Rückbildung von Aphasien und Wirkung von Sprachtherapie

Größe: px
Ab Seite anzeigen:

Download "Rückbildung von Aphasien und Wirkung von Sprachtherapie"

Transkript

1 Rückbildung von Aphasien und Wirkung von Sprachtherapie Medizinische Fakultät Basel 2. Jahreskurs, Major Clinical Medicine Wahlmodul 3 Gehirn und Sprache Dezember 2008 Seraina Locher

2 Medical eduction, it seems to me, has failed the patient with aphasia. Aphasia therapy works. Why isn t the message getting out? Martin L. Albert Bhogal et al., Stroke 2003:34

3 Meta-Analyse von Boghal et al Widersprüchliche Resultate über den Effekt von Sprachtherapie Zusammenhang von Intensität der Therapie und Rückbildung der Aphasie? MEDLINE-Recherche (5) + weitere Arbeiten (5) Januar 1975 Mai 2002 nur Schlaganfall-Patienten SLT Gruppe vs. Vergleichsgruppe (gleiche Therapielänge) Meta-Analyse von 10 Studien, 864 Individuen Bhogal et al., Stroke 2003:34

4 Resultate Die Gesamtlänge der Therapie korreliert signifikant umgekehrt zur durchschnittlichen Veränderung im PICA (Trend auch im Token Test) Die Anzahl Therapiestunden pro Woche korreliert signifikant mit Verbesserung im PICA und Token Test Die Gesamtzahl an Therapiestunden korreliert signifikant mit Verbesserung im PICA und Token Test Bhogal et al., Stroke 2003:34

5 Bedeutung für klinische Anwendung SLT hat einen positiven Einfluss auf die Rückbildung von Aphasie, wenn sie intensiv angeboten wird. die optimalen Organisation und Struktur der Sprachtherapie hat grosse Bedeutung. Poeck et al. noted that aphasia improved even in the chronic phase with intensive therapy. [ ] Most importantly, this review underscores the importance of SLT to aphasia recovery. Bhogal et al., Stroke 2003:34

6 Sprachtherapie und chronische Aphasie Chronische Aphasie: Jenseits von 12 Monaten zeigen die verbleibenden aphasischen Symptome ein stabiles Bild, welches sich ohne therapeutische Intervention kaum noch verändert. Schlenck, Parleth 2004 Retrospektive Untersuchung von 140 Aphasie- Patienten bis in chronische Phase; 97 davon über einen Zeitraum von durchschnittlich 5 Jahren. Einflussgrössen auf Rückbildungsprognose? Quantitative und qualitative Rückbildungsverläufe intensive Therapie Art und Ausmass der aphasischen Störung Schlenck et al., Die Sprachheilarbeit 2004:49

7 Resultate Akutphase keine signifikanten Unterschiede zwischen Patienten mit globaler und nicht globaler Aphasie! Methodisch keine Unterscheidung zwischen Spontanremission und Therapie-Effekt möglich Verbesserung in allen Untertests und auf allen Ebenen der Spontansprache Schlenck et al., Die Sprachheilarbeit 2004:49

8 Resultate chronische Phase Unter intensiver Therapie verbessert sich etwas mehr als die Hälfte (56,5%) der Patienten signifikant! Verbesserung bei Patienten mit globaler Aphasie signifikant seltener Verbesserung bei Patienten ohne Verbesserung in Akutphase signifikant seltener Schlenck et al., Die Sprachheilarbeit 2004:49

9 Langzeitverläufe Die Wahrscheinlichkeit, sich unter intensiver Sprachtherapie in der chronischen Phase zu verbessern, nimmt mit zunehmender Dauer nicht ab. Verbesserung deutlich häufiger auf phonologischer, als auf lexikalisch-semantisch bzw. syntaktischer Ebene Schlenck et al., Die Sprachheilarbeit 2004:49

10 Reorganisation des Sprachsystems nach Hirnschlag 14 Patienten mit Aphasie nach einem Erstinfarkt im Gebiet der linken A. cerebri media 3 fmri-scans bei den Aphasie- Patienten (in akuter, subakuter und chronischer Phase); Kontrollgruppe 1 Scan parallel Einschätzung mittels Aphasie- Tests Einzelwerte auf Wert 0-1 normalisiert = Language Recovery Score (LRS) Alle Patienten erhalten intensive SLT über die gesamte Zeitdauer des Versuchs Saur et al., Brain 2006:129 Elsevier, Sobotta interaktiv Version 1.5 Nerven und Sinne

11 Resultate fmri Akute Phase: wenig Aktivierung in nicht geschädigten Sprach- Strukturen in der linken Hemisphäre vlg. signifikant hohe Korrelation von LRS und Sprach-Aktivierung Subakute Phase: Hochregulierung der Aktivierung in bilateralen Sprach-Strukturen der rechten Hemisphäre (Broca-Homologue) Chronische Phase: Rückverschiebung der Peak-Aktivierung auf Sprach-Strukturen in der linken Hemisphäre Saur et al., Brain 2006:129

12 3 Phasen der Sprach-Reorganisation ( ) Kontrolle ( ) IFG und SMA auf der rechten Hemisphäre: biphasisch; früh Hochregulierung, später Abfall der Aktivierung (---) Sprach-Strukturen der linken Hemisphäre: monophasisch; kontinuierliche Hochregulierung Saur et al., Brain 2006:129

13 Fragen? Diskussion Gibt es DAS Therapieprogramm für Aphasie-Patienten? Wie könnte es deiner Meinung nach aussehen? Kann man einen Aphasie-Patienten in der chronischen Phase ab einem gewissen Zeitpunkt als therapie-resistent bezeichnen? Soll man niederfrequente ambulante logopädische Therapie für Aphasie- Patienten in der chronischen Phase empfehlen? Warum? 1. Bhogal, S.K.; Teasell, R.; Speechley, M Intensity of Aphasia therapy, Impact on Recovery. Stroke 34: Schlenck, K.-J., Perleth, S Langzeitverlauf bei Aphasie und der Effekt von Sprachtherapie in der chronischen Phase. Die Sprachheilarbeit 49: Saur, D.; Lange, R.; Baumgaertner, A.; Schraknepper, V. et al Dynamics of language reorganization after stroke. Brain 129:

Prof. Dr. Dr. Martin HärterH

Prof. Dr. Dr. Martin HärterH Effekte von Shared Decision-Making Forschungsstand zur Adherence Prof. Dr. Dr. Martin HärterH Fachtagung Adherence Berlin 11.12.2009 Definition Adherence ist definiert als das Ausmaß, in welchem das Verhalten

Mehr

Evidenzbasierte Aphasietherapie: Was ist erreicht, was ist noch zu tun?

