Bioinformatik I. Zentrum für Bioinformatik der Universität des Saarlandes WS 2001/2002

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Bioinformatik I. Zentrum für Bioinformatik der Universität des Saarlandes WS 2001/2002"

Transkript

1 Bioinformatik I Zentrum für Bioinformatik der Universität des Saarlandes WS 2001/2002

2 Der Bauplan des Menschen

3 Das menschliche Genom G ATGC TACG T C A

4 Die Chromosomen Die (46) Chromosomen sind die Träger der menschlichen Erbinformation. Der menschliche Bauplan (das menschliche Genom) besteht aus 46 Texten, die zusammen circa 3 Milliarden Buchstaben (Basenpaare) lang sind. In diesen Texten (DNA Molekülen) treten nur vier Buchstaben (Basen) auf: A, T, G, C

5 Die Sequenzierung des menschlichen Genoms?????????????????????????????????????????????????????????????????????????????????????? Unter der Sequenzierung des Genoms versteht man die Bestimmung der Reihenfolge der Buchstaben (Basen) in den Doppelsträngen der DNA Moleküle. Es genügt natürlich, die Reihenfolge in einem der beiden komplementären Stränge (Texte) zu bestimmen. Der zweite Strang kann mit Hilfe der Basenkomplementarität bestimmt werden. AACCTTACTACTGGGGTTTTATGCATGCATGCCCCGGGA TTGGAATGATGACCCCAAAATACGTACGTACGGGGCCCT

6 Die Sequenzierung des menschlichen Genoms Die Sequenzierung des menschlichen Genoms war das herausragende wissenschaftliche Ereignis der letzten Jahre bzw. Jahrzehnte. Sie wurde in den Medien als die Mondlandung der Biologie gefeiert. Schaut man genauer hin, so stellt man fest, daß die Bezeichnung Mondlandung der Bioinformatik in gewisser Weise treffender gewesen wäre. Zwei Projekte konkurrierten bei der Sequenzierung des menschlichen Genoms miteinander: (1) Das öffentlich geförderte Humangenomprojekt: HUGO oder HGP (2) Die amerikanische Firma Celera Genomics unter der Leitung von Graig Venter: Celera

7 Die Sequenzierung des menschlichen Genoms HGP: Mehr als 1100 Wissenschaftler aus 18 Ländern. Das Projekt startete in den achtziger Jahren. Das Projekt sollte zwischen 2005 und 2010 enden. Die Kosten des Projekts gehen in die Milliarden. Celera: Circa 100 Wissenschaftler und circa 50 Techniker. Das Projekt startete 1998 und wurde 2001 abgeschlossen. Die Kosten wurden auf circa 400 Millionen Dollar geschätzt.

8 Der "Shotgun"-Ansatz?????????????????????????????????????????????????????????????????????????????????????? DNA Zielmolekül (1) Kopieren (2) Zerkleinern (3) Auswählen (4) Sequenzieren (5) Assemblieren AACCTTACTACTGGGGTTTTATGCATGCATGCCCCGGGA TTGGAATGATGACCCCAAAATACGTACGTACGGGGCCCT

9 Kopieren (1) Kopieren des DNA Zielmolekül PCR: Polymerase Chain Reaction Cloning: Einbau in einen Vector (z.b. Bakterium)

10 Zerkleinern (2) Zerkleinern Die DNA Moleküle werden durch Einwirkung von Ultraschall oder durch Anwendung von hohem Druck (mit hohem Druck durch eine feine Düse gepresst) zerkleinert.

11 Auftrennung mit Gelelektrophorese Auftrennung mit Gelelektrophorese (3) Auswählen

12 Sequenzieren (4) Sequenzieren Celera hatte 300 ABI 3700 DNA Sequenzierer im Einsatz Die Sequenzierer verwenden die Kapillargelelektrophoresetechnik. Welche DNA Moleküle zu welchem Zeitpunkt das Kapillar durchwandern, wird mit einem Laser abgelesen.

13 Sequenzieren TCACAATCAACTGCGCTATAG AGTG AGTGTTA AGTGTTAGTTGACGCGATATC C A T G A A C T T A C A A T C C G T T A A C A T A G C C T T G G T C G

14 Sequenzieren TCACAATCAACTGCGCTATAG AGTG AGTGTTA AGTGTTAGTTGACGCGATATC Die Doppelhelix wird aufgebrochen und in eine Lösung von Nukleinsäuren (Nukleotiden) gegeben, von denen viele phosphoriszierend markiert sind. Die vier verschiedenen Nukleotide unterscheiden sich in der Farbe. Die einzelnen Basen bzw. Nukleotide (Buchstaben) lagern sich nun zufällig an komplementäre Basen (Buchstaben) an. Markierte Nukleinsäuren haben die zusätzliche Eigenschaft, daß sie die Reaktion beenden. Auf diese Art und Weise erhält man eine Lösung mit allen komplementären DNA Bruchstücken, die mit dem ersten komplementären Buchstaben (in unserem Beispiel A) beginnen und mit einem markierten Buchstaben enden. Die Bruchstücke in dieser DNA Suppe werden dann mit Hilfe der Kapillargelelektrophorese der Länge nach sortiert. Mit Hilfe des Lasers kann man an der farblichen Markierung des letzten Buchstabens ablesen, mit welchem Buchstaben die einzelnen, der Länge nach sortierten, Bruchstücke enden.

15 Mit einem Sequenzierer kann man gleichzeitig eine bestimmte Zahl von DNA Fragmenten in der Größenordnung von circa 500 Buchstaben sequenzieren bzw. lesen. Sequenzieren

16 Assemblieren (Sequence Assembly) (5) Assemblieren ATGGCCTCGTCAATGCATG CCGGTGCATGCATGGCCTCGTCAA Man suche alle Paare von Textfragmenten, die sich überlappen, d.h., das Ende des einen Fragments ist identisch oder ähnelt dem Anfang des anderen Fragments oder umgekehrt. ATGCGGTTGCTACGT ATCGGTGACCA ATTCATGCGGTTGC CGTCGTATCG GACCACGGTT TCATGCGG ACGTCGT TCGGTGACCACGGTT ATTCATG GGTTGCTAC CGTATCG ACCACGG ATTCATGCGGTTGCTACGTCGTATCGGTGACCACGGTT Mit Hilfe dieser Überlappungsinformationen versucht man das riesige Textpuzzle zusammenzusetzen und den Originaltext zu rekonstruieren.

