML) Akute myeloische Leukämie im ersten oder höheren Rezidiv nach erfolgreicher Induktionstherapie und einer Remissionsdauer nach Erstmanifestation von mindestens sechs Monaten. Die Dauer der letzten Remission nach einem ersten oder höheren Rezidiv muss mindestens drei Monate betragen CIO Köln Zum Seitenanfang Bonn - Alle Rechte vorbehalten - Impressum - Datenschutzerklärung - Sitemap Patientenmerkmale Stadium Rezidiv Alter 18-0 Einschlusskriterien 1. Akute myeloische Leukämie im ersten oder höheren Rezidiv nach erfolgreicher Induktionstherapie und einer Remissionsdauer nach Erstmanifestation von mindestens sechs Monaten. Die Dauer der letzten Remission nach einem ersten oder höheren Rezidiv muss mindestens drei Monate betragen. 2. Alter mindestens 18 Jahre 3. Lebenserwartung (ohne Berücksichtigung der AML oder ihrer Komplikationen) mindestens drei Monate 4. ECOG-Status (ohne Berücksichtigung der AML oder ihrer Komplikationen) Schriftliches Einverständnis Ausschlusskriterien 1. Jede Vorbehandlung der akuten myeloischen Leukämie mit Cladribin 2. Jede lebensbedrohliche, unkontrollierte Infektion unmittelbar vor Therapiebeginn, der Studieneinschluss ist jedoch nach Kontrolle der Infektion möglich 3. Schwerwiegende Herzinsuffizienz Grad III oder IV nach NYHA (ein alleiniger pathologischer Befund der Myokardfunktion ist nicht ausreichend als Ausschlusskriterium) 4. Schwerwiegende Niereninsuffizienz mit einer Kreatinin-Clearance (gemessen oder errechnet nach Levey et al.) kleiner als 30 ml/min, falls nicht durch die Leukämie bedingt. Gegebenenfalls sollte vor Therapiebeginn zunächst die Nierenfunktion verbessert werden, falls dies möglich erscheint. 5. Schwerwiegende Leberinsuffizienz mit einem Bilirubin über 3 mg/dl oder einer

4 4 von :09 GOT über 200 U/l, falls diese nicht durch die akute myeloische Leukämie bedingt ist. 6. Schwerwiegende andere Organschädigung Grad III bis IV nach WHO, falls diese nicht durch die akute myeloische Leukämie bedingt ist oder nach Entscheidung des behandelnden Arztes die Therapie schwerwiegend beeinträchtigen würde. 7. HIV-Infektion jeden Stadiums 8. Spezielle Ausschlusskriterien für Studienmedikation incl. Unverträglichkeit 9. Schwangerschaft, Stillzeit 10. Patienten mit einer weiteren aktiven malignen Erkrankung, die den Verlauf der AML voraussichtlich beeinträchtigen wird Studiendesign Phase II, Monozentrisch, Prospektiv, Einarmig Intervention Cladribin, d1-3 Cytarabin, d1-3 Idarubicin, d1-3 Zuständigkeiten Gesamtstudie Sponsor Universitätsklinikum Bonn Tel Fax Leiter der klinischen Prüfung Prüfzentren Studienzentrale Hämatologie / Onkologie (Med. Klinik III) UKB Tel Fax

5 5 von :09 Leitender Prüfarzt im Zentrum (Hauptprüfer) Subinvestigator Dr. Karin Mayer Ansprechpartner Dr. Corinna Hahn-Ast

Chronisch myeloproliferative Syndrome - CML-V TIGER

Chronisch myeloproliferative Syndrome - CML-V TIGER Innere Medizin I - Onkologie, Hämatologie, Klinische Infektiologie, Klinische Immunologie, Hämostaseologie, Internistische Intensivmedizin Chronisch myeloproliferative Syndrome - CML-V TIGER Prüfplancode

Mehr

Chronische lymphatische Leukämien - CLL2-BCG

Chronische lymphatische Leukämien - CLL2-BCG Innere Medizin I - Onkologie, Hämatologie, Klinische Infektiologie, Klinische Immunologie, Hämostaseologie, Internistische Intensivmedizin Chronische lymphatische Leukämien - CLL2-BCG Prüfplancode ISRCTN

Mehr

Kinderneurologie - STIM-CP

Kinderneurologie - STIM-CP Kinderneurologie - STIM-CP Prüfplancode ISRCTN EudraCT Clinicaltrials.gov DRKS 1603 NCT02097693 Effekt der Tiefen Hirnstimulation im Globus Pallidus internus auf die Lebensqualität von jungen Patienten

Mehr

Therapie von Patienten über 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Chlorambucil

Therapie von Patienten über 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Chlorambucil CLL5-Protokoll der deutschen CLL-Studiengruppe 15 Therapie von Patienten über 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Chlorambucil - CLL5-Protokoll der

Mehr

Therapie von Patienten bis 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Fludarabin/Cyclophosphamid

Therapie von Patienten bis 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Fludarabin/Cyclophosphamid 10 CLL4-Protokoll der deutschen CLL-Studiengruppe Therapie von Patienten bis 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Fludarabin/Cyclophosphamid - CLL4-Protokoll

Mehr

AMLSG Amendment Nr. 3 vom zur Version der Protokollanhänge vom

AMLSG Amendment Nr. 3 vom zur Version der Protokollanhänge vom Studie: Randomisierte Phase II-Studie zu All-trans-Retinsäure bei der Induktions- und Konsolidierungstherapie sowie Pegfilgrastim in der Konsolidierungstherapie bei jüngeren Patienten mit neu diagnostizierter

Mehr

Charitè, Campus Benjamin Franklin Medizinische Klinik III Hämatologie, Onkologie und Transfusionsmedizin Direktor Prof. Dr. E.Thiel Berlin Bonn, 04/05

Charitè, Campus Benjamin Franklin Medizinische Klinik III Hämatologie, Onkologie und Transfusionsmedizin Direktor Prof. Dr. E.Thiel Berlin Bonn, 04/05 VERGLEICHENDE PROSPEKTIVE STUDIE FÜR DIE PRIMÄRE UND SEKUNDÄRE PROPHYLAXE VON MYKOTISCHEN INFEKTIONEN BEI PATIENTEN MIT LANGER NEUTROPENIEDAUER MIT TOPISCHEN ANTIMYKOTIKA IM VERGLEICH MIT SYSTEMISCHER

Mehr

Charitè, Campus Benjamin Franklin Medizinische Klinik III Hämatologie, Onkologie und Transfusionsmedizin Direktor Prof. Dr. E.