Evidenzbasierte Aphasietherapie: Was ist erreicht, was ist noch zu tun? Evidenzbasierte Aphasietherapie: Was ist erreicht, was ist noch zu tun? Zusammenfassung Seit mehr als zehn Jahren liegen evidenzbasierte Nachweise dafür vor, dass Aphasie therapie effektiv ist. Sie ist

Mehr

Grundlagen der evidenzbasierten neurologischen Rehabilitation

Grundlagen der evidenzbasierten neurologischen Rehabilitation Grundlagen der evidenzbasierten neurologischen Rehabilitation Prof. Dr. phil. Helmut Hildebrandt Klinikum Bremen-Ost, Neurologie Universität Oldenburg, Psychologie email: helmut.hildebrandt@uni-oldenburg.de

Mehr

1. Einleitung. Fachbeiträge

1. Einleitung. Fachbeiträge Erfassung der logopädischen Versorgungslage von erwachsenen Patientinnen und Patienten aus Sicht praktizierender Logopädinnen und Logopäden in der Deutschschweiz. Einleitung Die effektive und effiziente

Mehr

Publikationsliste. Zeitschriften/Journale. Originalarbeiten

Publikationsliste. Zeitschriften/Journale. Originalarbeiten Publikationsliste Prof. Dr. Bernhard Elsner, MPH Stand: 09.10.2014 IF = Science Citation Impact Factor 2012 * = Diese Publikation resultiert aus der Doktorarbeit. Zeitschriften/Journale Originalarbeiten

Mehr

Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen.

Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen. Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen. Reduktion der Antibiotikaverordnungen bei akuten Atemwegserkrankungen 1. Basis für rationale Antibiotikaverordnungen: Leitlinien

Mehr

Einfluss von einem Computerspiel auf Depression, Angststörungen und Schmerzen bei stationären Patienten: rct. Institut für Physiotherapie

Einfluss von einem Computerspiel auf Depression, Angststörungen und Schmerzen bei stationären Patienten: rct. Institut für Physiotherapie Einfluss von einem Computerspiel auf Depression, Angststörungen und Schmerzen bei stationären Patienten: rct Institut für Physiotherapie Der rote Faden Wie ist die epidemiologische Datenlage? Nehmen psychische

Mehr

Neue Aspekte in der Rehabilitation

Neue Aspekte in der Rehabilitation Berliner Medizinische Gesellschaft Der Schlaganfall von der Forschung zur verbesserten Versorgung in Berlin 20.11.2013 Neue Aspekte in der Rehabilitation Agnes Flöel Neurologie/NeuroCure/CSB Charite, Berlin

Mehr

Präklinische Versorgung von Schlaganfallpatienten im Landkreis Fulda. Roland Stepan (Ärztlicher Leiter Rettungsdienst) April / Mai 2012

Präklinische Versorgung von Schlaganfallpatienten im Landkreis Fulda. Roland Stepan (Ärztlicher Leiter Rettungsdienst) April / Mai 2012 Präklinische Versorgung von Schlaganfallpatienten im Landkreis Fulda Roland Stepan (Ärztlicher Leiter Rettungsdienst) April / Mai 2012 1 Inhalte Fakten und Zahlen Definition Beurteilung von Patienten mit

Mehr

Videogestütztes Konversationstraining: Eine Studie zum hochfrequenten und repetitiven Lernen von Alltagsdialogen in der Aphasie

Videogestütztes Konversationstraining: Eine Studie zum hochfrequenten und repetitiven Lernen von Alltagsdialogen in der Aphasie Videogestütztes Konversationstraining: Eine Studie zum hochfrequenten und repetitiven Lernen von Alltagsdialogen in der Aphasie Kerstin Bilda (Prof. Dr.), Katrin Matzner (BSc), Hanna Jochims (BSc), Caterina

Mehr

Klinische Versorgungsforschung: Warum, wieso, und wie?

Klinische Versorgungsforschung: Warum, wieso, und wie? Klinische Versorgungsforschung: Warum, wieso, und wie? Werner Vach Koordinierungsstelle Versorgungsforschung Medizinische Fakultät der Universität Freiburg Was ist Versorgungsforschung? Was ist Versorgungsforschung?

Mehr

Ist geriatrische Rehabililtation wirksam?

Ist geriatrische Rehabililtation wirksam? Ist geriatrische Rehabililtation wirksam? Dr. med. Stefan Bachmann Chefarzt Rheumatologie/muskuloskelettale Rehabilitation Rehabilitationszentrum Klinik Valens Leiter Forschung Geriatrie Universität Bern

Mehr

TIME IS BRAIN! Aktuelles zur Schlaganfallbehandlung. Marianne Dieterich Klinik und Poliklinik für Neurologie

TIME IS BRAIN! Aktuelles zur Schlaganfallbehandlung. Marianne Dieterich Klinik und Poliklinik für Neurologie TIME IS BRAIN! Aktuelles zur Schlaganfallbehandlung Marianne Dieterich Klinik und Poliklinik für Neurologie Interdisziplinäres Schlaganfallzentrum München (Ludwig-Maximilians-Universität München, Standort

Mehr

Schlaganfall, was nun?

Schlaganfall, was nun? Schlaganfall, was nun? Neurologisch bedingte Sprach- und Sprechstörungen Corinna Rolf & Dr. phil. Uta Lürßen Dipl. Sprachheilpädagoginnen Inhalt Begrüßung und Vorstellung Einführung in das Thema Ursachen

Mehr

Johanniskraut Metaanalyse 2005

Johanniskraut Metaanalyse 2005 Johanniskraut Metaanalyse 2005 Seit 1983 wurden 37 randomisierte klinische Studien mit Johanniskraut-Präparaten publiziert Davon: 26 Placebo-kontrolliert, 14 Verum-kontrolliert Studiendauer: 4 Wochen (10

Mehr

Neurofeedback --- Train your brain

Neurofeedback --- Train your brain Seminar Brain-Machine Interfaces Neurofeedback --- Train your brain 1 18.11.2009 Biofeedback...bezeichnet eine Methode, bei der eine Person die bewusste Selbstkontrolle über bestimmte Funktionen seines

Mehr

Musik und Schlaganfall. Einige Hinweise

Musik und Schlaganfall. Einige Hinweise Herausgeber: B. Fischer, 77736 Zell a.h, Birkenweg 19 Tel: 07835-548070 www.wisiomed.de Musik und geistige Leistungsfähigkeit s. www.wissiomed.de linke Leiste: downloads Bildung Nr. 14 Musik und Schlaganfall

Mehr

ECVET-konformes Curriculum der Logopädie

ECVET-konformes Curriculum der Logopädie ECVET-konformes Curriculum der Logopädie Entstanden im Projekt 2get1care Lebenslanges Lernen und Interprofessionalität in den Gesundheitsfachberufen (2011-2013) Dieses Projekt wurde mit Unterstützung der

Mehr

"Interventionell, operativ oder doch lieber konservativ. Wo geht es hin bei der Behandlung der pavk?"