17 Einige Kernprobleme der Bioinformatik ATGGCCTCGTCAATGCATG CCGGTGCATGCATGGCCTCGTCAA Drei Kernprobleme der Bioinformatik: 1. Datenbanksuche nach ähnlichen Sequenzen (Texten): Gegeben ein Pattern P und eine Menge von Texten (Sequenzen) T = {t 1, t 2,..., t s }. Suche alle Sequenzen t i, die P lokal oder global ähneln. Gegeben ein Pattern P und ein großer Text T. Suche alle Teilsequenzen von T, die dem Pattern P oder Teilsequenzen des Pattern ähneln ATGGCCTCGTCAATGCATG CCGGTGCATGCATGGCCTCGTCAA Berechnung von Sequenzalignments: Ordne die Buchstaben von zwei oder mehreren vorgegebenen Sequenzen so in Form einer Matrix übereinander an, dass man in den Spalten der Matrix die Gemeinsamkeiten und Unterschiede der Sequenzen erkennt. [Exaktere Definition folgt].

18 Einige Kernprobleme der Bioinformatik ATGCGGTTGCTACGT ATCGGTGACCA ATTCATGCGGTTGC CGTCGTATCG GACCACGGTT TCATGCGG ACGTCGT TCGGTGACCACGGTT ATTCATG GGTTGCTAC CGTATCG ACCACGG ATTCATGCGGTTGCTACGTCGTATCGGTGACCACGGTT Drei Kernprobleme der Bioinformatik: 3. Sequenz-Assemblierungs-Problem (Sequence Assembly Problem): Gegeben die Überlappungsinformationen und Alignments von Fragmenten einer unbekannten Sequenz. Man bestimme die Reihenfolge der Buchstaben (Basen) der unbekannten Sequenz.

19 Der Sequenzierungsansatz des HGP Genom Physikal Mapping aus circa BACs. Minimum Tiling Set Shotgun Assembly BAC: BAC ist die Abkürzung für Bacterial Artificial Chromosome. Indem man einem Bakterium ein künstliches Chromsom hinzufügt, kann man die DNA in dem Chromosom mit Hilfe des Bakteriums kopieren (vermehren) und am Leben erhalten. Das künstliche Chromosom kann z.b. ein Stück menschlicher DNA enthalten. Der Einfachheit halber bezeichnet man die eingebauten DNA Sequenzen auch als BACs. Eine Bakterienkultur mit einer bestimmten DNA Sequenz bezeichnet man auch als Clone. Die BACs haben eine durchschnittliche Länge von Basenpaaren.

20 Der Sequenzierungsansatz von Celera Genom Physikal Mapping aus circa BACs. Minimum Tiling Set Shotgun Assembly Der Ansatz von Celera wird als Whole Genom Shotgun -Ansatz bezeichnet, da das gesamte Sequenzierungsproblem nicht in kleinere Teilprobleme (BACs beim HGP-Ansatz) unterteilt wird. Das eigentliche Assembly-Problem wird dadurch natürlich erheblich komplexer: Zahl der Basenpaare circa 3 * 10 9 bp / Lesbare Fragmentlänge circa 0.5 * 10 3 bp * Überdeckung 10 = Zahl der benötigten Fragmente circa 6 * 10 7

21 Der Sequenzierungsansatz von Celera Um zusätzliche Abstandsinformationen zu erhalten, verwendet Celera sogenannte Mate Pairs : Fragmentpaare, deren ungefährer Abstand bekannt ist und die entgegengesetzt orientiert sind. Short 2, 10 Kbp Long 50 and 100Kbp Celera verwendet auch Informationen des Humangenomprojekts. Um weniger Fragmente sequenzieren zu müssen, werden sequenzierte BACs des HGP virtuell geschreddert und als zusätzliche Fragmente im Assembly-Prozeß verwendet. Celera stellt seine Daten dem HGP zunächst nicht zur Verfügung.

22 Besondere Schwierigkeiten bei der Sequenzierung Lücken in der Überdeckung Fehler beim Kopieren (Clonen) und beim Sequenzieren: Fehlerquote 1-2 % Repeats unterschiedlicher Länge: Repeats sind Teile der DNA, die wiederholt auftreten. Man spricht auch von Repeats, wenn sich die Teilsequenzen sehr ähnlich sind. ATGATGATCGGCGTATTCTCCACGCGTTATCGCCGTATTGTCCACATGGTCAACACACTT Repeat

23 Die "Mondlandung der Biologie (Bioinformatik)" Im Juni des Jahres 2000 verkündet der damalige US-Präsident Bill Clinton im Weißen Haus, daß es zwei Forschungsprojekten gleichzeitig gelungen ist, eine erste Version des menschlichen Genoms zu erstellen, und würdigt dies als das herausragende wissenschaftliche Ereignis der letzten Jahrzehnte. G. Venter (Celera) und Collins (HGP).

24 Die "Mondlandung der Biologie (Bioinformatik)" Im Februar 2001 veröffentlichen beide Projekte ihre Resultate. Da es unterschiedliche Auffassung über die Verfügbarkeit der Genomdaten gibt, veröffenlichen die beiden Projekte in verschiedenen Zeitschriften. Celera s Resultate erscheinen in SCIENCE. HGP veröffentlicht in NATURE. Es gibt sozusagen zwei Versionen des menschlichen Erbguts. Buch: Cracking the Genome: Inside the Race to Unlock Human DNA, by K. Davies.

