ESBL, AmpC & Co. Beta-Lactamasen in Enterobacteriaceae

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "ESBL, AmpC & Co. Beta-Lactamasen in Enterobacteriaceae"

Transkript

1 Antibiotikaresistenz Gram-negativer nosokomialer Infektionserreger ESBL, AmpC & Co. Beta-Lactamasen in Enterobacteriaceae Yvonne Pfeifer Bad Honnef Symposium 2008

2 Enterobakterien (Enterobacteriaceae) als nosokomiale Erreger Escherichia coli Klebsiella ssp. Enterobacter ssp. Citrobacter ssp. Providencia ssp. Klebsiella ssp. Escherichia coli Harnwegsinfektionen, Urosepsis Wundinfektionen, Bakteriämie Sepsis Infektion der Atemwege/ Nosokomiale Pneumonie Therapie: Fluorchinolone (Ciprofloxacin) Beta-Lactam-Antibiotika Aminobenzylpenicilline (Ampicillin) Cephalosporine (Ceftazidim, Cefotaxim) Monobactame (Aztreonam) Carbapeneme (Imipenem, Meropenem) 6-Aminopenicilliansäure

3 Mechanismen der Beta-Lactam-Resistenz Beta-Lactam Hydrolyse Enterobacteriaceae 2. Abb. sitemaker.umich.edu/.../files/resistance.gif P. aeruginosa

4 Einteilung der β-lactamasen nach Ambler Serin-β-Lactamasen Metallo-β-Lactamasen A C D TEM-1 SHV-1 ESBL TEM SHV CTX-M Ceftazidim Cefotaxim Cefpodoxim AmpC CMY MOX ACT Cefoxitin Ceftazidim Cefotaxim Cefpodoxim Enterobacteriaceae ESBL OXA Resistenzen Oxacillin Carbapeneme B Carbapenemasen VIM IMP Imipenem Meropenem P. aeruginosa; Enterobacteriaceae

5 Verbreitung der ESBL-Gene Mobilisierung chromosomaler Vorläufer-Gene über Transposons und Integration in Resistenzplasmide Horizontaler Gentransfer - Übertragung von konjugativen Plasmiden innerhalb der Spezies oder in andere Spezies A B Ausbreitung von Resistenz- Plasmiden zwischen verschiedenen Spezies A Donor B Rezipient Akkumulation von verschiedenen Resistenzgenen auf mehreren Transposons hintereinander möglich: multi-drug resistance regions (MDR) Multiresistenz

6 Verbreitung der Cephalosporin-Resistenz bei Enterobakterien EARSS - European Antimicrobial Resistance Surveillance System In Deutschland sind derzeit 5% der E. coli resistent gegenüber Cephalosporinen der Gruppe 3

7 Untersuchungen zu Auftreten und Verbreitung der β-lactamasen in Enterobacteriaceae in Deutschland NS(20) n = 30 NRW(16) n = 36 H (5) n = 7 RP(3) 2 BW(14) n = 29 MVP(2) n = 20 B (1) n = 20 BY(11) 5 Sammlung von klinischen Isolaten mit bundesweitem Einzugsgebiet Enterobacteriaceae 63 Escherichia coli n = 91 Klebsiella pneumoniae n = 37 Klebsiella oxytoca n = 22 Enterobacter cloacae n = 8 Enterobacter aerogenes n = 2 Citrobacter freundii n = 2 Providencia stuartii Phänotypische Resistenzbestimmung Genotypische Charakterisierung: B, Berlin; BW, Baden-Württemberg; BY, Bayern; H, Hessen; MVP, Mecklenburg-Vorpommern; NRW, Nordrhein-Westfalen; NS, Niedersachsen; RP, Rheinland-Pfalz; (x), Anzahl der Kliniken; n = x, Anzahl der Isolate aus den Kliniken des jeweiligen Bundeslandes PCR und Sequenzierung relevanter Resistenz Gene (bla TEM, bla SHV, bla CTX-M, bla ampc ) Einsatz schnelldiagnostischer Methoden (Microarray)

8 Beta-Lactamase-Typ und Phänotypische Resistenz Antibiotika Hemmbarkeit durch β-lactamase AP CPD CTX CAZ FOX SUL, CLV, EDTA TEM ESBL R R V R S SUL, CLV SHV ESBL R R V R S SUL, CLV CTX-M-ESBL R R R V S SUL, CLV K1 (K. oxytoca) R R V S S - AmpC R R R R R - MBL R R R R R EDTA AP, Ampicillin; CPD, Cefpodoxim; CTX, Cefotaxim; CAZ, Ceftazidim; FOX, Cefoxitin; SUL, Sulbactam; CLV, Clavulansäure; Resistent; V, variabel; S, sensitiv Veränderung des Phänotyps durch Kombination von verschiedenen Beta-Lactamasen in einem Isolat Molekulare Diagnostik (Resistenz-Genotyp) erforderlich

9 Projekt-Ergebnisse: ESBL in Enterobacteriaceae bla TEM n = 76 bla SHV n = 49 bla CTX-M n = 56 TEM-1 TEM-12 TEM-29 TEM-30 TEM-52 n = 57 n = 3 4 SHV-1 SHV-2 SHV-2a SHV-5 SHV-11 SHV-12 SHV-28 SHV-33 SHV-36 SHV-31 SHV-76 n = 9 1 n = 4 n = 5 n = 4 1 CTX-M-1 CTX-M-2 CTX-M-3 CTX-M-9 CTX-M-10 CTX-M-14 CTX-M-15 CTX-M-58 1 n = n = 5 1 n = 2 ESBL-Typen in E. coli, Klebsiella spp. sowie Enterobacter cloacae Dominanz von CTX-M-Typen (61% aller ESBL-Bildner) Identifikation neuer Varianten SHV-76 und CTX-M-58 Mehr als 1/3 der ESBL-Isolate sind multiresistent

10 AmpC-β-Lactamasen in Enterobacteriaceae Plasmid-kodierte AmpC-β-Lactamasen CMY ACC ACT FOX LAT MOX 6 Gen-Familien abgeleitet von verschiedenen Ursprungsspezies High-level Expression z.b. in E. coli ; K. pneumoniae Cefoxitin-resistent Chromosomal-kodierte AmpC-β-Lactamasen Konstitutive o. induzierbare high-level Expression des Wildtyp ampc Gens in E. cloacae, Citrobacter freundii Cefoxitin-resistent Konstitutive low-level Expression des Wildtyp ampc Gens in Escherichia coli Cefoxitin-sensitiv

11 Cephalosporin-Resistenz verursacht durch AmpC-β-Lactamasen Cefoxitin-Resistenz in E. coli : Plasmid-kodierte AmpC-β-Lactamasen chromosomal-kodierte AmpC-β-Lactamasen Sequenzierung der chromosomalen ampc Promoter Region box box -1 WT AmpC* TCCTGACAGTTGTCACGCTGATTGGTGTCGTTACAATCTAACGCATCGCCAATGTAAATCCGGCCCGCC 108/04 --T A T / A---A T / I T WT AmpC* TATGGCGGGCCGTTTTGTATGGAAACCAGACCCTATGTTCAAAACGACGCTCTGCGCCTTATTAAT 108/ T / D T A / T Ergebnis: High-level Expression des E. coli ampc durch Promoter-Mutationen