Interventionell, operativ oder doch lieber konservativ. Wo geht es hin bei der Behandlung der pavk? "Interventionell, operativ oder doch lieber konservativ Wo geht es hin bei der Behandlung der pavk?" Vom Symptom zur Diagnose. Beispiel pavk. Besonderheiten der hausärztlichen Tätigkeit: Quantitative Bedingungen:

Mehr

Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin, Clomipramin, Doxepin und Maprotilin unter naturalistischen Bedingungen

Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin, Clomipramin, Doxepin und Maprotilin unter naturalistischen Bedingungen Aus der Klinik und Poliklinik für Psychiatrie, Psychosomatik und Psychotherapie der Universität Würzburg Direktor: Professor Dr. med. J. Deckert Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin,

Mehr

AVWS Diagnostik aus sprachtherapeutischer Sicht

AVWS Diagnostik aus sprachtherapeutischer Sicht AVWS Diagnostik aus sprachtherapeutischer Sicht Birke Peter, Klinische Sprechwissenschaftlerin Klinik und Poliklinik für Hals-, Nasen-, Ohrenheilkunde Universitätsmedizin Leipzig Direktor: Univ.-Prof.

Mehr

Psychotherapie und Psychopharmakologie Wo liegt die Balance: Psychosen

Psychotherapie und Psychopharmakologie Wo liegt die Balance: Psychosen Psychotherapie und Psychopharmakologie Wo liegt die Balance: Psychosen Prof. Dr. med. Wolfram Kawohl Chefarzt Zentrum für Soziale Psychiatrie Klinik für Psychiatrie, Psychotherapie und Psychosomatik Psychiatrische

Mehr

DGK-Jahrestagung 2007 in Mannheim. Beurteilung der Kosten-Effektivität der CRT-D Therapie bei Patienten mit chronischer Herzinsuffizienz

DGK-Jahrestagung 2007 in Mannheim. Beurteilung der Kosten-Effektivität der CRT-D Therapie bei Patienten mit chronischer Herzinsuffizienz DGK-Jahrestagung 2007 in Mannheim Beurteilung der Kosten-Effektivität der CRT-D Therapie bei Patienten mit chronischer Herzinsuffizienz Presenting Author: Wasem J Verfasser: Dr. Pamela Aidelsburger 1 Kristin

Mehr

Faktenblatt: Traditionelle Chinesische Medizin. (Siehe auch: Mind-Body-Therapien und Medizinische Pilze) Methode/Substanz

Faktenblatt: Traditionelle Chinesische Medizin. (Siehe auch: Mind-Body-Therapien und Medizinische Pilze) Methode/Substanz Faktenblatt: Traditionelle Chinesische Medizin Mai 2015 Verantwortlich: PD Dr. J. Hübner, Prof. K. Münstedt, Prof. O. Micke, PD Dr. R. Mücke, Prof. F.J. Prott, Prof. J. Büntzel, Prof. V. Hanf, Dr. C. Stoll

Mehr

Vom unklaren Symptomkomplex zur ganzheitlichen Diagnose

Vom unklaren Symptomkomplex zur ganzheitlichen Diagnose Morbus Fabry - Niereninsuffizienz Kardiomyopathie Neurologische Störungen - Vom unklaren Sympto Morbus Fabry Niereninsuffizienz Kardiomyopathie Neurologische Störungen Vom unklaren Symptomkomplex zur ganzheitlichen

Mehr

Komplementärmedizin nach Transplantation?

Komplementärmedizin nach Transplantation? Komplementärmedizin nach Transplantation? Dr.med. Martin Frei-Erb Facharzt FMH Allgemeine Innere Medizin Institut für Komplementärmedizin IKOM Universität Bern 22.3.2014, 10. Symposium für Transplantierte,

Mehr

II. Forum Gesundheitswirtschaft Münsterland

II. Forum Gesundheitswirtschaft Münsterland II. Forum Gesundheitswirtschaft Münsterland 17.02.2009 Hörscreening Antoinette am Zehnhoff-Dinnesen Peter Matulat Claus-Michael Schmidt Klinik und Poliklinik für II. Forum Gesundheitswirtschaft Münsterland

Mehr

Das komplexe regionale Schmerzsyndrom CRPS Handtherapeutische Strategien in Kombination mit PNF

Das komplexe regionale Schmerzsyndrom CRPS Handtherapeutische Strategien in Kombination mit PNF Das komplexe regionale Schmerzsyndrom CRPS Handtherapeutische Strategien in Kombination mit PNF Bundeskongress Physiotherapie 21. 22. Oktober 2016 Dresden Barbara Dopfer, Physiotherapeutin, zertifizierte

Mehr

3. Fortbildungstag Forum für klinische Notfallmedizin

3. Fortbildungstag Forum für klinische Notfallmedizin 3. Fortbildungstag Forum für klinische Notfallmedizin Die forum Pearls klinische Fälle klinische Perle 1 Vortrag Therapie der akuten Ateminsuffizienz Problemstellung Klassische Therapieformen Alternativen

Mehr

Sprachen im Gehirn. Marco Monachino. Christina Backes

Sprachen im Gehirn. Marco Monachino. Christina Backes Sprachen im Gehirn Marco Monachino Christina Backes Überblick Allgemeines und Aufbau Sprachzentren Neurolinguistische Verarbeitung Methoden der Neurolinguistik 2 Allgemeines Das Gehirn wiegt bei einem

Mehr

Tapentadol weiterhin keine nachhaltige therapeutische Verbesserung belegt

Tapentadol weiterhin keine nachhaltige therapeutische Verbesserung belegt AG AMV Arbeitsgruppe Arzneimittelvereinbarung Gemeinsame Information der KVWL und der Verbände der Krankenkassen in Westfalen-Lippe Datum: Oktober 2014 Tapentadol weiterhin keine nachhaltige therapeutische

