Rückbildung von Aphasien und Wirkung von Sprachtherapie

Größe: px
Ab Seite anzeigen:

Download "Rückbildung von Aphasien und Wirkung von Sprachtherapie"

Transkript

1 Rückbildung von Aphasien und Wirkung von Sprachtherapie Medizinische Fakultät Basel 2. Jahreskurs, Major Clinical Medicine Wahlmodul 3 Gehirn und Sprache Dezember 2008 Seraina Locher

2 Medical eduction, it seems to me, has failed the patient with aphasia. Aphasia therapy works. Why isn t the message getting out? Martin L. Albert Bhogal et al., Stroke 2003:34

3 Meta-Analyse von Boghal et al Widersprüchliche Resultate über den Effekt von Sprachtherapie Zusammenhang von Intensität der Therapie und Rückbildung der Aphasie? MEDLINE-Recherche (5) + weitere Arbeiten (5) Januar 1975 Mai 2002 nur Schlaganfall-Patienten SLT Gruppe vs. Vergleichsgruppe (gleiche Therapielänge) Meta-Analyse von 10 Studien, 864 Individuen Bhogal et al., Stroke 2003:34

4 Resultate Die Gesamtlänge der Therapie korreliert signifikant umgekehrt zur durchschnittlichen Veränderung im PICA (Trend auch im Token Test) Die Anzahl Therapiestunden pro Woche korreliert signifikant mit Verbesserung im PICA und Token Test Die Gesamtzahl an Therapiestunden korreliert signifikant mit Verbesserung im PICA und Token Test Bhogal et al., Stroke 2003:34

5 Bedeutung für klinische Anwendung SLT hat einen positiven Einfluss auf die Rückbildung von Aphasie, wenn sie intensiv angeboten wird. die optimalen Organisation und Struktur der Sprachtherapie hat grosse Bedeutung. Poeck et al. noted that aphasia improved even in the chronic phase with intensive therapy. [ ] Most importantly, this review underscores the importance of SLT to aphasia recovery. Bhogal et al., Stroke 2003:34

6 Sprachtherapie und chronische Aphasie Chronische Aphasie: Jenseits von 12 Monaten zeigen die verbleibenden aphasischen Symptome ein stabiles Bild, welches sich ohne therapeutische Intervention kaum noch verändert. Schlenck, Parleth 2004 Retrospektive Untersuchung von 140 Aphasie- Patienten bis in chronische Phase; 97 davon über einen Zeitraum von durchschnittlich 5 Jahren. Einflussgrössen auf Rückbildungsprognose? Quantitative und qualitative Rückbildungsverläufe intensive Therapie Art und Ausmass der aphasischen Störung Schlenck et al., Die Sprachheilarbeit 2004:49

7 Resultate Akutphase keine signifikanten Unterschiede zwischen Patienten mit globaler und nicht globaler Aphasie! Methodisch keine Unterscheidung zwischen Spontanremission und Therapie-Effekt möglich Verbesserung in allen Untertests und auf allen Ebenen der Spontansprache Schlenck et al., Die Sprachheilarbeit 2004:49

8 Resultate chronische Phase Unter intensiver Therapie verbessert sich etwas mehr als die Hälfte (56,5%) der Patienten signifikant! Verbesserung bei Patienten mit globaler Aphasie signifikant seltener Verbesserung bei Patienten ohne Verbesserung in Akutphase signifikant seltener Schlenck et al., Die Sprachheilarbeit 2004:49

9 Langzeitverläufe Die Wahrscheinlichkeit, sich unter intensiver Sprachtherapie in der chronischen Phase zu verbessern, nimmt mit zunehmender Dauer nicht ab. Verbesserung deutlich häufiger auf phonologischer, als auf lexikalisch-semantisch bzw. syntaktischer Ebene Schlenck et al., Die Sprachheilarbeit 2004:49

10 Reorganisation des Sprachsystems nach Hirnschlag 14 Patienten mit Aphasie nach einem Erstinfarkt im Gebiet der linken A. cerebri media 3 fmri-scans bei den Aphasie- Patienten (in akuter, subakuter und chronischer Phase); Kontrollgruppe 1 Scan parallel Einschätzung mittels Aphasie- Tests Einzelwerte auf Wert 0-1 normalisiert = Language Recovery Score (LRS) Alle Patienten erhalten intensive SLT über die gesamte Zeitdauer des Versuchs Saur et al., Brain 2006:129 Elsevier, Sobotta interaktiv Version 1.5 Nerven und Sinne

11 Resultate fmri Akute Phase: wenig Aktivierung in nicht geschädigten Sprach- Strukturen in der linken Hemisphäre vlg. signifikant hohe Korrelation von LRS und Sprach-Aktivierung Subakute Phase: Hochregulierung der Aktivierung in bilateralen Sprach-Strukturen der rechten Hemisphäre (Broca-Homologue) Chronische Phase: Rückverschiebung der Peak-Aktivierung auf Sprach-Strukturen in der linken Hemisphäre Saur et al., Brain 2006:129

12 3 Phasen der Sprach-Reorganisation ( ) Kontrolle ( ) IFG und SMA auf der rechten Hemisphäre: biphasisch; früh Hochregulierung, später Abfall der Aktivierung (---) Sprach-Strukturen der linken Hemisphäre: monophasisch; kontinuierliche Hochregulierung Saur et al., Brain 2006:129

13 Fragen? Diskussion Gibt es DAS Therapieprogramm für Aphasie-Patienten? Wie könnte es deiner Meinung nach aussehen? Kann man einen Aphasie-Patienten in der chronischen Phase ab einem gewissen Zeitpunkt als therapie-resistent bezeichnen? Soll man niederfrequente ambulante logopädische Therapie für Aphasie- Patienten in der chronischen Phase empfehlen? Warum? 1. Bhogal, S.K.; Teasell, R.; Speechley, M Intensity of Aphasia therapy, Impact on Recovery. Stroke 34: Schlenck, K.-J., Perleth, S Langzeitverlauf bei Aphasie und der Effekt von Sprachtherapie in der chronischen Phase. Die Sprachheilarbeit 49: Saur, D.; Lange, R.; Baumgaertner, A.; Schraknepper, V. et al Dynamics of language reorganization after stroke. Brain 129:

Erholung von Aphasien. Hellmuth Obrig

Erholung von Aphasien. Hellmuth Obrig Erholung von Aphasien Hellmuth Obrig Sprache ist universell menschlich aber kulturspezifisch erworben Sprache ist lateralisiert Neurolinguistik und Aphasieforschung sind eng verbunden Die Beschreibung

