Angelman-Syndrom. Ellen, Barbara u Anna

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Angelman-Syndrom. Ellen, Barbara u Anna"

Transkript

1 Angelman-Syndrom Ellen, Barbara u Anna

2 Angelman-Syndrom = Folge einer seltenen neurologischen Genbesonderheit im Bereich des Chromosoms der Nummer 15 psychischen und motorischen Entwicklungsverzögerungen kognitive Behinderung Hyperaktivität stark reduzierte Lautsprachentwicklung

3 Geschichte britischer Kinderarzt Dr. Harry Angelman beschrieb das später nach ihm benannte Syndrom im Jahr 1965 erstmals auffälliges Bewegungsmusters u häufiges Lachen der Kinder Happy-Puppet- Syndrom (engl.: puppet = Marionette)

4 Auftretenshäufigkeit Mädchen u Jungen im Jahr 2005 waren weltweit über 800 dokumentiert Angelman-Syndrom vielfach nicht als solches diagnostiziert, sondern beispielsweise als Autismus Hinweise auf einen Zusammenhang zwischen der aktuellen Auftrittswahrscheinlichkeit und einer intrazytoplasmatischen Spermieninjektion werden diskutiert

5 Kognitive Symptome häufiges, oft objektiv unbegründetes Lächeln und Lachen, zum Teil regelrechte Lachanfälle, oft bei Aufregung kognitive Behinderung oft Hyperaktivität Konzentrationsschwierigkeiten, häufig kurze Aufmerksamkeitsspanne, aber oftmals gutes Gedächtnis für Gesichter und Richtungen, gute räumliche Orientierung

6 Motorische Symptome Bewegungs- und Gleichgewichtsstörungen, Ataxie (meist eher steifer, ungelenker, schwankender, breitbeiniger Gang, ruckartige, abgehackte (Lauf-) Bewegungen, eines von 10 Kindern lernt nicht laufen) Verzögerung der motorischen Entwicklung (dadurch auch z.b. vergleichsweise spätes Laufenlernen) Wahrnehmungsstörungen im körperlichen Bereich (oft zum Beispiel Gleichgewichtsprobleme) oft übermäßige Mund- und Kaubewegungen aufgrund von ungenügender Kontrolle der Mundmuskulatur

7 Anatomische Symptome ungewöhnliches Hervorstrecken der Zunge (Auftretenshäufigkeit etwa 50%) Wachstumsstörungen häufig Wirbelsäulenverkrümmung (Skoliose) in der Pubertät kleine Hände und Füße, nach außen gedrehte Füße häufig sehr schwach pigmentierte Haut, helles Haar und blaue Augen (Hypopigmentierung), zum Teil Parallelen zum Albinismus) großer Mund mit hervorstehendem Oberkiefer vergleichsweise kleine Zähne, die oft recht weit auseinander stehen übermäßiger Speichelfluss Schielen (Strabismus) mit einer Auftretenshäufigkeit von 50% übermäßiges Schwitzen, besondere Hitzeempfindlichkeit vergleichsweise kleiner Kopf (Mikrozephalie), der oft an der Hinterseite abgeflacht ist

8 Neurologische Symptome Epilepsie mit Beginn meist zwischen dem 3. und 36. Monat nach der Geburt, die Anfälle verschwinden oft im Jugendalter, etwa um das 16. Lebensjahr, wieder (Auftretenshäufigkeit bis zu 90%) Besonderheiten im EEG, auch unabhängig von Epilepsie und auch im Schlaf nachweisbar Schlafstörungen

9 Sprachliche Symptome im Kleinkindalter oft keine Sprechversuche, kein Brabbeln, später nur sehr eingeschränkte lautsprachliche Artikulationsfähigkeit (expressive Sprache), aber gewisse Fähigkeit zum Erlernen alternativer Kommunikationsformen (z.b. die Gebärden nach dem System der Gebärdenunterstützten Kommunikation / GuK, Bildkommunikation) gute rezeptive Sprache (Sprachverständnis) überdurchschnittlich lange Dauer der oralen Phase (Erkundung der Umwelt mit dem Mund)

10 Merkmale intensive Suche nach Körperkontakt viel Sinn für Humor, häufig sehr sozial, Grundhaltung freundlich lebenslang auf die Hilfe anderer angewiesen meist spezielle Hilfen und vor allem dauerhaft personelle Unterstützung beim Lernen und bei der lebenspraktischen Bewältigung des Alltags besondere Vorliebe für Wasser Schwimmen, spielen gern mit Wasser, fasziniert durch Spiegelungen auf Wasser- oder z. B. auch auf Glasflächen Plastik, insbesondere stark knisterndes Material wie etwa Plastiktüten oder Verpackungen betrachten gerne Bilder von sich selbst und nahen Bezugspersonen

11 Diagnose zwischen dem dritten und siebten Lebensjahr durch Neurologen (anhand auffälliger EEG-Werte, unabhängig von Epilepsie, auch in Schlaf bestehend) oder durch Genetiker (anhand einer zytogenetischen oder molekulargenetischen Untersuchung) gestellt. Verhaltensbeobachtung und Aussehen als Hilfe

12 Therapie Symptomatische Therapie Fördermethoden: heilpädagogische Frühförderung Mototherapie Physiotherapie Ergotherapie Logopädie sensorische Integrationstherapie therapeutisches Reiten Vorliebe für Wasser kann ebenfalls therapeutisch genutzt werden

Einschätzen und Unterstützen

Einschätzen und Unterstützen Irene Leber (vs 2012) Einschätzen und Unterstützen Förderdiagnostik Unterstützte Kommunikation für... geb.... mögliche Diagnose:... Ansprechpartner/in: Adresse / Telefon: Wichtige Bezugspersonen (und deren

Mehr

Wie erkenne ich medizinische und psychosoziale Probleme bei Kindergartenkindern?