25 Die zwei Versionen des Genoms Celera und das HGP stellen fest, daß Ihre Versionen des Genoms aus circa 3 Milliarden Bp bestehen. Beide Versionen enthalten noch tausende von Lücken, wobei die Version von Celera weniger Lücken zu enthalten scheint. Es gibt große Unterschiede zwischen den beiden Versionen. Fig. 6. Comparison of the CSA and the HGP assembly. To generate the figure, Celera fragment sequences were mapped onto each assembly. The HGP assembly is indicated in the upper third of each panel; the Celera assembly is indicated in the lower third. In the center of the panel, green lines show Celera sequences that are in the same order and orientation in both assemblies and form the longest consistently ordered run of sequences. Yellow lines indicate sequence blocks that are in the same orientation, but out of order. Red lines indicate sequence blocks that are not in the same orientation. For clarity, in the latter two cases, lines are only drawn between segments of matching sequence that are at least 50 kbp long. Vergleich von Chromosom 13

26 Die zwei Versionen des Genoms Celera und das HGP stellen fest, daß Ihre Versionen des Genoms aus circa 3 Milliarden Bp bestehen. Beide Versionen enthalten noch tausende von Lücken, wobei die Version von Celera weniger Lücken zu enthalten scheint. Es gibt große Unterschiede zwischen den beiden Versionen. Fig. 6. Comparison of the CSA and the HGP assembly. To generate the figure, Celera fragment sequences were mapped onto each assembly. The HGP assembly is indicated in the upper third of each panel; the Celera assembly is indicated in the lower third. In the center of the panel, green lines show Celera sequences that are in the same order and orientation in both assemblies and form the longest consistently ordered run of sequences. Yellow lines indicate sequence blocks that are in the same orientation, but out of order. Red lines indicate sequence blocks that are not in the same orientation. For clarity, in the latter two cases, lines are only drawn between segments of matching sequence that are at least 50 kbp long. Vergleich von Chromosom 21

27 Ein Blick auf die Resultate von Celera Circa 27 Millionen Fragmente (Überdeckung von 5,11 plus Überdeckung von 2,9 durch HGP Daten) Protein-codierende Gene + circa Verdächtige

28 Gene: Die Baupläne der molekularen Bausteine Gene kodieren die Baupläne für den Aufbau der molekularen Bausteine (Proteine, RNA). Bei der Translation wird die in der mrna gespeicherte Information übersetzt und der entsprechende Baustein (Protein) synthetisiert. Bei der mrna-reifung und Splicing werden die Introns aus der mrna herausgeschnitten. Bei der Transkription wird eine mrna-kopie (messenger RNA) des Gens erstellt. Transkriptionsfaktoren Tyr Ala Arg Tyr Val Arg Thr Translation in Protein UACGCACGUUACGUGCGUACU mrna-reifung plus Splicing UACGCACGUUA...CGUGCGUACU Transkription mrna-molekül ATGCGTGCAAT...GCACGCATGA TGACGCA CACGTG GGGCGG CCAAT TATA ATG Exon Intron Exon TGA Promoter

29 Proteine Proteine sind lineare Kettenmoleküle, die aus 20 Grundbausteinen, den sogenannten Aminosäuren, aufgebaut sind: Ala, Asp, Glu, Gly, Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, Gln, Arg, Met, Asn, Lys, Val, Ile, Thr Die Reihenfolge der Aminosäuren eines Proteins nennt man die Primärstruktur (Sequenz). Die Kette eines jeden Proteins faltet sich auf spezifische Art und Weise im Raum. Dieser Faltungsprozeß verleiht dem Protein eine wohldefinierte dreidimensionale Gestalt. Man spricht hierbei von der Tertiärstruktur, 3D-Struktur oder auch Konformation des Proteins. Die Primärstruktur bestimmt wesentlich die Teriärstruktur des Proteins. Die Tertiärstruktur des Proteins hat großen Einfluß auf seine chemische Reaktivität bzw. auf die Funktion des Proteins. Primärstruktur Tertiärstruktur Funktion

30 Proteine

31 Der Genetische Code

32 Gene: Die Baupläne der molekularen Bausteine Gene kodieren die Baupläne für den Aufbau der molekularen Bausteine (Proteine, RNA). Tyr Ala Arg Tyr Val Arg Thr Translation in Protein UACGCACGUUACGUGCGUACU mrna-reifung plus Splicing UACGCACGUUA...CGUGCGUACU Transkriptionsfaktoren Transkription mrna-molekül ATGCGTGCAAT...GCACGCATGA TGACGCA CACGTG GGGCGG CCAAT TATA ATG Exon Intron Exon TGA Promoter

33 Ein Blick auf die Resultate von Celera Circa 27 Millionen Fragmente (Überdeckung von 5,11 plus Überdeckung von 2,9 durch HGP Daten) Protein-codierende Gene + circa Verdächtige

34 Gen-Annotation: Wie sucht man Gene? Primärstruktur Ähnliche Gene (DNA Sequenz) Tertiärstruktur Ähnliche Struktur der codierten Bausteine Funktion Ähnliche oder identische Funktion Man nehme die DNA-Sequenz von einem bekannten Gen und suche mit dieser Sequenz in der neu-sequenzierten DNA nach ähnlichen Teilsequenzen (Ähnlichkeitssuche). Die bekannten Gene können auch von anderen Spezies stammen. Da die Genome von Mensch und Maus sehr ähnlich sind, kann man zum Beispiel mit bekannten Genen der Maus nach unbekannten Genen des Menschen suchen.