Mehr

AMBULANTE CONSTRAINT - INDUCED THERAPIE FÜR APHASIE: EINE EINZELFALLSTUDIE ZUR PRÜFUNG DER WIRKSAMKEIT

AMBULANTE CONSTRAINT - INDUCED THERAPIE FÜR APHASIE: EINE EINZELFALLSTUDIE ZUR PRÜFUNG DER WIRKSAMKEIT AMBULANTE CONSTRAINT - INDUCED THERAPIE FÜR APHASIE: EINE EINZELFALLSTUDIE ZUR PRÜFUNG DER WIRKSAMKEIT J U L I A N E K R E T Z S C H M A R U N I V E R S I T Ä T S A L Z B U R G 1 5. 0 3. 2 0 1 3 GLIEDERUNG

Mehr

Prof. Dr. Dr. Martin HärterH

Prof. Dr. Dr. Martin HärterH Effekte von Shared Decision-Making Forschungsstand zur Adherence Prof. Dr. Dr. Martin HärterH Fachtagung Adherence Berlin 11.12.2009 Definition Adherence ist definiert als das Ausmaß, in welchem das Verhalten

Mehr

DIE VERBVERARBEITUNG BEI ALZHEIMER-DEMENZ UND PRIMÄR PROGRESSIVER APHASIE EIN VERGLEICH

DIE VERBVERARBEITUNG BEI ALZHEIMER-DEMENZ UND PRIMÄR PROGRESSIVER APHASIE EIN VERGLEICH DIE VERBVERARBEITUNG BEI ALZHEIMER-DEMENZ UND PRIMÄR PROGRESSIVER APHASIE EIN VERGLEICH Alexandra Madl 19.10.2012 INHALT Einleitung/ Motivation Das Krankheitsbild der Demenz Alzheimer Demenz Primär Progressive

Mehr

Publikationsliste. Zeitschriften/Journale. Originalarbeiten

Publikationsliste. Zeitschriften/Journale. Originalarbeiten Publikationsliste Prof. Dr. Bernhard Elsner, MPH Stand: 09.10.2014 IF = Science Citation Impact Factor 2012 * = Diese Publikation resultiert aus der Doktorarbeit. Zeitschriften/Journale Originalarbeiten

Mehr

Grundlagen der evidenzbasierten neurologischen Rehabilitation

Grundlagen der evidenzbasierten neurologischen Rehabilitation Grundlagen der evidenzbasierten neurologischen Rehabilitation Prof. Dr. phil. Helmut Hildebrandt Klinikum Bremen-Ost, Neurologie Universität Oldenburg, Psychologie email: helmut.hildebrandt@uni-oldenburg.de

Mehr

Evidenzbasierte Aphasietherapie: Was ist erreicht, was ist noch zu tun?

Evidenzbasierte Aphasietherapie: Was ist erreicht, was ist noch zu tun? Evidenzbasierte Aphasietherapie: Was ist erreicht, was ist noch zu tun? Zusammenfassung Seit mehr als zehn Jahren liegen evidenzbasierte Nachweise dafür vor, dass Aphasie therapie effektiv ist. Sie ist

Mehr

1. Einleitung. Fachbeiträge

1. Einleitung. Fachbeiträge Erfassung der logopädischen Versorgungslage von erwachsenen Patientinnen und Patienten aus Sicht praktizierender Logopädinnen und Logopäden in der Deutschschweiz. Einleitung Die effektive und effiziente

Mehr

Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen.

Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen. Neue Wege zur Reduktion der Antibiotikaverordnung bei Atemwegsinfektionen. Reduktion der Antibiotikaverordnungen bei akuten Atemwegserkrankungen 1. Basis für rationale Antibiotikaverordnungen: Leitlinien

Mehr

Inhalte der Präsentation

Inhalte der Präsentation Strategietherapie bei einem simultan bilingual aufwachsenden Vorschulkind mit einer semantisch-lexikalischen Störung Eine Einzelfalltherapiestudie Katharina Klöpfer ULG Klinische Linguistik, Salzburg 15.

Mehr

Dr. Christian Stock Institut für Medizinische Biometrie und Informatik (IMBI) Universitätsklinikum Heidelberg

Dr. Christian Stock Institut für Medizinische Biometrie und Informatik (IMBI) Universitätsklinikum Heidelberg Was wäre wenn in allen Krankenhäusern die gleichen Behandlungsentscheidungen getroffen würden wie in spezialisierten Zentren? Eine Untersuchung zum Potential der Thrombolysetherapie bei Hirninfarkt Dr.

Mehr

Brauchen wir eine Evidenz-basierte Telemedizin?

Brauchen wir eine Evidenz-basierte Telemedizin? Brauchen wir eine Evidenz-basierte Telemedizin? Prof. Dr. Petra A. Thürmann Lehrstuhl für Klinische Pharmakologie Universität Witten/Herdecke Philipp Klee-Institut für Klinische Pharmakologie HELIOS Klinikum

Mehr

Systematische Reviews und Meta-Analysen

Systematische Reviews und Meta-Analysen Systematische Reviews und Meta-Analysen Univ.-Prof. DI Dr. Andrea Berghold Institut für Med. Informatik, Statistik und Dokumentation Medizinische Universität Graz Szenario Sollen wir Julians Mittelohrentzündung

Mehr

Kompensation von LS bei Kindern mit überwundenen USES, die phonologische Ebene betreffen

Kompensation von LS bei Kindern mit überwundenen USES, die phonologische Ebene betreffen Kompensation von LS bei Kindern mit überwundenen USES, die phonologische Ebene betreffen Carola D. Schnitzler, MSc (GB) Humanwissenschaftliche Fakultät Profilbereich Bildungswissenschaften Grundschulpädagogik

Mehr

Neue Aspekte in der Rehabilitation

Neue Aspekte in der Rehabilitation Berliner Medizinische Gesellschaft Der Schlaganfall von der Forschung zur verbesserten Versorgung in Berlin 20.11.2013 Neue Aspekte in der Rehabilitation Agnes Flöel Neurologie/NeuroCure/CSB Charite, Berlin

Mehr

Bilder des Gehirns Bilder der Psyche

Bilder des Gehirns Bilder der Psyche Bilder des Gehirns Bilder der Psyche Prof. Stefan Borgwardt Universitäre Psychiatrische Kliniken Basel (UPK) Die Hirnforschung sucht tatsächlich ohne Rücksicht auf die Klinik und ohne je von der Psychopathologie