Mehr

Einfluss von Aufmerksamkeit auf die auditive Verarbeitung

Einfluss von Aufmerksamkeit auf die auditive Verarbeitung Einfluss von Aufmerksamkeit auf die auditive Verarbeitung eine fmri-einzelfallstudie Alexandra Liebs Universität Salzburg ULG Klinische Linguistik Patient L.A.S., 1967 St. n. Subarachnoidalblutung am 20.08.06

Mehr

Ärzteinformation. Asthma-Patientenschulung. Ärzteinformation NEU

Ärzteinformation. Asthma-Patientenschulung. Ärzteinformation NEU Ärzteinformation -Patientenschulung Ärzteinformation NEU ab 2016 LUN -Patientenschulung der Lungenliga Thurgau Mit professioneller Beratung die Lebensqualität steigern Über 60% der Patientinnen und Patienten

Mehr

Seroquel Prolong ermöglicht kontinuierliche Therapie über alle Phasen

Seroquel Prolong ermöglicht kontinuierliche Therapie über alle Phasen Monotherapie bipolar affektiver Störung Seroquel Prolong ermöglicht kontinuierliche Therapie über alle Phasen Bonn (8. März 2010) Mit der Zulassung von Seroquel Prolong (Quetiapin) zur Phasenprophylaxe

Mehr

Das Stepped Wedge Design

Das Stepped Wedge Design Das Stepped Wedge Design Chance und Herausforderung zur Bestimmung der Effektivität in der Versorgungsforschung Sven Reuther, MScN 4. Fachtagung der DGP Methodische Herausforderungen an Pflegeforschung

Mehr

Was hilft im fortgeschrittenen Krankheitsstadium?

Was hilft im fortgeschrittenen Krankheitsstadium? Was hilft im fortgeschrittenen Krankheitsstadium? Daniela Berg Zentrum für Neurologie und Hertie-Institut für Klinische Hirnforschung Universität Tübingen Hertie-Institut für klinische Hirnforschung Aufmerksamkeit/Gedächtnis

Mehr

Ausgewählte Publikationen - Prof. Dr. phil. Tanja Grewe

Ausgewählte Publikationen - Prof. Dr. phil. Tanja Grewe Ausgewählte Publikationen - Prof. Dr. phil. Tanja Grewe Qualifizierende Arbeiten Grewe, T. (2006). The neuronal reality of the nominal hierarchy: fmri observations on animacy in sentence comprehension.

Mehr

Hausärztliche Lehre und Forschung im Wandel der Zeit. Klaus Bally

Hausärztliche Lehre und Forschung im Wandel der Zeit. Klaus Bally Hausärztliche Lehre und Forschung im Wandel der Zeit Klaus Bally Voraussetzungen für eine gute Lehre an der Universität Ziel der Ausbildung? Gute Ärzte Was braucht es für eine gute Ausbildung? Studierende;

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

Telemedizinische Rehabilitation nach Schlaganfall. Prof. Dr. Stefan Hesse, Medical Park Berlin Humboldtmühle Christopher Tomelleri

Telemedizinische Rehabilitation nach Schlaganfall. Prof. Dr. Stefan Hesse, Medical Park Berlin Humboldtmühle Christopher Tomelleri Telemedizinische Rehabilitation nach Schlaganfall Prof. Dr. Stefan Hesse, Medical Park Berlin Humboldtmühle Christopher Tomelleri Schlaganfall Epidemiologie Inzidenz: 180/100000 (Kolominski-Rabas, 2002)

Mehr

Evidenzbasierte Aphasietherapie

Evidenzbasierte Aphasietherapie Sprachtherapie aktuell Aus der Praxis für die Praxis Evidenzbasierte Aphasietherapie Holger Grötzbach Zusammenfassung: Sowohl Patient(inn)en mit einer Aphasie als auch Sprachtherapeut(inn)en erwarten,

Mehr

Hyperbare Sauerstofftherapie beim Hörsturz

Hyperbare Sauerstofftherapie beim Hörsturz Hyperbare Sauerstofftherapie beim Hörsturz Ergebnisbericht Recherche Datum der Suche: 01.09.2011 PICO-Fragestellung: Population: Personen mit einem Hörsturz mit/ ohne Tinnitus Intervention: Hyperbare Sauerstofftherapie

Mehr

L-Dopa und Dopaminagonisten: Einfluss auf Schlaf und Vigilanz

L-Dopa und Dopaminagonisten: Einfluss auf Schlaf und Vigilanz Klinik für Neurologie Parkinson und Schlaf L-Dopa und Dopaminagonisten: Einfluss auf Schlaf und Vigilanz Dr. med. Manuel Bertschi, Oberarzt Informationstagung Parkinson Schweiz, 20.10.2016, Basel Inhalt

Mehr

~` Read Chronisch entzndliche Darmerkrankungen (CED) und der Einfluss von Sport und Bewegung (German Edition) digital books free download ID:yeixve

~` Read Chronisch entzndliche Darmerkrankungen (CED) und der Einfluss von Sport und Bewegung (German Edition) digital books free download ID:yeixve ~` Read Chronisch entzndliche Darmerkrankungen (CED) und der Einfluss von Sport und Bewegung (German Edition) digital books free download ID:yeixve Click Here to Read Chronisch entzndliche Darmerkrankungen

Mehr

2013 Dr. Dietmar Bayer bayer@burnout-zentrum.at 1

2013 Dr. Dietmar Bayer bayer@burnout-zentrum.at 1 bayer@burnout-zentrum.at 1 4 bayer@burnout-zentrum.at 2 Datenmaterial im Gesundheitswesen Kein einheitliches Datenmaterial in den Krankenanstalten, Kassen, der PVA etc. etc. Prävalenz von BO in der Normalpopulation

Mehr

Strategien für eine ausreichende Ernährung beim alten Patienten

Strategien für eine ausreichende Ernährung beim alten Patienten Strategien für eine ausreichende Ernährung beim alten Patienten Rainer Wirth Klinik für Geriatrie, St. Marien-Hospital Borken Arbeitsgruppe Ernährung der Deutschen Gesellschaft für Geriatrie Lehrstuhl

Mehr

Evaluation des DMP Diabetes

Evaluation des DMP Diabetes QMR Kongress Potsdam, 19./20. Sept. 2011 Evaluation des DMP Diabetes BARMER GEK Hauptverwaltung Lichtscheider Strasse 89-95 42285 Wuppertal Dr. Christian Graf Abteilungsleiter Versorgungsprogramme christian.graf@barmer-gek.de

Mehr

MRT zur Früherkennung einer Alzheimer-Demenz

MRT zur Früherkennung einer Alzheimer-Demenz MRT zur Früherkennung einer Alzheimer- Ergebnisbericht Recherche Datum der Suche: 10.08.2011 PICO-Fragestellung: Population: Personen ohne Alzheimer- (AD) Intervention: MRT zur Früherkennung von Alzheimer-

Mehr

Perspektiven mit Tarceva und Avastin

Perspektiven mit Tarceva und Avastin Fortgeschrittenes NSCLC: Perspektiven mit Tarceva und Avastin Mannheim (20. März 2009) - Die Behandlung des fortgeschrittenen nicht-kleinzelligen Lungenkarzinoms (Non Small Cell Lung Cancer, NSCLC) mit

Mehr

Langzeitverlauf posttraumatischer Belastungsreaktionen bei ehemals politisch Inhaftierten der DDR.