35 Gen-Annotation: Wie sucht man Gene? Eine andere Möglichkeit, ein Gen zu suchen, eröffnet sich, wenn man einen Baustein (Protein), der durch ein Gen codiert wird, oder ein Zwischenprodukt (mrna) aufspüren und sequenzieren kann. Ein sehr erfolgreicher Ansatz verwendet hierzu die sogenannten Expressed Sequence Tags (ESTs): Kurze ( bp) DNA-Stücke, die aus codierenden Regionen (Exons) stammen und nur einmal im Genom vorkommen (keine Repeats). Gene, die selten oder nur in biologischen Ausnahmesituationen (Krankheit) exprimiert werden, wird man auf diese Art und Weise nur mit geringer Wahrscheinlichkeit finden, da man für diese Gene nur mit viel Glück oder extremen Arbeitsaufwand die entsprechenden Bausteine oder ESTs aufspüren kann. Transkriptionsfaktoren ATGCGTGCAAT...GCACGCATGA TGACGCA CACGTG GGGCGG CCAAT TATA ATG TGA Exon Intron Exon Promoter

36 Ein Blick auf die Resultate von Celera Circa 27 Millionen Fragmente (Überdeckung von 5,11 plus Überdeckung von 2,9 durch HGP Daten) Protein-codierende Gene + circa Verdächtige Nur 1,1% des Genoms wird von Exons gebildet, während sich 24 % des Genoms in Introns befindet, d.h., circa 75 % liegt sozusagen zwischen den Genen. Bisher 2,1 Millionen Single-Nucleotide Polymorphism (SNP), d.h., im Durchschnitt 1 SNP auf 1250 Basenpaare.

37 Singe-Nucleotide Polymorphisms (SNPs) Bisher haben wir immer von dem menschlichen Genom gesprochen. Da jeder Mensch (bis auf eineiige Zwillinge, Clone) ein individuelles Erbgut (Genom) besitzt, gibt es Milliarden von unterschiedlichen menschlichen Genomen. SNPs sind Variationen einzelner Basenpaare: Peter ATGTGCCACACGGTCATGGTCCCACGTTGGCATACTCTCT TACACGGTGTGCCAGTACCAGGGTGCAACCGTATGAGAGA Paul ATGTGCCACACGGTCATGGCCCCACGTTGGCATACTCTCT TACACGGTGTGCCAGTACCGGGGTGCAACCGTATGAGAGA

38 Ein Blick auf die Resultate von Celera Circa 27 Millionen Fragmente (Überdeckung von 5,11 plus Überdeckung von 2,9 durch HGP Daten) Protein-codierende Gene + circa Verdächtige Nur 1,1% des Genoms wird von Exons gebildet, während sich 24 % des Genoms in Introns befindet, d.h., circa 75 % liegt sozusagen zwischen den Genen. Bisher 2,1 Millionen Single-Nucleotide Polymorphism (SNP), d.h., im Durchschnitt 1 SNP auf 1250 Basenpaare. Weniger als 1 % aller bereits identifizierter SNPs resultierten in Proteinvariationen (liegen in den Exons): circa Gen-Duplikation spielte in der Evolution des Genoms eine entscheidende Rolle.

39 Duplikationen zwischen den Chromosomen Segmental duplications between chromosomes in the human genome. The 24 panels show the 1077 duplicated blocks of genes, containing 10,310 pairs of genes in total. Each line represents a pair of homologous genes belonging to a block; all blocks contain at least three genes on each of the chromosomes where they appear. Each panel shows all the duplications between a single chromosome and other chromosomes with shared blocks. The chromosome at the center of each panel is shown as a thick red line for emphasis. Other chromosomes are displayed from top to bottom within each panel ordered by chromosome number. The inset (bottom, center right) shows a close-up of one duplication between chromosomes 18 and 20, expanded to display the gene names of 12 of the 64 gene pairs shown.

40 Funktionen der vorhergesagten Proteine S

Was ist Bioinformatik?

Was ist Bioinformatik? Bioinformatik: Vom Genom zum Medikament Was ist Bioinformatik? Biowissenschaften Bioinformatik Informatik Die Bioinformatik entwickelt ein virtuelles Biolabor. Die Bioinformatik entwickelt ein virtuelles

Mehr

Der "Shotgun"-Ansatz. Bioinformatik I. Zentrum für Bioinformatik der Universität des Saarlandes WS 2002/2003. Der "Shotgun"-Ansatz

Der Shotgun-Ansatz. Bioinformatik I. Zentrum für Bioinformatik der Universität des Saarlandes WS 2002/2003. Der Shotgun-Ansatz Der "Shotgun"-Ansatz 1 Bioinformatik I Zentrum für Bioinformatik der Universität des Saarlandes WS 2002/2003 Der "Shotgun"-Ansatz 2 1 Der "Shotgun"-Ansatz 3 ATGC TACG G T C A http://www.oebvhpt.at/chemie/orville/nucl.html

Mehr

Kapitel 1: Einführung und biologische Grundlagen

Kapitel 1: Einführung und biologische Grundlagen Kapitel 1: Einführung und biologische Grundlagen Ziele der Vorlesung n Grundverständnis wichtiger Verfahren zur Datengewinnung Sequenzierung, Microarrayanalyse,... Literatur und verwendete Materialien

Mehr

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten.

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Wie bezeichnet man den Strang der DNA- Doppelhelix, der die

Mehr

Aminosäurenanalytik. Probenvorbereitung Eiweißfällung, Oxidation und Hydrolyse Karl-Heinz Jansen SYKAM CHROMATOGRAPHIE

Aminosäurenanalytik. Probenvorbereitung Eiweißfällung, Oxidation und Hydrolyse Karl-Heinz Jansen SYKAM CHROMATOGRAPHIE Aminosäurenanalytik Probenvorbereitung Eiweißfällung, Oxidation und Hydrolyse Karl-Heinz Jansen SYKAM CHROMATOGRAPHIE Proteinfällung 2 Proteinfällung 3 Proteinfällung 4 Proteinfällung 5 Proteinfällung

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen

MOL.504 Analyse von DNA- und Proteinsequenzen MOL.504 Analyse von DNA- und Proteinsequenzen Kurs 1 Monika Oberer, Karl Gruber MOL.504 Modul-Übersicht Einführung, Datenbanken BLAST-Suche, Sequenzalignment Proteinstrukturen Virtuelles Klonieren Abschlusstest

Mehr

Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen

Mehr

Verfahren zu Strukturvorhersagen in vereinfachten Modellen. Tobias Voigt Sommerakademie 2002 St. Johann