Mehr

Einfluss von einem Computerspiel auf Depression, Angststörungen und Schmerzen bei stationären Patienten: rct. Institut für Physiotherapie

Einfluss von einem Computerspiel auf Depression, Angststörungen und Schmerzen bei stationären Patienten: rct. Institut für Physiotherapie Einfluss von einem Computerspiel auf Depression, Angststörungen und Schmerzen bei stationären Patienten: rct Institut für Physiotherapie Der rote Faden Wie ist die epidemiologische Datenlage? Nehmen psychische

Mehr

Patient mit Husten: Klinische Unterscheidung von akuter Bronchitis und Pneumonie

Patient mit Husten: Klinische Unterscheidung von akuter Bronchitis und Pneumonie Alkoholmissbrauch Patient mit Husten: Klinische Unterscheidung von akuter Bronchitis und Pneumonie TGAM-Weiterbildung Bronchitis, 19. 11. 2014 Vortrag Herbert Bachler 1 Akute Bronchitis In den ersten Tagen

Mehr

Präklinische Versorgung von Schlaganfallpatienten im Landkreis Fulda. Roland Stepan (Ärztlicher Leiter Rettungsdienst) April / Mai 2012

Präklinische Versorgung von Schlaganfallpatienten im Landkreis Fulda. Roland Stepan (Ärztlicher Leiter Rettungsdienst) April / Mai 2012 Präklinische Versorgung von Schlaganfallpatienten im Landkreis Fulda Roland Stepan (Ärztlicher Leiter Rettungsdienst) April / Mai 2012 1 Inhalte Fakten und Zahlen Definition Beurteilung von Patienten mit

Mehr

Evidenz der koronaren Revaskularisation

Evidenz der koronaren Revaskularisation Universitätsherzzentrum Thüringen Evidenz der koronaren Revaskularisation PD Dr. T. Pörner und Prof. Dr. T. Doenst Universitätsherzzentrum Thüringen Koronare Herzkrankheit - Anatomie LCA (Hauptstamm) RCA

Mehr

"Die Auswirkung der farblichen Darstellung auf die Benennleistung von Nomen bei Patienten mit Aphasie".

Die Auswirkung der farblichen Darstellung auf die Benennleistung von Nomen bei Patienten mit Aphasie. "Die Auswirkung der farblichen Darstellung auf die Benennleistung von Nomen bei Patienten mit Aphasie". Masterthesis Kathrina Gerling, München Vortrag in Salzburg am 16.03.13 Aufbau Motivation Einleitung

Mehr

Schlaganfall, was nun?

Schlaganfall, was nun? Schlaganfall, was nun? Neurologisch bedingte Sprach- und Sprechstörungen Corinna Rolf & Dr. phil. Uta Lürßen Dipl. Sprachheilpädagoginnen Inhalt Begrüßung und Vorstellung Einführung in das Thema Ursachen

Mehr

Singen als Sprachtherapie? Rhythmus und Liedtext geben den Ton an Singing as speech therapy? Why rhythm and lyric type may do the trick

Singen als Sprachtherapie? Rhythmus und Liedtext geben den Ton an Singing as speech therapy? Why rhythm and lyric type may do the trick Singen als Sprachtherapie? Rhythmus und Liedtext geben den Ton an Singing as speech therapy? Why rhythm and lyric type may do the trick Stahl, Benjamin Max-Planck-Institut für Kognitions- und Neurowissenschaften,

Mehr

Telemedizin und Rehabilitation: Von der Forschung in die Praxis Anwendungen in der TeleNeurorehabilitation

Telemedizin und Rehabilitation: Von der Forschung in die Praxis Anwendungen in der TeleNeurorehabilitation Telemedizin und Rehabilitation: Von der Forschung in die Praxis Anwendungen in der TeleNeurorehabilitation Michael Jöbges Brandenburgklinik Bernau bei Berlin Bedürfnisse von Schlaganfall Patienten nach

Mehr

Wirksamkeit der Komplementärmedizin am Beispiel der Akupunktur - Möglichkeiten der Integration in die Schulmedizin

Wirksamkeit der Komplementärmedizin am Beispiel der Akupunktur - Möglichkeiten der Integration in die Schulmedizin Institut für Sozialmedizin, Epidemiologie und Gesundheitsökonomie (Direktor: Prof. Dr. med. Stefan N. Willich), Charité - Universitätsmedizin Berlin HABILITATIONSSCHRIFT Wirksamkeit der Komplementärmedizin

Mehr

Musik und Schlaganfall. Einige Hinweise

Musik und Schlaganfall. Einige Hinweise Herausgeber: B. Fischer, 77736 Zell a.h, Birkenweg 19 Tel: 07835-548070 www.wisiomed.de Musik und geistige Leistungsfähigkeit s. www.wissiomed.de linke Leiste: downloads Bildung Nr. 14 Musik und Schlaganfall

Mehr

Einsatz elektronischer Kommunikationshilfen bei Aphasie

Einsatz elektronischer Kommunikationshilfen bei Aphasie Einsatz elektronischer Kommunikationshilfen bei Aphasie Linguistik Claudia Wahn Einsatz elektronischer Kommunikationshilfen bei Aphasie Shaker Verlag Aachen 2004 Bibliografische Information der Deutschen

Mehr

am Was ist neu in der Kardiologie? H.Reuter

am Was ist neu in der Kardiologie? H.Reuter am 22.5.2007 Seite 1 Körperliche Belastung bei Herzerkrankungen: Ist Sport wirklich Mord? Hannes Reuter Klinik III für Innere Medizin Herzzentrum der Universität zu Köln Körperliche Belastung bei Herzerkrankungen:

Mehr

Neue Klassifikationssysteme in der Nierenpathologie

Neue Klassifikationssysteme in der Nierenpathologie Neue Klassifikationssysteme in der Nierenpathologie Kerstin Amann Abt. Nephropathologie Pathologisches Institut der Universität Erlangen-Nürnberg Krankenhausstr. 12 91054 Erlangen Histologische Klassifikationssysteme

Mehr

Einfluss einer Niereninsuffizienz auf die Korrelation von NTproBNP mit dem Schweregrad der Herzinsuffizienz