12 XbaI-Makrorestriktionsanalyse: (PFGE) Pulsfeld-Gelelektrophorese Cefoxitin-resistenter E. coli Isolate Dice (Tol 1%-1%) (H>0.0% S>0.0%)[ %] RKI-Nr. 65/04 109/04 78/04 86/04 66/04 87/04 108/04 15/04 43/04 18/04 21/ /04 74/04 85/04 17/04 54/04 51/04 56/04 16/04 68/04 36/04 30/04 49/04 99/04 28/04 24/04 67/04 98/04 89/04 62/04 Bundesland BW BY BW NRW BY NRW NRW RP BW BW H n.s. NRW RP RP NRW BY n.s. NRW BW BW BY BW H BW NRW BY H RP n.s. neuer ampc- Promoter Phylogenetische Gruppe A neuer ampc- Promoter Phylogenetische Gruppe A

13 Projekt Antibiotika-Resistenz-Surveillance in Deutschland (ARS) Cephalosporin-Resistenz in Enterobacteriaceae Molekulare Untersuchung von ESBL Isolaten (Blutkultur) aus mehr als 50 beteiligten Kliniken: Escherichia coli Klebsiella pneumoniae Klebsiella oxytoca Proteus mirabilis Projekt-Erweiterung: Untersuchung von ESBL Isolaten anderer Herkunft (Urinkultur ambulant/nosokomial) Molekulare Untersuchung von Isolaten mit Cefoxitin-Resistenz (AmpC-β-Lactamasen) und Carbapenem-Resistenz (OXA-, Metallo-β-Lactamasen) sichere Diagnostik und deren Weiterentwicklung Erkennen von Resistenz-Trends, z. B. durch Untersuchungen von Ausbrüchen

14 Untersuchung von Ausbruchs- Isolaten 23 E. coli aus der Neonatologie/ Neointensivstation mit ESBL-Verdacht RKI-Nr. Herkunft bla-gen (ESBL-MP-PCR) 165/07 Kind TEM-1 + CTX-M /07 Kind TEM-1 + CTX-M /07 Kind TEM-1 + CTX-M /07 Kind TEM-1 + CTX-M /07 Kind CTX-M-2 170/07 Kind CTX-M-2 CTX-M-15 als häufigste ESBL-Variante Klonale Verbreitung durch Hygienemängel KLUC-1 CTX-M-10 CTX-M-3 CTX-M-28 CTX-M-15 CTX-M-22 CTX-M-23 CTX-M-1 CTX-M-21 CTX-M-17 CTX-M-24 CTX-M-14 CTX-M-9 CTX-M-16 CTX-M-6 CTX-M-7 [AAK08976] [AAF65843] [BAB40925] [AJ549244] [AAL02127] [AAL86924] [AAL99990] [P28565] [CAD08929] [AAM33515] [AAN38836] [AAF72530] [AAF05311] [AAK32961] [CAA06311] [CAA06312] KLUC-1 Gruppe CTX-M-1 Gruppe > 97 % Sequenz-Identität CTX-M-9 Gruppe > 98 % Sequenz-Identität 171/07 Kind TEM-1 + CTX-M /07 Kind TEM-1 + CTX-M /07 Kind TEM-1 + CTX-M /07 Kind TEM-1 + CTX-M /07 Kind CTX-M /07 Kind CTX-M /07 Kind TEM-1 + CTX-M /07 Kind TEM-1 + CTX-M /07 Kind TEM-1 + CTX-M /07 Kind TEM-1 + CTX-M /07 Kind TEM-1 + CTX-M /07 Kind TEM-1 + CTX-M-15 CTX-M-4 CTX-M-2 CTX-M-20 KLUA-Enzyme [CAA74573] [P74841] [CAC95175] [CAB59824] CTX-M-2 Gruppe > 94 % Sequenz-Identität 183/07 Mutter TEM-1 + CTX-M-1 184/07 Personal TEM-1 + CTX-M-15 KLUG-1 CTX-M-8 CTX-M-25 CTX-M-26 [AF501233] [AAF04388] [AAM70498] [AY157676] CTX-M-8 Gruppe > 98 % Sequenz-Identität CTX-M-25 Gruppe > 98 % Sequenz-Identität 20/08 (1) Mutter TEM-1 + CTX-M-15 20/08 (2) Mutter TEM-1 + CTX-M-15 21/08 Personal TEM-1 + CTX-M-15

15 XbaI-Makrorestriktionsanalyse (Pulsfeld-Gelelektrophorese) E. coli ESBL PFGE-Typ CTX-M-15 CTX-M-15 CTX-M-15; TEM-1 CTX-M-9; TEM-1 CTX-M-15 SHV-5; TEM-1 CTX-M-1; TEM-1 CTX-M-14; TEM-1 CTX-M-15 CTX-M-14; TEM-1 CTX-M-3; TEM-1 CTX-M-15; TEM-1 CTX-M-15 CTX-M-15 CTX-M-15 CTX-M-1; TEM-1 CTX-M-15; TEM-1 CTX-M-1; TEM-1 CTX-M-1; TEM-1 CTX-M-65; TEM-1 CTX-M-15 CTX-M-15; TEM Dice (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%]

16 ESBL in Salmonella 16 humane Isolate Salmonella enterica serovar Typhimurium, Lysotyp DT193 aus fünf Bundesländern Gastroenteritis,Harnwegsinfektion Resistenz gegen Cephalosporine der Gruppe 3 Xba-I-Makrorestriktionsanalyse (PFGE) S S S S = S. enterica Braenderup universal marker 1 = 6/07 CTX-M-1 + TEM-1 2 = 7/07 CTX-M-1 + TEM-1 3 = 8/07 CTX-M-1 + TEM-1 4 = 9/07 CTX-M-1 + TEM-1 5 = 10/07 CTX-M-1 + TEM-1 6 = 11/07 CTX-M-1 + TEM-1 7 = 12/07 CTX-M-1 + TEM-1 Bayern Bayern Niedersachsen Thüringen Thüringen Sachsen-Anhalt Bayern Nachweis von ESBL-Varianten TEM-52 und CTX-M-1 in Salmonella serovar Infantis (human und aus tierischem Material) Salmonella als mögliches ESBL-Reservoir

17 Einteilung der β-lactamasen nach Ambler Serin-β-Lactamasen Metallo-β-Lactamasen A C D TEM-1 SHV-1 ESBL TEM SHV CTX-M Ceftazidim Cefotaxim Cefpodoxim AmpC CMY MOX ACT Cefoxitin Ceftazidim Cefotaxim Cefpodoxim Enterobacteriaceae ESBL OXA Resistenzen Oxacillin Carbapeneme B Carbapenemasen VIM IMP Imipenem Meropenem P. aeruginosa; Enterobacteriaceae

18 Carbapenem-Resistenz und Metallo-Beta-Lactamasen Mobilisierung der Gene bla VIM und bla IMP aus Acinetobacter baumannii und Pseudomonas aeruginosa und Transfer in Enterobacteriaceae Phänotyp der Metallo-beta-Lactamases: Hemmbarkeit durch EDTA Variabilität des Resistenz-Levels verursacht durch Kombination der Beta- Lactamase-Bildung mit anderen Resistenzmechanismen: Carbapenem-Resistenz und Porin-Verlust OMP outer mebrane protein (OmpA-Trimer) 1, 2bp-Deletion STOP in ompk-35 2, 384 bp-deletion in ompk-36 3, 600 bp-deletion in ompk-36 Antibiotika K.p. 5 K.p. 54 K.p. 149 Imipenem Imipenem+EDTA Meropenem bla TEM bla SHV bla CTX-M bla ampc bla VIM qnr-gen - qnr-b - Porin OmpK Porin OmpK