Verfahren zu Strukturvorhersagen in vereinfachten Modellen. Tobias Voigt Sommerakademie 2002 St. Johann Verfahren zu Strukturvorhersagen in vereinfachten Modellen Tobias Voigt Sommerakademie 2002 St. Johann Einführung! Sequenzierung von Proteinen und Nukleinsäuren ist heute Routine! Die räumliche Struktur

Mehr

Inhalt Genexpression Microarrays E-Northern

Inhalt Genexpression Microarrays E-Northern Inhalt Genexpression Microarrays E-Northern Genexpression Übersicht Definition Proteinbiosynthese Ablauf Transkription Translation Transport Expressionskontrolle Genexpression: Definition Realisierung

Mehr

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit in der Nucleotidsequenz der DNA verschlüsselt (codiert)

Mehr

DNS-Modell Best.-Nr. 2015801

DNS-Modell Best.-Nr. 2015801 DNS-Modell Best.-Nr. 2015801 1. Produktvorstellung Ziel des Produktes Dieses Modell soll das DNS-Molekül visualisieren: es soll die Doppelspirale, Stickstoffbasen mit Wasserstoffbrückenbindung, Zucker-Phosphatskelette

Mehr

Genannotation bei Prokaryoten

Genannotation bei Prokaryoten Genannotation bei Prokaryoten Maike Tech Abt. Bioinformatik Institut für Mikrobiologie und Genetik (IMG) Universität Göttingen 28. November 2005 Genetik von Pro- und Eukaryoten Eukaryoten Prokaryoten Zellkern

Mehr

Modul 8: Bioinformatik A. Von der DNA zum Protein Proteinsynthese in silicio

Modul 8: Bioinformatik A. Von der DNA zum Protein Proteinsynthese in silicio Modul 8: Bioinformatik A. Von der DNA zum Protein Proteinsynthese in silicio Ein Wissenschaftler erhält nach einer Sequenzierung folgenden Ausschnitt aus einer DNA-Sequenz: 5 ctaccatcaa tccggtaggt tttccggctg

Mehr

Vorlesung Biophysik I - Molekulare Biophysik Kalbitzer/Kremer/Ziegler

Vorlesung Biophysik I - Molekulare Biophysik Kalbitzer/Kremer/Ziegler Vorlesung Biophysik I - Molekulare Biophysik Kalbitzer/Kremer/Ziegler 23.10. Zelle 30.10. Biologische Makromoleküle I 06.11. Biologische Makromoleküle II 13.11. Nukleinsäuren-Origami (DNA, RNA) 20.11.

Mehr

Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

Einblicke in das menschliche Erbgut (Genom) am Computer

Einblicke in das menschliche Erbgut (Genom) am Computer Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Binger Nacht der Wissenschaft - 16.04.2010 Das menschliche Genom ist entschlüsselt

Mehr

Chemie für Biologen. Vorlesung im. WS 2004/05 V2, Mi 10-12, S04 T01 A02. Paul Rademacher Institut für Organische Chemie der Universität Duisburg-Essen

Chemie für Biologen. Vorlesung im. WS 2004/05 V2, Mi 10-12, S04 T01 A02. Paul Rademacher Institut für Organische Chemie der Universität Duisburg-Essen Chemie für Biologen Vorlesung im WS 004/05 V, Mi 0-, S04 T0 A0 Paul Rademacher Institut für rganische Chemie der Universität Duisburg-Essen (Teil 3: 9.0.005) MILESS: Chemie für Biologen 36 D-Aldosen C

Mehr

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird Molekularbiologie 6c Proteinbiosynthese Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird 1 Übersicht: Vom Gen zum Protein 1. 2. 3. 2 Das Dogma

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 7 (11.07-15.07.) Methoden und Techniken II 1. Sie bekommen

Mehr

Seminar Genetischer Code und Genomgrammatik

Seminar Genetischer Code und Genomgrammatik Seminar Genetischer Code und Genomgrammatik Thema: Statistische Betrachtung des menschlichen Genoms Dozent: Prof. Dr. rer. nat. Andreas de Vries Studierender: Cem Kiyak 25.08.2011 1 Inhalt Einleitender

Mehr

Vertiefendes Seminar zur Vorlesung Biochemie I

Vertiefendes Seminar zur Vorlesung Biochemie I Vertiefendes Seminar zur Vorlesung Biochemie I 30.01.2015 Klausurvorbereitung: Gerhild van Echten-Deckert Rekombinante DNA Fon. +49-228-732703 Homepage: http://www.limes.uni-bonn.de Klärung einiger Begriffe:

Mehr

BCDS - Biochemische Datenbanken und Software

BCDS - Biochemische Datenbanken und Software BCDS - Biochemische Datenbanken und Software Seminarinhalte Bioinformatische Genom- und Proteomanalyse Literaturrecherche und Zitation Naturwissenschaftliche Software Termine 25. Mai, 1. Juni, 8. Juni,

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

Aufgabe 2: (Aminosäuren)

Aufgabe 2: (Aminosäuren) Aufgabe 2: (Aminosäuren) Aufgabenstellung Die 20 Aminosäuren (voller Name, 1- und 3-Buchstaben-Code) sollen identifiziert und mit RasMol grafisch dargestellt werden. Dann sollen die AS sinnvoll nach ihren

Mehr

Pharmazeutische Biologie WS2011/2012. Das neue Paradigma: Personalisierte Medizin

Pharmazeutische Biologie WS2011/2012. Das neue Paradigma: Personalisierte Medizin 3. Vorlesung Pharmazeutische Biologie WS2011/2012 Das neue Paradigma: Personalisierte Medizin Prof. Theo Dingermann Institut für Pharmazeutische Biologie Biozentrum Max-von Laue-Str. 9 60438 Frankfurt

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 3. Aus welchen vier Nukleotiden ist RNA aufgebaut? 4. DNA RNA 5. Ein Wissenschaftler

Mehr

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Algorithmische

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

Informationsgehalt von DNA

Informationsgehalt von DNA Informationsgehalt von DNA Welche Themen werden behandelt? Gene Code, Genorganisation Signale in DNA Detektion von Genen Genome Genomorganisation Nukleotidmuster Junk DNA 2 DNA als Informationsträger 3