Einfluss einer Niereninsuffizienz auf die Korrelation von NTproBNP mit dem Schweregrad der Herzinsuffizienz Einfluss einer Niereninsuffizienz auf die Korrelation von NTproBNP mit dem Schweregrad der Herzinsuffizienz Dr. Andreas Rieth, et al, Bad Nauheim Hintergrund: Der Biomarker NTproBNP ist für die Diagnostik

Mehr

Psychotherapie und Psychopharmakologie Wo liegt die Balance: Psychosen

Psychotherapie und Psychopharmakologie Wo liegt die Balance: Psychosen Psychotherapie und Psychopharmakologie Wo liegt die Balance: Psychosen Prof. Dr. med. Wolfram Kawohl Chefarzt Zentrum für Soziale Psychiatrie Klinik für Psychiatrie, Psychotherapie und Psychosomatik Psychiatrische

Mehr

Videogestütztes Konversationstraining: Eine Studie zum hochfrequenten und repetitiven Lernen von Alltagsdialogen in der Aphasie

Videogestütztes Konversationstraining: Eine Studie zum hochfrequenten und repetitiven Lernen von Alltagsdialogen in der Aphasie Videogestütztes Konversationstraining: Eine Studie zum hochfrequenten und repetitiven Lernen von Alltagsdialogen in der Aphasie Kerstin Bilda (Prof. Dr.), Katrin Matzner (BSc), Hanna Jochims (BSc), Caterina

Mehr

Ist geriatrische Rehabililtation wirksam?

Ist geriatrische Rehabililtation wirksam? Ist geriatrische Rehabililtation wirksam? Dr. med. Stefan Bachmann Chefarzt Rheumatologie/muskuloskelettale Rehabilitation Rehabilitationszentrum Klinik Valens Leiter Forschung Geriatrie Universität Bern

Mehr

Faktenblatt: Traditionelle Chinesische Medizin. (Siehe auch: Mind-Body-Therapien und Medizinische Pilze) Methode/Substanz

Faktenblatt: Traditionelle Chinesische Medizin. (Siehe auch: Mind-Body-Therapien und Medizinische Pilze) Methode/Substanz Faktenblatt: Traditionelle Chinesische Medizin Mai 2015 Verantwortlich: PD Dr. J. Hübner, Prof. K. Münstedt, Prof. O. Micke, PD Dr. R. Mücke, Prof. F.J. Prott, Prof. J. Büntzel, Prof. V. Hanf, Dr. C. Stoll

Mehr

Untersuchung über die Effizienz des. Nasensauger-Staubsauger. bei der Schnupfenbehandlung

Untersuchung über die Effizienz des. Nasensauger-Staubsauger. bei der Schnupfenbehandlung MEDIZINISCHE UNIVERSITAT WIEN Untersuchung über die Effizienz des Nasensauger-Staubsauger bei der Schnupfenbehandlung Universitätsklinik für Kinder- und Jugendheilkunde Ao. Univ.-Prof. Dr. Dieter Koller

Mehr

Johanniskraut Metaanalyse 2005

Johanniskraut Metaanalyse 2005 Johanniskraut Metaanalyse 2005 Seit 1983 wurden 37 randomisierte klinische Studien mit Johanniskraut-Präparaten publiziert Davon: 26 Placebo-kontrolliert, 14 Verum-kontrolliert Studiendauer: 4 Wochen (10

Mehr

Antikoagulation und Plättchenaggregationshemmung beim flimmernden KHK-Patienten

Antikoagulation und Plättchenaggregationshemmung beim flimmernden KHK-Patienten Antikoagulation und Plättchenaggregationshemmung beim flimmernden KHK-Patienten Dr. Ralph Kallmayer, Innere Abteilung Kardiologie HELIOS Klinik Lutherstadt Eisleben Das therapeutische Dilemma: Patient

Mehr

Vom unklaren Symptomkomplex zur ganzheitlichen Diagnose

Vom unklaren Symptomkomplex zur ganzheitlichen Diagnose Morbus Fabry - Niereninsuffizienz Kardiomyopathie Neurologische Störungen - Vom unklaren Sympto Morbus Fabry Niereninsuffizienz Kardiomyopathie Neurologische Störungen Vom unklaren Symptomkomplex zur ganzheitlichen

Mehr

II. Forum Gesundheitswirtschaft Münsterland

II. Forum Gesundheitswirtschaft Münsterland II. Forum Gesundheitswirtschaft Münsterland 17.02.2009 Hörscreening Antoinette am Zehnhoff-Dinnesen Peter Matulat Claus-Michael Schmidt Klinik und Poliklinik für II. Forum Gesundheitswirtschaft Münsterland

Mehr

Case Management Aufgaben, Rollen, Qualifikationen

Case Management Aufgaben, Rollen, Qualifikationen Case Aufgaben, Rollen, Qualifikationen Prof. Dr. Michael Wissert München, 28. Januar 2005 Case Grundfunktion der Sozialen Arbeit Klient-(Patient-)System Einzelne Menschen und Gruppen mit Problemen in Notlagen/Belastungen

Mehr

Neurofeedback --- Train your brain

Neurofeedback --- Train your brain Seminar Brain-Machine Interfaces Neurofeedback --- Train your brain 1 18.11.2009 Biofeedback...bezeichnet eine Methode, bei der eine Person die bewusste Selbstkontrolle über bestimmte Funktionen seines

Mehr

Evidenzbasierte Prinzipien der Aphasietherapie. Holger Grötzbach, M. A. Asklepios Klinik Schaufling D Schaufling

Evidenzbasierte Prinzipien der Aphasietherapie. Holger Grötzbach, M. A. Asklepios Klinik Schaufling D Schaufling Evidenzbasierte Prinzipien der Aphasietherapie Holger Grötzbach, M. A. Asklepios Klinik Schaufling D 94571 Schaufling integra Fachmesse Wels 22.09.2006 Evidenzbasierte Aphasietherapie Agenda Effizienz

Mehr

Deutsche Multicenter-Studien erforschen die Wirksamkeit der Psychotherapie chronischer Depression und ihre neurobiologischen Wirkmechanismen

Deutsche Multicenter-Studien erforschen die Wirksamkeit der Psychotherapie chronischer Depression und ihre neurobiologischen Wirkmechanismen UniversitätsKlinikum Heidelberg Heidelberg, den 31. Juli 2012 PRESSEMITTEILUNG Deutsche Multicenter-Studien erforschen die Wirksamkeit der Psychotherapie chronischer Depression und ihre neurobiologischen

