1 von :09

Größe: px
Ab Seite anzeigen:

Download "1 von :09"

Transkript

1 1 von :09

2 2 von :09 Klinische Studien CAI Prüfplancode ISRCTN EudraCT Clinicaltrials.gov DRKS CAI n/a NCT Therapie von Patienten mit rezidivierter akuter myeloischer Leukämie mit Cladribin, hochdosiertem Cytarabin und Idarubicin Studienziel / Fragestellung Primäres Prüfziel Status: Aktiv 1. Ermittlung der Verträglichkeit des geprüften Therapieprotokolles durch Erfassung der Toxizität nach NCI/CTC, insbesondere der Rate schwerwiegender Infektionen und der Frühtodesfälle 2. Ermittlung der Wirksamkeit des geprüften Therapieprotokolles durch Bestimmung der Remissionsrate Sekundäre Prüfziele 1. Ermittlung der Remissionsdauer (abhängig von der Postremissionstherapie) 2. Ermittlung des Gesamtüberlebens der Patienten 3. Ermittlung des Einflusses zytogenetischer Aberrationen (insbesondere komplexer Aberrationen [ 3]) auf Remissionsrate, Remissionsdauer und Gesamtüberleben 4. Verlauf der CD3/CD4+-Subpopulation der Lymphozyten nach der Therapie Diagnose

3 3 von :09 Akute Leukämien: Akute myeloische Leukämien (AML) Akute myeloische Leukämie im ersten oder höheren Rezidiv nach erfolgreicher Induktionstherapie und einer Remissionsdauer nach Erstmanifestation von mindestens sechs Monaten. Die Dauer der letzten Remission nach einem ersten oder höheren Rezidiv muss mindestens drei Monate betragen CIO Köln Zum Seitenanfang Bonn - Alle Rechte vorbehalten - Impressum - Datenschutzerklärung - Sitemap Patientenmerkmale Stadium Rezidiv Alter 18-0 Einschlusskriterien 1. Akute myeloische Leukämie im ersten oder höheren Rezidiv nach erfolgreicher Induktionstherapie und einer Remissionsdauer nach Erstmanifestation von mindestens sechs Monaten. Die Dauer der letzten Remission nach einem ersten oder höheren Rezidiv muss mindestens drei Monate betragen. 2. Alter mindestens 18 Jahre 3. Lebenserwartung (ohne Berücksichtigung der AML oder ihrer Komplikationen) mindestens drei Monate 4. ECOG-Status (ohne Berücksichtigung der AML oder ihrer Komplikationen) Schriftliches Einverständnis Ausschlusskriterien 1. Jede Vorbehandlung der akuten myeloischen Leukämie mit Cladribin 2. Jede lebensbedrohliche, unkontrollierte Infektion unmittelbar vor Therapiebeginn, der Studieneinschluss ist jedoch nach Kontrolle der Infektion möglich 3. Schwerwiegende Herzinsuffizienz Grad III oder IV nach NYHA (ein alleiniger pathologischer Befund der Myokardfunktion ist nicht ausreichend als Ausschlusskriterium) 4. Schwerwiegende Niereninsuffizienz mit einer Kreatinin-Clearance (gemessen oder errechnet nach Levey et al.) kleiner als 30 ml/min, falls nicht durch die Leukämie bedingt. Gegebenenfalls sollte vor Therapiebeginn zunächst die Nierenfunktion verbessert werden, falls dies möglich erscheint. 5. Schwerwiegende Leberinsuffizienz mit einem Bilirubin über 3 mg/dl oder einer

4 4 von :09 GOT über 200 U/l, falls diese nicht durch die akute myeloische Leukämie bedingt ist. 6. Schwerwiegende andere Organschädigung Grad III bis IV nach WHO, falls diese nicht durch die akute myeloische Leukämie bedingt ist oder nach Entscheidung des behandelnden Arztes die Therapie schwerwiegend beeinträchtigen würde. 7. HIV-Infektion jeden Stadiums 8. Spezielle Ausschlusskriterien für Studienmedikation incl. Unverträglichkeit 9. Schwangerschaft, Stillzeit 10. Patienten mit einer weiteren aktiven malignen Erkrankung, die den Verlauf der AML voraussichtlich beeinträchtigen wird Studiendesign Phase II, Monozentrisch, Prospektiv, Einarmig Intervention Cladribin, d1-3 Cytarabin, d1-3 Idarubicin, d1-3 Zuständigkeiten Gesamtstudie Sponsor Universitätsklinikum Bonn Tel Fax Leiter der klinischen Prüfung Prüfzentren Studienzentrale Hämatologie / Onkologie (Med. Klinik III) UKB Tel Fax

5 5 von :09 Leitender Prüfarzt im Zentrum (Hauptprüfer) Subinvestigator Dr. Karin Mayer Ansprechpartner Dr. Corinna Hahn-Ast

Kinderneurologie - STIM-CP

Kinderneurologie - STIM-CP Kinderneurologie - STIM-CP Prüfplancode ISRCTN EudraCT Clinicaltrials.gov DRKS 1603 NCT02097693 Effekt der Tiefen Hirnstimulation im Globus Pallidus internus auf die Lebensqualität von jungen Patienten

Mehr

Therapie von Patienten bis 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Fludarabin/Cyclophosphamid

Therapie von Patienten bis 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Fludarabin/Cyclophosphamid 10 CLL4-Protokoll der deutschen CLL-Studiengruppe Therapie von Patienten bis 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Fludarabin/Cyclophosphamid - CLL4-Protokoll

Mehr

22. Onkologisches Symposium Große Fortschritte in der Leukämietherapie

22. Onkologisches Symposium Große Fortschritte in der Leukämietherapie 22. Onkologisches Symposium - 21.01.2017 Große Fortschritte in der Leukämietherapie Prof. Dr. Wolfgang Herr Klinik und Poliklinik für Innere Medizin III - Hämatologie und intern. Onkologie Leukämien (Patienten

Mehr

Kooperative multizentrische Studie für Kinder und Jugendliche mit einem Gliom niedrigen Malignitätsgrades

Kooperative multizentrische Studie für Kinder und Jugendliche mit einem Gliom niedrigen Malignitätsgrades 1 von 5 15.12.2010 14:38» Home» Fachinformationen» Studien-Portal» Studien und Register der GPOH» SIOP-LGG 2004 Autor: Dr. med. Astrid Gnekow, erstellt 13.08.2003, Zuletzt geändert: 16.08.2010 Titel Erkrankung,