Wie erkenne ich medizinische und psychosoziale Probleme bei Kindergartenkindern? Wie erkenne ich medizinische und psychosoziale Probleme bei Kindergartenkindern? DKFZ 05.12.2013 Dr.med.Andreas Scheffzek Um über Beobachtungen austauschen zu können sind Kriterien notwendig (1) Form Farbe

Mehr

Prim.Dr.Katharina Purtscher

Prim.Dr.Katharina Purtscher Prim.Dr.Katharina Purtscher Leiterin der Abteilung Kinder- und Jugendpsychiatrie, Landesnervenklinik Sigmund Freud Graz Definition tiefgreifende Entwicklungsstörung Qualitative Beeinträchtigungen gegenseitiger

Mehr

Prim.Dr.Katharina Purtscher

Prim.Dr.Katharina Purtscher Prim.Dr.Katharina Purtscher Leiterin der Abteilung Kinder- und Jugendpsychiatrie, Landesnervenklinik Sigmund Freud Graz Definition tiefgreifende Entwicklungsstörung Qualitative Beeinträchtigungen gegenseitiger

Mehr

Das Lennox-Gastaut-Syndrom

Das Lennox-Gastaut-Syndrom Das Lennox-Gastaut-Syndrom Diagnose, Behandlung und Unterstützung im Alltag von Ulrich Stephani 1. Auflage Das Lennox-Gastaut-Syndrom Stephani schnell und portofrei erhältlich bei beck-shop.de DIE FACHBUCHHANDLUNG

Mehr

A. Autismus ist eine Form der Autismus-Spektrum-Störung

A. Autismus ist eine Form der Autismus-Spektrum-Störung Es ist sehr wichtig, dass autistische Kinder als auch die Eltern die Autismus-Spektrum-Störun g thematisch verstehen und die neuesten Trends der Behandlungsansätze kennen. Auf so wenig wie möglichen aber

Mehr

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4

VORANSICHT II/B2. Studien an eineiigen Zwillingen. Der zweite Code die DNA ist nicht die ganze Antwort Reihe 13 Verlauf Material S 4 S 4 M 2 Studien an eineiigen Zwillingen Was ist für die Unterschiede bei eineiigen Zwillingen verantwortlich? Aufgaben 1. Fassen Sie die Informationen des Textes zusammen. 2. Wie sind die im Text beschriebenen

Mehr

Diagnostik-, Beratungs- und Behandlungsangebote in unserer Einrichtung: Kinderärztin. Psychologie. Ergotherapie. Heilpädagogik.

Diagnostik-, Beratungs- und Behandlungsangebote in unserer Einrichtung: Kinderärztin. Psychologie. Ergotherapie. Heilpädagogik. Diagnostik-, Beratungs- und Behandlungsangebote in unserer Einrichtung: Kinderärztin Psychologie Ergotherapie Heilpädagogik Logopädie Musiktherapie Physiotherapie Sozialarbeit KINDERÄRZTIN Als Kinderärztin

Mehr

Sprachförderung bei Kindern mit Down-Syndrom

Sprachförderung bei Kindern mit Down-Syndrom Etta Wilken Sprachförderung bei Kindern mit Down-Syndrom Mit ausführlicher Darstellung des GuK-Systems EDITION MARHOLD Inhaltsverzeichnis Vorwort zur 9. Auflage 9 1. Begriff des Down-Syndroms 11 2. Ursachen

Mehr

Menschen mit hohem Hilfebedarf

Menschen mit hohem Hilfebedarf Menschen mit hohem Hilfebedarf Prof. Dr. med. Jeanne Nicklas-Faust Klausurtag der Lebenshilfe Ahrensburg 19. Februar 2011 Gliederung - Begriffsbestimmung: Was sind Menschen mit hohem Hilfebedarf? - Besonderheiten:

Mehr

KINDERÄRZTIN. Tel.: Fax:

KINDERÄRZTIN. Tel.: Fax: KINDERÄRZTIN Als Fachärztin für Kinder- und Jugendmedizin, Neuropädiatrie und Psychotherapie bin ich zuständig für die entwicklungsneurologische Untersuchung von Säuglingen, Klein-, Vorschul- und Schulkindern

Mehr

Förderdiagnostik Unterstützte Kommunikation

Förderdiagnostik Unterstützte Kommunikation Irene Leber September 09 Förderdiagnostik Unterstützte Kommunikation für... geb.... mögliche Diagnose:... Ansprechpartner/in: Adresse / Telefon: Wichtige Bezugspersonen: Wichtigste Interessen: Wichtige

Mehr

Ausbildungsinhalte zum Arzt für Allgemeinmedizin. Neurologie

Ausbildungsinhalte zum Arzt für Allgemeinmedizin. Neurologie Ausbildungsinhalte zum Arzt für Allgemeinmedizin Anlage 1.B.8.5 Neurologie 1. Akut- und Notfallmedizin absolviert 1. Kenntnisse und Erfahrungen im Erkennen und Vorgehen bei akut bedrohlichen Situationen,

Mehr

Willi-Syndrom im Überblick

Willi-Syndrom im Überblick zen Eltern und Betreuungspersonen von PWS-Patienten jedoch nicht entmutigen. Ihr Einsatz, verbunden mit der Unterstützung durch ein interdisziplinäres Team, ist von entscheidender Bedeutung für das körperliche

Mehr

Trisomie 21: Entstehung - Folgen - Lebenserwartung/-standard - Auftretenswahrscheinlichkeit

Trisomie 21: Entstehung - Folgen - Lebenserwartung/-standard - Auftretenswahrscheinlichkeit Naturwissenschaft Lorenz Wächter Trisomie 21: Entstehung - Folgen - Lebenserwartung/-standard - Auftretenswahrscheinlichkeit Studienarbeit Inhaltsverzeichnis 1. Begriffsbestimmung 1 2. Entstehung...1

Mehr

ANFALLSFORMEN UND IHRE SYMPTOME ROLANDO-EPILEPSIE

ANFALLSFORMEN UND IHRE SYMPTOME ROLANDO-EPILEPSIE ANFALLSFORMEN UND IHRE SYMPTOME ROLANDO-EPILEPSIE LIEBE PATIENTIN, LIEBER PATIENT! LIEBE ELTERN! Epileptische Anfälle können sich mit den unterschiedlichsten Erscheinungsbildern bemerkbar machen. Angehörige

Mehr

INHALT TEIL 1 ALLGEMEINER TEIL... 17

INHALT TEIL 1 ALLGEMEINER TEIL... 17 TEIL 1 ALLGEMEINER TEIL... 17 DEFINITION... 18 Was ist die Parkinson-Krankheit?... 18 Was sind die ersten Anzeichen?... 19 Wer diagnostiziert Parkinson?... 19 Seit wann kennt man Parkinson?... 20 SYMPTOME...22