Mehr

Elektrosensibilität, unspezifische gesundheitliche Beschwerden

Elektrosensibilität, unspezifische gesundheitliche Beschwerden Elektrosensibilität, unspezifische gesundheitliche Beschwerden Dr. Anne Dehos Bundesamt für Strahlenschutz Mobilfunk und Gesundheit BfS-Informationsveranstaltung, 25. Juni 2009, München 1 Was versteht

Mehr

Tempusmorphologie bei deutschen Agrammatikern: Die Sprachproduktion von regulären, irregulären und gemischten Verben *

Tempusmorphologie bei deutschen Agrammatikern: Die Sprachproduktion von regulären, irregulären und gemischten Verben * Spektrum Patholinguistik 6 (2013) 219 223 Tempusmorphologie bei deutschen Agrammatikern: Die Sprachproduktion von regulären, irregulären und gemischten Verben * Tina Marusch 1, Titus von der Malsburg 1,

Mehr

Arbeitsgruppe: Spastik. Fragestellung: Motorische Übungsbehandlung

Arbeitsgruppe: Spastik. Fragestellung: Motorische Übungsbehandlung Arbeitsgruppe: Spastik Fragestellung: Motorische Übungsbehandlung 1 Intervention: Physioterapie Ref.- Nr. Autor, Jahr 1 Sunderlan d et al 1992 Erhebung sbogen Originalarbeit Studie ntyp RCT während der

Mehr

Der Meßplatz wurde speziell für diesen Zweck entwickelt und es findet sich keine direkt vergleichbare Meßeinrichtung.

Der Meßplatz wurde speziell für diesen Zweck entwickelt und es findet sich keine direkt vergleichbare Meßeinrichtung. für Impuls, Maximalkraft, Gesamt-IEMG und IEMG-Kraft-Quotient deutlich höher und der Wert der elektrischen Effizienz niedriger. Dieses Ergebnis zeigte sich auch bei der Nachuntersuchung. 4. Diskussion

Mehr

Motorische Rehabilitation

Motorische Rehabilitation Motorische Rehabilitation S. Hesse Medical Park Berlin Humboldtmühle Charité Universitätsmedizin Berlin Interessenskonflikte: Reha- Stim, Reha-Technologies Facts u. Fragen multiprofessionelle Früh-Reha

Mehr

SS 09: Klinische Linguistik

SS 09: Klinische Linguistik SS 09: Klinische Linguistik Gebärdensprache und Gehirn Helen Leuninger Gebärdensprache und Gehirn Sprache und Raum Ikonizität Speicherung der Mimik im Gehirn 2 Klassen von Studien: Läsionsstudien Bildgebende

Mehr

Qualitätsbericht 2010 Praxis für Psychotherapie Dr. Shaw & Kollegen

Qualitätsbericht 2010 Praxis für Psychotherapie Dr. Shaw & Kollegen Qualitätsbericht 2010 Praxis für Psychotherapie Dr. Shaw & Kollegen Qualitätsbericht 2010 Praxis für Psychotherapie Dr. Shaw & Kollegen In unserem Qualitätsbericht 2010 haben wir die Ergebnisse von Erhebungen

Mehr

Klinische Versorgungsforschung: Warum, wieso, und wie?

Klinische Versorgungsforschung: Warum, wieso, und wie? Klinische Versorgungsforschung: Warum, wieso, und wie? Werner Vach Koordinierungsstelle Versorgungsforschung Medizinische Fakultät der Universität Freiburg Was ist Versorgungsforschung? Was ist Versorgungsforschung?

Mehr

Wie wirkt Laufen gegen Depression? Prof. Dr. Gerhard Huber Institut für Sport und Sportwissenschaft Universität Heidelberg

Wie wirkt Laufen gegen Depression? Prof. Dr. Gerhard Huber Institut für Sport und Sportwissenschaft Universität Heidelberg Wie wirkt Laufen gegen Depression? Prof. Dr. Gerhard Huber Institut für Sport und Sportwissenschaft Universität Heidelberg Sport is one part, but is probably not a large part of lifetime physical activity.

Mehr

Evidenz-basierte Therapie: Der Feind therapeutischer Intuition? Dr. O. Wegwarth Max-Planck-Institut für Bildungsforschung, Berlin

Evidenz-basierte Therapie: Der Feind therapeutischer Intuition? Dr. O. Wegwarth Max-Planck-Institut für Bildungsforschung, Berlin + Evidenz-basierte Therapie: Der Feind therapeutischer Intuition? Dr. O. Wegwarth Max-Planck-Institut für Bildungsforschung, Berlin + Intuition Das Herz hat viele Gründe, die der Verstand nicht kennt.

Mehr

AVWS Diagnostik aus sprachtherapeutischer Sicht

AVWS Diagnostik aus sprachtherapeutischer Sicht AVWS Diagnostik aus sprachtherapeutischer Sicht Birke Peter, Klinische Sprechwissenschaftlerin Klinik und Poliklinik für Hals-, Nasen-, Ohrenheilkunde Universitätsmedizin Leipzig Direktor: Univ.-Prof.

Mehr

DGK-Jahrestagung 2007 in Mannheim. Beurteilung der Kosten-Effektivität der CRT-D Therapie bei Patienten mit chronischer Herzinsuffizienz

DGK-Jahrestagung 2007 in Mannheim. Beurteilung der Kosten-Effektivität der CRT-D Therapie bei Patienten mit chronischer Herzinsuffizienz DGK-Jahrestagung 2007 in Mannheim Beurteilung der Kosten-Effektivität der CRT-D Therapie bei Patienten mit chronischer Herzinsuffizienz Presenting Author: Wasem J Verfasser: Dr. Pamela Aidelsburger 1 Kristin

Mehr

TIME IS BRAIN! Aktuelles zur Schlaganfallbehandlung. Marianne Dieterich Klinik und Poliklinik für Neurologie

TIME IS BRAIN! Aktuelles zur Schlaganfallbehandlung. Marianne Dieterich Klinik und Poliklinik für Neurologie TIME IS BRAIN! Aktuelles zur Schlaganfallbehandlung Marianne Dieterich Klinik und Poliklinik für Neurologie Interdisziplinäres Schlaganfallzentrum München (Ludwig-Maximilians-Universität München, Standort

Mehr

Ergebnis des Projektes Therapeutische Berührung bei Früh- und Neugeborenen von drogenabhängigen Müttern