Mehr

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz 1. Nennen Sie die verschiedenen RNA-Typen, die bei der Translation wichtig sind. Erklären Sie die Funktion der verschiedenen RNA-Typen. Skizzieren Sie die Struktur der verschiedenen RNA-Typen und bezeichnen

Mehr

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Bioinformatik

Mehr

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien

Mehr

Molekulare Evolution

Molekulare Evolution Molekulare Evolution 1. Grundprinzip: Die Evolution arbeitet aus gegebenen Materialien neue Strukturen (Gene, Organe, usw.) enstehen nur aus schon existierenden Technische vs. Biologische 1. Technische

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

Einleitung. Replikation

Einleitung. Replikation (C) 2014 - SchulLV 1 von 9 Einleitung Der Action-Film von gestern Abend war wieder ziemlich spannend. Mal wieder hat es der Superheld geschafft, alle Zeichen richtig zu deuten, diverse Geheimcodes zu knacken

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren...

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... Molekulargenetik Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... 2 Beschreiben, wie die DNA aufgebaut ist... 3 Den Ablauf der Replikation erklären und dabei die

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

Sequence Assembly. Nicola Palandt

Sequence Assembly. Nicola Palandt Sequence Assembly Nicola Palandt 1 Einleitung Das Genom eines Lebewesens ist der Träger aller Informationen, die eine Zelle weitergeben kann. Es besteht aus Sequenzen, die mehrere Milliarden Basen lang

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

DATENQUALITÄT IN GENOMDATENBANKEN

DATENQUALITÄT IN GENOMDATENBANKEN DATENQUALITÄT IN GENOMDATENBANKEN Alexander Fehr 28. Januar 2004 Gliederung Motivation Biologische Grundkonzepte Genomdaten Datenproduktion und Fehler Data Cleansing 2 Motivation (1) Genomdatenbanken enthalten

Mehr

Genaktivierung und Genexpression

Genaktivierung und Genexpression Genaktivierung und Genexpression Unter Genexpression versteht man ganz allgemein die Ausprägung des Genotyps zum Phänotyp einer Zelle oder eines ganzen Organismus. Genotyp: Gesamtheit der Informationen

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Seminar Biomedical Informatics

Seminar Biomedical Informatics Martin Dugas und Xiaoyi Jiang Institut für Informatik Sommersemester 2017 Organisation Vorlage: Englischsprachige Publikation Vortrag: ca. 30min + 15min Diskussion, Hand-out, Blockseminar Anfang Juni Seminararbeit:

Mehr

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Vererbung Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Klassische Genetik Äußeres Erscheinungsbild: Phänotypus setzt sich aus einer Reihe von Merkmalen (Phänen))

Mehr

C SB. Genomics Herausforderungen und Chancen. Genomics. Genomic data. Prinzipien dominieren über Detail-Fluten. in 10 Minuten!

C SB. Genomics Herausforderungen und Chancen. Genomics. Genomic data. Prinzipien dominieren über Detail-Fluten. in 10 Minuten! Genomics Herausforderungen und Chancen Prinzipien dominieren über Detail-Fluten Genomics in 10 Minuten! biol. Prin cip les Genomic data Dr.Thomas WERNER Scientific & Business Consulting +49 89 81889252

Mehr

Datenbanken in der Bioinformatik

Datenbanken in der Bioinformatik Datenbanken in der Bioinformatik Kapitel 1 Motivation und Grundlagen http://dbs.uni-leipzig.de Institut für Informatik Vorläufiges Inhaltsverzeichnis 1. Motivation und Grundlagen 2. Klassifizierung von

Mehr

Informationsvisualisierung

Informationsvisualisierung Informationsvisualisierung Thema: 7. Visualisierung Biologischer Daten Dozent: Dr. Dirk Zeckzer zeckzer@informatik.uni-leipzig.de Sprechstunde: nach Vereinbarung Umfang: 2 Prüfungsfach: Modul Fortgeschrittene

Mehr

Arten der Intronen. Spliceosome Struktur des snrnp U1. Spliceosome. Vorlesung 3: Evolution des eukaryotischen Genoms 4/20/11

Arten der Intronen. Spliceosome Struktur des snrnp U1. Spliceosome. Vorlesung 3: Evolution des eukaryotischen Genoms 4/20/11 Vorlesung 3: Evolution des eukaryotischen Genoms Struktur des eukaryotischen Gens Intronen und Exonen Genduplikation--Familien des Gens Eiweißdomänen (Protein domains) Domänen und Exonen: sind sie verwandt?

Mehr

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath Grundlagen Genetik Dipl.- Psych. Silja Bellingrath Infos zur Klausur Dauer: 11/2 Stunden (maximal) Keine Noten, nur bestanden versus nicht bestanden Inhalt: Grundlage sind die Folien zum Seminar; geprüft

Mehr

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Einführung in die Grundlagen der Genetik Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Molekularbiologische Grundlagen Die Zelle ist die grundlegende, strukturelle und funktionelle

Mehr

1. Nennt Informationen, die ein Wissenschaftler für die Durchführung des farbig markierten Schrittes benötigt. 2. Nennt zusätzliche Probleme die bei

1. Nennt Informationen, die ein Wissenschaftler für die Durchführung des farbig markierten Schrittes benötigt. 2. Nennt zusätzliche Probleme die bei Wir erinnern uns 1. Nennt Informationen, die ein Wissenschaftler für die Durchführung des farbig markierten Schrittes benötigt. 2. Nennt zusätzliche Probleme die bei der Verwendung eines Gens aus einer

Mehr

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS)

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) N U C L E I N S Ä U R E N Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) BAUSTEINE DER NUCLEINSÄUREN Die monomeren Bausteine der Nucleinsäuren

Mehr

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de

Mehr

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

Informationsgehalt von DNA

Informationsgehalt von DNA Informationsgehalt von DNA Topics Genes code, gene organisation, signals, gene detection Genomes genome organisation, nucleotide patterns, junk DNA DNA als Informationsträger DNA Building Blocks Desoxyribose