Mehr

Studienprotokoll Fax:

Studienprotokoll Fax: Studienprotokoll Kombinierte systemische und intrathekale Chemotherapie mit nachfolgender Hochdosischemotherapie und autologer Stammzelltransplantation bei ZNS-Rezidiven aggressiver Lymphome Version: (3.2)

Mehr

Prüfplan. MCL Rezidiv-Studie des European MCL Network und der GLSG Protokoll Version 1.5

Prüfplan. MCL Rezidiv-Studie des European MCL Network und der GLSG Protokoll Version 1.5 Prüfplan MCL Rezidiv-Studie des und der GLSG Protokoll Version 1.5 Vollständiger Titel: Wirksamkeit und Sicherheit einer Kombinationstherapie mit Rituximab, hochdosiertem Ara-C und Dexamethason (R-HAD)

Mehr

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Ein Vortrag von Univ. Prof. Dr. Johannes Drach Medizinische Universität Wien Univ. Klinik für Innere Medizin I Klinische Abteilung

Mehr

HECTOR (Hycamtin plus Carboplatin versus Established Regimens for the Treatment of Ovarian Cancer Relapse) EudraCT Number: 2006-004628-34

HECTOR (Hycamtin plus Carboplatin versus Established Regimens for the Treatment of Ovarian Cancer Relapse) EudraCT Number: 2006-004628-34 Topotecan plus Carboplatin im Vergleich zur Standardtherapie (Paclitaxel plus Carboplatin oder Gemcitabin plus Carboplatin) in der Therapie von Patientinnen mit Platin-sensitivem rezidivierten epithelialen

Mehr

Wirksamkeit und Sicherheit von Thalidomid in der primären Therapie des multiplen Myeloms

Wirksamkeit und Sicherheit von Thalidomid in der primären Therapie des multiplen Myeloms AMB 2006, 40, 89 Wirksamkeit und Sicherheit von Thalidomid in der primären Therapie des multiplen Myeloms Mit Thalidomid, Lenalidomid und Bortezomib (Velcade ) stehen inzwischen neue Wirkstoffe für die

Mehr

KURZFASSUNG DES PRÜFPROTOKOLLS 1839IL/0079 VOM

KURZFASSUNG DES PRÜFPROTOKOLLS 1839IL/0079 VOM KURZFASSUNG DES PRÜFPROTOKOLLS 1839IL/0079 VOM 11.11.02 RANDOMISIERTE, OFFENE, NICHT-KOMPARATIVE PHASE II STUDIE ZUR BEURTEILUNG DER WIRKSAMKEIT UND VERTRÄGLICHKEIT VON ZWEI DOSIERUNGEN ZD1839 BEI PATIENTEN

Mehr

Indolente Non Hodgkin- Lymphome (NHL) Leitlinie

Indolente Non Hodgkin- Lymphome (NHL) Leitlinie Indolente Non Hodgkin- Lymphome (NHL) Leitlinie Empfehlungen der Fachgesellschaft zur Diagnostik und Therapie hämatologischer und onkologischer Erkrankungen Herausgeber DGHO Deutsche Gesellschaft für Hämatologie

Mehr

Kurzprotokoll. GMMG-HD4 / HOVON-65 Studie

Kurzprotokoll. GMMG-HD4 / HOVON-65 Studie Kurzprotokoll GMMG-HD4 / HOVON-65 Studie 2.1 Titel Hochdosistherapie und autologe Stammzelltransplantation gefolgt von einer Thalidomid-Erhaltungstherapie vs. Bortezomib plus Hochdosistherapie und autologe

Mehr

Version: V1.0 basierend auf Amendment 1 vom 15. Juli 2016

Version: V1.0 basierend auf Amendment 1 vom 15. Juli 2016 Pertuzumab in First Line Treatment of HER2-positive metastatic breast Cancer patients: A cohort study of patients treated either with docetaxel and Trastuzumab or docetaxel, trastuzumab and, NCT02642458

Mehr

1.4. Protokoll-Synopse

1.4. Protokoll-Synopse EudraCT-Nr.: 2005-005473-29 Protokoll Version 2.4 vom 20.7.2009 Seite - 13-1.4. Protokoll-Synopse Protokoll-Nr.: OSHO # 70 (FL-OSHO/GLSG-M3-2005-01) Protokoll-Version und Datum.: 2.4 vom 20.07.2009 Titel

Mehr

Vitamin-K- Antagonisten NOAK VKA. Neue orale Antikoagulanzien. Informationen für Ärzte: Umstellung von NOAK auf VKA

Vitamin-K- Antagonisten NOAK VKA. Neue orale Antikoagulanzien. Informationen für Ärzte: Umstellung von NOAK auf VKA Vitamin-K- Antagonisten NOAK VKA vs Neue orale Antikoagulanzien Informationen für Ärzte: Umstellung von NOAK auf VKA Better Care. Better Life. Better Care. Better Life. Alere. Alere. Alere INRatio 2: Das

Mehr

Zusammenfassung des Studienprotokolls

Zusammenfassung des Studienprotokolls Zusammenfassung des Studienprotokolls Titel des Gesuchs: Protokoll-No.: HOVON 103 / SAKK 30/10 Gesuchsteller: Weitere Mitarbeiter/Innen: Eine randomisierte Phase II Multizenter Studie zur Evaluation der

Mehr

Indolente Non Hodgkin- Lymphome (NHL) Leitlinie

Indolente Non Hodgkin- Lymphome (NHL) Leitlinie Indolente Non Hodgkin- Lymphome (NHL) Leitlinie Empfehlungen der Fachgesellschaft zur Diagnostik und Therapie hämatologischer und onkologischer Erkrankungen Herausgeber DGHO Deutsche Gesellschaft für Hämatologie

Mehr

Stammzelltransplantation: Vorhersage von Komplikationen mittels neuer Technologien

Stammzelltransplantation: Vorhersage von Komplikationen mittels neuer Technologien Stammzelltransplantation: Vorhersage von Komplikationen mittels neuer Technologien Abteilung Hämatologie, Hämostaseologie und Onkologie Prof. Dr. med. Arnold Ganser Prof. Dr. med. univ. Eva M. Weissinger

Mehr

Als Krebspatient an einer Studie teilnehmen was sollte man wissen?