Langzeitverlauf posttraumatischer Belastungsreaktionen bei ehemals politisch Inhaftierten der DDR. Langzeitverlauf posttraumatischer Belastungsreaktionen bei ehemals politisch Inhaftierten der DDR. Ergebnisse einer 15-Jahre Follow-Up-Studie Matthias Schützwohl TU Dresden Klinik und Poliklinik für Psychiatrie

Mehr

Quantifizierung von Cytomegalievirus (CMV)-DNA in Darmbiopsien mittels PCR zur Diagnostik der gastrointestinalen CMV-Erkrankung

Quantifizierung von Cytomegalievirus (CMV)-DNA in Darmbiopsien mittels PCR zur Diagnostik der gastrointestinalen CMV-Erkrankung Quantifizierung von Cytomegalievirus (CMV)-DNA in Darmbiopsien mittels PCR zur Diagnostik der gastrointestinalen CMV-Erkrankung Dr. med. Tina Ganzenmüller Institut für Virologie Humanes Cytomegalievirus

Mehr

Nutzenbewertung von Arzneimitteln im Rahmen des Programms für Nationale Versorgungs-Leitlinien

Nutzenbewertung von Arzneimitteln im Rahmen des Programms für Nationale Versorgungs-Leitlinien Nutzenbewertung von Arzneimitteln im Rahmen des Programms für Nationale Versorgungs-Leitlinien Symposium der Paul-Martini-Stiftung M.Lelgemann, G.Ollenschläger Ärztliches Zentrum für Qualität in der Medizin,

Mehr

Ergebnisse der testpsychologischen Untersuchungen für das zweite Halbjahr 2013

Ergebnisse der testpsychologischen Untersuchungen für das zweite Halbjahr 2013 Ergebnisse der testpsychologischen Untersuchungen für das zweite Halbjahr 2013 Hintergrund: Seit 2012 führen wir zu Beginn und zum Ende der Behandlung bei allen Patienten eine testpsychologische Untersuchung

Mehr

Kurzpräsentation: Patientenschulungen. 09.12.14 Modul: Forschungsfragen und Ethik Dozent: Prof. Dr. Andreas Zieger Referentin: Laura Totzek

Kurzpräsentation: Patientenschulungen. 09.12.14 Modul: Forschungsfragen und Ethik Dozent: Prof. Dr. Andreas Zieger Referentin: Laura Totzek Kurzpräsentation: Patientenschulungen 09.12.14 Modul: Forschungsfragen und Ethik Dozent: Prof. Dr. Andreas Zieger Referentin: Laura Totzek Patientenschulungen Warum? Lebenslanger Umgang mit einer Krankheit

Mehr

Wirksamkeit von semantischer Komplexität bei der Therapie von Wortabrufstörungen? Eine Einzelfallstudie

Wirksamkeit von semantischer Komplexität bei der Therapie von Wortabrufstörungen? Eine Einzelfallstudie Wirksamkeit von semantischer Komplexität bei der Therapie von Wortabrufstörungen? Eine Einzelfallstudie 1 Einleitung Maria Höger, Nicole Stadie & Astrid Schröder Department Linguistik, Universität Potsdam

Mehr

Schlaganfall (Hirnschlag, Apoplex, Stroke)

Schlaganfall (Hirnschlag, Apoplex, Stroke) Schlaganfall (Hirnschlag, Apoplex, Stroke) Ein Schlaganfall (in der Fachsprache Apoplex oder cerebrovaskulärer Insult genannt) wird verursacht durch eine plötzliche Unterbrechung der Hirndurchblutung in

Mehr

Leitlinien und Qualitätsförderung. Individuelle Konzepte u. Multiprofessionelle Kooperation

Leitlinien und Qualitätsförderung. Individuelle Konzepte u. Multiprofessionelle Kooperation Leitlinien und Qualitätsförderung Individuelle Konzepte u. Multiprofessionelle Kooperation Erfahrungen mit der Implementierung von Leitlinienempfehlungen in der Physiotherapie G-I-N Conference 2012 Programm

Mehr

DIAGNOSTIK DER GESTÖRTEN KOMMUNIKATIONSFÄHIGKEIT

DIAGNOSTIK DER GESTÖRTEN KOMMUNIKATIONSFÄHIGKEIT DIAGNOSTIK DER GESTÖRTEN KOMMUNIKATIONSFÄHIGKEIT 2008 AGI-Information Management Consultants May be used for personal purporses only or by libraries associated to dandelon.com network. herausgegeben von

Mehr

Ergebnisse früherer Studien

Ergebnisse früherer Studien Psychosoziale Belastungen und Gesundheitsstörungen Christian Albus, Alexander Niecke, Kristin Forster, Christina Samel Tagung des Interessenverbandes Contergangeschädigter NRW e.v. Köln, 09. April 2016

Mehr

EEG-Biofeedback/Neurofeedback Neueste Studienergebnisse

EEG-Biofeedback/Neurofeedback Neueste Studienergebnisse EEG-Biofeedback/Neurofeedback Neueste Studienergebnisse Überblick Rehabilitation nach Schlaganfall 2011 Fibromyalgie 2011 ADHD 2007 ADHD 2009 ADHD 2010 ADHD 2012 Tinnitus 2011 rtfmri Neurofeedback Depression

Mehr

Interdisziplinäre multimodale Therapie versus konventioneller Behandlung chronischer Rückenschmerzen: Eine kostenanalytische Matched-Pairs-Studie