Charitè, Campus Benjamin Franklin Medizinische Klinik III Hämatologie, Onkologie und Transfusionsmedizin Direktor Prof. Dr. E. VERGLEICHENDE PROSPEKTIVE STUDIE FÜR DIE PROPHYLAXE VON INVASIVEN MYKOTISCHEN INFEKTIONEN BEI NEUTROPENISCHEN PATIENTEN MIT TOPISCHEN ANTIMYKOTIKA IM VERGLEICH ZU NIEDRIGDOSIERTEM, LIPOSOMALEM AMPHOTERICIN

Mehr

CLDK378X2103. JavaScript scheint in Ihrem Browser deaktiviert zu sein.

CLDK378X2103. JavaScript scheint in Ihrem Browser deaktiviert zu sein. JavaScript scheint in Ihrem Browser deaktiviert zu sein. Sie müssen JavaScript in Ihrem Browser aktivieren um alle Funktionen der Seite nutzen zu können. Notfall Uniklinik Köln Kontakt International https://www.uk-koeln.de/

Mehr

Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Hochschulschrift finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin

Mehr

22. Onkologisches Symposium Große Fortschritte in der Leukämietherapie

22. Onkologisches Symposium Große Fortschritte in der Leukämietherapie 22. Onkologisches Symposium - 21.01.2017 Große Fortschritte in der Leukämietherapie Prof. Dr. Wolfgang Herr Klinik und Poliklinik für Innere Medizin III - Hämatologie und intern. Onkologie Leukämien (Patienten

Mehr

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Ein Vortrag von Univ. Prof. Dr. Johannes Drach Medizinische Universität Wien Univ. Klinik für Innere Medizin I Klinische Abteilung

Mehr

Studienprotokoll Fax:

Studienprotokoll Fax: Studienprotokoll Kombinierte systemische und intrathekale Chemotherapie mit nachfolgender Hochdosischemotherapie und autologer Stammzelltransplantation bei ZNS-Rezidiven aggressiver Lymphome Version: (3.2)

Mehr

Kooperative multizentrische Studie für Kinder und Jugendliche mit einem Gliom niedrigen Malignitätsgrades

Kooperative multizentrische Studie für Kinder und Jugendliche mit einem Gliom niedrigen Malignitätsgrades 1 von 5 15.12.2010 14:38» Home» Fachinformationen» Studien-Portal» Studien und Register der GPOH» SIOP-LGG 2004 Autor: Dr. med. Astrid Gnekow, erstellt 13.08.2003, Zuletzt geändert: 16.08.2010 Titel Erkrankung,

Mehr

Aktuelle Aspekte der PARP-Inhibition: Wer profitiert, wer nicht?

Aktuelle Aspekte der PARP-Inhibition: Wer profitiert, wer nicht? Ovarialkarzinom State of the Art AGO-Symposium Aktuelle Aspekte der PARP-Inhibition: Wer profitiert, wer nicht? Pauline Wimberger Klinik und Poliklinik für Gynäkologie und Geburtshilfe Technische Universität

Mehr

ANAMNESEBOGEN (für Nicht-Studienpatienten im PRO, Rezidiv od. bei vorbehand. HL)

ANAMNESEBOGEN (für Nicht-Studienpatienten im PRO, Rezidiv od. bei vorbehand. HL) Dokumentationsbogen IV-AN (1/06) für Nicht-Studienpatienten weiblich männlich ANAMNESEBOGEN (für Nicht-Studienpatienten im PRO, Rezidiv od. bei vorbehand. HL) IV-AN Nur auszufüllen, sofern die Daten nicht

Mehr

Prüfplan. MCL Rezidiv-Studie des European MCL Network und der GLSG Protokoll Version 1.5

Prüfplan. MCL Rezidiv-Studie des European MCL Network und der GLSG Protokoll Version 1.5 Prüfplan MCL Rezidiv-Studie des und der GLSG Protokoll Version 1.5 Vollständiger Titel: Wirksamkeit und Sicherheit einer Kombinationstherapie mit Rituximab, hochdosiertem Ara-C und Dexamethason (R-HAD)

Mehr

Innere Medizin II - Nephrologie, Rheumatologie, Diabetologie und Allgemeine Innere Medizin

Innere Medizin II - Nephrologie, Rheumatologie, Diabetologie und Allgemeine Innere Medizin Innere Medizin II - Nephrologie, Rheumatologie, Diabetologie und Allgemeine Innere Medizin CL010_168 Prüfplancode ISRCTN EudraCT Clinicaltrials.gov DRKS CL010_168 Eine randomisierte, doppelblinde, placebo-kontrollierte

Mehr

Wirksamkeit und Sicherheit von Thalidomid in der primären Therapie des multiplen Myeloms

Wirksamkeit und Sicherheit von Thalidomid in der primären Therapie des multiplen Myeloms AMB 2006, 40, 89 Wirksamkeit und Sicherheit von Thalidomid in der primären Therapie des multiplen Myeloms Mit Thalidomid, Lenalidomid und Bortezomib (Velcade ) stehen inzwischen neue Wirkstoffe für die

Mehr

HD6 Studie der GMMG-Studiengruppe (German-Speaking Myeloma Multicenter Group) in Heidelberg rekrutiert seit Juni 2015

HD6 Studie der GMMG-Studiengruppe (German-Speaking Myeloma Multicenter Group) in Heidelberg rekrutiert seit Juni 2015 HD6 Studie der GMMG-Studiengruppe (German-Speaking Myeloma Multicenter Group) in Heidelberg rekrutiert seit Juni 2015 - ein Beitrag von Dr. Annemarie Angerer, Dr. Uta Bertsch, Dr. Jana Schlenzka, Dr. Barbara

Mehr

Originalarbeit: James et al., N Engl J Med 2012; 366:

Originalarbeit: James et al., N Engl J Med 2012; 366: Originalarbeit: James et al., N Engl J Med 2012; 366: 1477-1488 Kommentar zur Originalarbeit: Shipley & Zietman N Engl J Med 2012; 366: 1540-41 Meilenstein BC2001-Studie: Design randomisierte Studie mit

Mehr

HECTOR (Hycamtin plus Carboplatin versus Established Regimens for the Treatment of Ovarian Cancer Relapse) EudraCT Number: 2006-004628-34

HECTOR (Hycamtin plus Carboplatin versus Established Regimens for the Treatment of Ovarian Cancer Relapse) EudraCT Number: 2006-004628-34 Topotecan plus Carboplatin im Vergleich zur Standardtherapie (Paclitaxel plus Carboplatin oder Gemcitabin plus Carboplatin) in der Therapie von Patientinnen mit Platin-sensitivem rezidivierten epithelialen

Mehr

PROTOKOLL SYNOPSE Version 3.1 (Protokollversion 3.1 Amendment 1):

PROTOKOLL SYNOPSE Version 3.1 (Protokollversion 3.1 Amendment 1): T-PLL2-Protokoll der Deutschen CLL Studiengruppe (DCLLSG) Phase II Trial of Combined Immunochemotherapy with Fludarabine, Mitoxantrone, Cyclophosphamide and Alemtuzumab (FMC-Alemtuzumab) in Patients with

Mehr

Version: V1.0 basierend auf Amendment 1 vom 15. Juli 2016

Version: V1.0 basierend auf Amendment 1 vom 15. Juli 2016 Pertuzumab in First Line Treatment of HER2-positive metastatic breast Cancer patients: A cohort study of patients treated either with docetaxel and Trastuzumab or docetaxel, trastuzumab and, NCT02642458

Mehr

KURZFASSUNG DES PRÜFPROTOKOLLS 1839IL/0079 VOM

KURZFASSUNG DES PRÜFPROTOKOLLS 1839IL/0079 VOM KURZFASSUNG DES PRÜFPROTOKOLLS 1839IL/0079 VOM 11.11.02 RANDOMISIERTE, OFFENE, NICHT-KOMPARATIVE PHASE II STUDIE ZUR BEURTEILUNG DER WIRKSAMKEIT UND VERTRÄGLICHKEIT VON ZWEI DOSIERUNGEN ZD1839 BEI PATIENTEN

Mehr

Indolente Non Hodgkin- Lymphome (NHL) Leitlinie

Indolente Non Hodgkin- Lymphome (NHL) Leitlinie Indolente Non Hodgkin- Lymphome (NHL) Leitlinie Empfehlungen der Fachgesellschaft zur Diagnostik und Therapie hämatologischer und onkologischer Erkrankungen Herausgeber DGHO Deutsche Gesellschaft für Hämatologie

Mehr

Hämatologische Erkrankungen - Neue Behandlungsmöglichkeiten bei CLL / CML

Hämatologische Erkrankungen - Neue Behandlungsmöglichkeiten bei CLL / CML Hämatologische Erkrankungen - Neue Behandlungsmöglichkeiten bei CLL / CML Von Priv.-Doz. Dr. R. Liersch Gemeinschaftspraxis für Hämatologie und Onkologie, Münster Innere Medizin III (Hämatologie/Onkologie)Clemenshospital

Mehr

Kurzprotokoll. GMMG-HD4 / HOVON-65 Studie

Kurzprotokoll. GMMG-HD4 / HOVON-65 Studie Kurzprotokoll GMMG-HD4 / HOVON-65 Studie 2.1 Titel Hochdosistherapie und autologe Stammzelltransplantation gefolgt von einer Thalidomid-Erhaltungstherapie vs. Bortezomib plus Hochdosistherapie und autologe

Mehr

Ein einfacher Prognoseindex zur Vorhersage von ZVK- Infektionen bei Patienten mit hämatologischen Malignomen (CIPS-H)

Ein einfacher Prognoseindex zur Vorhersage von ZVK- Infektionen bei Patienten mit hämatologischen Malignomen (CIPS-H) Ein einfacher Prognoseindex zur Vorhersage von ZVK- Infektionen bei Patienten mit hämatologischen Malignomen (CIPS-H) Enrico Schalk 1, Jacqueline Färber 2, Dirk Schlüter 2, Daniela Tölle 3, Fabian Prax

Mehr

Antrag bei der Krankenkasse Zur Übernahme der Behandlungskosten - Off Label Therapie bei Uveitis - Patient:, geb. Datum:

Antrag bei der Krankenkasse Zur Übernahme der Behandlungskosten - Off Label Therapie bei Uveitis - Patient:, geb. Datum: Antrag bei der Krankenkasse Zur Übernahme der Behandlungskosten - Off Label Therapie bei Uveitis - Patient:, geb. Datum: Augen-Diagnosen (bitte alle auflisten): Uveitis bekannt seit: Symptome durch die

Mehr

1.4. Protokoll-Synopse

1.4. Protokoll-Synopse EudraCT-Nr.: 2005-005473-29 Protokoll Version 2.4 vom 20.7.2009 Seite - 13-1.4. Protokoll-Synopse Protokoll-Nr.: OSHO # 70 (FL-OSHO/GLSG-M3-2005-01) Protokoll-Version und Datum.: 2.4 vom 20.07.2009 Titel

Mehr

Vitamin-K- Antagonisten NOAK VKA. Neue orale Antikoagulanzien. Informationen für Ärzte: Umstellung von NOAK auf VKA

Vitamin-K- Antagonisten NOAK VKA. Neue orale Antikoagulanzien. Informationen für Ärzte: Umstellung von NOAK auf VKA Vitamin-K- Antagonisten NOAK VKA vs Neue orale Antikoagulanzien Informationen für Ärzte: Umstellung von NOAK auf VKA Better Care. Better Life. Better Care. Better Life. Alere. Alere. Alere INRatio 2: Das

Mehr

Therapie der älteren Patientin

Therapie der älteren Patientin Therapie der älteren Patientin P. Wimberger, F. Hilpert Universitätsklinikum Essen Universitätsklinikum Kiel Ovarialkarzinom - State of the Art AGO-Symposium München 20.Juni 2009 Lebenserwartung von Frauen