Als Krebspatient an einer Studie teilnehmen was sollte man wissen? Als Krebspatient an einer Studie teilnehmen was sollte man wissen? Krebsinformationsdienst, Heidelberg Dr. Susanne Weg-Remers Seite 2 Grundlage für evidenzbasiertes medizinisches Wissen sind klinische

Mehr

Bakterielle Infektionen und Pneumocystis jirovecii Pneumonie - Prophylaxe Leitlinie

Bakterielle Infektionen und Pneumocystis jirovecii Pneumonie - Prophylaxe Leitlinie Bakterielle Infektionen und Pneumocystis jirovecii Pneumonie - Prophylaxe Leitlinie Empfehlungen der Fachgesellschaft zur Diagnostik und Therapie hämatologischer und onkologischer Erkrankungen Herausgeber

Mehr

Organbegrenztes Prostatakarzinom

Organbegrenztes Prostatakarzinom Organbegrenztes Prostatakarzinom Michael Stöckle Klinik für Urologie und Kinderurologie Universitätsklinikum des Saarlandes, Homburg/Saar Seite Ausgangssituation Prostata-Ca ist häufigh 3% aller Männer

Mehr

Thrombozytopenie: Wann transfundieren?

Thrombozytopenie: Wann transfundieren? Thrombozytopenie: Wann transfundieren? Heiko Rühl Institut für Experimentelle Hämatologie und Transfusionsmedizin Universitätsklinikum Bonn IAKH Jahreskongress 2013 Thrombozytopenie: Wann transfundieren?

Mehr

Das Mammakarzinom des Mannes. Holm Eggemann. Universitätsfrauenklinik. tsfrauenklinik Direktor: Prof. Dr. Dr. S.-D. Costa.R.

Das Mammakarzinom des Mannes. Holm Eggemann. Universitätsfrauenklinik. tsfrauenklinik Direktor: Prof. Dr. Dr. S.-D. Costa.R. Das Mammakarzinom des Mannes Holm Eggemann Universitätsfrauenklinik tsfrauenklinik Direktor: Prof. Dr. Dr. S.-D. Costa Universitätsklinikum tsklinikum Magdeburg A.ö.R..R. Mammakarzinom des Mannes Inzidenz

Mehr

Abschlussbericht (Zusammenfassung) Final / Datum:

Abschlussbericht (Zusammenfassung) Final / Datum: Zusammenfassung des Abschlussberichts Studientitel: Intravenöse Gabe von Eisen-Carboxymaltose (Ferinject ) zur präoperativen Therapie der Eisenmangel-Anämie bei Patienten vor orthopädischen Eingriffen

Mehr

Studienleitung: ClinicalTrials.gov Identifier: NCT Version 2.0 vom

Studienleitung: ClinicalTrials.gov Identifier: NCT Version 2.0 vom Prospektive multizentrische Beobachtungsstudie zur therapeutischen Thrombozytentransfusion bei Patienten mit akuter myeloischer Leukämie in der Postremissionstherapie Studienleitung: ClinicalTrials.gov

Mehr

Moderne und zielgerichtete Therapie der akuten Leukämie

Moderne und zielgerichtete Therapie der akuten Leukämie Universitätsklinikum Regensburg Moderne und zielgerichtete Therapie der akuten Leukämie Wolfgang Herr Innere Medizin III (Hämatologie u. internistische Onkologie) Klinik und Poliklinik für Innere Medizin

Mehr

» Home» Fachinformationen» Studien- Portal» Studien und Register der GPOH» CWS- 2007- HR

» Home» Fachinformationen» Studien- Portal» Studien und Register der GPOH» CWS- 2007- HR Page 1 of 5» Home» Fachinformationen» Studien- Portal» Studien und Register der GPOH» CWS- 2007- HR CWS- 2007- HR Autor: CWS, erstellt am: 26.03.2010, Zuletzt geändert: 23.08.2010 Titel Erkrankung Art

Mehr

Klinische Chemie und Hämatologie Vorlesung: Allgemeine & Spezielle Hämatologie

Klinische Chemie und Hämatologie Vorlesung: Allgemeine & Spezielle Hämatologie Klinische Chemie und Hämatologie Vorlesung: Allgemeine & Spezielle Hämatologie Prof. Dr. med. Th. Büchner Medizinische Klinik und Poliklinik - Innere Medizin A - Universitätsklinikum Münster Albert-Schweitzer-Straße

Mehr

Leukozyten 300/ul Hb 8,7 g/dl Thrombozyten 3.000 /ul Überweisung an MZA-Aufnahme

Leukozyten 300/ul Hb 8,7 g/dl Thrombozyten 3.000 /ul Überweisung an MZA-Aufnahme 60 jährige Patientin ohne maligne Vorerkrankungen (Hysterektomie, AE, TE, Tibiakopffraktur) Seit 3 Wochen Abgeschlagenheit seit 1 Woche Thoraxschmerzen, Husten, Fieber seit 1 Woche Ausschlag "geschwollenes

Mehr

Vom unklaren Symptomkomplex zur ganzheitlichen Diagnose

Vom unklaren Symptomkomplex zur ganzheitlichen Diagnose Morbus Fabry - Niereninsuffizienz Kardiomyopathie Neurologische Störungen - Vom unklaren Sympto Morbus Fabry Niereninsuffizienz Kardiomyopathie Neurologische Störungen Vom unklaren Symptomkomplex zur ganzheitlichen

Mehr

Therapiemöglichkeiten von Leukämien Herausforderungen und Chancen aus der Sicht der Klinik

Therapiemöglichkeiten von Leukämien Herausforderungen und Chancen aus der Sicht der Klinik Therapiemöglichkeiten von Leukämien Herausforderungen und Chancen aus der Sicht der Klinik Dr.Nicola Gökbuget Leiterin der Studienzentrale und Koordinatorin der GMALL-Studiengruppe Medizinische Klinik

Mehr

O f f e n e S t u d i e n - August 2013 -

O f f e n e S t u d i e n - August 2013 - Sehr geehrte Patientinnen und Angehörige, sehr geehrte Ärztinnen und Ärzte, Klinische Studien zur Behandlung des Ovarial-, Tuben-, Endometrium- und Peritonealkarzinoms: bevor antihormonelle, chemotherapeutische

Mehr

Brustkrebs: Adjuvante Therapie mit Herceptin

Brustkrebs: Adjuvante Therapie mit Herceptin Trastuzumab after adjuvant Chemotherapy in HER2-positive Breast Cancer Piccart-Gebhart et al: New England Journal of Medicine 353 : 1659 72, October 20, 2005. HERA 2-year follow-up of trastuzumab after

Mehr

ALLHAT. The Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial JAMA 2002, 288, Prof. Dr. med.