19 Multiresistente Klebsiellen: ESBL, AmpC- und Metallo-Beta-Lactamasen Antibiotika Ampicillin Mezlocillin K.p. 62 > 16 K.o. 57 > 16 Klonale Verbreitung von Isolaten (Klebsiella spp.) mit Resistenzen gegenüber allen eingesetzten Antibiotika MSU Cefotiam Cefotaxim Ceftazidim > 8 > 16 > 8 > 16 Ursache ist die Kombination unterschiedlicher Beta- Lactamasen sowie Porin-Defekte in den Isolaten: Beta-Lactamase Gene (bla) Cefoxitin K.p. 62 K.o. 57 Gentamicin Kanamycin > 8 2 bla TEM - - Amikacin 2 bla SHV 1 - Streptomycin Nalidixinsäure Oxytetrazyclin Chloramphenicol Ciprofloxacin Sulfameracin SXT Colistin > 64 > 8 > 64 > 512 > 128 0,5 > 64 > 8 64 > 512 > 128 0,5 bla CTX-M 9 - bla ampc CMY-4 - bla VIM 1 1 qnr-gen - qnr-b Porin OmpK35 - a - b Porin OmpK b a, IS1-Transposase in ompk-35; b, bp-deletionen Imipenem Imipenem+EDTA Meropenem bla CMY-4 und bla VIM-1 auf einem Plasmid (120 kb) lokalisiert und übertragbar

20 Danke Prof. Dr. Wolfgang Witte Dr. Guido Werner Dr. Birgit Strommenger Sibylle M.-Bertling Angela Danschke Dr. Rita Prager Dr. W. Rabsch Dr. Anne-Marie Fahr

Extended-Spectrum Beta-Lactamasen (ESBL) und Carbapenemasen

Extended-Spectrum Beta-Lactamasen (ESBL) und Carbapenemasen Bad Honnef-Symposium 2009 Antibiotikaresistenz- Mechanismen der Entstehung, Ausprägung und Ausbreitung Extended-Spectrum Beta-Lactamasen (ESBL) und Carbapenemasen Dr. Yvonne Pfeifer 06./07.04.2009 Gramnegative,

Mehr

Klassifizierung multiresistenter Keime. Dr. Ingrid Heller Sektion für Hygiene und Medizinische Mikrobiologie Hygieneteam LKI

Klassifizierung multiresistenter Keime. Dr. Ingrid Heller Sektion für Hygiene und Medizinische Mikrobiologie Hygieneteam LKI Klassifizierung multiresistenter Keime Dr. Ingrid Heller Sektion für Hygiene und Medizinische Mikrobiologie Hygieneteam LKI Definition Multiresistenz Mycobacteriumtuberculosis: MDR: Resistenz gegen INH

Mehr

Das neue Dokument zur Erkennung und Bestätigung von Resistenzmechanismen

Das neue Dokument zur Erkennung und Bestätigung von Resistenzmechanismen Das neue Dokument zur Erkennung und Bestätigung von Resistenzmechanismen Gramnegative Erreger Dr. Rainer Hartl Nationales Referenzzentrum für nosokomiale Infektionen und Antibiotikaresistenz Institut für

Mehr

Gramnegative multiresistente Erreger eine unterschätzte Gefahr

Gramnegative multiresistente Erreger eine unterschätzte Gefahr Gramnegative multiresistente Erreger eine unterschätzte Gefahr Dr. Martin Kaase NRZ für gramnegative Krankenhauserreger Ruhr-Universität Bochum martin.kaase@rub.de E. coli Wildtyp Ampicillin Piperacillin

Mehr

Bedeutung, Behandlung, Prophylaxe

Bedeutung, Behandlung, Prophylaxe ESBL und andere mulitresistente gramnegative Keime Bedeutung, Behandlung, Prophylaxe Dr. Martin Kaase NRZ für gramnegative Krankenhauserreger Ruhr-Universität Bochum martin.kaase@rub.de E. coli Wildtyp

Mehr

MRE / Diagnostik. Was wird im Labor gemacht? Heidrun Kerschner

MRE / Diagnostik. Was wird im Labor gemacht? Heidrun Kerschner MRE / Diagnostik Was wird im Labor gemacht? Heidrun Kerschner Nationales Referenzzentrum für nosokomiale Infektionen und Antibiotikaresistenz Institut für Hygiene, Mikrobiologie und Tropenmedizin Krankenhauses

Mehr

Antibiotikaresistenz bei gramnegativen Bakterien

Antibiotikaresistenz bei gramnegativen Bakterien Antibiotikaresistenz bei gramnegativen Bakterien - Fokus Carbapenemresistenz - Fachtagung multiresistente Erreger September 2012 Tilo Hackel LUA Dresden Antibiotikaresistenz ist die Folge von Antibiotikagebrauch.

Mehr

Bedeutung von Kreuzresistenz und Mehrfachresistenz bei bakteriellen Erregern für die Initialtherapie Michael Kresken. 21./22. März 2016, Königswinter

Bedeutung von Kreuzresistenz und Mehrfachresistenz bei bakteriellen Erregern für die Initialtherapie Michael Kresken. 21./22. März 2016, Königswinter Bad Honnef-Symposium 2016 Paul-Ehrlich-Gesellschaft für Chemotherapie e. V. Empfehlungen zur kalkulierten Initialtherapie bakterieller Erkrankungen bei Erwachsenen 21./22. März 2016, Königswinter Bedeutung

Mehr

3/4MRGN was macht den Unterschied oder gibt es womöglich gar keinen?

3/4MRGN was macht den Unterschied oder gibt es womöglich gar keinen? 3/4MRGN was macht den Unterschied oder gibt es womöglich gar keinen? Dr. L. Zabel Fortbildungsveranstaltung des MRE-Netzwerkes 11.03.2015 1 Viele Multiresistente Erreger Grampositive Kokken Benennung nach

Mehr

Multiresistente Erreger, insbesondere ESBL. J. Steinmann Institut für Medizinische Mikrobiologie

Multiresistente Erreger, insbesondere ESBL. J. Steinmann Institut für Medizinische Mikrobiologie Multiresistente Erreger, insbesondere ESBL J. Steinmann Institut für Medizinische Mikrobiologie Aktuelle Situation Folie 2 Resistenzmechanismen Impermeabilität der äußeren Zellmembran Geringe epidemiolog.

Mehr

Epidemiologische Analyse von S. Infantis-Isolaten aus Mensch, Tier sowie Lebensmitteln

Epidemiologische Analyse von S. Infantis-Isolaten aus Mensch, Tier sowie Lebensmitteln Epidemiologische Analyse von S Infantis-Isolaten aus Mensch, Tier sowie Lebensmitteln 50 Arbeitstagung des Arbeitsgebietes Lebensmittelhygiene der DVG 300909, Garmisch-Partenkirchen Tatjana Miller Salmonella

Mehr

Epidemiologie meldepflichtiger multiresistenter Erreger in Sachsen

Epidemiologie meldepflichtiger multiresistenter Erreger in Sachsen Epidemiologie meldepflichtiger multiresistenter Erreger in Sachsen Meißen, MRE-Fachtagung September 2016 Tilo Hackel Landesuntersuchungsanstalt Dresden, Fachgebiet Bakteriologie, Parasitologie, Wasserhygiene

Mehr

Mirkobiologische Diagnostik und Befundung bei MRGN Dr. med. Martin Chwoika

Mirkobiologische Diagnostik und Befundung bei MRGN Dr. med. Martin Chwoika Mirkobiologische Diagnostik und Befundung bei MRGN Dr. med. Martin Chwoika Fortbildungsveranstaltung Netzwerk MRE Landkreis Stendal 14.06.2017 Gramnegative Bakterien Enterobakterien* Pseudomonas aeruginosa

Mehr

ISOLATION SCREENING - DEKOLONISATION

ISOLATION SCREENING - DEKOLONISATION Extended-spectrum Beta-Laktamase (ESBL) bildende Bakterien ISOLATION SCREENING - DEKOLONISATION 15. September 2007 Prof. Dr. Kathrin Mühlemann Klinik und Poliklinik für Infektionskrankheiten Universität

Mehr

N O. Betalaktam-Ring. Penizilline. Carbapeneme. Cephalosporine. Gram negative Resistenzkeime. Mikrobiologie für Nicht-Mikrobiologen

N O. Betalaktam-Ring. Penizilline. Carbapeneme. Cephalosporine. Gram negative Resistenzkeime. Mikrobiologie für Nicht-Mikrobiologen Übersicht Gram negative esistenzkeime Mikrobiologie für icht-mikrobiologen ygienesymposium 2013 Morschach Betalaktam Chinolone Cotrimoxazol Aminoglykoside Tetrazykline Gerhard Eich, Stadtspital Triemli

Mehr

Phänotypische & genotypische Detektion von Beta-Laktamasen

Phänotypische & genotypische Detektion von Beta-Laktamasen Bad Honnef-Symposium 2013 Update Antibiotika-Resistenzen: Erkennen, Bewerten, Handeln, 25. - 26. März, Königswinter Phänotypische & genotypische Detektion von Beta-Laktamasen M 1 2 3 4 5 MP Dr. rer. nat.