Interdisziplinäre multimodale Therapie versus konventioneller Behandlung chronischer Rückenschmerzen: Eine kostenanalytische Matched-Pairs-Studie Interdisziplinäre multimodale Therapie versus konventioneller Behandlung chronischer Rückenschmerzen: Eine kostenanalytische Matched-Pairs-Studie Ulf Marnitz, Ludwig Weh von Jan Brömme als Promotionsarbeit

Mehr

Störungen höherer Hirnleistungen nicht übersehen DemenzScreening

Störungen höherer Hirnleistungen nicht übersehen DemenzScreening Störungen höherer Hirnleistungen nicht übersehen DemenzScreening Prof. Dr. med. Helmut Buchner und klinische Neurophysiologie Recklinghausen Höhere Hirnleistungen Erkennen Gedächtnis Orientierung Lernen

Mehr

Was Psychiatrie so spannend macht. Prof. Dr. med. Thomas J. Müller Universitätsklinik für Psychiatrie und Psychotherapie Universität Bern

Was Psychiatrie so spannend macht. Prof. Dr. med. Thomas J. Müller Universitätsklinik für Psychiatrie und Psychotherapie Universität Bern Was Psychiatrie so spannend macht Prof. Dr. med. Thomas J. Müller Universitätsklinik für Psychiatrie und Psychotherapie Universität Bern WARUM IST DIE BEHANDLUNG PSYCHIATRISCHER STÖRUNGEN RELEVANT? Tatsächliche

Mehr

KURZFASSUNG DES PRÜFPROTOKOLLS 1839IL/0079 VOM

KURZFASSUNG DES PRÜFPROTOKOLLS 1839IL/0079 VOM KURZFASSUNG DES PRÜFPROTOKOLLS 1839IL/0079 VOM 11.11.02 RANDOMISIERTE, OFFENE, NICHT-KOMPARATIVE PHASE II STUDIE ZUR BEURTEILUNG DER WIRKSAMKEIT UND VERTRÄGLICHKEIT VON ZWEI DOSIERUNGEN ZD1839 BEI PATIENTEN

Mehr

Wiederholung: Circadiane Rhythmus-Schlafstörungen

Wiederholung: Circadiane Rhythmus-Schlafstörungen 1. Extrinsisch Wiederholung: Circadiane Rhythmus-Schlafstörungen Klassifikation nach ICSD (International Classification of Sleep Disorders) Circadiane Rhythmus-Schlafstörung vom Typ Schichtarbeitersyndrom,

Mehr

Bevacizumab kann demnach bei selektionierten Patienten im

Bevacizumab kann demnach bei selektionierten Patienten im Fortgeschrittenes NSCLC Neue S3-Leitlinie empfiehlt Bevacizumab Grenzach-Wyhlen (7. April 2010) - Die kürzlich veröffentlichte S3-Leitlinie Prävention, Diagnostik, Therapie und Nachsorge des Lungenkarzinoms

Mehr

Alzheimer Demenz: Unser Engagement. Eine Broschüre für Betroffene, Ihre Angehörigen und Interessierte

Alzheimer Demenz: Unser Engagement. Eine Broschüre für Betroffene, Ihre Angehörigen und Interessierte Alzheimer Demenz: Unser Engagement Eine Broschüre für Betroffene, Ihre Angehörigen und Interessierte Wer wir sind und wofür wir stehen Simone Thomsen Im Jahre 1876 gründete Colonel Eli Lilly das heutige

Mehr

Mixed-Pain Gibt es das wirklich und was machen wir damit?

Mixed-Pain Gibt es das wirklich und was machen wir damit? Mixed-Pain Gibt es das wirklich und was machen wir damit? Prof. Dr. med. Ralf Baron, Kiel Berlin (21. Oktober 2009) - Chronische Rückenschmerzen gehören zu den häufigsten Schmerzsyndromen. Sehr oft ist

Mehr

Wie schreibe ich (m)eine Dissertation???

Wie schreibe ich (m)eine Dissertation??? Wie schreibe ich (m)eine Dissertation??? Arbeitsmethodik und Standards Frank Krummenauer Promovierendensymposium Mülheim, 10. Juni 2011 Redaktionelle Aspekte Übliche Gliederung einer medizinischen Dissertation:

Mehr

Kontrollüberzeugungen als Prädiktor für subjektive Systembewertungen

Kontrollüberzeugungen als Prädiktor für subjektive Systembewertungen Wenke Ohlemüller Schlüsselwörter: Usability, Prototypen, Kontrollüberzeugungen Zusammenfassung Dieses Paper stellt das psychologische Konstrukt der Kontrollüberzeugungen nach Julian Rotter in den Mittelpunkt

Mehr

Medikamentöse Therapie der Carotisstenose. Peter A. Ringleb Neurologische Klinik

Medikamentöse Therapie der Carotisstenose. Peter A. Ringleb Neurologische Klinik Medikamentöse Therapie der Carotisstenose Peter A. Ringleb Neurologische Klinik Interessensanzeige Prof. Dr. Peter A. Ringleb Professor für Vaskuläre Neurologie und Leiter der Sektion Vaskuläre Neurologie

Mehr

Nachgefragt! - Welche Perspektive haben Menschen nach einem schweren Schlaganfall?

Nachgefragt! - Welche Perspektive haben Menschen nach einem schweren Schlaganfall? Nachgefragt! - Welche Perspektive haben Menschen nach einem schweren Schlaganfall? Ergebnisse einer Nachbefragung von Patienten ein Jahr nach der Frührehabilitation Die Neurologische Frührehabilitation

Mehr

Aktuelle Behandlung bei M. Parkinson: Update Früh - bis Spätphase. Prof. Dr. J. Kassubek Klinik für Neurologie, Universitätsklinikum Ulm

Aktuelle Behandlung bei M. Parkinson: Update Früh - bis Spätphase. Prof. Dr. J. Kassubek Klinik für Neurologie, Universitätsklinikum Ulm Aktuelle Behandlung bei M. Parkinson: Update Früh - bis Spätphase Prof. Dr. J. Kassubek Klinik für Neurologie, Universitätsklinikum Ulm Hawkes et al., Parkinsonism Rel Dis 2010 Morbus Parkinson: Therapie-Prinzipien

Mehr

L-Dopa und DA-Agonisten: Einfluss auf Psyche und Cognition

L-Dopa und DA-Agonisten: Einfluss auf Psyche und Cognition L-Dopa und DA-Agonisten: Einfluss auf Psyche und Cognition PD Dr. med. Dipl. Psych. U. Gschwandtner MSc A. Meyer Klinische Neurologie und Neurophysiologie, Universitätsspital Basel (CH) Informationstagung

Mehr

Mesalazin bei Colitis ulcerosa Sind alle therapeutischen Möglichkeiten ausgereizt?