ALLHAT. The Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial JAMA 2002, 288, Prof. Dr. med. ALLHAT The Antihypertensive and Lipid-Lowering Treatment to Prevent Heart Attack Trial JAMA 2002, 288, 2981-96 Hintergrund ALLHAT Studienziel Vergleich dreier Antihypertensiva-Klassen (Chlortalidon, Amlodipin,

Mehr

Studien der AML-CG. Hämatologie im Wandel März 2013 Michael Fiegl Medizinische Klinik III, KUM CAMPUS GROSSHADERN

Studien der AML-CG. Hämatologie im Wandel März 2013 Michael Fiegl Medizinische Klinik III, KUM CAMPUS GROSSHADERN CAMPUS GROSSHADERN Prof. Dr. W. Hiddemann Studien der AML-CG Hämatologie im Wandel 1. 2. März 2013 Michael Fiegl Medizinische Klinik III, KUM AML-CG Deutsche Kooperative AML Studiengruppe e.v. (AML-CG)

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

Velcade (Bortezomib) auch in der Therapie niereninsuffizienter Myelompatienten effektiv und verträglich

Velcade (Bortezomib) auch in der Therapie niereninsuffizienter Myelompatienten effektiv und verträglich Aktuelle Pressemitteilung Velcade (Bortezomib) auch in der Therapie niereninsuffizienter Myelompatienten effektiv und verträglich (Neuss, 4. Dezember 2007) Neueste beim Internationalen Myelomworkshop auf

Mehr

als Beispiel für die Vernetzung von Partnern aus Klinik und Forschung

als Beispiel für die Vernetzung von Partnern aus Klinik und Forschung Das als Beispiel für die Vernetzung von Partnern aus Klinik und Forschung U. Creutzig, I. Krämer, J. Hannemann, G. Henze, R. Herold, M. Zimmermann Koordinationszentrale Berlin/Hannover Krebs bei Kindern

Mehr

Einfluss einer Niereninsuffizienz auf die Korrelation von NTproBNP mit dem Schweregrad der Herzinsuffizienz

Einfluss einer Niereninsuffizienz auf die Korrelation von NTproBNP mit dem Schweregrad der Herzinsuffizienz Einfluss einer Niereninsuffizienz auf die Korrelation von NTproBNP mit dem Schweregrad der Herzinsuffizienz Dr. Andreas Rieth, et al, Bad Nauheim Hintergrund: Der Biomarker NTproBNP ist für die Diagnostik

Mehr

Leukämie (CML) Was ist Chronische Myeloische Leukämie? Download. Published on Novartis Austria (https://www.novartis.at)

Leukämie (CML) Was ist Chronische Myeloische Leukämie? Download. Published on Novartis Austria (https://www.novartis.at) Published on Novartis Austria (https://www.novartis.at) Home > Printer-friendly PDF > Leukämie (CML) Leukämie (CML) Was ist Chronische Myeloische Leukämie? Die chronische myeloische Leukämie (CML) ist

Mehr

Malignes Melanom. Aktuelles vom amerikanischen Krebskongress 2013

Malignes Melanom. Aktuelles vom amerikanischen Krebskongress 2013 Malignes Melanom Aktuelles vom amerikanischen Krebskongress 2013 Peter Kurschat Klinik für Dermatologie und Venerologie Centrum für Integrierte Onkologie CIO Mittwoch, 26.06.2013, Köln Wo standen wir vor

Mehr

AML C92.0, C92.3, C92.4, C92.5, C92.6, C92.7, C92.8, C92.9, C93.0, C94.0, C Vorstufen

AML C92.0, C92.3, C92.4, C92.5, C92.6, C92.7, C92.8, C92.9, C93.0, C94.0, C Vorstufen Durchschnittlich erfasste Erkrankungszahlen Zeitraum Geschlecht N rohe Rate altersstandardisierte Rate (ESR)* arithm. Alter Jahre medianes Alter Jahre Vergleich medianes Alter 2010-2014 männlich 108 7,3

Mehr

1 von 5 17.08.2010 10:47» Home» Fachinformationen» Studien-Portal» Studien der GPOH» HIT-HGG-2007 HIT-HGG-2007 Autor: Julia Dobke, erstellt am: 19.03.2010, Zuletzt geändert: 30.06.2010 Titel Erkrankung,

Mehr

Tragende Gründe. Vom 28. Mai Inhaltsverzeichnis. 1. Rechtsgrundlagen. 2. Eckpunkte der Entscheidung. 3. Beratungsverlauf

Tragende Gründe. Vom 28. Mai Inhaltsverzeichnis. 1. Rechtsgrundlagen. 2. Eckpunkte der Entscheidung. 3. Beratungsverlauf Tragende Gründe zum Beschluss des Gemeinsamen Bundesausschusses über einen Antrag zur Verordnungsfähigkeit der zulassungsüberschreitenden Anwendung eines Arzneimittels zu Lasten der gesetzlichen Krankenkassen

Mehr

Präzision ist unser Versprechen

Präzision ist unser Versprechen Hypofraktionierte Strahlentherapie bei lokal begrenztem Prostatakarzinom ( HYPOSTAT ) Präzision ist unser Versprechen www.saphir-radiochirurgie.com Liebe Patienten, die Radiochirurgie ist eine gering

Mehr

AGO-OVAR OP.2 (AGO DESKTOP OVAR II)

AGO-OVAR OP.2 (AGO DESKTOP OVAR II) EVALUATION EINES PRÄDIKTORS FÜR DIE KOMPLETTE RESEKTION BEI PLATIN-SENSIBLEM OVARIALKARZINOMREZIDIV AGO-OVAR OP.2 (AGO DESKTOP OVAR II) Ein Projekt der AGO Kommission OVAR und der AGO Studiengruppe Ovarialkarzinom

Mehr

2. Regensburger Patiententag

2. Regensburger Patiententag 2. Regensburger Patiententag 7. Feb. 2015 Neues aus der Therapie von Leukämien und Lymphomen Wolfgang Herr Innere Medizin III Hämatologie und Onkologie Leukämien und Lymphome entstehen durch Veränderungen

Mehr

Wer sagt was ein QALY ist und was darf es kosten?