Mehr

Carbapenemresistenz bei Gram-negativen Bakterien Hype oder reale Bedrohung?

Carbapenemresistenz bei Gram-negativen Bakterien Hype oder reale Bedrohung? Fortbildung für den Öffentlichen Gesundheitsdienst, Berlin 23.-25. März 2011 Carbapenemresistenz bei Gram-negativen Bakterien Hype oder reale Bedrohung? E. coli P. aeruginosa K. pneumoniae A. baumannii

Mehr

Antibiotikaresistenz und Surveillance

Antibiotikaresistenz und Surveillance Antibiotikaresistenz und Surveillance Ingo Klare, Wolfgang Witte Robert Koch-Institut, Bereich Wernigerode Klare, I., RKI, Bereich Wernigerode 1 Einführung von Antibiotika und Resistenzentwicklung: Gegenüber

Mehr

Übersichtsvortrag gram-negative Erreger

Übersichtsvortrag gram-negative Erreger Übersichtsvortrag gram-negative Erreger 9. NRW-Dialog Infektionsschutz Dr. med. Martin Kaase NRZ für gramnegative Krankenhauserreger Ruhr-Universität Bochum martin.kaase@rub.de Multiresistente Bakterien

Mehr

Was sind MRGN? Mikrobiologie und Meldepflicht

Was sind MRGN? Mikrobiologie und Meldepflicht Was sind MRGN? Mikrobiologie und Meldepflicht Fortbildungsveranstaltung der LIgA, 29. Januar / 05. Februar 2014 Dr. med. Tilo Hackel Landesuntersuchungsanstalt Dresden, Fachgebiet Bakteriologie, Mykologie,

Mehr

ESBL & AmpC Detection Disc Sets

ESBL & AmpC Detection Disc Sets Mast_ESBL_Results_6pp_v6 deutsch_layout 1 21.07.11 13:03 Seite 3 IVD solutions through partnership ESBL & AmpC Detection Disc Sets Differenzierung verschiedener Typen von Resistenz-Enzymen Einfache vergleichende

Mehr

EARS-Net QC Ergebnisse und feed-back 2015 und 2016 Nationales Referenzzentrum für NI und AMR Ordensklinikum Linz Elisabethinen

EARS-Net QC Ergebnisse und feed-back 2015 und 2016 Nationales Referenzzentrum für NI und AMR Ordensklinikum Linz Elisabethinen EARS-Net QC Ergebnisse und feed-back 21 und 216 Nationales Referenzzentrum für NI und AMR Ordensklinikum Linz Elisabethinen Univ. Prof. Dr. Petra Apfalter EARS-Net Qualitätskontrolle 216 3676 E. coli 3677

Mehr

mastdiscs combi ESBL & AmpC Detection Disc Sets Differenzierung der verschiedenen Resistenztypen Einfache Interpretation durch vergleichende Analyse

mastdiscs combi ESBL & AmpC Detection Disc Sets Differenzierung der verschiedenen Resistenztypen Einfache Interpretation durch vergleichende Analyse IVD solutions through partnership mastdiscs TM combi ESBL & AmpC Detection Disc Sets Differenzierung der verschiedenen Resistenztypen Einfache Interpretation durch vergleichende Analyse Geringer Kostenaufwand

Mehr

Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen.

Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen. Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen. Epidemiologie der antimikrobiellen Resistenzen in Deutschland und Europa Miriam Wiese-Posselt Institut für Hygiene und Umweltmedizin

Mehr

Pseudomonas aeruginosa Acinetobacter Baumannii. Gramnegative MRE. Bedeutung und Hygienemaßnahmen

Pseudomonas aeruginosa Acinetobacter Baumannii. Gramnegative MRE. Bedeutung und Hygienemaßnahmen Pseudomonas aeruginosa Acinetobacter Baumannii Gramnegative MRE E. Coli Stenotrophomonas maltophilia Bedeutung und Hygienemaßnahmen Dr. Gabriele Sinn Gesundheitsamt Charlottenburg-Wilmersdorf von Berlin

Mehr

Hygienemaßnahmen bei Infektionen oder Besiedlung mit multiresistenten gramnegativen Stäbchen

Hygienemaßnahmen bei Infektionen oder Besiedlung mit multiresistenten gramnegativen Stäbchen Hygienemaßnahmen bei Infektionen oder Besiedlung mit Empfehlung der Kommission für Krankenhaushygiene und Infektionsprävention (KRINKO) beim RKI Bundesgesundheitsblatt 2012, 55:1311-1354 20.02.2013 Dr.

Mehr

ESBL-, AmpC-und Carbapenemase-bildende Keime beim Menschen

ESBL-, AmpC-und Carbapenemase-bildende Keime beim Menschen ESBL-, AmpC-und Carbapenemase-bildende Keime beim Menschen FG13 Nosokomiale Infektionserreger und Antibiotikaresistenzen Robert Koch-Institut, Bereich Wernigerode BfR Symposium Antibiotikaresistenzen in

Mehr

Ursachen und Konsequenzen der Verbreitung

Ursachen und Konsequenzen der Verbreitung Bundesgesundheitsbl 2012 55:XXX XXX DOI 10.1007/s00103-012-1549-5 Springer-Verlag 2012 Empfehlung der Kommission für Krankenhaushygiene und Infektionsprävention Hygienemaßnahmen bei Infektionen oder Besiedlung

Mehr

Multiresistenz sind wir noch zu retten?

Multiresistenz sind wir noch zu retten? Multiresistenz sind wir noch zu retten? Dr. med. Béatrice Grabein Max von Pettenkofer-Institut für Hygiene und Medizinische Mikrobiologie Außenstelle Großhadern Béatrice Grabein Aktuelle Situation Resistenz-Entwicklung

Mehr

Kolonisation mit ESBL- E. coli in der Allgemeinbevölkerung. Giuseppe Valenza

Kolonisation mit ESBL- E. coli in der Allgemeinbevölkerung. Giuseppe Valenza Kolonisation mit ESBL- E. coli in der Allgemeinbevölkerung Giuseppe Valenza www.reset-verbund.de Trägertum von ESBL- E. coli in der Bayerischen Allgemeinbevölkerung www.lgl.bayern.de PEG, Bad Honnef-Symposium,

Mehr

Antibiotikaresistenz: Carbapenemase-bildende Keime in Nutztierbeständen

Antibiotikaresistenz: Carbapenemase-bildende Keime in Nutztierbeständen Antibiotikaresistenz: Carbapenemase-bildende Keime in Nutztierbeständen Aktualisierte Mitteilung Nr. 036/2016 des BfR vom 23.12.2016* Carbapeneme sind Antibiotika, die für die Behandlung von Menschen zugelassen