Mehr

Fragebogen: Pferdegestützte Therapie und ADHS

Fragebogen: Pferdegestützte Therapie und ADHS Humboldt-Universität Berlin Institut für Rehabilitationswissenschaften Abteilung Rehabilitationspsychologie Fragebogen: Pferdegestützte Therapie und ADHS Name:.... Einrichtung:.... 1. Ich habe eine Grundausbildung

Mehr

Anmeldebogen. Dr. med. Ute Krieter Fachärztin für Kinder- und Jugendpsychiatrie und Psychotherapie

Anmeldebogen. Dr. med. Ute Krieter Fachärztin für Kinder- und Jugendpsychiatrie und Psychotherapie Anmeldebogen Kind/Jugendlicher: Name/Vorname: geb.am: Staatsangehörigkeit: Wohnadresse: Telefon: Handy: Krankenkasse: Mit wem versichert: Kinder- oder Hausarzt: Dr. med. Ute Krieter Fachärztin für Kinder-

Mehr

Ergotherapie. Wir bieten Ihnen mit der Ergotherapie eine individuelle, ganzheitliche Förderung der persönlichen Entwicklung.

Ergotherapie. Wir bieten Ihnen mit der Ergotherapie eine individuelle, ganzheitliche Förderung der persönlichen Entwicklung. Ergotherapie Wir bieten Ihnen mit der Ergotherapie eine individuelle, ganzheitliche Förderung der persönlichen Entwicklung. Unser Angebot Wahrnehmungsfördernde Behandlungsmethoden Stimulation, Stabilisierung

Mehr

Liebe Eltern, Ihre. Tanja Völker Leiterin

Liebe Eltern, Ihre. Tanja Völker Leiterin Liebe Eltern, Kinder sind das größte Geschenk im Leben. Der Alltag mit ihnen zeigt sich indes nicht immer paradiesisch. Die Geburt eines Kindes stellt vieles auf den Kopf. Aus der Zweisamkeit entsteht

Mehr

Ergotherapie im Arbeitsfeld Pädiatrie

Ergotherapie im Arbeitsfeld Pädiatrie Ergotherapie Ergotherapie im Arbeitsfeld Pädiatrie von Heidrun Becker, Ute Steding-Albrecht 1. Auflage Thieme 2006 Verlag C.H. Beck im Internet: www.beck.de ISBN 978 3 13 125591 4 Zu Inhaltsverzeichnis

Mehr

Petra Seedorf-Gries. Eltern - Fragebogen. Name des Kindes: Geburtsdatum: Adresse: Tel. Nr.: Datum:

Petra Seedorf-Gries. Eltern - Fragebogen. Name des Kindes: Geburtsdatum: Adresse: Tel. Nr.: Datum: Petra Seedorf-Gries Praxis für Lern- und Mototherapie, Diagnostik und Beratung Praxis: In der Ratemicke 1a 51647 Gummersbach Büro/Postadresse: Gartenweg 14 51647 Gummersbach Telefon: 02354 4253 Telefax:

Mehr

Geistige Behinderung Autismus, Down- Syndrom. Mgr. Petra Hamalčíková SP4BP_2NB1 Němčina pro spec. ped. - B

Geistige Behinderung Autismus, Down- Syndrom. Mgr. Petra Hamalčíková SP4BP_2NB1 Němčina pro spec. ped. - B Geistige Behinderung Autismus, Down- Syndrom Mgr. Petra Hamalčíková SP4BP_2NB1 Němčina pro spec. ped. - B Definition der geistigen Behinderung mentale Retardierung andauernder Zustand deutlich unterdurchschnittlicher

Mehr

Fetales Alkoholsyndrom FAS/ Alkoholspektrumsstörung. Henrike Härter, Sozialpädiatrisches Zentrum Ludwigsburg 2/2017

Fetales Alkoholsyndrom FAS/ Alkoholspektrumsstörung. Henrike Härter, Sozialpädiatrisches Zentrum Ludwigsburg 2/2017 Fetales Alkoholsyndrom FAS/ Alkoholspektrumsstörung FASD Henrike Härter, Sozialpädiatrisches Zentrum Ludwigsburg 2/2017 Dauerhafte Hirnschädigung bei FASD Alkohol im Blut des Fetus in hoher Konzentration,

Mehr

Einführung/ Diagnostik

Einführung/ Diagnostik Einführung/ Diagnostik Definitionen Definitionen der Kinder- und Jugendpsychiatrie (KJP) Die KJP beschäftigt sich mit der Diagnose und Behandlung von Störungen des Verhaltens und Befindens im Entwicklungsalter.

Mehr

Frühe Diagnose, frühe Förderung frühe Besserung? Dr. med. Dorothee Veer, Kinderärztin SPATZ Meppen

Frühe Diagnose, frühe Förderung frühe Besserung? Dr. med. Dorothee Veer, Kinderärztin SPATZ Meppen Frühe Diagnose, frühe Förderung frühe Besserung? Dr. med. Dorothee Veer, Kinderärztin SPATZ Meppen Übersicht Diagnostik im SPZ anhand verschiedener Fallbeispiele Diagnostik bei besonderen Fragestellungen

Mehr

Sozialpädiatrisches Zentrum am Klinikum Weiden (Ltd. Ärztin: Dr. med. Susanne Rinnert)

Sozialpädiatrisches Zentrum am Klinikum Weiden (Ltd. Ärztin: Dr. med. Susanne Rinnert) Sozialpädiatrisches Zentrum am Klinikum Weiden (Ltd. Ärztin: Dr. med. Susanne Rinnert) Söllnerstrasse. 16 92637 Weiden Tel.: 0961 303 3331 Fax: 0961 303 3339 Zurück an: Stempel des behandelnden Kinderarztes:

Mehr

Therapeutisches Angebot

Therapeutisches Angebot Therapeutisches Angebot 1 2 Unser Blick in die Welt des Kindes Die Welt mit den Sinnen entdecken Jedes Kind vollbringt in den ersten Lebensjahren grosse Leistungen auf dem Weg zur ausdrucks- und handlungsfähigen