Wer sagt was ein QALY ist und was darf es kosten? Wer sagt was ein QALY ist und was darf es kosten? Dipl. Gesundheitsökonom Thomas Reinhold Institut für Sozialmedizin, Epidemiologie und Gesundheitsökonomie Überblick Die Idee des QALYs Was ist ein QALY?

Mehr

Evaluation eines stichprobenartigen Monitorings bei Therapieoptimierungsstudien Ulrike Zettelmeyer

Evaluation eines stichprobenartigen Monitorings bei Therapieoptimierungsstudien Ulrike Zettelmeyer internet: www.lymphome.de email: lymphome@medizin.uni-koeln.de Evaluation eines stichprobenartigen Monitorings bei Therapieoptimierungsstudien Ulrike Zettelmeyer Gliederung Deutsche Hodgkin Studiengruppe

Mehr

PATIENTENINFORMATION UND EINWILLIGUNGSERKLÄRUNG ZUR LAGERUNG VON BLUTPROBEN

PATIENTENINFORMATION UND EINWILLIGUNGSERKLÄRUNG ZUR LAGERUNG VON BLUTPROBEN PATIENTENINFORMATION UND EINWILLIGUNGSERKLÄRUNG ZUR LAGERUNG VON BLUTPROBEN Eine placebo-kontrollierte, doppelblinde, randomisierte multizentrische dreiarmige Phase III Studie zu Effektivität und Sicherheit

Mehr

Myelomzentrum Tübingen Newsletter 2015 Aktuelle Studien

Myelomzentrum Tübingen Newsletter 2015 Aktuelle Studien Myelomzentrum Tübingen Newsletter 2015 Aktuelle Studien lmml competence center tübingen 2 Liebe Kolleginnen und Kollegen, wir möchten Sie mit der Neuauflage unseres Flyers über die aktuell lau fen den

Mehr

Seite Diskussion

Seite Diskussion Seite 99 4 Diskussion In der Behandlung lokal fortgeschrittener oder inflammatorischer Mammakarzinome gilt die neoadjuvante Chemotherapie schon lange als Standard. Dass diese Therapieform in Hinblick auf

Mehr

Protokol ID: AGO-OVAR OP.4 (AGO DESKTOP OVAR III)

Protokol ID: AGO-OVAR OP.4 (AGO DESKTOP OVAR III) EINE RANDOMISIERTE, MULTIZENTRISCHE STUDIE ZUM VERGLEICH DER WIRKSAMKEIT EINER ZUSÄTZLICHEN TUMORDEBULKING-OPERATION GEGEN EINE ALLEINIGE CHEMOTHERAPIE BEI PATIENTINNEN MIT EINEM PLATIN-SENSIBLEN OVARIALKARZINOM-REZIDIV

Mehr

Kardiomyopathien. Kardiomyopathien -I- Dilatative, hypertrophe, restriktive und andere. Prof. Dr. med. Matthias Paul

Kardiomyopathien. Kardiomyopathien -I- Dilatative, hypertrophe, restriktive und andere. Prof. Dr. med. Matthias Paul Kardiomyopathien Kardiomyopathien -I- -I- Dilatative, hypertrophe, restriktive und andere Dilatative, hypertrophe, restriktive und andere Prof. Dr. med. Matthias Paul Department für Kardiologie und Angiologie

Mehr

Chronisch myeloische Leukämie Erstlinentherapien (TKI+ PegIFN) Neuer Wirkmechanismus Update TKI-STOP

Chronisch myeloische Leukämie Erstlinentherapien (TKI+ PegIFN) Neuer Wirkmechanismus Update TKI-STOP Höhepunkte des Amerikanischen Hämatologie-Kongresses Orlando, 2015 Dr. Sebastian Saur, Med. Klinik II, Universitätsklinik Tübingen Chronisch myeloische Leukämie Erstlinentherapien (TKI+ PegIFN) Neuer Wirkmechanismus

Mehr

medialog Urologie Da Vinci: Verbindung zwischen Tradition und Moderne Innere Medizin Blutdrucksenkung durch Verödung von Nierennerven Ausgabe 1/14

medialog Urologie Da Vinci: Verbindung zwischen Tradition und Moderne Innere Medizin Blutdrucksenkung durch Verödung von Nierennerven Ausgabe 1/14 Universitätsklinikum Halle (Saale) medialog zeitschrift des universitätsklinikums halle (saale) Urologie Da Vinci: Verbindung zwischen Tradition und Moderne Innere Medizin Blutdrucksenkung durch Verödung

Mehr

Übersicht klinischer Studien im Onkologischen Zentrum Stand Juni 2014

Übersicht klinischer Studien im Onkologischen Zentrum Stand Juni 2014 Übersicht klinischer Studien im Onkologischen Zentrum Stand Juni 2014 Studienzentrale Klinikum Aschaffenburg Studienbüro MKII: Fr. C. Klassert Telefon: 06021 / 32-2322 Fax: 06021 / 32-3020 christine.klassert@klinikum-aschaffenburg.de

Mehr

Thrombosemanagement mit NMH Wichtiges worauf Sie achten sollten

Thrombosemanagement mit NMH Wichtiges worauf Sie achten sollten Thrombosemanagement mit NMH Wichtiges worauf Sie achten sollten Thrombosemanagement mit niedermolekularem Heparin (NMH) bei Niereninsuffizienz: Worauf Sie unbedingt achten sollten. Beantworten Sie die

Mehr

Chemoimmuntherapie mit Rituximab: Standard bei der CLL sowie beim aggressiven und follikulären NHL

Chemoimmuntherapie mit Rituximab: Standard bei der CLL sowie beim aggressiven und follikulären NHL Neue Maßstäbe in der Lymphomtherapie Chemoimmuntherapie mit Rituximab: Standard bei der CLL sowie beim aggressiven und follikulären NHL Mannheim (2. Oktober 2009) - Der monoklonale Antikörper Rituximab

Mehr

Diabetes mellitus und kardiovaskuläres Risiko: Welches ist die optimale Therapie?