Mehr

Meldungen multiresistenter Erreger in Sachsen

Meldungen multiresistenter Erreger in Sachsen Meldungen multiresistenter Erreger in Sachsen Meißen, MRE-Fachtagung 2014 Dr. med. Tilo Hackel Landesuntersuchungsanstalt Dresden, Fachgebiet Bakteriologie, Mykologie, Mykobakteriologie Tel. 0351-8144

Mehr

Multiresistenz Erfahrungen aus der PEG-Studie

Multiresistenz Erfahrungen aus der PEG-Studie Multiresistenz Erfahrungen aus der PEG-Studie Bad Honnef- Symposium 2001 Michael Kresken Antiinfectives Intelligence Gesellschaft für klinisch-mikrobiologische Forschung und Kommunikation, Bonn Bad Honnef

Mehr

Hygiene in der Arztpraxis

Hygiene in der Arztpraxis Hygiene in der Arztpraxis 3MRGN/4MRGN Gefahr durch multiresistente Erreger? 22.04.2015 Multiresistente Erreger Welche sollen es denn diesmal sein? MRGN = Multiresistente Gramnegative Stäbchen Stäbchen?

Mehr

Multiresistente Gram-negative Bakterien (MRGN) Problemkeime des 21. Jahrhunderts

Multiresistente Gram-negative Bakterien (MRGN) Problemkeime des 21. Jahrhunderts Multiresistente Gram-negative Bakterien (MRGN) Problemkeime des 21. Jahrhunderts Prävention der Ausbreitung Präzise und rasche Diagnostik Konsequente Infektionskontrolle Rationaler Antibiotika- Einsatz

Mehr

M. Mielke, N.-O. Hübner, RKI

M. Mielke, N.-O. Hübner, RKI Nosokomiale und schwierig zu therapierende Infektionen IfSG und aktuelle Empfehlungen der KRINKO Aufmerksamkeit - Wissen - Verantwortung MRGN Was ist das? Was ist zu tun? M. Mielke, N.-O. Hübner, RKI Novellierung

Mehr

NEWSLETTER. Inhalt. Multiresistente Erreger und deren Nachweis 10/2010

NEWSLETTER. Inhalt. Multiresistente Erreger und deren Nachweis 10/2010 NEWSLETTER 10/2010 Inhalt CHROMagar TM MRSA CHROMagar TM ESBL CHROMagar TM CTX-M CHROMagar TM KPC CHROMagar TM VRE CHROMagar TM Acinetobacter Multiresistente Erreger und deren Nachweis Vor wenigen Tagen

Mehr

Multiresistente Erreger und Antibiotikaresistenzen

Multiresistente Erreger und Antibiotikaresistenzen Rationaler Antibiotikaeinsatz durch Information und Kommunikation Multiresistente Erreger und Antibiotikaresistenzen Professor Petra Gastmeier Dr. med. Tobias Kramer Dr. med. Florian Salm Institut für

Mehr

Multiresistente Erreger. Welche sollen es denn diesmal sein? Stäbchen? Kokken? Spiralen?

Multiresistente Erreger. Welche sollen es denn diesmal sein? Stäbchen? Kokken? Spiralen? Hygiene in der Arztpraxis 3MRGN/4MRGN was ist das nun wieder?? 17.04.2013 Multiresistente Erreger Welche sollen es denn diesmal sein? Stäbchen? Kokken? Spiralen? Multiresistente Erreger Welche sollen

Mehr

4MRGN: Vorkommen Verbreitung Diagnostik

4MRGN: Vorkommen Verbreitung Diagnostik 4MRGN: Vorkommen Verbreitung Diagnostik Yvonne Pfeifer FG13 Nosokomiale Infektionserreger und Antibiotikaresistenzen Robert Koch-Institut, Bereich Wernigerode GeQiK: Landesverfahren QS MRE Einführung der

Mehr

Ergebnisse der 4 MRGN-PCR

Ergebnisse der 4 MRGN-PCR Ergebnisse der 4 MRGN-PCR CarbaR PCR und kulturelles MRGN Screening am Klinikum Darmstadt (2015 / 2016) MRE-Netzwerk Südhessen 12. Dezember 2016 Dr. J. LUGAUER Zentrum für Labormedizin Klinikum Darmstadt

Mehr

Diagnostik und molekulare Epidemiologie multiresistenter Gram-negativer Bakterien

Diagnostik und molekulare Epidemiologie multiresistenter Gram-negativer Bakterien Fachtagung Krankenhaushygiene, Halle/Saale, 13. April 2011 Diagnostik und molekulare Epidemiologie multiresistenter Gram-negativer Bakterien E. coli P. aeruginosa K. pneumoniae A. baumannii Dr. rer. nat.

Mehr

Multiresistente gramnegative Erreger - mikrobiologische und hygienische Aspekte. Dr. Uwe Lang Facharzt für Mikrobiologie Facharzt für Hygiene

Multiresistente gramnegative Erreger - mikrobiologische und hygienische Aspekte. Dr. Uwe Lang Facharzt für Mikrobiologie Facharzt für Hygiene Multiresistente gramnegative Erreger - mikrobiologische und hygienische Aspekte Dr. Uwe Lang Facharzt für Mikrobiologie Facharzt für Hygiene Antibiotikatherapie und Sterblichkeit Ibrahim Chest 2000; Alvarez

Mehr

Epidemiologisches Bulletin

Epidemiologisches Bulletin ROBERT KOCH INSTITUT Epidemiologisches Bulletin 4. April 2008 / Nr. 14 aktuelle und informationen zu infektionskrankheiten und public health Zum Weltgesundheitstag 2008: Schutz der Gesundheit vor den Folgen

Mehr

15.3 ESBL-bildende Bakterien und andere multiresistente gram-negative Erreger (MRGN)

15.3 ESBL-bildende Bakterien und andere multiresistente gram-negative Erreger (MRGN) .3 ESBL-bildende Bakterien und andere multiresistente gram-negative Erreger (MRGN) Molekularer Baustein und antibakteriell aktives Zentrum einer Reihe von Antibiotika (z. B. Penicillin, Cepholosporin,

Mehr

antibiotikaresistenter Mikroorganismen

antibiotikaresistenter Mikroorganismen Epidemiologie und Bedeutung antibiotikaresistenter Mikroorganismen Workshop Clearingstelle Versorgungsforschung NRW 07. Juli 2010 P. Walger Medizinische Klinik III Universitätsklinikum Bonn International

Mehr

ESBL heißt jetzt MRGN Neues über multiresistente gramnegative Erreger. Prof. Dr. C. Wendt

ESBL heißt jetzt MRGN Neues über multiresistente gramnegative Erreger. Prof. Dr. C. Wendt ESBL heißt jetzt MRGN Neues über multiresistente gramnegative Erreger Prof. Dr. C. Wendt Weitere Co-Resistenzen E. coli ESBL+ / Chin-S E. coli ESBL+ / Chin-R Klebsiella spp. ESBL+ / Chin-S Klebsiella spp.