Mehr

Bakterielle Infektionen und Pneumocystis jirovecii Pneumonie - Prophylaxe

Bakterielle Infektionen und Pneumocystis jirovecii Pneumonie - Prophylaxe Bakterielle Infektionen und Pneumocystis jirovecii Pneumonie - Prophylaxe Leitlinie Empfehlungen der Fachgesellschaft zur Diagnostik und Therapie hämatologischer und onkologischer Erkrankungen Herausgeber

Mehr

Studienmeeting der AG Ovarialkarzinom Berlin, Predictor-study

Studienmeeting der AG Ovarialkarzinom Berlin, Predictor-study Studienmeeting der AG Ovarialkarzinom Berlin, 19.03.2009 Predictor-study Diagnostische Genauigkeit von In-vitro-Diagnostika für die Vorhersage eines Therapieansprechens bei Patientinnen mit Ovarialkarzinom-Rezidiv

Mehr

Erhaltungstherapie mit Erlotinib verlängert Gesamtüberleben bei fortgeschrittenem NSCLC

Erhaltungstherapie mit Erlotinib verlängert Gesamtüberleben bei fortgeschrittenem NSCLC SATURN-Studie: Erhaltungstherapie mit Erlotinib verlängert Gesamtüberleben bei fortgeschrittenem NSCLC Grenzach-Wyhlen (13. August 2009) - Aktuelle Daten der SATURN-Studie bestätigen eine signifikante

Mehr

Labor für Leukämiediagnostik Medizinische Klinik und Poliklinik III Ludwig-Maximilians-Universität München.

Labor für Leukämiediagnostik Medizinische Klinik und Poliklinik III Ludwig-Maximilians-Universität München. Einfluss genetischer Alterationen auf die Therapieergebnisse bei 75- jährigen, intensiv behandelten AML-Patienten Subgruppenanalyse der AMLCG-1999-Studie Victoria Prassek, Maja Rothenberg-Thurley, Maria

Mehr

Zusammenfassung des Studienprotokolls

Zusammenfassung des Studienprotokolls Zusammenfassung des Studienprotokolls Titel des Gesuchs: Protokoll-No.: HOVON 103 / SAKK 30/10 Gesuchsteller: Weitere Mitarbeiter/Innen: Eine randomisierte Phase II Multizenter Studie zur Evaluation der

Mehr

Indolente Non Hodgkin- Lymphome (NHL) Leitlinie

Indolente Non Hodgkin- Lymphome (NHL) Leitlinie Indolente Non Hodgkin- Lymphome (NHL) Leitlinie Empfehlungen der Fachgesellschaft zur Diagnostik und Therapie hämatologischer und onkologischer Erkrankungen Herausgeber DGHO Deutsche Gesellschaft für Hämatologie

Mehr

Chronisch-Lymphatische Leukämie (CLL) Indolente Lymphome

Chronisch-Lymphatische Leukämie (CLL) Indolente Lymphome Höhepunkte des Amerikanischen Hämatologie-Kongresses San Diego, 2016 Chronisch-Lymphatische Leukämie (CLL) Indolente Lymphome PD Dr. Dr. M. R. Müller Medizinische Klinik Abt. Onkologie/Hämatologie Überblick

Mehr

AGO-OVAR 19 / TRUST. (platinfreies Intervall 6-12 Monate) Intermediär-platinsensibles Rezidiv. Erstdiagnose FIGO IIIB-IV

AGO-OVAR 19 / TRUST. (platinfreies Intervall 6-12 Monate) Intermediär-platinsensibles Rezidiv. Erstdiagnose FIGO IIIB-IV Ovarialkarzinom Aktuelle Studien in der Klinik für Gynäkologie des UKE Kontakt Studiensekretariat: Sylke Krenkel (040/7410-57970, skrenkel@uke.de) Stand juni 2017 Intermediär-platinsensibles Rezidiv (platinfreies

Mehr

Stammzelltransplantation: Vorhersage von Komplikationen mittels neuer Technologien

Stammzelltransplantation: Vorhersage von Komplikationen mittels neuer Technologien Stammzelltransplantation: Vorhersage von Komplikationen mittels neuer Technologien Abteilung Hämatologie, Hämostaseologie und Onkologie Prof. Dr. med. Arnold Ganser Prof. Dr. med. univ. Eva M. Weissinger

Mehr

MICORYX Weitere Informationen

MICORYX Weitere Informationen MICORYX Weitere Informationen Im Rahmen der Micoryx-Studie wird eine neue Therapie getestet, die sich noch in der Erprobungsphase befindet. Es handelt sich dabei um eine Impfung gegen den Tumor mit Hilfe

Mehr

Bakterielle Infektionen und Pneumocystis jirovecii Pneumonie - Prophylaxe Leitlinie

Bakterielle Infektionen und Pneumocystis jirovecii Pneumonie - Prophylaxe Leitlinie Bakterielle Infektionen und Pneumocystis jirovecii Pneumonie - Prophylaxe Leitlinie Empfehlungen der Fachgesellschaft zur Diagnostik und Therapie hämatologischer und onkologischer Erkrankungen Herausgeber

Mehr

Thrombozytopenie: Wann transfundieren?

Thrombozytopenie: Wann transfundieren? Thrombozytopenie: Wann transfundieren? Heiko Rühl Institut für Experimentelle Hämatologie und Transfusionsmedizin Universitätsklinikum Bonn IAKH Jahreskongress 2013 Thrombozytopenie: Wann transfundieren?

Mehr

Organbegrenztes Prostatakarzinom

Organbegrenztes Prostatakarzinom Organbegrenztes Prostatakarzinom Michael Stöckle Klinik für Urologie und Kinderurologie Universitätsklinikum des Saarlandes, Homburg/Saar Seite Ausgangssituation Prostata-Ca ist häufigh 3% aller Männer

Mehr

Studienzentrum der Deutschen Gesellschaft für f. SYNCHRONOUS Trial

Studienzentrum der Deutschen Gesellschaft für f. SYNCHRONOUS Trial Studienzentrum der Deutschen Gesellschaft für f Chirurgie SYNCHRONOUS Trial Resection of the primary tumor vs. no resection prior to systemic therapy in patients with colon cancer and synchronous unresectable

Mehr

Das Mammakarzinom des Mannes. Holm Eggemann. Universitätsfrauenklinik. tsfrauenklinik Direktor: Prof. Dr. Dr. S.-D. Costa.R.