Mehr

Statistisches. 2015: 7,6 Mio schwerbehinderte Menschen (Beh.-Grad von 50 und mehr) 9,3% der Bevölkerung 51% Männer

Statistisches. 2015: 7,6 Mio schwerbehinderte Menschen (Beh.-Grad von 50 und mehr) 9,3% der Bevölkerung 51% Männer Seminar Inklusion 1 2 Statistisches Statistisches 2015: 7,6 Mio schwerbehinderte Menschen (Beh.-Grad von 50 und mehr) 9,3% der Bevölkerung 51% Männer Alter: 32% über 75 Jahre 44% 55-74 Jahre 22% 18-54

Mehr

S. Springer, Autismus im Kindergartenalter - Früherkennung und Frühförderung

S. Springer, Autismus im Kindergartenalter - Früherkennung und Frühförderung S. Springer, 2013 im Kindergartenalter - Früherkennung und Frühförderung Gliederung Definition - Das autistische Spektrum Begleiterkrankungen und Begleiterscheinungen Diagnostik Therapeutische Konzepte

Mehr

Häufige Begleiterkrankungen: Körperliche Erkrankungen Epilepsie Sonstige körperliche Erkrankungen

Häufige Begleiterkrankungen: Körperliche Erkrankungen Epilepsie Sonstige körperliche Erkrankungen Vorwort und Einleitung: Autismus und Gesundheit... 11 Menschen mit Autismus und das Recht auf Gesundheit.... 12 Gesundheit und Krankheit bei Menschen mit Autismus.... 12 Zu diesem Buch.......... 12 Vorsorge

Mehr

Ernst Reinhardt Verlag München Basel

Ernst Reinhardt Verlag München Basel Brita Schirmer Schulratgeber Autismus- Spektrum-Störungen Ein Leitfaden für Lehrerinnen 3. Auflage Mit 20 Abbildungen und 1 Tabelle Ernst Reinhardt Verlag München Basel Inhalt Vorwort 9 1 Was ist Autismus?

Mehr

Smith-Magenis. Magenis-Syndrom

Smith-Magenis. Magenis-Syndrom Smith-Magenis Magenis-Syndrom Schädigung (Mikrodeletion) am kurzen Arm des 17. Chromosoms (del 17p11.2) Deletierter Bereich unterschiedlich groß => uneinheitliches Symptomenbild Entdeckt und klassifiziert

Mehr

Kinder mit Autismus Spektrum in der heilpädagogischen Früherziehung. Autismus Spektrum Störung. Erstellen der Diagnose

Kinder mit Autismus Spektrum in der heilpädagogischen Früherziehung. Autismus Spektrum Störung. Erstellen der Diagnose Kinder mit Autismus Spektrum in der heilpädagogischen Früherziehung VHDS 18. September 2014 Monika Casura www.m-casura.ch Autismus Spektrum Störung Soziale Interaktion Qualitative Beeinträchtigung der

Mehr

Überblick über den Vortrag

Überblick über den Vortrag Psychosexuelle Entwicklung neurotypisch und bei Menschen im Autismus-Spektrum Barbara Rittmann Dipl.-Psych./Psychologische Psychotherapeutin Hamburger Autismus Institut Überblick über den Vortrag Psychosexuelle

Mehr

Bitte füllen Sie den Fragebogen vollständig aus! Nicht zutreffende Fragen können Sie streichen.

Bitte füllen Sie den Fragebogen vollständig aus! Nicht zutreffende Fragen können Sie streichen. zurück an: Städt. Klinikum Solingen ggmbh Sozialpädiatrisches Zentrum z. H. Frau Skoppeck / Frau Fritz Gotenstr. 1 42653 Solingen Bitte füllen Sie den Fragebogen vollständig aus! Nicht zutreffende Fragen

Mehr

Anamnesebogen für Kinder mit Sprachentwicklungsstörungen

Anamnesebogen für Kinder mit Sprachentwicklungsstörungen Anamnesebogen für Kinder mit Sprachentwicklungsstörungen Persönliche Daten des Kindes Vorname Geburtsdatum Telefon: Handy: Berufe der Eltern: Nachname Adresse PLZ/Ort Krankenkasse: Kindergarten/Schule:

Mehr

Gesamtplan 58 SGB XII für Kinder

Gesamtplan 58 SGB XII für Kinder Gesamtplan 58 SGB XII für Kinder 09.06.2016 1.1 Personendaten Kind Name: Anschrift: Geschlecht: Staatsangehörigkeit: Leibliche Geschwister: Anzahl Pflegekindergeschwister: 1.2 Beteiligte am Eingliederungshilfeprozess

Mehr

in der industrialisierten Welt stark ansteigt und auch weiter ansteigen wird, ist mit einer weiteren Zunahme der Zahl der Betroffenen

in der industrialisierten Welt stark ansteigt und auch weiter ansteigen wird, ist mit einer weiteren Zunahme der Zahl der Betroffenen Vorwort Der Morbus Parkinson, also die Parkinson sche Krankheit (lat. Morbus = Krankheit), ist eine häufige neurologische Krankheit. Mit höherem Lebensalter steigt die Wahrscheinlichkeit, an dieser Erkrankung

Mehr

1. Angaben zum Antragsteller/in (Kind): 2. Angaben zur Kindertagesstätte: Familienname. Vorname(n) PLZ, Wohnort. Straße, Hausnummer.

1. Angaben zum Antragsteller/in (Kind): 2. Angaben zur Kindertagesstätte: Familienname. Vorname(n) PLZ, Wohnort. Straße, Hausnummer. Fragebogen zur Umsetzung der Inklusion von Kindern mit Behinderungen in Kindertagesstätten zum Antrag auf Eingliederungshilfe gemäß 53 SGBXII / 35a SGBVIII 1. Angaben zum Antragsteller/in (Kind): Familienname

Mehr

Fragebogen zur Umsetzung der Inklusion von Kindern mit Behinderungen in Kindertagesstätten

Fragebogen zur Umsetzung der Inklusion von Kindern mit Behinderungen in Kindertagesstätten Fragebogen zur Umsetzung der Inklusion von Kindern mit Behinderungen in Kindertagesstätten 1. Angaben zum Antragsteller/in (Kind): Familienname Vorname(n) PLZ, Wohnort Straße, Hausnummer Geburtsdatum Tel.-Nr.