Mehr

Resistenzsituation im Krankenhausbereich -

Resistenzsituation im Krankenhausbereich - 2. estagung der PEG Antibiotikaverbrauch und Resistenz Wo steht Deutschland Resistenzsituation im Krankenhausbereich - Datenquellen, Entwicklung und aktuelle Situation Michael Kresken Antiinfectives Intelligence

Mehr

Überblick über die Resistenzlage (insbesondere gramnegative Erreger)

Überblick über die Resistenzlage (insbesondere gramnegative Erreger) Überblick über die Resistenzlage (insbesondere gramnegative Erreger) Dr. med. Martin Kaase NRZ für gramnegative Krankenhauserreger Ruhr-Universität Bochum martin.kaase@rub.de MRSA MRSA (%) 40 35 30 25

Mehr

Erfassung bakterieller Resistenzen nach dem Infektionsschutzgesetz: eine vergleichende Untersuchung

Erfassung bakterieller Resistenzen nach dem Infektionsschutzgesetz: eine vergleichende Untersuchung Erfassung bakterieller Resistenzen nach dem Infektionsschutzgesetz: eine vergleichende Untersuchung Inaugural-Dissertation zur Erlangung des Doktorgrades der Hohen Medizinischen Fakultät der Rheinischen

Mehr

Antworten auf häufig gestellte Fragen (FAQ) im Zusammenhang mit der Klassifikation von 3MRGN und 4MRGN durch mikrobiologische Laboratorien

Antworten auf häufig gestellte Fragen (FAQ) im Zusammenhang mit der Klassifikation von 3MRGN und 4MRGN durch mikrobiologische Laboratorien Antworten auf häufig gestellte Fragen (FAQ) im Zusammenhang mit der Klassifikation von 3MRGN und 4MRGN durch mikrobiologische Laboratorien (Aufgrund zahlreicher Anfragen werden in Abstimmung mit dem RKI

Mehr

Infektionen durch CPE & Co therapieren. Robert Krause Universitätsklinik f. Innere Medizin Medizinische Universität Graz

Infektionen durch CPE & Co therapieren. Robert Krause Universitätsklinik f. Innere Medizin Medizinische Universität Graz Infektionen durch CPE & Co therapieren Robert Krause Universitätsklinik f. Innere Medizin Medizinische Universität Graz CPE und Co CPE Carbapenemase produzierende Enterobakterien Co Pseudomonas aeruginosa

Mehr

Mathias W. Pletz Zentrum für Infektionsmedizin und Krankenhaushygiene

Mathias W. Pletz Zentrum für Infektionsmedizin und Krankenhaushygiene Multiresistente Erreger Mathias W. Pletz Zentrum für Infektionsmedizin und Krankenhaushygiene Inhalte 1. Wo liegt das Problem? 2. MRSA 3. 3 und 4 MRGN Infektionsmedizin im 15. Jahrhundert im 21. Jahrhundert?

Mehr

Multiresistente gramnegative Bakterien (MRGN, früher ESBL-Bildner)

Multiresistente gramnegative Bakterien (MRGN, früher ESBL-Bildner) Institut für Medizinische Mikrobiologie und Hygiene Seite 1 von 8 Multiresistente gramnegative Bakterien (MRGN, früher ESBL-Bildner) Erreger: gramnegative Stäbchenbakterien, mit Resistenzen gegenüber Standard-Antibiotika:

Mehr

Hygienemaßnahmen bei Infektionen oder Besiedlung mit multiresistenten gramnegativen bakteriellen Erregern

Hygienemaßnahmen bei Infektionen oder Besiedlung mit multiresistenten gramnegativen bakteriellen Erregern Hygienemaßnahmen bei Infektionen oder Besiedlung mit multiresistenten gramnegativen bakteriellen Erregern Eine Musterpräsentation des Robert Koch-Institutes Erstellt von: PD Dr. Nils-Olaf Hübner in Abstimmung

Mehr

Hygienetag der KVB in Regensburg 2016: Antibiotika-Resistenzen und -Verordnungen. Dr. Lutz Bader Fachreferent Hygiene, KVB München

Hygienetag der KVB in Regensburg 2016: Antibiotika-Resistenzen und -Verordnungen. Dr. Lutz Bader Fachreferent Hygiene, KVB München Hygienetag der KVB in Regensburg 2016: Antibiotika-Resistenzen und -Verordnungen Dr. Lutz Bader Fachreferent Hygiene, KVB München Das dreckige Sextett der Multiresistenz (MRE) ESKAPE : bad bugs, no drugs!

Mehr

Nosokomiale Infektionen: Die Fakten

Nosokomiale Infektionen: Die Fakten Geffers U N I V E R S I T Ä T S M E D I Z I N B E R L I N Nosokomiale Infektionen: Die Fakten Christine Geffers Institut für Hygiene und Umweltmedizin, Charité-Universitätsmedizin Berlin Nationales Referenzzentrum

Mehr

Antibiotika-Verbrauch und Antibiotika- Resistenzsituation in der Humanmedizin

Antibiotika-Verbrauch und Antibiotika- Resistenzsituation in der Humanmedizin Europäischer Antibiotikatag, 18. November 2011 Paul Ehrlich gratuliert Gerhard Domagk 75 Jahre antibakterielle Therapie quo vadis Antibiotika? Brennpunkt Resistente Escherichia coli Antibiotika-Verbrauch

Mehr

Ergebnisse der PEG Resistenzstudie Resistenzsituation im stationären Versorgungsbereich

Ergebnisse der PEG Resistenzstudie Resistenzsituation im stationären Versorgungsbereich Bad Honnef-Symposium 215 Paul-Ehrlich-Gesellschaft für Chemotherapie e. V. Strategien zur Bekämpfung multiresistenter Erreger 3./31. März 215, Königswinter Ergebnisse der PEG Resistenzstudie 213 - Resistenzsituation

Mehr

Surveillanceergebnisse von Carbapenemase-bildenden Enterobacteriaceae

Surveillanceergebnisse von Carbapenemase-bildenden Enterobacteriaceae Surveillanceergebnisse von Carbapenemase-bildenden Enterobacteriaceae 4. Kölner Hygienetag 20.01.2014 Christina Weßels Folie 1 20.01.2014 Christina Weßels Folie 2 CRE = Carbapenem-resistente Enterobakteriaceae

Mehr

Enterobacteriaceae und konventionelle Methoden zu ihrer Detektion

Enterobacteriaceae und konventionelle Methoden zu ihrer Detektion Epidemiologie von Carbapenemasebildenden Enterobacteriaceae und konventionelle Methoden zu ihrer Detektion Dr. Martin Kaase NRZ für gramnegative Krankenhauserreger Ruhr-Universität Bochum martin.kaase@rub.de

Mehr

Antibiotika-Empfindlichkeit von HWI-Erregern

Antibiotika-Empfindlichkeit von HWI-Erregern Bad Honnef-Symposium 212, 16./17. April 212 Venerologische und urogenitale Infektionen Antibiotika-Empfindlichkeit von HWI-Erregern Michael Kresken Paul-Ehrlich-Gesellschaft für Chemotherapie e.v., Campus

Mehr

Wie häufig sind ESBL- und Carbapenemaseproduzierende

Wie häufig sind ESBL- und Carbapenemaseproduzierende Wie häufig sind ESBL- und Carbapenemaseproduzierende E. coli in der Schweiz? PD Dr. med. Andreas Kronenberg Berner Infektiologie Symposium 20.11.2014 Institut für Infektionskrankheiten, Universität Bern

Mehr

Umgang mit multiresistenten Erregern (MRE) aus der Sicht des Mikrobiologischen Labor. Dr. med. Arno Köster

Umgang mit multiresistenten Erregern (MRE) aus der Sicht des Mikrobiologischen Labor. Dr. med. Arno Köster Umgang mit multiresistenten Erregern (MRE) aus der Sicht des Mikrobiologischen Labor Dr. med. Arno Köster Definition Multiresistenz (MRE) ICD-10-GM Version 2010 U81! Bakterien mit Multiresistenz gegen

Mehr

Management Multiresistente Erreger

Management Multiresistente Erreger Management Multiresistente Erreger E. coli (EBL) Cefuroxim Cefotaxim Ciprofloxcin Imipenem Gentamicin Cotrimoxazol E. cloacae Cefuroxim Cefotaxim Ciprofloxcin Imipenem Gentamicin Cotrimoxazol Deutscher

Mehr

Carbapenemasen in der Küche Symptom oder Ursache?