Das Mammakarzinom des Mannes. Holm Eggemann. Universitätsfrauenklinik. tsfrauenklinik Direktor: Prof. Dr. Dr. S.-D. Costa.R. Das Mammakarzinom des Mannes Holm Eggemann Universitätsfrauenklinik tsfrauenklinik Direktor: Prof. Dr. Dr. S.-D. Costa Universitätsklinikum tsklinikum Magdeburg A.ö.R..R. Mammakarzinom des Mannes Inzidenz

Mehr

» Home» Fachinformationen» Studien- Portal» Studien und Register der GPOH» CWS- 2007- HR

» Home» Fachinformationen» Studien- Portal» Studien und Register der GPOH» CWS- 2007- HR Page 1 of 5» Home» Fachinformationen» Studien- Portal» Studien und Register der GPOH» CWS- 2007- HR CWS- 2007- HR Autor: CWS, erstellt am: 26.03.2010, Zuletzt geändert: 23.08.2010 Titel Erkrankung Art

Mehr

Abschlussbericht (Zusammenfassung) Final / Datum:

Abschlussbericht (Zusammenfassung) Final / Datum: Zusammenfassung des Abschlussberichts Studientitel: Intravenöse Gabe von Eisen-Carboxymaltose (Ferinject ) zur präoperativen Therapie der Eisenmangel-Anämie bei Patienten vor orthopädischen Eingriffen

Mehr

Studienleitung: ClinicalTrials.gov Identifier: NCT Version 2.0 vom

Studienleitung: ClinicalTrials.gov Identifier: NCT Version 2.0 vom Prospektive multizentrische Beobachtungsstudie zur therapeutischen Thrombozytentransfusion bei Patienten mit akuter myeloischer Leukämie in der Postremissionstherapie Studienleitung: ClinicalTrials.gov

Mehr

Efficacy and safety of recombinant human activated protein C for severe sepsis Bernard, G.et al. N Engl J Med 2001; 344:

Efficacy and safety of recombinant human activated protein C for severe sepsis Bernard, G.et al. N Engl J Med 2001; 344: RCT: Efficacy and safety of recombinant human activated protein C for severe sepsis Bernard, G.et al. Eignung der Studie für critical appraisal im Rahmen eines EbM Kurses: - typisches Beispiel für Arzneimittelstudie

Mehr

Klinische Chemie und Hämatologie Vorlesung: Allgemeine & Spezielle Hämatologie

Klinische Chemie und Hämatologie Vorlesung: Allgemeine & Spezielle Hämatologie Klinische Chemie und Hämatologie Vorlesung: Allgemeine & Spezielle Hämatologie Prof. Dr. med. Th. Büchner Medizinische Klinik und Poliklinik - Innere Medizin A - Universitätsklinikum Münster Albert-Schweitzer-Straße

Mehr

Chronisch entzündlicher Darmerkrankungen Klinische Daten aus der Phytoforschung

Chronisch entzündlicher Darmerkrankungen Klinische Daten aus der Phytoforschung 19. Oktober 2011 Chronisch entzündlicher Darmerkrankungen Klinische Daten aus der Phytoforschung Prof. Dr. med. Jost Langhorst Universität Duisburg-Essen Hintergrund Fragestellung Patienten und Methoden

Mehr

Praktische Erfahrungen eines Prüfers bei der Durchführung klinischer Studien Herausforderung und Chancen

Praktische Erfahrungen eines Prüfers bei der Durchführung klinischer Studien Herausforderung und Chancen Praktische Erfahrungen eines Prüfers bei der Durchführung klinischer Studien Herausforderung und Chancen Prof. Dr. J. Bogner Klinikum der Universität München, Campus Innenstadt Pettenkoferstr. 8a 80336

Mehr

Moderne und zielgerichtete Therapie der akuten Leukämie

Moderne und zielgerichtete Therapie der akuten Leukämie Universitätsklinikum Regensburg Moderne und zielgerichtete Therapie der akuten Leukämie Wolfgang Herr Innere Medizin III (Hämatologie u. internistische Onkologie) Klinik und Poliklinik für Innere Medizin

Mehr

Therapiemöglichkeiten von Leukämien Herausforderungen und Chancen aus der Sicht der Klinik

Therapiemöglichkeiten von Leukämien Herausforderungen und Chancen aus der Sicht der Klinik Therapiemöglichkeiten von Leukämien Herausforderungen und Chancen aus der Sicht der Klinik Dr.Nicola Gökbuget Leiterin der Studienzentrale und Koordinatorin der GMALL-Studiengruppe Medizinische Klinik

Mehr

Vom unklaren Symptomkomplex zur ganzheitlichen Diagnose

Vom unklaren Symptomkomplex zur ganzheitlichen Diagnose Morbus Fabry - Niereninsuffizienz Kardiomyopathie Neurologische Störungen - Vom unklaren Sympto Morbus Fabry Niereninsuffizienz Kardiomyopathie Neurologische Störungen Vom unklaren Symptomkomplex zur ganzheitlichen

Mehr

Leukämie (CML) Was ist Chronische Myeloische Leukämie? Download. Published on Novartis Austria (https://www.novartis.at)

Leukämie (CML) Was ist Chronische Myeloische Leukämie? Download. Published on Novartis Austria (https://www.novartis.at) Published on Novartis Austria (https://www.novartis.at) Home > Printer-friendly PDF > Leukämie (CML) Leukämie (CML) Was ist Chronische Myeloische Leukämie? Die chronische myeloische Leukämie (CML) ist

Mehr

Als Krebspatient an einer Studie teilnehmen was sollte man wissen?