Diabetes mellitus und kardiovaskuläres Risiko: Welches ist die optimale Therapie? Diabetes mellitus und kardiovaskuläres Risiko: Welches ist die optimale Therapie? Hannes Reuter Herzzentrum, Klinik III für Innere Medizin Seite 1 Patienten mit Typ 2-Diabetes haben gehäuft ischämische

Mehr

Universität Ulm Medizinische Fakultät

Universität Ulm Medizinische Fakultät , Anhang F Universität Ulm Medizinische Fakultät Universitätsklinikum Zentrum für Innere Medizin, D-89070 Ulm Klinik für Innere Medizin III Hämatologie, Onkologie, Rheumatologie und Infektionskrankheiten

Mehr

XGEVA 120 mg (Denosumab)

XGEVA 120 mg (Denosumab) München, 03.09.2014 XGEVA 120 mg (Denosumab) Wichtige aktualisierte Informationen für Angehörige der medizinischen Heilberufe, um die Risiken für das Auftreten von n und n zu minimieren. Sehr geehrte Frau

Mehr

Aktuelle klinische Studien zur Prophylaxe py

Aktuelle klinische Studien zur Prophylaxe py Aktuelle klinische Studien zur Prophylaxe py chronischrezidivierender e e de Infekte Prof. Dr. med. Volker Fintelmann KFN Pressekonferenz, 30.01.2013, München Atemwegs und Harnwegsinfekte (AWI, HWI) gehören

Mehr

DIAGNOSTIC CHALLENGES IN HEMATO-ONCOLOGY2016.

DIAGNOSTIC CHALLENGES IN HEMATO-ONCOLOGY2016. DIAGNOSTIC CHALLENGES IN HEMATO-ONCOLOGY2016. DER AKTUELLE WISSENSSTAND PRAXISNAH ERKLÄRT & EFFIZIENT AUFBEREITET 30. APRIL 2016 Hamburg 17. September 2016 Essen 19. November 2016 Frankfurt a.m. Eingereicht

Mehr

Register für Sichelzellerkrankungen

Register für Sichelzellerkrankungen Register für Sichelzellerkrankungen 2. Ersterhebung Registerzentrale: Dr. R. Dickerhoff, Dr. C. Potthoff, Universitätsklinikum Düsseldorf, Klinik für Kinder-Onkologie, -Hämatologie und Klinische Immunologie,

Mehr

Dossierbewertung A14-01 Version 1.0 Trastuzumab Emtansin Nutzenbewertung gemäß 35a SGB V

Dossierbewertung A14-01 Version 1.0 Trastuzumab Emtansin Nutzenbewertung gemäß 35a SGB V 2 Nutzenbewertung 2.1 Kurzfassung der Nutzenbewertung Hintergrund Der G-BA hat das IQWiG mit der Nutzenbewertung des Wirkstoffs Trastuzumab Emtansin gemäß 35a SGB V beauftragt. Die Bewertung erfolgte auf

Mehr

Zweigbibliothek Medizin

Zweigbibliothek Medizin Sächsische Landesbibliothek - Staats- und Universitätsbibliothek Dresden (SLUB) Zweigbibliothek Medizin Diese Dissertation finden Sie original in Printform zur Ausleihe in der Zweigbibliothek Medizin Nähere

Mehr

Was gibt es Neues in der Therapie? YAEL Arzt-Patientenseminar, Hamburg Christoph Schramm I. Medizinische Klinik und Poliklinik, UKE

Was gibt es Neues in der Therapie? YAEL Arzt-Patientenseminar, Hamburg Christoph Schramm I. Medizinische Klinik und Poliklinik, UKE Was gibt es Neues in der Therapie? YAEL Arzt-Patientenseminar, Hamburg 2011 Christoph Schramm I. Medizinische Klinik und Poliklinik, UKE Autoimmune Lebererkrankungen Autoimmune Lebererkrankungen Autoimmune

Mehr

Neues in der Lymphom-Behandlung. Prof. Thomas Pabst, Universitätsklinik für Medizinische Onkologie, Inselspital, Bern

Neues in der Lymphom-Behandlung. Prof. Thomas Pabst, Universitätsklinik für Medizinische Onkologie, Inselspital, Bern Neues in der Lymphom-Behandlung Prof., Universitätsklinik für Medizinische Onkologie, Inselspital, Bern es läuft ganz viel! es läuft ganz viel! Okt 2014 Revlimid für rezidiviertes Mantelzell-Lymphom (MCL)

Mehr

Neue Diagnostik für akute myeloische Leukämie

Neue Diagnostik für akute myeloische Leukämie Neue Diagnostik für akute myeloische Leukämie Neuherberg (9. März 2011) - Wissenschaftler des Helmholtz Zentrums München und der Ludwig-Maximilians-Universität München haben eine Methode entwickelt, mit

Mehr

Rezidiv eines invasiven eptihelialem Ovarial-, Tuben- oder primären Peritonealkarzinom

Rezidiv eines invasiven eptihelialem Ovarial-, Tuben- oder primären Peritonealkarzinom STUDIENÜBERSICHT Laufende Studien Sphero NEO: (Brustzentrum) Neoadjuvant Mamma-CA Kurzbeschreibung: prospektive Kohortenstudie zur Prädiktion des Effektes der medikamentösen Therapie am multizellulären

Mehr

Aktuelle klinische Studien in Österreich

Aktuelle klinische Studien in Österreich Aktuelle klinische Studien in Österreich Dr. E. Müldür Wilhelminenspital,Zentrum für Hämatologie- u. Onkologie Vorstand: Univ.Prof.Dr.H.Ludwig Aktuelle klinische Studien in Österreich -LD-STUDIE -BBD-STUDIE

Mehr

Patientenaufklärung. Patientenname:... Vorname:... Geburtsdatum:... Diagnose:... Das Aufklärungsgespräch erfolgte am:... durch:...