Mehr

Dysphagie Prävalenz-Bedeutung-Diagnose-Therapie

Dysphagie Prävalenz-Bedeutung-Diagnose-Therapie GESKES Zertifikationskurs 2014 Dysphagie Prävalenz-Bedeutung-Diagnose-Therapie Esther Thür Physiotherapie Nord 1+2 Inhalt Dysphagieformen Bedeutung Dysphagie Erkennen Behandlungsmöglichkeiten Dysphagie

Mehr

Original-Prüfungsfragen zum Thema Pädiatrie

Original-Prüfungsfragen zum Thema Pädiatrie 1. Welche der nachstehenden Aussagen, unter dem Gesichtspunkt einer normalen Entwicklung des Kindes, sind richtig? 1. Etwa im Alter von 5-6 Monaten hat sich das Geburtsgewicht des Kindes verdoppelt. 2.

Mehr

Ich bin mir Gruppe genug

Ich bin mir Gruppe genug Ich bin mir Gruppe genug Leben mit Autismus Spektrum bzw. Asperger Syndrom Mag. Karin Moro, Diakoniewerk OÖ. Autismus Spektrum Störung Tiefgreifende Entwicklungsstörung (Beginn: frühe Kindheit) Kontakt-

Mehr

GEMEINSAM MANCHMAL EINSAM?

GEMEINSAM MANCHMAL EINSAM? GEMEINSAM MANCHMAL EINSAM? IMPaCCT Gruppe 4 Dargestellt am Beispiel des Kindergartens der Lebenshilfe Salzburg KINDERGARTEN DER LEBENSHILFE SALZBURG 2 Heilpädagogische Gruppe mit jeweils 8 Kindern mit

Mehr

Freiburger Elterntraining

Freiburger Elterntraining Freiburger Elterntraining für Autismus-Spektrum-Störungen 2015, Springer Verlag Berlin Heidelberg. Aus: Brehm et al.: FETASS Freiburger Elterntraining für Autismus-Spektrum-Störungen 1.1 Die Module und

Mehr

A n m e l d e b o g e n. geb. am: Geschlecht: weiblich männlich Nationalität. Straße/Haus-Nr.: PLZ/Ort:

A n m e l d e b o g e n. geb. am: Geschlecht: weiblich männlich Nationalität. Straße/Haus-Nr.: PLZ/Ort: ggmbh Bodelschwinghstraße 23 * 22337 Hamburg Telefon: 50 77 02 * Fax: 50 77-31 91 email: spz@werner-otto-institut.de Sozialpädiatrisches Zentrum zur Früherkennung und Behandlung entwicklungsgestörter oder

Mehr

Versorgung von Patienten mit Tiefer Hirnstimulation in Dülmen. Neurologische Klinik Dülmen - Christophorus-Kliniken

Versorgung von Patienten mit Tiefer Hirnstimulation in Dülmen. Neurologische Klinik Dülmen - Christophorus-Kliniken in Dülmen Neurologische Klinik Dülmen - Christophorus-Kliniken 1 in der Neurologischen Klinik Dülmen 1.Einleitung 2.Der geeignete Patient für die Tiefe Hirnstimulation 3.Vorbereitung vor der Operation

Mehr

Das Lennox- Gastaut-Syndrom

Das Lennox- Gastaut-Syndrom Prof. Dr. med. Ulrich Stephani Das Lennox- Gastaut-Syndrom Diagnose, Behandlung und Unterstützung im Alltag Inhalt Vorwort 5 Was ist das Lennox-Gastaut-Syndrom? 6 Was ist Epilepsie? 6 Was ist ein Epilepsiesyndrom?

Mehr

Hilfen für Menschen mit erworbener Hirnschädigung in den v. Bodelschwinghschen Stiftungen Bethel am Beispiel des Hauses Rehoboth

Hilfen für Menschen mit erworbener Hirnschädigung in den v. Bodelschwinghschen Stiftungen Bethel am Beispiel des Hauses Rehoboth Hilfen für Menschen mit erworbener Hirnschädigung in den v. Bodelschwinghschen Stiftungen am Beispiel des Hauses Rehoboth Michael Kamp, Teamleitung Haus Rehoboth Michael Kamp, Teamleitung Haus Rehoboth

Mehr

Katrin Otto / Barbara Wimmer Unterstützte Kommunikation Ein Ratgeber für Eltern, Angehörige sowie Therapeuten und Pädagogen

Katrin Otto / Barbara Wimmer Unterstützte Kommunikation Ein Ratgeber für Eltern, Angehörige sowie Therapeuten und Pädagogen Katrin Otto / Barbara Wimmer Unterstützte Kommunikation Ein Ratgeber für Eltern, Angehörige sowie Therapeuten und Pädagogen Ratgeber für Angehörige, Betroffene und Fachleute herausgegeben von Prof. Dr.

Mehr

Konzept zur Förderung von Schülerinnen und Schülern mit autistischem Verhalten an der IGS Helpsen

Konzept zur Förderung von Schülerinnen und Schülern mit autistischem Verhalten an der IGS Helpsen Konzept zur Förderung von Schülerinnen und Schülern mit autistischem Verhalten an der IGS Helpsen Vorbemerkung Das vorliegende Konzept ist Teil des Schulkonzepts der IGS Helpsen und bezieht sich auf die

Mehr

Entwicklungspsychologische Aspekte bei frühgeborenen Kindern

Entwicklungspsychologische Aspekte bei frühgeborenen Kindern Entwicklungspsychologische Aspekte bei frühgeborenen Kindern Christoph Schneidergruber Villach 14.5.2012 ASPEKTE Risikofaktoren Psychologische Entwicklungsdiagnostik Emotionale Faktoren/Schutzfaktoren

Mehr

Patienteninformation

Patienteninformation Patienteninformation Zahn-, Muskel-, Kiefergelenksschmerzen, Gesichts- und Kopfschmerzen, Ohrenschmerzen/Tinnitus, Nacken-, Schulter- und Rückenschmerzen Schwindel Ursachen und Behandlung Fehlstellung

Mehr

Wir danken folgenden Einrichtungen für Ihre Mitarbeit:

Wir danken folgenden Einrichtungen für Ihre Mitarbeit: Wir danken folgenden Einrichtungen für Ihre Mitarbeit: 1. Die kleinen Strolche, DRK-Familienzentrum Ladbergen 2. Additiver Else-Weecks-Kindergarten des DRK, Bottrop 3. Caritasverband Dortmund e.v., Sprachheilkindergarten

Mehr

Autismus-Spektrum-Störung im Versorgungssystem der Jugendhilfe. Prof. Dr. med. Judith Sinzig

Autismus-Spektrum-Störung im Versorgungssystem der Jugendhilfe. Prof. Dr. med. Judith Sinzig Autismus-Spektrum-Störung im Versorgungssystem der Jugendhilfe Prof. Dr. med. Judith Sinzig Symptomatik Autismus Spektrum Störungen (ASS) Qualitative Beeinträchtigung der reziproken sozialen Interaktion

Mehr

Autistische Kinder Symptomatik Diagnostik Komorbiditäten. Jan Hendrik Puls, Kiel

Autistische Kinder Symptomatik Diagnostik Komorbiditäten. Jan Hendrik Puls, Kiel Autistische Kinder Symptomatik Diagnostik Komorbiditäten Jan Hendrik Puls, Kiel Offenlegung In den vergangenen fünf Jahren habe ich direkte finanzielle Zuwendungen für Vorträge, Beratungstätigkeiten und

Mehr

KONZEPTION FÖRDERBEREICH

KONZEPTION FÖRDERBEREICH KONZEPTION FÖRDERBEREICH Gesetzliche Grundlagen und Auftrag In der Fördergruppe an der Werkstatt für behinderte Menschen werden Menschen betreut und gefördert, die die Voraussetzung für eine Beschäftigung

Mehr

Maßnahmen der Ergotherapie

Maßnahmen der Ergotherapie Ergotherapie Maßnahmen der Ergotherapie Motorisch-funktionelle Behandlung Eine motorisch-funktionelle Behandlung dient der gezielten Therapie krankheitsbedingter Störungen der motorischen Funktionen mit

Mehr

Feinfühliges Verhalten: Basis für die Entwicklung einer sicheren Bindungsbeziehung

Feinfühliges Verhalten: Basis für die Entwicklung einer sicheren Bindungsbeziehung en: Basis für f r Entwicklung Feinfühliges Verhalten: Basis für die Entwicklung einer sicheren 21.02.2008 Feinfühligkeit erfahren ein einfühlsamer Mensch werden 1 Wenn ein Baby auf die Welt kommt, bringt

Mehr

Kinderneurologisches Zentrum SPZ Hagen Sozialpädiatrisches Zentrum an der Kinderklinik des AKH Vorstellung

Kinderneurologisches Zentrum SPZ Hagen Sozialpädiatrisches Zentrum an der Kinderklinik des AKH Vorstellung Vorstellung Mitarbeiter 1. Entstehungsgeschichte 2. Was ist ein SPZ? 3. Arbeitsweise und Organisationsstruktur 4. Fallbeispiele . Das Team zur Zeit (im Aufbau und in Erweiterung begriffen) Hr. Dr. W. Hammacher

Mehr

1. Interventionssetting

1. Interventionssetting 1. Interventionssetting S. Schreiber ambulant teilstationär stationär O O O O O O 2. Multimodale Behandlung 2.1 Aufklärung und Beratung der Eltern S. Schreiber Information über Symptomatik, Ätiologie,

Mehr

ERGOTHERAPIE für Kinder

ERGOTHERAPIE für Kinder ERGOTHERAPIE für Kinder Cornelia Kolar Jägerstraße 63/7 Kagraner Platz 13/11 1200 Wien 1220 Wien Tel.: 0699 11 37 3000 www.ergotherapie-kolar.at E-mail: cornelia.kolar@gmx.at Mein ergotherpeuthischer Werdegang

Mehr

Autismus-Spektrum-Störung neuropädiatrische Einführung in das Thema

Autismus-Spektrum-Störung neuropädiatrische Einführung in das Thema Autismus-Spektrum-Störung neuropädiatrische Einführung in das Thema P. Weber Universitäts-Kinderspital beider Basel Abteilung Neuro-/Entwicklungspädiatrie Peter.Weber@ukbb.ch Kernmerkmale des Autismus

Mehr

Kinder und Jugendliche mit Autismus-Spektrum-Störung -Aufgabe der Teilhabe für alle Schularten

Kinder und Jugendliche mit Autismus-Spektrum-Störung -Aufgabe der Teilhabe für alle Schularten Kinder und Jugendliche mit Autismus-Spektrum-Störung -Aufgabe der Teilhabe für alle Schularten Wir finden Wege gemeinsam Unterricht in der katholischen Schule entwickeln 27./28. September 2016 in Bonn

Mehr

Haverland Dr. Kerckhoff Homöopathie für Frauen

Haverland Dr. Kerckhoff Homöopathie für Frauen Haverland Dr. Kerckhoff Homöopathie für Frauen Daniela Haverland Dr. Annette Kerckhoff Homöopathie für Frauen 193 Abbildungen S. Hirzel Verlag Stuttgart 4 Inhalt Inhalt Einige Worte zuvor 6 Was dieses

Mehr

Inhalt. Was ist Autismus? Liebe Leserin, lieber Leser 9. Intelligenz und spezielle Begabungen 33. Was die Eltern erleben 12

Inhalt. Was ist Autismus? Liebe Leserin, lieber Leser 9. Intelligenz und spezielle Begabungen 33. Was die Eltern erleben 12 Was ist Autismus? Liebe Leserin, lieber Leser 9 Was die Eltern erleben 12 Das Kind verhält sich anders als erwartet 13 Die Eltern trifft keine Schuld 17 Wie die Diagnose gestellt wird 19 Anamnese: Das

Mehr

I N F O R M A T I O N

I N F O R M A T I O N I N F O R M A T I O N zur Pressekonferenz mit Sozial-Landesrat Josef Ackerl, Prim. Dr. Werner Gerstl, ärztlicher Direktor Diakonie Zentrum Spattstraße und Mag. a (FH) Andrea Boxhofer, Abteilungsleitung