Als Krebspatient an einer Studie teilnehmen was sollte man wissen? Als Krebspatient an einer Studie teilnehmen was sollte man wissen? Krebsinformationsdienst, Heidelberg Dr. Susanne Weg-Remers Seite 2 Grundlage für evidenzbasiertes medizinisches Wissen sind klinische

Mehr

Studien der AML-CG. Hämatologie im Wandel März 2013 Michael Fiegl Medizinische Klinik III, KUM CAMPUS GROSSHADERN

Studien der AML-CG. Hämatologie im Wandel März 2013 Michael Fiegl Medizinische Klinik III, KUM CAMPUS GROSSHADERN CAMPUS GROSSHADERN Prof. Dr. W. Hiddemann Studien der AML-CG Hämatologie im Wandel 1. 2. März 2013 Michael Fiegl Medizinische Klinik III, KUM AML-CG Deutsche Kooperative AML Studiengruppe e.v. (AML-CG)

Mehr

Einfluss einer Niereninsuffizienz auf die Korrelation von NTproBNP mit dem Schweregrad der Herzinsuffizienz

Einfluss einer Niereninsuffizienz auf die Korrelation von NTproBNP mit dem Schweregrad der Herzinsuffizienz Einfluss einer Niereninsuffizienz auf die Korrelation von NTproBNP mit dem Schweregrad der Herzinsuffizienz Dr. Andreas Rieth, et al, Bad Nauheim Hintergrund: Der Biomarker NTproBNP ist für die Diagnostik

Mehr

(Imatinib) aufweisen. Durch die Zulassung von Tasigna können wir mehr Patienten mit CML helfen. Mit Glivec als Primärtherapie

(Imatinib) aufweisen. Durch die Zulassung von Tasigna können wir mehr Patienten mit CML helfen. Mit Glivec als Primärtherapie Tasigna (Nilotinib) erhält in der Europäischen Union die Zulassung für die Zweitlinientherapie von CML-Patienten Frankfurt am Main (17. Dezember 2007) - Tasigna führte zu einem guten zytogenetischen Ansprechen

Mehr

O f f e n e S t u d i e n - August 2013 -

O f f e n e S t u d i e n - August 2013 - Sehr geehrte Patientinnen und Angehörige, sehr geehrte Ärztinnen und Ärzte, Klinische Studien zur Behandlung des Ovarial-, Tuben-, Endometrium- und Peritonealkarzinoms: bevor antihormonelle, chemotherapeutische

Mehr

Eine Zusammenfassung des Studienprotokolls

Eine Zusammenfassung des Studienprotokolls Eine Zusammenfassung des Studienprotokolls Datum: Dienstag, 27. September 2011 Studiennummer: FumadermAA01 EudraCT-Nr.: 2011-000659-18 Leiter der klinischen Prüfung: Professor Dr. Martin Röcken Universitäts-Hautklinik,

Mehr

ALLHAT. The Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial JAMA 2002, 288, Prof. Dr. med.

ALLHAT. The Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial JAMA 2002, 288, Prof. Dr. med. ALLHAT The Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial JAMA 2002, 288, 2981-96 Hintergrund ALLHAT Studienziel Vergleich dreier Antihypertensiva-Klassen (Chlortalidon, Amlodipin,

Mehr

Studien der AML-CG. Hämatologie im Wandel März 2013 Michael Fiegl Medizinische Klinik III, KUM CAMPUS GROSSHADERN

Studien der AML-CG. Hämatologie im Wandel März 2013 Michael Fiegl Medizinische Klinik III, KUM CAMPUS GROSSHADERN CAMPUS GROSSHADERN Prof. Dr. W. Hiddemann Studien der AML-CG Hämatologie im Wandel 1. 2. März 2013 Michael Fiegl Medizinische Klinik III, KUM AML-CG Deutsche Kooperative AML Studiengruppe e.v. (AML-CG)

Mehr

Einfluss der Lymphombehandlung auf das Blut. Michael Gregor Abteilung für Hämatologie Kantonsspital Luzern

Einfluss der Lymphombehandlung auf das Blut. Michael Gregor Abteilung für Hämatologie Kantonsspital Luzern Einfluss der Lymphombehandlung auf das Blut Michael Gregor Abteilung für Hämatologie Kantonsspital Luzern Zusammensetzung des Blutes Blutgefäss Erythrozyten Blutkörperchen (Zellen) Blutflüssigkeit (Plasma)

Mehr

Brustkrebs: Adjuvante Therapie mit Herceptin

Brustkrebs: Adjuvante Therapie mit Herceptin Trastuzumab after adjuvant Chemotherapy in HER2-positive Breast Cancer Piccart-Gebhart et al: New England Journal of Medicine 353 : 1659 72, October 20, 2005. HERA 2-year follow-up of trastuzumab after

Mehr

Leukozyten 300/ul Hb 8,7 g/dl Thrombozyten 3.000 /ul Überweisung an MZA-Aufnahme

Leukozyten 300/ul Hb 8,7 g/dl Thrombozyten 3.000 /ul Überweisung an MZA-Aufnahme 60 jährige Patientin ohne maligne Vorerkrankungen (Hysterektomie, AE, TE, Tibiakopffraktur) Seit 3 Wochen Abgeschlagenheit seit 1 Woche Thoraxschmerzen, Husten, Fieber seit 1 Woche Ausschlag "geschwollenes

Mehr

Aktuelle Aspekte zur Diagnostik und Therapie mit mibg bei Neuroblastom

Aktuelle Aspekte zur Diagnostik und Therapie mit mibg bei Neuroblastom Aktuelle Aspekte zur Diagnostik und Therapie mit mibg bei Neuroblastom Priv.-Doz. Dr. med. Matthias Schmidt Klinik und Poliklinik für Nuklearmedizin und Priv.-Doz. Dr. med. Thorsten Simon Kinderonkologie

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

WAS BRINGEN KLINISCHE STUDIEN FÜR PATIENTEN

WAS BRINGEN KLINISCHE STUDIEN FÜR PATIENTEN CAMPUS INNENSTADT KOMM. DIREKTOR: PROF. DR: C. DANNEKER STELLV. DIREKTOR: PD DR. T. WEISSENBACHER WAS BRINGEN KLINISCHE STUDIEN FÜR PATIENTEN Informationsnachmittag- Leben mit Brustkrebs Was gibt es Neues?