Ergebnis des Projektes Therapeutische Berührung bei Früh- und Neugeborenen von drogenabhängigen Müttern Ergebnis des Projektes Therapeutische Berührung bei Früh- und Neugeborenen von drogenabhängigen Müttern (Neonatales Entzugssyndrom NAS) Projektdauer 30. April 2007 30. April 2008 Kurzbeschreibung 32 Kinder

Mehr

Diagnostik und Therapie von Sprachstörungen

Diagnostik und Therapie von Sprachstörungen Diagnostik und Therapie von Sprachstörungen rungen Psycholinguistischer Paradigmenwechsel in der Diagnostik und Therapie von Aphasien Norbert Rüffer Folien und Text des Referats im Internet: http://www.words

Mehr

Telemedizinische Rehabilitation nach Schlaganfall. Prof. Dr. Stefan Hesse, Medical Park Berlin Humboldtmühle Christopher Tomelleri

Telemedizinische Rehabilitation nach Schlaganfall. Prof. Dr. Stefan Hesse, Medical Park Berlin Humboldtmühle Christopher Tomelleri Telemedizinische Rehabilitation nach Schlaganfall Prof. Dr. Stefan Hesse, Medical Park Berlin Humboldtmühle Christopher Tomelleri Schlaganfall Epidemiologie Inzidenz: 180/100000 (Kolominski-Rabas, 2002)

Mehr

Evidenzbasierte Aphasietherapie: Was ist erreicht, was ist noch zu tun?

Evidenzbasierte Aphasietherapie: Was ist erreicht, was ist noch zu tun? ICF- Arbeitsgruppe Schaufling Asklepios Klinik Schaufling Evidenzbasierte Aphasietherapie: Was ist erreicht, was ist noch zu tun? Holger Grötzbach Asklepios Klinik Schaufling Abteilung Sprachtherapie D

Mehr

Interventionsstudien

Interventionsstudien Interventionsstudien Univ.-Prof. DI Dr. Andrea Berghold Institut für Med. Informatik, Statistik und Dokumentation Medizinische Universität Graz Vorgangsweise der EBM 1. Formulierung der relevanten und

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

Effekte von Routinetherapie bei Kindern und Jugendlichen

Effekte von Routinetherapie bei Kindern und Jugendlichen Effekte von Routinetherapie bei Kindern und Jugendlichen Daniel Walter Klinik für Psychiatrie und Psychotherapie des Kindes und Jugendalters & Ausbildungsinstitut für Kinder und Jugendlichenpsychotherapie

Mehr

Neurokognitive Störungen nach leichten HWS-Traumen: Befunde und morphologisches Korrelat

Neurokognitive Störungen nach leichten HWS-Traumen: Befunde und morphologisches Korrelat Neurokognitive Störungen nach leichten HWS-Traumen: Befunde und morphologisches Korrelat Prof. B. Radanov Schmerz- und Gutachtenzentrum, Schulthessklinik Zürich Häufigste Symptome des kranio-zervikalen

Mehr

Komplementärmedizin nach Transplantation?

Komplementärmedizin nach Transplantation? Komplementärmedizin nach Transplantation? Dr.med. Martin Frei-Erb Facharzt FMH Allgemeine Innere Medizin Institut für Komplementärmedizin IKOM Universität Bern 22.3.2014, 10. Symposium für Transplantierte,

Mehr

Neues vom ASCO beim metastasierten Mammakarzinom

Neues vom ASCO beim metastasierten Mammakarzinom Neues vom ASCO 2008 beim metastasierten Mammakarzinom 04.07.2008 Dorit Lässig Medizinische Klinik und Poliklinik III (Direktor: Prof. Dr. med. W. Hiddemann) Universität München - Standort Großhadern Übersicht

Mehr

Eine neue Zukunft in der Epilepsie-Behandlung Wirksamkeit und Sicherheit. Von Anfang an mit KetoCal!

Eine neue Zukunft in der Epilepsie-Behandlung Wirksamkeit und Sicherheit. Von Anfang an mit KetoCal! Eine neue Zukunft in der Epilepsie-Behandlung Wirksamkeit und Sicherheit Von Anfang an mit KetoCal! Fol_effektivitaet_12-08.indd 1 17.12.2008 15:55:30 Uhr Ketogene Therapie bietet eine sichere Alternative

Mehr

"Interventionell, operativ oder doch lieber konservativ. Wo geht es hin bei der Behandlung der pavk?"

Interventionell, operativ oder doch lieber konservativ. Wo geht es hin bei der Behandlung der pavk? "Interventionell, operativ oder doch lieber konservativ Wo geht es hin bei der Behandlung der pavk?" Vom Symptom zur Diagnose. Beispiel pavk. Besonderheiten der hausärztlichen Tätigkeit: Quantitative Bedingungen:

Mehr

chronische Exposition Nicht- Exponierte Exponierte vs. dem Bevölkerungsdurchschnitt Exponierte vs. Nicht- Exponierte Exponierte vs.

chronische Exposition Nicht- Exponierte Exponierte vs. dem Bevölkerungsdurchschnitt Exponierte vs. Nicht- Exponierte Exponierte vs. Übersicht über Studien bei exponierten Vätern / Müttern, unterschieden chronischer akuter Strahlenexposition Referenz Macht Lawrence 1955 Tanaka Okhura 1958, 1961 Kitabatake 1960 Müller et al. 1962 Radiologen

Mehr

Aphasien. Seminar Sprache und Spracherwerb. Hannah Schmitt

Aphasien. Seminar Sprache und Spracherwerb. Hannah Schmitt Aphasien 26.11.2009 Hannah Schmitt Inhalt Sprachfunktionen Definition Aphasien Sprachliche Störungsmerkmale 1. Störungen der Wortfindung und Wortwahl 2. Störungen im Satzbau Aphasische Störungsbilder 2

Mehr

Nutzenbewertung von Arzneimitteln im Rahmen des Programms für Nationale Versorgungs-Leitlinien

Nutzenbewertung von Arzneimitteln im Rahmen des Programms für Nationale Versorgungs-Leitlinien Nutzenbewertung von Arzneimitteln im Rahmen des Programms für Nationale Versorgungs-Leitlinien Symposium der Paul-Martini-Stiftung M.Lelgemann, G.Ollenschläger Ärztliches Zentrum für Qualität in der Medizin,

Mehr

Kurzpräsentation: Patientenschulungen. 09.12.14 Modul: Forschungsfragen und Ethik Dozent: Prof. Dr. Andreas Zieger Referentin: Laura Totzek