Patientenaufklärung. Patientenname:... Vorname:... Geburtsdatum:... Diagnose:... Das Aufklärungsgespräch erfolgte am:... durch:... Patientenaufklärung Patientenname:... Vorname:... Geburtsdatum:... Diagnose:... Das Aufklärungsgespräch erfolgte am:... durch:... Art der Erkrankung, Ziel der Chemotherapie und Zweck der Studie Sehr geehrte

Mehr

Chemotherapie bei metastasiertem Mammakarzinom

Chemotherapie bei metastasiertem Mammakarzinom Diagnostik und Therapie primärer und metastasierter Mammakarzinome Chemotherapie bei metastasiertem Mammakarzinom Chemotherapie bei metastasiertem Mammakarzinom Version 2002: von Minckwitz Version 2003

Mehr

Nodales Marginalzonen Lymphom Leitlinie

Nodales Marginalzonen Lymphom Leitlinie Nodales Marginalzonen Lymphom Leitlinie Empfehlungen der Fachgesellschaft zur Diagnostik und Therapie hämatologischer und onkologischer Erkrankungen Herausgeber DGHO Deutsche Gesellschaft für Hämatologie

Mehr

Brustkrebs und Schwangerschaft

Brustkrebs und Schwangerschaft Brustkrebs und Schwangerschaft 13.Berliner Patientinnentag Brustkrebs 10.04.2016 Dr. Martina Dombrowski Durchschnittl. jährliche altersspezifische Inzidenz (je 100.000) Altersverteilung (%) 85+ 80-84 75-79

Mehr

Patientenaufklärung. Patientenname:... Vorname:... Geburtsdatum:... Diagnose:... Das Aufklärungsgespräch erfolgte am:... durch:...

Patientenaufklärung. Patientenname:... Vorname:... Geburtsdatum:... Diagnose:... Das Aufklärungsgespräch erfolgte am:... durch:... Patientenaufklärung Patientenname:... Vorname:... Geburtsdatum:... Diagnose:... Das Aufklärungsgespräch erfolgte am:... durch:... Art der Erkrankung, Ziel der Chemotherapie und Zweck der Studie Sehr geehrte

Mehr

Tumorzentrum Regensburg e.v.

Tumorzentrum Regensburg e.v. Tumorzentrum Regensburg e.v. Gegenüberstellung der Kiel-/REAL-/ICD-O-3-/WHO-Klassifikation Erfahrungen der Umsetzung am Tumorzentrum Regensburg 18. Informationstagung Tumordokumentation Jena 2009 D. Weinberger

Mehr

Warum heisst es: Sepsis- 3?

Warum heisst es: Sepsis- 3? Dritte Internationale Konsensus Definition der Sepsis und des septischen Schocks (Sepsis-3) Warum heisst es: Sepsis- 3? 3. Konsensus-Konferenz 3 Publikationen im JAMA 2016;315 (8) 3 einfache Indikatoren

Mehr

Verbessert eine palliative Chemotherapie die Symptome bei Patientinnen mit rezidiviertem Ovarialkarzinom? Deutsches Kurzprotokoll

Verbessert eine palliative Chemotherapie die Symptome bei Patientinnen mit rezidiviertem Ovarialkarzinom? Deutsches Kurzprotokoll Verbessert eine palliative Chemotherapie die Symptome bei Patientinnen mit rezidiviertem Ovarialkarzinom? Deutsches Kurzprotokoll AGO-PO 1/Symptom Benefit Eine Studie der GCIG Internationaler Studienleiter

Mehr

Projektlaufzeit: Projektbeteiligte: 01.03.2012 28.02.2015

Projektlaufzeit: Projektbeteiligte: 01.03.2012 28.02.2015 Projektlaufzeit: 01.03.2012 28.02.2015 Projektbeteiligte: Anja Gerlach (MScN): Projektleitung Birte Berger Höger (BSc): Studienassistentin Prof. Dr. Ingrid Mühlhauser Seite 1 von 9 Kooperationspartner

Mehr

Harnwegsinfekte nach Nierentransplantation Symposium 25 Jahre Transplantationszentrum Stuttgart

Harnwegsinfekte nach Nierentransplantation Symposium 25 Jahre Transplantationszentrum Stuttgart Harnwegsinfekte nach Nierentransplantation Symposium 25 Jahre Transplantationszentrum Stuttgart Professor Dr. med. Andreas Kribben Klinik für Nephrologie Universitätsklinikum Essen 21. 5. 2011 Harnwegsinfektionen

Mehr

Studienprojekt Candidämie des NRZ für Systemische Mykosen

Studienprojekt Candidämie des NRZ für Systemische Mykosen Studienprojekt Candidämie des NRZ für Systemische Mykosen PD Dr. med. Margarete Borg-von Zepelin Institut für Medizinische Mikrobiologie; Universitätsklinikum Göttingen Nationales Referenzzentrum für systemische

Mehr

Ernährungstherapie bei Tumorpatienten während Chemotherapie

Ernährungstherapie bei Tumorpatienten während Chemotherapie Ernährungstherapie bei Tumorpatienten während Chemotherapie Prof. Ernst-Dietrich Kreuser 16. Onkologisches Symposium 22. Januar 2011 Hintergrund Bei Tumorpatienten werden in 31-87% bereits zum Zeitpunkt

Mehr

Frage: Führt die antibiotische Behandlung der Helicobacter pylori Infektion bei Patienten mit funktioneller Dyspepsie zur Beschwerdefreiheit?

Frage: Führt die antibiotische Behandlung der Helicobacter pylori Infektion bei Patienten mit funktioneller Dyspepsie zur Beschwerdefreiheit? Funktionelle Dyspepsie: Bei Patienten mit positivem Helicobacter pylori Nachweis hilft eine Eradikation, wenn überhaupt nur wenigen Patienten (Resultate von 2 Studien) Frage: Führt die antibiotische Behandlung

Mehr

Gemeinsam gegen den Krebs. Gemeinsam für das Leben. Informationen zum CIO Köln Bonn für Patienten und Interessierte

Gemeinsam gegen den Krebs. Gemeinsam für das Leben. Informationen zum CIO Köln Bonn für Patienten und Interessierte Gemeinsam gegen den Krebs. Gemeinsam für das Leben. Informationen zum CIO Köln Bonn für Patienten und Interessierte Wir bieten keine Behandlung nach Schema F! Die wissenschaftlichen Erkenntnisse der letzten

Mehr

Kriterienkatalog des Sponsorbevollmächtigten (GHSG) (Auswahl angemessen qualifizierter Mitglieder der Prüfgruppe)

Kriterienkatalog des Sponsorbevollmächtigten (GHSG) (Auswahl angemessen qualifizierter Mitglieder der Prüfgruppe) Studienkurztitel: HD 16 EudraCT-Nr.: 2007-004474-24 Prüfplan-Code: Uni-Koeln-987 Sponsor: Universität zu Köln Studienfunktion Qualifikationsanforderungen Qualifikationsnachweis Studienaufgabe (Codierung