Mesalazin bei Colitis ulcerosa Sind alle therapeutischen Möglichkeiten ausgereizt? Mesalazin bei Colitis ulcerosa Sind alle therapeutischen Möglichkeiten ausgereizt? Von Prof. Dr. med. Stefan Schreiber Berlin (3. Oktober 2008) - Seit 1940 erstmals Sulfasalazine zur Therapie der entzündlichen

Mehr

Was machen eigentlich KlinikClowns? Orthopädiekongress Ulm, 2016

Was machen eigentlich KlinikClowns? Orthopädiekongress Ulm, 2016 Was machen eigentlich KlinikClowns? Orthopädiekongress Ulm, 2016 Prof. Dr. Michael Bossle Pflegewissenschaftler, Clown innovativ & lebendig Bildungsregion DonauWald Übersicht 1. Entstehungsgeschichte 2.

Mehr

Psychosomatik: Anamnese bei komplexen Symptomen. Pierre Loeb (loeb@hin.ch) Alexander Kiss (akiss@uhbs.ch)

Psychosomatik: Anamnese bei komplexen Symptomen. Pierre Loeb (loeb@hin.ch) Alexander Kiss (akiss@uhbs.ch) Psychosomatik: Anamnese bei komplexen Symptomen Pierre Loeb (loeb@hin.ch) Alexander Kiss (akiss@uhbs.ch) Übersicht Vorstellung Publikum: Ihr letzter Patient mit komplexen Symptomen Input: Anamnesetechniken

Mehr

Welche Patienten profitieren schon heute vom Herz CT? S. Achenbach

Welche Patienten profitieren schon heute vom Herz CT? S. Achenbach Welche Patienten profitieren schon heute vom Herz CT? S. Achenbach Herz / Koronararterien Kleine Dimensionen Schnelle Bewegung Mehrzeilen CT Kardiale Computertomographie Hardware Mehrzeilen CT, zumindest

Mehr

Projekt Fatigue. Annina Thöny. Medizinische Kinderklinik Onkologie

Projekt Fatigue. Annina Thöny. Medizinische Kinderklinik Onkologie Projekt Fatigue Annina Thöny Medizinische Kinderklinik Onkologie Ablauf Präsentation Projekt Fatigue bei Kindern und Jugendlichen Strukturen/Hintergrund Zeitplan 2005-2009 Einzelne Projektinhalte Diskussion

Mehr

Ernährung und Multiple Sklerose. Dieter Pöhlau Kamillus Klinik Asbach (Westerwald)

Ernährung und Multiple Sklerose. Dieter Pöhlau Kamillus Klinik Asbach (Westerwald) Ernährung und Multiple Sklerose Dieter Pöhlau Kamillus Klinik Asbach (Westerwald) Die Multiple Sklerose -eine chronische, entzündliche, demyelinisierende ZNS - Erkrankung Zentralnervensystem und Oxidation

Mehr

Tiefes Testosteron... Nach Testosteron Substitution...? Kausaler Zusammenhang?? Yesterday, all those troubles seemed so far away..

Tiefes Testosteron... Nach Testosteron Substitution...? Kausaler Zusammenhang?? Yesterday, all those troubles seemed so far away.. Herr F.H., 69 jähriger Manager JA: seit ein paar Jahren zunehmende Libido Erektile Dysfunktion, fühlt sich subdepressiv, vergesslich, abends oft müde Herr F.H., 69 jähriger Manager JA: seit ein paar Jahren

Mehr

Wim Nieuwenboom Untersuchung zur Befindlichkeit von Kindern und Jugendlichen mit einem krebskranken Elternteil

Wim Nieuwenboom Untersuchung zur Befindlichkeit von Kindern und Jugendlichen mit einem krebskranken Elternteil Wim Nieuwenboom Untersuchung zur Befindlichkeit von Kindern und Jugendlichen mit einem krebskranken Elternteil Referat an der Internationalen Fachtagung der ECCSW in Berlin Soziale Gesundheit Stärken Explorative

Mehr

Persönliche PDF-Datei für C. Breitenstein, T. Grewe, A. Flöel, W. Ziegler, L. Springer, P. Martus, A. Baumgärtner

Persönliche PDF-Datei für C. Breitenstein, T. Grewe, A. Flöel, W. Ziegler, L. Springer, P. Martus, A. Baumgärtner Persönliche PDF-Datei für C. Breitenstein, T. Grewe, A. Flöel, W. Ziegler, L. Springer, P. Martus, A. Baumgärtner Mit den besten Grüßen vom Georg Thieme Verlag www.thieme.de Wie wirksam ist intensive Aphasietherapie

Mehr

Modellorientierte Sprachtherapie und Aachener Sprachanalyse: Evaluation bei Patienten mit chronischer Aphasie

Modellorientierte Sprachtherapie und Aachener Sprachanalyse: Evaluation bei Patienten mit chronischer Aphasie Modellorientierte Sprachtherapie und Aachener Sprachanalyse: Evaluation bei Patienten mit chronischer Aphasie Dissertation zur Erlangung des akademischen Grades Doktor der Naturwissenschaften Universität

Mehr

Physiotherapeutische Massnahmen bei degenerativen Veränderungen der Gelenke

Physiotherapeutische Massnahmen bei degenerativen Veränderungen der Gelenke Institut für Physiotherapie Physiotherapeutische Massnahmen bei degenerativen Veränderungen der Gelenke Symposium Muskuloskelettale Medizin 2016 Donnerstag 14. April Balz Winteler Ziel dieser Präsentation

Mehr

Ernährung in der onkologischen Rehabilitation. Eine der wichtigsten Säule in der supportiven Therapie bei Tumorpatienten

Ernährung in der onkologischen Rehabilitation. Eine der wichtigsten Säule in der supportiven Therapie bei Tumorpatienten Diät- und Ernährungstherapie in der Onkologischer Rehabilitation: Evidenzbasiert Beraten Nicole Erickson, Diätassistentin, M.Sc, RD Zentrum für Prävention, Ernährung und Sportmedizin Klinikum rechts der

Mehr

Diese Folien beinhalten den Einleitungsteil des Vortrags. Aphasie und Gestik

Diese Folien beinhalten den Einleitungsteil des Vortrags. Aphasie und Gestik EKN Entwicklungsgruppe Klinische Neuropsychologie Diese Folien beinhalten den Einleitungsteil des Vortrags Aphasie und vorgestellt auf der BKL Summer School in Clinical Linguistics Würzburg, 5. September