Mehr

15. Aminosäuren, Peptide und Proteine

15. Aminosäuren, Peptide und Proteine 15. Aminosäuren, Peptide und Proteine 1 Proteine (Polypeptide) erfüllen in biologischen ystemen die unterschiedlichsten Funktionen. o wirken sie z.b. bei vielen chemischen eaktionen in der atur als Katalysatoren

Mehr

Pinschertage der OG Bonn Grundlagen der Zucht

Pinschertage der OG Bonn Grundlagen der Zucht Pinschertage der OG Bonn 31.05. - 01.06.2008 Grundlagen der Zucht von Ralf Wiechmann Der Phänotyp Ist die Gesamtheit der wahrnehmbaren Merkmale eines Organismus. das äußere Erscheinungsbild das Aussehen,

Mehr

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während

Mehr

Restriktion und Gentechnik

Restriktion und Gentechnik Restriktion und Gentechnik Einteilung 1.) Restriktion - Restriktionsenzyme - Southern Blotting 2.)Gentechnik - sticky ends - blunt ends Restriktion Grundwerkzeuge der Gentechnik - Restriktionsenzymanalyse

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Aminosäuren - Proteine

Aminosäuren - Proteine Aminosäuren - Proteine ÜBERBLICK D.Pflumm KSR / MSE Aminosäuren Überblick Allgemeine Formel für das Grundgerüst einer Aminosäure Carboxylgruppe: R-COOH O Aminogruppe: R-NH 2 einzelnes C-Atom (α-c-atom)

Mehr

Human Genome Project

Human Genome Project 2003 by IMABE - Institut für medizinische Anthropologie und Bioethik, Wien Imago Hominis, Band 10 Heft 3, S. 157-4162 ISSN 1021-9803 Human Genome Project Carmen CZEPE Zusammenfassung Im Februar des Jahres

Mehr

1. Beschreiben Sie die Rolle der folgenden Proteine bei der DNA- Replikation in E. coli:

1. Beschreiben Sie die Rolle der folgenden Proteine bei der DNA- Replikation in E. coli: 1. Beschreiben Sie die Rolle der folgenden Proteine bei der DNA- Replikation in E. coli: Übung 7 - DnaA bindet an 13 bp DNA Sequenz (DnaA Box, 5 Wiederholungen bei E. coli) im oric ori wird in AT reicher

Mehr

Bioinformatik Für Biophysiker

Bioinformatik Für Biophysiker Bioinformatik Für Biophysiker Sommersemester 2009 Silke Trißl / Ulf Leser Wissensmanagement in der Bioinformatik Wissensmanagement in der Bioinformatik Schwerpunkte Algorithmen der Bioinformatik Management

Mehr

Gendefekte und Gentherapie bei Mukoviszidose Klausuraufgaben Reihe 3 Verlauf Material S 1

Gendefekte und Gentherapie bei Mukoviszidose Klausuraufgaben Reihe 3 Verlauf Material S 1 S 1 Gendefekte und Gentherapie Klausurarbeit Name: Datum: I Aufgabenteil Aufgabe 1 a) Lesen Sie sich die Informationen über die Ursache der Krankheit Mukoviszidose im Teil I des Materialteils genau durch.

Mehr

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Bioinformatik,

Mehr

Vertiefendes Seminar zur Vorlesung Biochemie

Vertiefendes Seminar zur Vorlesung Biochemie Vertiefendes Seminar zur Vorlesung Biochemie 24.10.2014 Vorbesprechung und Organisation Gerhild van Echten-Deckert Fon. +49-228-732703 Homepage: http://www.limes-institut-bonn.de/forschung/arbeitsgruppen/unit-3/abteilung-van-echten-deckert/abt-van-echten-deckert-startseite/

Mehr

Institut für Biochemie und Molekulare Medizin. Lecture 1 Translational components. Michael Altmann FS 2011

Institut für Biochemie und Molekulare Medizin. Lecture 1 Translational components. Michael Altmann FS 2011 Institut für Biochemie und Molekulare Medizin Lecture 1 Translational components Michael Altmann FS 2011 Gene Expression Fliessdiagramm der eukaryotischen Genexpression Die Expression eines Gens kann auf

Mehr

The LAREU DNA Project

The LAREU DNA Project The LAREU DNA Project LAREU has started the initiative for a world wide standard of markers for parentage testing in alpacas and llamas, in collaboration with ISAG (International Society of Animal Genetics)

Mehr

Molekularbiologische Grundlagen

Molekularbiologische Grundlagen Molekularbiologische Grundlagen Ulf Leser, Sommersemester 2008 Silke Trißl Überblick Biologie Organismen Aufbau von Zellen Prokaryoten und Eukaryoten Genom und DNA Transkription DNA RNA Protein Proteine

Mehr

Bioinformatik. Lokale Alignierung Gapkosten. Silke Trißl / Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Lokale Alignierung Gapkosten. Silke Trißl / Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Lokale Alignierung Gapkosten Silke Trißl / Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Ähnlichkeit Lokales und globales Alignment Gapped Alignment Silke Trißl:

Mehr

Die molekularbiologische Untersuchung von Morbus Wilson Durchmusterung des ATP7B Gens auf Mutationen

Die molekularbiologische Untersuchung von Morbus Wilson Durchmusterung des ATP7B Gens auf Mutationen Die molekularbiologische Untersuchung von Morbus Wilson Durchmusterung des ATP7B Gens auf Mutationen Dr. Alfred Cornelis Looman - Gene Analysis Service GmbH - Berlin Posterpresentation Morbus Wilson Symposium

Mehr

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von

DNA- Replikation. PowerPoint-Learning. Andrea Brügger. von DNA- Replikation PowerPoint-Learning von Andrea Brügger Lernziele dieser Lerneinheit: 1. Sie kennen und verstehen die einzelnen Teilschritte der DNA-Replikation und können diese Teilschritte den entsprechenden