Mehr

Ergebnisse eines systematischen Reviews

Ergebnisse eines systematischen Reviews Möglichkeiten der Krankheitsprognose mittels einer Methode der Personalisierten Medizin bei der Akuten Myeloischen Leukämie Ergebnisse eines systematischen Reviews Pouryamout, L; Neumann, A; Trachte, N;

Mehr

Narren atemlos. Alltägliche Maskeraden oder das Spektrum unterer Atemwegsinfektionen. 22. St.Galler Infekttag Eva Lemmenmeier

Narren atemlos. Alltägliche Maskeraden oder das Spektrum unterer Atemwegsinfektionen. 22. St.Galler Infekttag Eva Lemmenmeier Narren atemlos Alltägliche Maskeraden oder das Spektrum unterer Atemwegsinfektionen 22. St.Galler Infekttag Eva Lemmenmeier Definition Pneumonie Akute Erkrankung mit Husten und einem der folgenden Symptome

Mehr

Positionspapier der APRO zur Nachsorge in der Pädiatrischen Radioonkologie

Positionspapier der APRO zur Nachsorge in der Pädiatrischen Radioonkologie Positionspapier zur Nachsorge in Pädiatrischen Radioonkologie R. Schwarz, A. Glück und B. Timmermann () in Abstimmung mit M. Frühwald, S. Rutkowski Stand: 21.08.2013 Hintergrund Die Therapien in pädiatrischen

Mehr

Zu Therapie und Prophylaxe des paroxysmalen Vorhofflimmerns

Zu Therapie und Prophylaxe des paroxysmalen Vorhofflimmerns AMB 2000, 34, 92 Zu Therapie und Prophylaxe des paroxysmalen Vorhofflimmerns In einer Untersuchung von G. Cotter et al. aus Israel (1) wurden 100 Patienten (Durchschnittsalter 68 Jahre) mit seit weniger

Mehr

Follikuläres Lymphom und Mantelzelllymphom: aktuelle Studienergebnisse

Follikuläres Lymphom und Mantelzelllymphom: aktuelle Studienergebnisse Follikuläres Lymphom und Mantelzelllymphom: aktuelle Studienergebnisse Priv. Doz. Dr. Christian Scholz Medizinische Klinik m.s. Onkologie, Hämatologie und Tumorimmunologie CharitéCentrum 14 Charité Universitätsmedizin

Mehr

Aufbau eines therapeutischen Netzwerks für Lebensqualitätsdiagnostik und therapie bei Patientinnen mit Brustkrebs

Aufbau eines therapeutischen Netzwerks für Lebensqualitätsdiagnostik und therapie bei Patientinnen mit Brustkrebs Implementierung von Lebensqualität in die medizinische Versorgung: Aufbau eines therapeutischen Netzwerks für Lebensqualitätsdiagnostik und therapie bei Patientinnen mit Brustkrebs Patricia Lindberg Tumorzentrum

Mehr

Patienteninformation. Behandlung der akuten Promyelozytenleukämie mit Arsentrioxid (TRISENOX)

Patienteninformation. Behandlung der akuten Promyelozytenleukämie mit Arsentrioxid (TRISENOX) Anlage 11 Patienteninformation Behandlung der akuten Promyelozytenleukämie mit Arsentrioxid (TRISENOX) Eine Phase-IV Studie mit Arsentrioxid (ATO) zur Erfassung der Wirksamkeit und Toxizität sowie des

Mehr

Referat Blut Teil 3: Leukämien

Referat Blut Teil 3: Leukämien n 1. Definition Bei einer handelt es sich um eine bösartige (maligne) Erkrankung der weißen Blutkörperchen, bei der es zu einer qualitativen und meist auch quantitativen Veränderung der Leukozyten kommt.

Mehr

Was ist denn nun das Hauptproblem AA, PNH, MDS oder?

Was ist denn nun das Hauptproblem AA, PNH, MDS oder? Was ist denn nun das Hauptproblem AA, PNH, MDS oder? Dr. med. Sixten Körper Abteilung für Blutspende, Apherese und Hämotherapie Institut für Klinische Transfusionsmedizin und Immungenetik Ulm gemeinnützige

Mehr

Leistungen klinischer Krebsregister für Versorgungszentren, Kliniken und niedergelassene Ärzte Jutta Engel für das Forum KKR

Leistungen klinischer Krebsregister für Versorgungszentren, Kliniken und niedergelassene Ärzte Jutta Engel für das Forum KKR Leistungen klinischer Krebsregister für Versorgungszentren, Kliniken und niedergelassene Ärzte Jutta Engel für das Forum KKR Krebsregistrierung im Zeichen des Nationalen Krebsplans Jena 1.-3. April 2009

Mehr

Empfehlungen zur Antibiotikaverschreibung bei häufigen ambulant erworbenen Infektionen. Kriterien für die Antibiotikaverschreibung

Empfehlungen zur Antibiotikaverschreibung bei häufigen ambulant erworbenen Infektionen. Kriterien für die Antibiotikaverschreibung Empfehlungen zur Antibiotikaverschreibung bei häufigen ambulant erworbenen Infektionen für Sentinella Ärzte und Ärztinnen Kriterien für die Antibiotikaverschreibung Sentinella, Pediatric Infectious Disease

Mehr

Objektivierung der kardiovaskulären Dysfunktion im ambulanten und hausärztlichen Bereich mittels handgehaltener Echokardiographie

Objektivierung der kardiovaskulären Dysfunktion im ambulanten und hausärztlichen Bereich mittels handgehaltener Echokardiographie Objektivierung der kardiovaskulären Dysfunktion im ambulanten und hausärztlichen Bereich mittels handgehaltener Echokardiographie und dem BNP-Schnelltest. Multicenter-Studie des Teilprojekts 6 im Kompetenznetz

Mehr

Absolute Neuerkrankungen und Neuerkrankungsraten je 100.000 Einwohner

Absolute Neuerkrankungen und Neuerkrankungsraten je 100.000 Einwohner Durchschnittlich erfasste Erkrankungszahlen Zeitraum Geschlecht N rohe Rate altersstandardisierte Rate (ESR)* arithm. Alter Jahre medianes Alter Jahre Vergleich medianes Alter Vergleichsquelle 2009-2013

Mehr