Kurzpräsentation: Patientenschulungen. 09.12.14 Modul: Forschungsfragen und Ethik Dozent: Prof. Dr. Andreas Zieger Referentin: Laura Totzek Kurzpräsentation: Patientenschulungen 09.12.14 Modul: Forschungsfragen und Ethik Dozent: Prof. Dr. Andreas Zieger Referentin: Laura Totzek Patientenschulungen Warum? Lebenslanger Umgang mit einer Krankheit

Mehr

Musiktherapie für Patienten mit chronischen Schmerzen ein Behandlungsansatz

Musiktherapie für Patienten mit chronischen Schmerzen ein Behandlungsansatz Musiktherapie für Patienten mit chronischen Schmerzen ein Behandlungsansatz Thomas K. Hillecke 1, Alexander F. Wormit 2 1 Fachhochschule Heidelberg, Hochschule für Dienstleistungsmanagement der SRH- Gruppe

Mehr

Evidenz-basiert arbeiten in der Sprachtherapie

Evidenz-basiert arbeiten in der Sprachtherapie Sprachtherapie aktuell Sprachtherapie und Inklusion Evidenz-basiert arbeiten in der Sprachtherapie Ulla Beushausen Zusammenfassung: Die evidenz-basierte Praxis (EBP) hat das Ziel, die Qualität sprachtherapeutischer

Mehr

Das komplexe regionale Schmerzsyndrom CRPS Handtherapeutische Strategien in Kombination mit PNF

Das komplexe regionale Schmerzsyndrom CRPS Handtherapeutische Strategien in Kombination mit PNF Das komplexe regionale Schmerzsyndrom CRPS Handtherapeutische Strategien in Kombination mit PNF Bundeskongress Physiotherapie 21. 22. Oktober 2016 Dresden Barbara Dopfer, Physiotherapeutin, zertifizierte

Mehr

Tapentadol weiterhin keine nachhaltige therapeutische Verbesserung belegt

Tapentadol weiterhin keine nachhaltige therapeutische Verbesserung belegt AG AMV Arbeitsgruppe Arzneimittelvereinbarung Gemeinsame Information der KVWL und der Verbände der Krankenkassen in Westfalen-Lippe Datum: Oktober 2014 Tapentadol weiterhin keine nachhaltige therapeutische

Mehr

Adipositas, Diabetes und Schlaganfall Prof. Dr. Joachim Spranger

Adipositas, Diabetes und Schlaganfall Prof. Dr. Joachim Spranger Adipositas, Diabetes und Schlaganfall Prof. Dr. Joachim Spranger Charité-Universitätsmedizin Berlin Adipositas- und Stoffwechselzentrum Campus Benjamin Franklin Hindenburgdamm 30 12200 Berlin The New Yorker

Mehr

Dosierung parenteraler ß-Laktame: Welche klinischen Vorteile bieten höhere Dosen und die kontinuierliche Infusion?

Dosierung parenteraler ß-Laktame: Welche klinischen Vorteile bieten höhere Dosen und die kontinuierliche Infusion? Dosierung parenteraler ß-Laktame: Welche klinischen Vorteile bieten höhere Dosen und die kontinuierliche Infusion? Katja de With Medizinische Universitätsklinik Freiburg Entwicklung antibiotikaresistenter

Mehr

Einfluss von Aufmerksamkeit auf die auditive Verarbeitung

Einfluss von Aufmerksamkeit auf die auditive Verarbeitung Einfluss von Aufmerksamkeit auf die auditive Verarbeitung eine fmri-einzelfallstudie Alexandra Liebs Universität Salzburg ULG Klinische Linguistik Patient L.A.S., 1967 St. n. Subarachnoidalblutung am 20.08.06

Mehr

Sprachen im Gehirn. Marco Monachino. Christina Backes

Sprachen im Gehirn. Marco Monachino. Christina Backes Sprachen im Gehirn Marco Monachino Christina Backes Überblick Allgemeines und Aufbau Sprachzentren Neurolinguistische Verarbeitung Methoden der Neurolinguistik 2 Allgemeines Das Gehirn wiegt bei einem

Mehr

Das Stepped Wedge Design

Das Stepped Wedge Design Das Stepped Wedge Design Chance und Herausforderung zur Bestimmung der Effektivität in der Versorgungsforschung Sven Reuther, MScN 4. Fachtagung der DGP Methodische Herausforderungen an Pflegeforschung

Mehr

Interventionsstudie zur barrierearmen und bedürfnisorientierten Versorgung lern- und körperbehinderter Patienten im Krankenhaus

Interventionsstudie zur barrierearmen und bedürfnisorientierten Versorgung lern- und körperbehinderter Patienten im Krankenhaus 1. Symposium der Initiative Pflege inklusiv am 22.2.2016 Interventionsstudie zur barrierearmen und bedürfnisorientierten Versorgung lern- und körperbehinderter Patienten im Krankenhaus Diakonin Prof. Dr.

Mehr

ECVET-konformes Curriculum der Logopädie

ECVET-konformes Curriculum der Logopädie ECVET-konformes Curriculum der Logopädie Entstanden im Projekt 2get1care Lebenslanges Lernen und Interprofessionalität in den Gesundheitsfachberufen (2011-2013) Dieses Projekt wurde mit Unterstützung der

Mehr

ebm info.at ärzteinformationszentrum Tranexamsäure bei Totalendoprothesen OP

ebm info.at ärzteinformationszentrum Tranexamsäure bei Totalendoprothesen OP ebm info.at ärzteinformationszentrum EbM Ärzteinformationszentrum www.ebm info.at Department für Evidenzbasierte Medizin und Klinische Epidemiologie Donau-Universität Krems Antwortdokument zur Anfrage

Mehr

startfaq BAG Beobachtungsstudie Bias

startfaq BAG Beobachtungsstudie Bias Hier finden Sie die Erläuterung zu Fachbegriffen, welche in wissenschaftlichen Studien verwendet werden. Sollten Begriffe nicht aufgeführt sein, geben Sie uns doch ein Feedback, damit wir diese ergänzen

Mehr

Bevacizumab kann demnach bei selektionierten Patienten im

Bevacizumab kann demnach bei selektionierten Patienten im Fortgeschrittenes NSCLC Neue S3-Leitlinie empfiehlt Bevacizumab Grenzach-Wyhlen (7. April 2010) - Die kürzlich veröffentlichte S3-Leitlinie Prävention, Diagnostik, Therapie und Nachsorge des Lungenkarzinoms