Mehr

Vortrag: EEG- Neurofeedback

Vortrag: EEG- Neurofeedback Facharzt für Kinder- und Jugendheilkunde Vortrag: EEG- Neurofeedback Organisation des Nervensystems Cortex cerebri (Hirnrinde): 10-50 Mrd. Neurone und Gliazellen ( Stützzellen ) Alle Prozesse, die unter

Mehr

Teure Odyssee durch das Gesundheitssystem

Teure Odyssee durch das Gesundheitssystem Fetale Alkoholspektrum-Störungen Teure Odyssee durch das Gesundheitssystem. Hilfen zur Erziehung - Eingliederungshilfe Neuendorfer Str. 60 13585 Berlin-Spandau www.ev-sonnenhof.de sonnenhof-ev@t-online.de

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

zahlreicher Bücher auswendig zu lernen. Es war ihm darüber hinaus möglich, mit dem rechten und dem linken Auge zeitgleich je eine

zahlreicher Bücher auswendig zu lernen. Es war ihm darüber hinaus möglich, mit dem rechten und dem linken Auge zeitgleich je eine zahlreicher Bücher auswendig zu lernen. Es war ihm darüber hinaus möglich, mit dem rechten und dem linken Auge zeitgleich je eine Buchseite»einzuscannen«. Er konnte in Sekundenschnelle Stadtpläne der ganzen

Mehr

Tiefgreifende frühkindliche Ent w ckl ickl ngsstör ngen

Tiefgreifende frühkindliche Ent w ckl ickl ngsstör ngen Tiefgreifende frühkindliche Entwicklungsstörungen ngsstör ngen C. Mehler-Wex SS2007 Aufbau von Bindung vier Phasen (Ainsworth 1973) Phase Lebens- Monat Qualität 1 0 2 Unspezifische soziale Reaktionen (Horchen,

Mehr

Intel igenzminderung

Intel igenzminderung Intelligenzminderung Intelligenzminderung ist eine sich in der Entwicklung manifestierende, stehen gebliebene oder unvollständige Entwicklung der geistigen Fähigkeiten, mit besonderer Beeinträchtigung

Mehr

Was ist wirklich früh?

Was ist wirklich früh? Bonner Fortbildungsreihe Interdisziplinäres Symposium Was ist wirklich früh? Workshop Interdisziplinäre Frühförderung Georgia Klabunn & Frauke Mengden Körperlich-sinnliches Wahrnehmen Erleben und Eigenaktivität

Mehr

Für ganz wenige ganz viel mehr. Autismuszentrum

Für ganz wenige ganz viel mehr. Autismuszentrum Für ganz wenige ganz viel mehr. Autismuszentrum Eine C-Organisation der Diagnose Autismus - wie weiter? Autismus ist eine tiefgreifende Entwicklungsstörung mit einem vielfältigen Erscheinungsbild. Daher

Mehr

Ergotherapeutische Betreuung und Förderung autistischer Menschen im Übergang zum Erwachsenenalter

Ergotherapeutische Betreuung und Förderung autistischer Menschen im Übergang zum Erwachsenenalter Ergotherapeutische Betreuung und Förderung autistischer Menschen im Übergang zum Erwachsenenalter Beschreibung der Entstehung eines dienstübergreifenden lokalen Netzwerks mit langfristigem und alltagsorientierten

Mehr

Psychotherapie bei Kindern und Jugendlichen mit geistiger Behinderung - ein Einblick

Psychotherapie bei Kindern und Jugendlichen mit geistiger Behinderung - ein Einblick Psychotherapie bei Kindern und Jugendlichen mit geistiger Behinderung - ein Einblick Vortrag Stefan Meir PIA der St. Lukas-Klinik Zum Vierteljahrestreffen der KJPP-Kliniken Baden - Württemberg am 23.03.2015

Mehr

Was ist ESDM? Das Early Start Denver Modell (ESDM) von S. Rogers & G. Dawson. Ablauf. Umsetzung und Rahmenbedingungen

Was ist ESDM? Das Early Start Denver Modell (ESDM) von S. Rogers & G. Dawson. Ablauf. Umsetzung und Rahmenbedingungen Das Early Start Denver Modell (ESDM) von S. Rogers & G. Dawson Was ist ESDM? Ablauf Umsetzung und Rahmenbedingungen Methodenund Technikenzur Erreichung der Förderziele 1 Familienzentrierung Einbeziehung

Mehr

Inhalt. 1 Einleitung... 7

Inhalt. 1 Einleitung... 7 Inhalt 1 Einleitung........................................ 7 2 Feststellen des Autismus und ähnlicher Erkrankungen..................................... 12 2.1 Was ist eine Diagnose und warum ist sie notwendig?.......

Mehr

Anmeldebogen Sozialpädiatrisches Zentrum Dinslaken

Anmeldebogen Sozialpädiatrisches Zentrum Dinslaken Anmeldebogen Sozialpädiatrisches Zentrum Dinslaken PERSONALIEN: Kinderabteilung Sozialpädiatrisches Zentrum (SPZ) Chefarzt Dr. Kluitmann 0 20 64 / 44-0 Durchwahl: 0 20 64 / 44-14 02 Fax 0 20 64 / 44-14

Mehr

Cindy Former & Jonas Schweikhard

Cindy Former & Jonas Schweikhard Cindy Former & Jonas Schweikhard Definition Krankheitsbild Entdeckung Ursachen Biochemische Grundlagen Diagnostik Therapie Quellen Morbus Parkinson ist eine chronisch progressive neurodegenerative Erkrankung

Mehr

Fragebogen für Ambulantes Betreutes Wohnen

Fragebogen für Ambulantes Betreutes Wohnen Fragebogen für Ambulantes Betreutes Wohnen Name, Vorname... Geb.-Dat.: Geb.-Ort:... Geschlecht, Fam.-Stand:... Beruf:... Staatsangehörigkeit:... Konfession:... Taufe: ja, Datum nein Erstkommunion: ja,

Mehr

eine Krankheit zu heilen, ihre Verschlimmerung zu verhindern oder Beschwerden zu lindern (Kuration)

eine Krankheit zu heilen, ihre Verschlimmerung zu verhindern oder Beschwerden zu lindern (Kuration) Ergotherapie Die Ergotherapie unterstützt Menschen jeden Alters, die aufgrund einer Erkrankung, Verletzung oder Behinderung in ihrer Handlungsfähigkeit eingeschränkt sind oder denen dies droht. Mit verschiedenen