Mehr

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat

Mehr

Methodik der Genomsequenzierung

Methodik der Genomsequenzierung WS2015/2016 Genomforschung und Sequenzanalyse - Einführung in Methoden der Bioinformatik- Thomas Hankeln Methodik der Genomsequenzierung Meilensteine Phi X 174 1977 5.386 bp λ Phage 1982 48.502 bp M. genitalium

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

4.9.7 Konstruktion der Suffixbäume

4.9.7 Konstruktion der Suffixbäume .9.7 Konstruktion der Suffixbäume Beipiel: xabxa (siehe Abbildung.27) Man beginnt mit der Konstruktion eines Suffixbaumes für gesamten String und schreibt eine 1 am Blatt, weil der Suffix xabxa an der

Mehr

Eukaryotische messenger-rna

Eukaryotische messenger-rna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende u.u. nicht-codierende Bereiche (Introns) Spleißen von prä-mrna Viele Protein-codierende Gene in Eukaryoten sind durch nicht-codierende

Mehr

Transkription Teil 2. - Transkription bei Eukaryoten -

Transkription Teil 2. - Transkription bei Eukaryoten - Transkription Teil 2 - Transkription bei Eukaryoten - Inhalte: Unterschiede in der Transkription von Pro- und Eukaryoten Die RNA-Polymerasen der Eukaryoten Cis- und trans-aktive Elemente Promotoren Transkriptionsfaktoren

Mehr

...-Arg-Met-Phe-Ala-Asn-His-Lys-Ser-Val-Gly-...

...-Arg-Met-Phe-Ala-Asn-His-Lys-Ser-Val-Gly-... 1. Im Enzym Xase, das aus einer Polypeptidkette aus 300 Aminosäuren besteht, findet sich in der Region der Aminosäuren 40-50 die folgende Aminosäurensequenz:...-Arg-Met-Phe-Ala-Asn-His-Lys-Ser-Val-Gly-...

Mehr

Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik. Karl J. Lackner

Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik. Karl J. Lackner Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik Karl J. Lackner Hochdurchsatzverfahren in der molekularen bzw. genetischen Diagnostik Next Generation-Sequenzierung

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Molekulargenetik der Eukaryoten WS 2014/15, VL 10. Erwin R. Schmidt Institut für Molekulargenetik

Molekulargenetik der Eukaryoten WS 2014/15, VL 10. Erwin R. Schmidt Institut für Molekulargenetik Molekulargenetik der Eukaryoten WS 2014/15, VL 10 Erwin R. Schmidt Institut für Molekulargenetik Replikationsgabel bei Prokaryoten Replikationsgabel bei Eukaryoten Pol e Pol d GINS (Go, Ichi, Nii, and

Mehr

DNA: Aufbau, Struktur und Replikation

DNA: Aufbau, Struktur und Replikation DNA: Aufbau, Struktur und Replikation Biochemie Die DNA als Träger der Erbinformation Im Genom sind sämtliche Informationen in Form von DNA gespeichert. Die Information des Genoms ist statisch, d. h. in

Mehr

Mathematik und Naturwissenschaften, Biologie, Biochemie. Biochemie II - Tutorium

Mathematik und Naturwissenschaften, Biologie, Biochemie. Biochemie II - Tutorium Mathematik und Naturwissenschaften, Biologie, Biochemie Biochemie II - Tutorium Dresden, 12.10.2016 Alexander Götze 3.Semester Molekulare Biotechnologie a.goetze2207@googlemail.com Mi. 2DS DRU. 68 H Michel

Mehr

Grundlagen der Bioinformatik Assignment 3: Hierarchical Clustering SS Yvonne Lichtblau/Johannes Starlinger

Grundlagen der Bioinformatik Assignment 3: Hierarchical Clustering SS Yvonne Lichtblau/Johannes Starlinger Grundlagen der Bioinformatik Assignment 3: Hierarchical Clustering SS 2017 Yvonne Lichtblau/Johannes Starlinger Presentations Assignment 2 Yvonne Lichtblau Übungen Grundlagen der Bioinformatik SS 2017

Mehr

Aufgabe 1. Bakterien als Untersuchungsgegenstand!

Aufgabe 1. Bakterien als Untersuchungsgegenstand! Genetik I Aufgabe 1. Bakterien als Untersuchungsgegenstand 1. Beschriften Sie die Abbildung zu den Bakterien. 2. Nennen Sie Vorteile, die Bakterien wie Escherichia coli so wertvoll für die genetische Forschung

Mehr

Genetische Marker in der Entomologie

Genetische Marker in der Entomologie Genetische Marker in der Entomologie Wien, 19. November 2004 1865 Merkmale werden unabhängig voneinander vererbt 1871 Entdeckung der Nukleinsäuren 1903 Chromosomen sind Träger des Erbguts 1927 Mutationen

Mehr

Posttranskriptionale RNA-Prozessierung

Posttranskriptionale RNA-Prozessierung Posttranskriptionale RNA-Prozessierung Spaltung + Modifikation G Q Spleissen + Editing U UUU Prozessierung einer prä-trna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Glossar Bio- Gentechnologie

Glossar Bio- Gentechnologie Glossar Bio- Gentechnologie Aminosäuren Organische Verbindungen, die als charakteristisches Merkmal sowohl eine Aminogruppe als auch eine Carboxylgruppe besitzen. Die 20 sogenannten "natürlichen" Aminosäuren

Mehr

Gen Protein Aufgaben: Edel LK-Bio BI-3

Gen Protein Aufgaben: Edel LK-Bio BI-3 Proteinbiosynthese Von der DNA zum Protein Dieses Lernprogramm zeigt Ihnen in einem vereinfachten Modell den im Zellinneren ablaufenden Prozess vom Gen auf der DNA zum Protein. Aufgaben: 1 Betrachten Sie

Mehr

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie

Grundwissenkarten Gymnasium Vilsbisburg. 9. Klasse. Biologie Grundwissenkarten Gymnasium Vilsbisburg 9. Klasse Biologie Es sind insgesamt 10 Karten für die 9. Klasse erarbeitet. davon : Karten ausschneiden : Es ist auf der linken Blattseite die Vorderseite mit Frage/Aufgabe,

Mehr