Mehr

Constraint Induced Aphasia Therapy (CIAT) Hintergrund, Durchführung, Wirksamkeit

Constraint Induced Aphasia Therapy (CIAT) Hintergrund, Durchführung, Wirksamkeit (CIAT) Hintergrund, Durchführung, Wirksamkeit 1 Stefan Krüger Lehranstalt Logopädie Bochum 1995-1998 Logopädisches und interdisziplinäres Behandlungszentrum für Intensivtherapie Lindlar, seit 1998 Donau-Universität

Mehr

Therapeutische Behandlungen mit nicht-medikamentösen, nicht-technischen Ansätzen:

Therapeutische Behandlungen mit nicht-medikamentösen, nicht-technischen Ansätzen: Gesundheitsforschungsrat (GFR) Institut für Qualität und Wirtschaftlichkeit im Gesundheitswesen (IQWiG) 6. Diskussionsforum zur Nutzenbewertung im Gesundheitswesen Therapeutische Behandlungen mit nicht-medikamentösen,

Mehr

Was hilft im fortgeschrittenen Krankheitsstadium?

Was hilft im fortgeschrittenen Krankheitsstadium? Was hilft im fortgeschrittenen Krankheitsstadium? Daniela Berg Zentrum für Neurologie und Hertie-Institut für Klinische Hirnforschung Universität Tübingen Hertie-Institut für klinische Hirnforschung Aufmerksamkeit/Gedächtnis

Mehr

VISA-A-Score. validierte deutsche Version (Lohrer 2009)

VISA-A-Score. validierte deutsche Version (Lohrer 2009) VISA-A-Score validierte deutsche Version (Lohrer 2009) Sehr geehrter Patient, der folgende Fragebogen dient der Erfassung von Beschwerden und Problemen, die durch Ihre Achillessehne verursacht werden.

Mehr

Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin, Clomipramin, Doxepin und Maprotilin unter naturalistischen Bedingungen

Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin, Clomipramin, Doxepin und Maprotilin unter naturalistischen Bedingungen Aus der Klinik und Poliklinik für Psychiatrie, Psychosomatik und Psychotherapie der Universität Würzburg Direktor: Professor Dr. med. J. Deckert Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin,

Mehr

~` Read Chronisch entzndliche Darmerkrankungen (CED) und der Einfluss von Sport und Bewegung (German Edition) digital books free download ID:yeixve

~` Read Chronisch entzndliche Darmerkrankungen (CED) und der Einfluss von Sport und Bewegung (German Edition) digital books free download ID:yeixve ~` Read Chronisch entzndliche Darmerkrankungen (CED) und der Einfluss von Sport und Bewegung (German Edition) digital books free download ID:yeixve Click Here to Read Chronisch entzndliche Darmerkrankungen

Mehr

Hausärztliche Lehre und Forschung im Wandel der Zeit. Klaus Bally

Hausärztliche Lehre und Forschung im Wandel der Zeit. Klaus Bally Hausärztliche Lehre und Forschung im Wandel der Zeit Klaus Bally Voraussetzungen für eine gute Lehre an der Universität Ziel der Ausbildung? Gute Ärzte Was braucht es für eine gute Ausbildung? Studierende;

Mehr

Unverändert höheres Risikoprofil von Frauen in der Sekundärprävention der KHK Sechs-Jahres-Verlauf an Patienten

Unverändert höheres Risikoprofil von Frauen in der Sekundärprävention der KHK Sechs-Jahres-Verlauf an Patienten Deutsche Gesellschaft für Kardiologie Herz- und Kreislaufforschung e.v. (DGK) Achenbachstr. 43, 40237 Düsseldorf Geschäftsstelle: Tel: 0211 6006920 Fax: 0211 60069267 mail : info@dgk.org Pressestelle:

Mehr

Ausgewählte Publikationen - Prof. Dr. phil. Tanja Grewe

Ausgewählte Publikationen - Prof. Dr. phil. Tanja Grewe Ausgewählte Publikationen - Prof. Dr. phil. Tanja Grewe Qualifizierende Arbeiten Grewe, T. (2006). The neuronal reality of the nominal hierarchy: fmri observations on animacy in sentence comprehension.

Mehr

Forschungsgruppe THICS Entwicklung und Evaluation des Therapieprogramms für Kinder und Jugendlichen mit Tic-Störungen

Forschungsgruppe THICS Entwicklung und Evaluation des Therapieprogramms für Kinder und Jugendlichen mit Tic-Störungen Forschungsgruppe THICS Entwicklung und Evaluation des Therapieprogramms für Kinder und Jugendlichen mit Tic-Störungen Mitglieder der Forschungsgruppe: Katrin Woitecki, Dr. Dipl.-Psych. (AKiP) Manfred Döpfner,

Mehr

Neurologische Rehabilitation II. PD.Dr.H.Gerhard Philippusstift KKENW SS 2011

Neurologische Rehabilitation II. PD.Dr.H.Gerhard Philippusstift KKENW SS 2011 Neurologische Rehabilitation II PD.Dr.H.Gerhard Philippusstift KKENW SS 2011 Ohne Neuroplastizität keine Rehabilitation Planung der Rehabilitation Die Planung der Rehabilitation beginnt auf der Stroke

Mehr

Neues in der Diagnose der Tuberkulose

Neues in der Diagnose der Tuberkulose Neues in der Diagnose der Tuberkulose Klinische Diagnose Dr. med. Alexander Turk Zürcher Höhenklinik Wald alexander.turk@zhw.ch Tuberkulose in Homo erectus vor 500 000 Jahren? AMERICAN JOURNAL OF PHYSICAL

Mehr

Evidenzbasierte Aphasietherapie

Evidenzbasierte Aphasietherapie Sprachtherapie aktuell Aus der Praxis für die Praxis Evidenzbasierte Aphasietherapie Holger Grötzbach Zusammenfassung: Sowohl Patient(inn)en mit einer Aphasie als auch Sprachtherapeut(inn)en erwarten,

Mehr

Direktzugang zur Physiotherapie in der (Ost-)Schweiz

Direktzugang zur Physiotherapie in der (Ost-)Schweiz Direktzugang zur Physiotherapie in der (Ost-)Schweiz * Gamper U.N., *Grob U., *Pfenninger M.N., *Efting R., Keller U., Bachmann S., Oesch P. * Physionetz werdenberg sarganserland, Pizolcare AG, Kliniken

Mehr