Mehr

Was bringt die medikamentöse Langzeittherapie wirklich? Neue Erkenntnisse aus der MTA-Studie Manfred Döpfner

Was bringt die medikamentöse Langzeittherapie wirklich? Neue Erkenntnisse aus der MTA-Studie Manfred Döpfner Was bringt die medikamentöse Langzeittherapie wirklich? Neue Erkenntnisse aus der MTA-Studie Manfred Döpfner Es gibt eine gute und eine schlechte Nachricht aus den jüngsten Ergebnisse zur Multimodal Treatment

Mehr

Biologische Psychologie II Peter Walla

Biologische Psychologie II Peter Walla Kapitel 16 Lateralisierung, Sprache und das geteilte Gehirn Das linke und das rechte Gehirn: Das menschliche Gehirn besteht aus 2 cerebralen Hemisphären, die voneinander getrennt sind, abgesehen von den

Mehr

Gütekriterien für evaluative Messinstrumente in der Rehabilitation

Gütekriterien für evaluative Messinstrumente in der Rehabilitation 12. Rehabilitationswissenschaftliches Kolloquium Rehabilitation im Gesundheitssystem Bad Kreuznach, 10. bis 12. März 2003 Gütekriterien für evaluative Messinstrumente in der Rehabilitation Dipl.-Psych.

Mehr

Ambulanter Sektor II: Leistungsmanagement und Beurteilung im internationalen Vergleich

Ambulanter Sektor II: Leistungsmanagement und Beurteilung im internationalen Vergleich Management im Gesundheitswesen Krankenversicherung und Leistungsanbieter Ambulanter Sektor II: Leistungsmanagement und Beurteilung im internationalen Vergleich Reinhard Busse, Prof. Dr. med. MPH FFPH FG

Mehr

Faktenbox Kombinationsbehandlung (Antidepressiva und Psychotherapie) bei schweren Depressionen

Faktenbox Kombinationsbehandlung (Antidepressiva und Psychotherapie) bei schweren Depressionen Faktenbox (Antidepressiva und Psychotherapie) bei schweren Depressionen Nutzen und Risiken im Überblick Was ist eine? Was passiert bei einer? Bei einer werden mehrere Therapien miteinander gekoppelt: Antidepressiva

Mehr

Abklärung Hirnschlag. Stephan Bohlhalter Zentrum für Neurologie und Neurorehabilitation Luzerner Kantonsspital

Abklärung Hirnschlag. Stephan Bohlhalter Zentrum für Neurologie und Neurorehabilitation Luzerner Kantonsspital Abklärung Hirnschlag Stephan Bohlhalter Zentrum für Neurologie und Neurorehabilitation Luzerner Kantonsspital Luzern, 30.4.2015 Schlaganfall häufig Definition Schlaganfall: Zelltod durch Ischämie im Gehirn,

Mehr

Telemedizin in der Neurologie Netzwerke und Regelversorgung. Dr. Johannes Schenkel, MPH Referent Telemedizin Dezernat Telematik Bundesärztekammer

Telemedizin in der Neurologie Netzwerke und Regelversorgung. Dr. Johannes Schenkel, MPH Referent Telemedizin Dezernat Telematik Bundesärztekammer Telemedizin in der Neurologie Netzwerke und Regelversorgung Dr. Johannes Schenkel, MPH Referent Telemedizin Dezernat Telematik Bundesärztekammer Warum Tele-Neurologie? Zeitkritischer Interventionsbedarf

Mehr

Interpersonelle Psychotherapie

Interpersonelle Psychotherapie Ellen Frank Jessica C. Levenson Interpersonelle Psychotherapie Aus dem Amerikanischen von Raimund J. Fender Ernst Reinhardt Verlag München Basel Ellen Frank, PhD, Professorin für Psychiatrie und Psychologie,

Mehr

Neuropsychologische Untersuchungen in der Praxis: Wann sind welche Tests sinnvoll?

Neuropsychologische Untersuchungen in der Praxis: Wann sind welche Tests sinnvoll? Neuropsychologische Untersuchungen in der Praxis: Wann sind welche Tests sinnvoll? Sophia Reul Klinik für Allgemeine Neurologie Department für Neurologie Westfälische Wilhelms-Universität Münster Welche

Mehr

Neue Studie beweist: Nachtfluglärm kann Gefäßschäden verursachen

Neue Studie beweist: Nachtfluglärm kann Gefäßschäden verursachen Fluglärm über Mainz Neue Studie beweist: Nachtfluglärm kann Gefäßschäden verursachen Mainzer Wissenschaftler publizieren Forschungsergebnisse der Fluglärmstudie im European Heart Journal Eine neue Studie

Mehr

Erfassung von Übelkeit und Erbrechen bei krebskranken Menschen unter Chemotherapie. Bachelorarbeit Ronja Stabenow SS 2013

Erfassung von Übelkeit und Erbrechen bei krebskranken Menschen unter Chemotherapie. Bachelorarbeit Ronja Stabenow SS 2013 Erfassung von Übelkeit und Erbrechen bei krebskranken Menschen unter Chemotherapie Bachelorarbeit Ronja Stabenow SS 2013 Hintergrund Verschiedene Ursachen - Chemotherapie, Bestrahlung, Erkrankung selbst,

Mehr

Publikationen Dr. Christina Reese

Publikationen Dr. Christina Reese Publikationen Dr. Christina Reese (Stand: März 2016) Zeitschriftenartikel 1. Reese, C., Hübner, P., Petrak, F., Schmucker, D., Weis, J. & Mittag, O. (2016). Strukturen und Praxis der psychologischen Abteilungen

Mehr

1.1 Arbeitsbereiche der Pflege auf der Stroke Unit... 13 1.2 Pflege als Unterstützung auf dem Weg zurück ins Leben... 18 Fazit... 23 Literatur...

1.1 Arbeitsbereiche der Pflege auf der Stroke Unit... 13 1.2 Pflege als Unterstützung auf dem Weg zurück ins Leben... 18 Fazit... 23 Literatur... Geleitwort zur 2. Auflage... 11 Geleitwort zur 1. Auflage... 12 1 Die Rolle der Pflege auf der Stroke Unit... 13 Anne-Kathrin Cassier-Woidasky 1.1 Arbeitsbereiche der Pflege auf der Stroke Unit... 13 1.2

Mehr