Carbapenemasen in der Küche Symptom oder Ursache? Carbapenemasen in der Küche Symptom oder Ursache? Dr. Arthur P. Schiffmann Meldepflichtige Erreger / Substanzen Erregerspezies Zu erfassen ist die Resistenz gegen folgende Substanzen, sofern im Rahmen

Mehr

MRE- Zahlen-Daten-Fakten

MRE- Zahlen-Daten-Fakten Friedrich-Ebert-Krankenhaus Neumünster GmbH Akademisches Lehrkrankenhaus der Christian-Albrechts-Universität zu Kiel MRE- Zahlen-Daten-Fakten 8. Hygieneforum in Neumünster 3.3.2016, Dr. Susanne Bauerfeind,

Mehr

MRE und deren Meldungen aus Sicht des ÖGD: Was hat sich 2013 getan, wie wird es weitergehen?

MRE und deren Meldungen aus Sicht des ÖGD: Was hat sich 2013 getan, wie wird es weitergehen? MRE und deren Meldungen aus Sicht des ÖGD: Was hat sich 2013 getan, wie wird es weitergehen? 18. Dezember 2013 Jürgen Krahn der Stadt Darmstadt und des Landkreises Gesetzliche Meldegrundlagen RKI 31.5.2009:

Mehr

Die Entwicklung der MRE-Meldepflicht in Hessen

Die Entwicklung der MRE-Meldepflicht in Hessen Die Entwicklung der MRE-Meldepflicht in Hessen FoBi: Multiresistente Erreger im One Health -Kontext am 06.12.2017 im Klinikum Darmstadt Jürgen Krahn MRE-Netzwerk Südhessen Bis 31.12.2000: - Bundes-Seuchengesetz

Mehr

Multiresistente Bakterien. Was bedeuten sie für uns?

Multiresistente Bakterien. Was bedeuten sie für uns? Multiresistente Bakterien Was bedeuten sie für uns? Hygiene im Langzeitpflegebereich, PZ Gerenholz, 19.5.2016 Gerhard Eich Infektiologie/Spitalhygiene Stadtspitäler Triemli & Waid Patient, geb. 1949 Persönliche

Mehr

ESBL PEG Rheinland 2014

ESBL PEG Rheinland 2014 ESBL PEG Rheinland 2014 ESBL = Extended-Spectrum Beta- Laktamase Keime aus der Familie der Enterobakterien (z.b. E. coli, Salmonella, Klebsiella, Enterobacter, Proteus, Shigella, Yersinia u.a.) erzeugen

Mehr

Kommentar zum Ringversuch B9 Mikrobiologie 2012-2

Kommentar zum Ringversuch B9 Mikrobiologie 2012-2 Verein für medizinische Qualitätskontrolle Association pour le contrôle de Qualité medical Associazione per il controllo di qualità medico Kommentar zum Ringversuch B9 Mikrobiologie 2012-2 Probe A: Peritonealexsudat

Mehr

Epidemiologie multiresistenter Erreger

Epidemiologie multiresistenter Erreger Epidemiologie multiresistenter Erreger Axel Kola Institut für Hygiene und Umweltmedizin Charité Universitätsmedizin Berlin Workshop Infektionsdiagnostik 25. Januar 2012 Immanuel Klinik Rüdersdorf Einfuhr

Mehr

Definition der Multiresistenz

Definition der Multiresistenz Neue Empfehlung der Kommission für Krankenhaushygiene und Infektionsprävention (KRINKO) beim Robert Koch-Institut (RKI): Hygienemaßnahmen bei Infektionen oder Besiedlung mit multiresistenten gramnegativen

Mehr

Carbapeneme im Vergleich Stellenwert von Doripenem Mikrobiologie

Carbapeneme im Vergleich Stellenwert von Doripenem Mikrobiologie Carbapeneme im Vergleich Stellenwert von Doripenem Mikrobiologie Dr. med. Béatrice Grabein Klinische Mikrobiologie und Krankenhaushygiene am KUM Béatrice Grabein Einteilung der Carbapeneme* Allgemein:

Mehr

Eintrag antibiotikaresistenter Enterobacteriaceae aus der Primärproduktion in die Schlachtkette

Eintrag antibiotikaresistenter Enterobacteriaceae aus der Primärproduktion in die Schlachtkette Eintrag antibiotikaresistenter Enterobacteriaceae aus der Primärproduktion in die Schlachtkette Roger Stephan Institut für Lebensmittelsicherheit und -hygiene Vetsuisse-Fakultät Universität Zürich, Schweiz

Mehr

Antibiotikum Applikationsform

Antibiotikum Applikationsform Carbapenem-Resistenz BMA Alexandra Wojna Med. chem. Labor Dr. Mustafa, Dr. Richter Salzburg www.medilab.at Carbapeneme Antibiotikum Imipenem Meropenem Ertapenem Doripenem Applikationsform IV IV IM,IV IV

Mehr

Kommentar zum Ringversuch B9 Mikrobiologie

Kommentar zum Ringversuch B9 Mikrobiologie Verein für medizinische Qualitätskontrolle Association pour le contrôle de Qualité medical Associazione per il controllo di qualità medico Kommentar zum Ringversuch B9 Mikrobiologie 2013-2 Probe A: Mittelstrahlurin,

Mehr

Kommentar zum Ringversuch B9 Mikrobiologie

Kommentar zum Ringversuch B9 Mikrobiologie Verein für medizinische Qualitätskontrolle Association pour le contrôle de Qualité medical Associazione per il controllo di qualità medico Kommentar zum Ringversuch B9 Mikrobiologie 2013-1 Probe A: Mittelstrahlurin

Mehr

Hygienemaßnahmen bei 3 und 4 MRGN Erreger in der stationären und ambulanten Versorgung

Hygienemaßnahmen bei 3 und 4 MRGN Erreger in der stationären und ambulanten Versorgung Hygienemaßnahmen bei 3 und 4 MRGN Erreger in der stationären und ambulanten Versorgung Vortrag von Nicole Demuth-Werner HFK in der Kath. Krankenhaus Hagen gem. GmbH 2 3 Was Sie erwartet: Erregervorstellung

Mehr

Molekulare Untersuchungen zu Extended-Spektrum β-laktamase (ESBL)-bildenden Enterobacteriaceae als Besiedler und Infektionserreger des Menschen

Molekulare Untersuchungen zu Extended-Spektrum β-laktamase (ESBL)-bildenden Enterobacteriaceae als Besiedler und Infektionserreger des Menschen Molekulare Untersuchungen zu Extended-Spektrum β-laktamase (ESBL)-bildenden Enterobacteriaceae als Besiedler und Infektionserreger des Menschen Von der Fakultät für Lebenswissenschaften der Technischen

Mehr

Antibiotika-Resistenz: Aktuelle Herausforderungen in der Veterinärmedizin

Antibiotika-Resistenz: Aktuelle Herausforderungen in der Veterinärmedizin Antibiotika-Resistenz: Was kann ich konkret dagegen unternehmen? Alumni-Vorlesung, 28. April 2016, Bern Antibiotika-Resistenz: Aktuelle Herausforderungen in der Veterinärmedizin Prof. Dr Vincent Perreten

Mehr

Nosokomiale und schwierig zu therapierende Infektionen DART, Novellierung des IfSG Empfehlungen der KRINKO; Kommission ART Regionale Netzwerke