Mehr

Thrombosemanagement mit NMH Wichtiges worauf Sie achten sollten

Thrombosemanagement mit NMH Wichtiges worauf Sie achten sollten Thrombosemanagement mit NMH Wichtiges worauf Sie achten sollten Thrombosemanagement mit niedermolekularem Heparin (NMH) bei Niereninsuffizienz: Worauf Sie unbedingt achten sollten. Beantworten Sie die

Mehr

als Beispiel für die Vernetzung von Partnern aus Klinik und Forschung

als Beispiel für die Vernetzung von Partnern aus Klinik und Forschung Das als Beispiel für die Vernetzung von Partnern aus Klinik und Forschung U. Creutzig, I. Krämer, J. Hannemann, G. Henze, R. Herold, M. Zimmermann Koordinationszentrale Berlin/Hannover Krebs bei Kindern

Mehr

Velcade (Bortezomib) auch in der Therapie niereninsuffizienter Myelompatienten effektiv und verträglich

Velcade (Bortezomib) auch in der Therapie niereninsuffizienter Myelompatienten effektiv und verträglich Aktuelle Pressemitteilung Velcade (Bortezomib) auch in der Therapie niereninsuffizienter Myelompatienten effektiv und verträglich (Neuss, 4. Dezember 2007) Neueste beim Internationalen Myelomworkshop auf

Mehr

Klinische Chemie und Laboratoriumsdiagnostik Vorlesung: Allgemeine Hämatologie

Klinische Chemie und Laboratoriumsdiagnostik Vorlesung: Allgemeine Hämatologie Klinische Chemie und Laboratoriumsdiagnostik Vorlesung: Allgemeine Hämatologie Priv.-Doz. Dr. med. Torsten Kessler Universitätsklinikum Münster Medizinische Klinik A Albert-Schweitzer-Campus 1 48149 Münster

Mehr

Versorgungsforschungsstudie zur peripheren arteriellen Verschlusskrankheit (PAVK)- Baseline Ergebnisse zur Diagnostik

Versorgungsforschungsstudie zur peripheren arteriellen Verschlusskrankheit (PAVK)- Baseline Ergebnisse zur Diagnostik Versorgungsforschungsstudie zur peripheren arteriellen Verschlusskrankheit (PAVK)- Baseline Ergebnisse zur Diagnostik Dipl. oec. troph. Rebecca Jahn, Prof. Dr. Curt Diehm, Dr. rer. medic. Elke Driller,

Mehr

AML C92.0, C92.3, C92.4, C92.5, C92.6, C92.7, C92.8, C92.9, C93.0, C94.0, C Vorstufen

AML C92.0, C92.3, C92.4, C92.5, C92.6, C92.7, C92.8, C92.9, C93.0, C94.0, C Vorstufen Durchschnittlich erfasste Erkrankungszahlen Zeitraum Geschlecht N rohe Rate altersstandardisierte Rate (ESR)* arithm. Alter Jahre medianes Alter Jahre Vergleich medianes Alter 2010-2014 männlich 108 7,3

Mehr

Titel der Studie: Kurzbezeichnung der Studie: Indikation: Primäres Ziel der Studie: Sekundäres Ziel der Studie: Studiendesign: Studienpopulation:

Titel der Studie: Kurzbezeichnung der Studie: Indikation: Primäres Ziel der Studie: Sekundäres Ziel der Studie: Studiendesign: Studienpopulation: Titel der Studie: Kurzbezeichnung der Studie: Indikation: Primäres Ziel der Studie: Sekundäres Ziel der Studie: Studiendesign: Studienpopulation: Studie zur Wirksamkeit und Sicherheit der HOchDOsis- GlukoKORTikoid-Therapie

Mehr

Kardio-CT im akuten Koronarsyndrom Gegenwart und Zukun. Hamburg Heart View,

Kardio-CT im akuten Koronarsyndrom Gegenwart und Zukun. Hamburg Heart View, Kardio-CT im akuten Koronarsyndrom Gegenwart und Zukun. Hamburg Heart View, 05.11.2016 Prof. Dr. Gunnar Lund, Klinik und Poliklinik für diagnostische und interventionelle Radiologie, Universitätskrankenhaus

Mehr

1 von 5 17.08.2010 10:47» Home» Fachinformationen» Studien-Portal» Studien der GPOH» HIT-HGG-2007 HIT-HGG-2007 Autor: Julia Dobke, erstellt am: 19.03.2010, Zuletzt geändert: 30.06.2010 Titel Erkrankung,

Mehr

Malignes Melanom. Aktuelles vom amerikanischen Krebskongress 2013

Malignes Melanom. Aktuelles vom amerikanischen Krebskongress 2013 Malignes Melanom Aktuelles vom amerikanischen Krebskongress 2013 Peter Kurschat Klinik für Dermatologie und Venerologie Centrum für Integrierte Onkologie CIO Mittwoch, 26.06.2013, Köln Wo standen wir vor

Mehr

Tragende Gründe. Vom 28. Mai Inhaltsverzeichnis. 1. Rechtsgrundlagen. 2. Eckpunkte der Entscheidung. 3. Beratungsverlauf

Tragende Gründe. Vom 28. Mai Inhaltsverzeichnis. 1. Rechtsgrundlagen. 2. Eckpunkte der Entscheidung. 3. Beratungsverlauf Tragende Gründe zum Beschluss des Gemeinsamen Bundesausschusses über einen Antrag zur Verordnungsfähigkeit der zulassungsüberschreitenden Anwendung eines Arzneimittels zu Lasten der gesetzlichen Krankenkassen

Mehr

Das Forschungs- und Entwicklungsprojekt Partnership for the Heart

Das Forschungs- und Entwicklungsprojekt Partnership for the Heart Das Forschungs- und Entwicklungsprojekt Partnership for the Heart Ein Erfahrungsbericht Dr. med. Friedrich Köhler nr.: 01MG532 DGTelemed Fachkongress Telemedizin Zukunft für die Medizin, Berlin 1.-2.11.2007

Mehr

Pilotprojekt Überregionales Prüfzentrum Rhein-Ruhr in der Pädiatrischen Onkologie

Pilotprojekt Überregionales Prüfzentrum Rhein-Ruhr in der Pädiatrischen Onkologie Pilotprojekt Überregionales Prüfzentrum Rhein-Ruhr in der Pädiatrischen Onkologie Beate Wulff, Katharina Waack-Buchholz, Dirk Reinhardt Klinik für Kinderheilkunde III, Pädiatrische Hämatologie-Onkologie