Mehr

Schlucken / Verdauung und Darm. Aufmerksamkeit / Gedächtnis

Schlucken / Verdauung und Darm. Aufmerksamkeit / Gedächtnis Parkinson-Tagebuch: Untersuchung Ihrer Symptome Um das Parkinson-Tagebuch auszufüllen, folgen Sie bitte den Anweisungen der vorherigen Seite. Schlafstörungen abe Probleme, nachts einzuschlafen abe Probleme,

Mehr

Diagnose Epilepsie TRIAS. Dr. med. Günter Krämer

Diagnose Epilepsie TRIAS. Dr. med. Günter Krämer Dr. med. Günter Krämer Diagnose Epilepsie Kurz & bündig: Wie Sie - die Krankheit verstehen - die besten Therapien für sich nutzen - und Ihren Alltag optimal gestalten TRIAS INHALT Was Sie wissen sollten

Mehr

Spracherwerbsstörungen Was muss die Kinderärztin wissen?

Spracherwerbsstörungen Was muss die Kinderärztin wissen? Spracherwerbsstörungen Was muss die Kinderärztin wissen? Oskar Jenni Abteilung Entwicklungspädiatrie Universitätskinderkliniken Zürich 43. Oster-Seminar-Kongress Brixen, 30. März 2010 Sprachentwicklung

Mehr

Autismus-Spektrum-Störungen (frühkindlicher Autismus, Asperger-Syndrom)

Autismus-Spektrum-Störungen (frühkindlicher Autismus, Asperger-Syndrom) Autismus-Spektrum-Störungen (frühkindlicher Autismus, Asperger-Syndrom) Prof. Dr. Michael Günter Klinik für Kinder- und Jugendpsychiatrie und Psychotherapie Wintersemester 2017/2018 Tiefgreifende Entwicklungsstörungen

Mehr

Unterstützte Kommunikation in der Sprachtherapie

Unterstützte Kommunikation in der Sprachtherapie Hildegard Kaiser-Mantel Unterstützte Kommunikation in der Sprachtherapie Bausteine für die Arbeit mit Kindern und Jugendlichen Mit 46 Abbildungen und 3 Tabellen Ernst Reinhardt Verlag München Basel Hildegard

Mehr

Patienten 2.1 Kasuistiken A.II:7, geb , männlich: A.II:8, geb , männlich:

Patienten 2.1 Kasuistiken A.II:7, geb , männlich: A.II:8, geb , männlich: 2 Patienten 2.1 Kasuistiken Ich untersuchte eine konsanguine Familie aus dem Libanon mit 11 Kindern (Stammbaum siehe Abbildung 6). Drei Kinder sind weiblich und acht männlich. Die Eltern sind Cousin/Cousine

Mehr

A. Ludwig, K. Ziegenhorn, S. Empting, T. Meissner*, J. Marquard*, K. Mohnike Universitätskinderkliniken Magdeburg und *Düsseldorf

A. Ludwig, K. Ziegenhorn, S. Empting, T. Meissner*, J. Marquard*, K. Mohnike Universitätskinderkliniken Magdeburg und *Düsseldorf 1 Standardisierte psychologische Untersuchung von 59 Patienten mit congenitalem Hyperinsulinismus A. Ludwig, K. Ziegenhorn, S. Empting, T. Meissner*, J. Marquard*, K. Mohnike Universitätskinderkliniken

Mehr

Verunsichert, ängstlich, aggressiv

Verunsichert, ängstlich, aggressiv Helga Simchen Verunsichert, ängstlich, aggressiv Verhaltensstörungen bei Kindern und Jugendlichen - Ursachen und Folgen Verlag W. Kohlhammer Vorwort 9 1 Ängstlich und aggressiv als Kind - psychisch krank

Mehr

Jahrestagung SGEP Olten Dr. med. F. Steiner,

Jahrestagung SGEP Olten Dr. med. F. Steiner, Neue Aspekte bei motorischer Ungeschicklichkeit (F82) Jahrestagung SGEP Olten Dr. med. F. Steiner, 3.11.2011 Was tut sich an der Front bezüglich F82? Leitlinie zur UEMF für den Deutschsprachigen Raum Europäische

Mehr

Sorgen um und für Versorgung von "Sorgenkindern" am Beispiel Fragiles-X Syndrom

Sorgen um und für Versorgung von Sorgenkindern am Beispiel Fragiles-X Syndrom Sorgen um und für Versorgung von "Sorgenkindern" am Beispiel Fragiles-X Syndrom Versorgung von Patienten mit SE im Alltag ACHSE/vfa/vfa bio - Berlin, 31.1.2013 Dr. Jörg Richstein Übersicht Sorgenkinder?

Mehr

BAUSTEIN IV Therapeutische Angebote IV/1

BAUSTEIN IV Therapeutische Angebote IV/1 BAUSTEIN IV Therapeutische Angebote IV/1 Element 1 Krankengymnastik Niederländische Krankengymnastinnen und -gymnasten einer Praxis aus Niederkrüchten sind an vier Tagen in der Woche an unserer Schule

Mehr

Wir danken für Ihr Interesse Ihr Kind am Institut für Sinnes- und Sprachneurologie vorzustellen.

Wir danken für Ihr Interesse Ihr Kind am Institut für Sinnes- und Sprachneurologie vorzustellen. Bitte retournieren an: Institut für Sinnes- und Sprachneurologie Sekretariat Neurologisch linguistische Ambulanz Seilerstätte 2 A-4021 Linz Konventhospital Barmherzige Brüder Linz Akademisches Lehrkrankenhaus

Mehr

Dravet Syndrom: Mehr als nur Anfälle

Dravet Syndrom: Mehr als nur Anfälle Dravet Syndrom: Mehr als nur Anfälle Dr. med. Sarah von Spiczak, Prof. Dr. med. Ulrich Stephani Klinik für Neuropädiatrie & AG Pädiatrische Epilepsiegenetik s.vonspiczak@pedneuro.uni-kiel.de www.epilepsiegenetik.de

Mehr