Nosokomiale und schwierig zu therapierende Infektionen DART, Novellierung des IfSG Empfehlungen der KRINKO; Kommission ART Regionale Netzwerke Nosokomiale und schwierig zu therapierende Infektionen DART, Novellierung des IfSG Empfehlungen der KRINKO; Kommission ART Regionale Netzwerke M. Mielke, RKI Novellierung IfSG Hintergründe Nosokomiale

Mehr

Kurstag 5. -Infektionen mit gramnegativen Erregern. -Therapie. -Auswertung der letzten Stunde. -Differenzierung gramnegativer Erreger

Kurstag 5. -Infektionen mit gramnegativen Erregern. -Therapie. -Auswertung der letzten Stunde. -Differenzierung gramnegativer Erreger Kurstag 5 -Infektionen mit gramnegativen Erregern -Therapie -Auswertung der letzten Stunde -Differenzierung gramnegativer Erreger Antibiotika-Seminar Freitag: Vorbesprechung Praktischer Teil Dienstag:

Mehr

MVZ Dr. Eberhard & Partner Dortmund - 1

MVZ Dr. Eberhard & Partner Dortmund - 1 Überblick MRSA-Netzwerktreffen Kreis Multiresistente Erreger und Antibiotika Dr. med. Arthur Pranada Facharzt für Mikrobiologie, Virologie und Infektionsepidemiologie Antibiotic Stewardship (ABS-)Experte

Mehr

RESISTENZANALYSE Atemwegsinfekte

RESISTENZANALYSE Atemwegsinfekte RESISTENZANALYSE Atemwegsinfekte NEU - aktuelle Daten aus 2016 Die Daten geben einen Überblick der ausgebildeten Resistenzen bei den am häufigsten aufgetretenen Keimen Nur ambulante Patienten Antibiotika

Mehr

Erregerhäufigkeit bei akuter bakterieller Meningitis

Erregerhäufigkeit bei akuter bakterieller Meningitis Erregerhäufigkeit bei akuter bakterieller Meningitis 70 60 % 50 40 30 20 10 Listeria B-Streptok. N. meningitidis S. pneumoniae H. influenzae 0 60 J. Schuchat et al

Mehr

Monitoring von Resistenzen in der Humanmedizin. Tim Eckmanns Robert Koch-Institut

Monitoring von Resistenzen in der Humanmedizin. Tim Eckmanns Robert Koch-Institut Monitoring von Resistenzen in der Humanmedizin Tim Eckmanns Robert Koch-Institut Unterschied Monitoring und Surveillance von Antibiotikaresistenzdaten Another task of epidemiology is monitoring or surveillance

Mehr

Infektionen mit Antibiotika-resistenten Gram-negativen Bakterien nehmen zu - die Rolle der Umwelt

Infektionen mit Antibiotika-resistenten Gram-negativen Bakterien nehmen zu - die Rolle der Umwelt AMB 2013, 47, 17 Infektionen mit Antibiotika-resistenten Gram-negativen Bakterien nehmen zu - die Rolle der Umwelt Zusammenfassung: Der übermäßige Gebrauch von Antibiotika in der Medizin und in der Massentierhaltung

Mehr

Antibiotika. Definition. Bedeutung. Substanzen, die den Infektionserreger, aber nicht den Makroorganismus schädigen. (Paul Ehrlich: Magische Kugel )

Antibiotika. Definition. Bedeutung. Substanzen, die den Infektionserreger, aber nicht den Makroorganismus schädigen. (Paul Ehrlich: Magische Kugel ) Antibiotika Definition Substanzen, die den Infektionserreger, aber nicht den Makroorganismus schädigen. (Paul Ehrlich: Magische Kugel ) Bedeutung Bis zu 50% des Arzneietats eines Krankenhauses Seite 1/64

Mehr

Resistenzentwicklung bei Enterobakteriazeen und Pseudomonas in Österreich

Resistenzentwicklung bei Enterobakteriazeen und Pseudomonas in Österreich Resistenzentwicklung bei Enterobakteriazeen und Pseudomonas in Österreich H. Mittermayer Institut für Hygiene, Mikrobiologie und Tropenmedizin, A. ö. Krankenhaus der Elisabethinen Linz (Leiter: Prim. Univ.-Prof.

Mehr

Aktuelles zur Antibiotikaresistenz - das Problem aus humanmedizinische Sicht

Aktuelles zur Antibiotikaresistenz - das Problem aus humanmedizinische Sicht Robert Koch Institut Außenstelle Wernigerode Aktuelles zur Antibiotikaresistenz - das Problem aus humanmedizinische Sicht Helmut Tschäpe (1) Wo liegt das Problem? (2) Was ist aktuell? (3) Was kann man

Mehr

Antibiotika-Resistenzsituation und Antibiotika-Verbrauch in der Lebensmittelkette

Antibiotika-Resistenzsituation und Antibiotika-Verbrauch in der Lebensmittelkette BUNDESINSTITUT FÜR RISIKOBEWERTUNG Antibiotika-Resistenzsituation und Antibiotika-Verbrauch in der Lebensmittelkette Annemarie Käsbohrer& Bernd Appel Abteilung Biologische Sicherheit Nationales Referenzlaboratorium

Mehr

MALDI-TOF zur Erregerdifferenzierung MALDI Biotyper

MALDI-TOF zur Erregerdifferenzierung MALDI Biotyper MALDI-TOF zur Erregerdifferenzierung MALDI Biotyper 7870.62 8368.99 6410.90 5096.01 7157.65 7273.87 6315.49 5380.64 6254.64 Intens. [a.u.] 4364.06 Die MALDI TOF Differenzierung ist robust, beruht auf Messung

Mehr

Aktuelles zum Thema Antibiotika

Aktuelles zum Thema Antibiotika Erreger der ESCAPE-Gruppe Die Ausbreitung von Infektionen durch multiresistente Erreger schreitet rasant voran. Aktuelles zum Thema Antibiotika Dr. Kathrin Marx E = Enterokokken, Vancomycin-resistent (VRE)

Mehr

Umgang mit Patienten, die mit multiresistenten gramnegativen Stäbchenbakterien (3MRGN, 4MRGN) besiedelt/ infiziert sind

Umgang mit Patienten, die mit multiresistenten gramnegativen Stäbchenbakterien (3MRGN, 4MRGN) besiedelt/ infiziert sind Umgang mit Patienten, die mit multiresistenten gramnegativen Stäbchenbakterien (3MRGN, 4MRGN) besiedelt/ infiziert sind Erregerdefinition In den letzten Jahren ist unter den gramnegativen Stäbchenbakterien

Mehr

Tätersuche durch Molekularbiologie

Tätersuche durch Molekularbiologie Klinische Mikrobiologie Hygiene im Operationssaal 7. März 2016 Tätersuche durch Molekularbiologie PD Dr. med. Dr. phil. Adrian Egli Leiter Abteilung Klinische Mikrobiologie & Applied Microbiology Research

Mehr

Verletzt aus dem Urlaub Welche Hygienemaßnahmen muss das Krankenhaus treffen?

Verletzt aus dem Urlaub Welche Hygienemaßnahmen muss das Krankenhaus treffen? Verletzt aus dem Urlaub Welche Hygienemaßnahmen muss das Krankenhaus treffen? W. Voelckel Insitut für Anästhesiologie und Intensivmedizin AUVA Traumazentrum Salzburg Versorgung von Kriegsopfern aus

Mehr

Surveillance und Häufigkeit multiresistenter Erreger im KISS

Surveillance und Häufigkeit multiresistenter Erreger im KISS Geffers U N I V E R S I T Ä T S M E D I Z I N B E R L I N Surveillance und Häufigkeit multiresistenter Erreger im KISS Christine Geffers Institut für Hygiene und Umweltmedizin, Charité-Universitätsmedizin

Mehr