Mehr

DETECT Studien: Multizentrische Studien bei Patientinnen mit HER2-negativem metastasiertem Brustkrebs und zirkulierenden Tumorzellen

DETECT Studien: Multizentrische Studien bei Patientinnen mit HER2-negativem metastasiertem Brustkrebs und zirkulierenden Tumorzellen DETECT Studien: Multizentrische Studien bei Patientinnen mit HER2-negativem metastasiertem Brustkrebs und zirkulierenden Tumorzellen Sponsor: Universitätsklinikum Ulm (AöR), Albert-Einstein-Allee 29, 89081

Mehr

2. Regensburger Patiententag

2. Regensburger Patiententag 2. Regensburger Patiententag 7. Feb. 2015 Neues aus der Therapie von Leukämien und Lymphomen Wolfgang Herr Innere Medizin III Hämatologie und Onkologie Leukämien und Lymphome entstehen durch Veränderungen

Mehr

Präzision ist unser Versprechen

Präzision ist unser Versprechen Hypofraktionierte Strahlentherapie bei lokal begrenztem Prostatakarzinom ( HYPOSTAT ) Präzision ist unser Versprechen www.saphir-radiochirurgie.com Liebe Patienten, die Radiochirurgie ist eine gering

Mehr

PATIENTENINFORMATION UND EINWILLIGUNGSERKLÄRUNG ZUR LAGERUNG VON BLUTPROBEN

PATIENTENINFORMATION UND EINWILLIGUNGSERKLÄRUNG ZUR LAGERUNG VON BLUTPROBEN PATIENTENINFORMATION UND EINWILLIGUNGSERKLÄRUNG ZUR LAGERUNG VON BLUTPROBEN Eine placebo-kontrollierte, doppelblinde, randomisierte multizentrische dreiarmige Phase III Studie zu Effektivität und Sicherheit

Mehr

TKI-Therapie bei CML: Wann ist es genug?

TKI-Therapie bei CML: Wann ist es genug? TKI-Therapie bei CML: Wann ist es genug? Dr. med. Jürgen Wehmeyer, Facharzt für Innere Medizin, Hämatologie und internistische Onkologie, Gemeinschaftspraxis für Hämatologie und Onkologie, Münster 23.12.2016

Mehr

Komplikationen der Transplantat-Nephrektomie

Komplikationen der Transplantat-Nephrektomie Komplikationen der Transplantat-Nephrektomie Stefan Hauser Klinik und Poliklinik für Urologie und Kinderurologie AK Nierentransplantation am 22.11-23.11.13 Ergebnisse Nierentransplantation Verlust der

Mehr

Erkennung von Krebsvorstufen des Gebärmutterhalses und dem Vorkommen des HPV-Virus bei Patientinnen mit chronisch entzündlichen Darmerkrankungen

Erkennung von Krebsvorstufen des Gebärmutterhalses und dem Vorkommen des HPV-Virus bei Patientinnen mit chronisch entzündlichen Darmerkrankungen Studienbeschreibung Titel der Studie Erkennung von Cervixdysplasien und HPV Besiedelung bei Patientinnen mit chronisch entzündlichen Darmerkrankungen Studienakronym Detect CD Internetseite der Studie [---]*

Mehr

Merck beantragt Zulassung in den USA für Cladribin-Tabletten als mögliche orale Kurzzeitbehandlung der Multiplen Sklerose

Merck beantragt Zulassung in den USA für Cladribin-Tabletten als mögliche orale Kurzzeitbehandlung der Multiplen Sklerose Merck beantragt Zulassung in den USA für Cladribin-Tabletten als mögliche orale Kurzzeitbehandlung der Multiplen Sklerose Darmstadt (30. September 2009) - Die Merck KGaA hat heute bekannt gegeben, dass

Mehr

Protokol ID: AGO-OVAR OP.4 (AGO DESKTOP OVAR III)

Protokol ID: AGO-OVAR OP.4 (AGO DESKTOP OVAR III) EINE RANDOMISIERTE, MULTIZENTRISCHE STUDIE ZUM VERGLEICH DER WIRKSAMKEIT EINER ZUSÄTZLICHEN TUMORDEBULKING-OPERATION GEGEN EINE ALLEINIGE CHEMOTHERAPIE BEI PATIENTINNEN MIT EINEM PLATIN-SENSIBLEN OVARIALKARZINOM-REZIDIV

Mehr

Kardiomyopathien. Kardiomyopathien -I- Dilatative, hypertrophe, restriktive und andere. Prof. Dr. med. Matthias Paul

Kardiomyopathien. Kardiomyopathien -I- Dilatative, hypertrophe, restriktive und andere. Prof. Dr. med. Matthias Paul Kardiomyopathien Kardiomyopathien -I- -I- Dilatative, hypertrophe, restriktive und andere Dilatative, hypertrophe, restriktive und andere Prof. Dr. med. Matthias Paul Department für Kardiologie und Angiologie

Mehr

Chronisch myeloische Leukämie Erstlinentherapien (TKI+ PegIFN) Neuer Wirkmechanismus Update TKI-STOP

Chronisch myeloische Leukämie Erstlinentherapien (TKI+ PegIFN) Neuer Wirkmechanismus Update TKI-STOP Höhepunkte des Amerikanischen Hämatologie-Kongresses Orlando, 2015 Dr. Sebastian Saur, Med. Klinik II, Universitätsklinik Tübingen Chronisch myeloische Leukämie Erstlinentherapien (TKI+ PegIFN) Neuer Wirkmechanismus

Mehr

Myelomzentrum Tübingen Newsletter 2015 Aktuelle Studien

Myelomzentrum Tübingen Newsletter 2015 Aktuelle Studien Myelomzentrum Tübingen Newsletter 2015 Aktuelle Studien lmml competence center tübingen 2 Liebe Kolleginnen und Kollegen, wir möchten Sie mit der Neuauflage unseres Flyers über die aktuell lau fen den

Mehr

Seite Diskussion

Seite Diskussion Seite 99 4 Diskussion In der Behandlung lokal fortgeschrittener oder inflammatorischer Mammakarzinome gilt die neoadjuvante Chemotherapie schon lange als Standard. Dass diese Therapieform in Hinblick auf

Mehr