DNA-Sequenzierung. Martina Krause

Größe: px
Ab Seite anzeigen:

Download "DNA-Sequenzierung. Martina Krause"


1 DNA-Sequenzierung Martina Krause

2 Inhalt Methoden der DNA-Sequenzierung Methode nach Maxam - Gilbert Methode nach Sanger

3 Einleitung Seit 1977 stehen zwei schnell arbeitende Möglichkeiten der Sequenzanalyse zur Verfügung 1975 : A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase (F. Sanger, AR. Coulson) 1977 : A new method for sequencing DNA (AM. Maxam, W. Gilbert)

4 Vorbereitung der Proben gilt für beide Verfahren : DNA wird enzymatisch in kleinere Bruchstücke zerlegt ( Restriktionsendonukleasen) Auftrennung durch Gelelektrophorese

5 Maxam - Gilbert Verfahren wird nur selten verwendet arbeitet mit chemischen Abbau-Methoden Ähnlich wie die Methoden zur Ermittlung der Aminosäurensequenz von Proteinen

6 Maxam-Gilbert-Verfahren

7 Maxam - Gilbert - Verfahren Die zu analysierende Teilsequenz wird am 5 -Ende mit 32 P radioaktiv markiert

8 Maxam-Gilbert-Verfahren Ansatz wird in 4 Teilansätze geteilt Jeder Ansatz wird durch chemische Reaktionen selektiv verändert z.b. Methylierung von Adenin und Guanin z.b. Spaltung von Cytosin bzw. Thymin mit Hydrazin zu Desoxy-Ribosylharnstoff Es muss jedoch erreicht werden, dass die Teilsequenz nur an wenigen Stellen modifiziert wird

9 Maxam-Gilbert-Verfahren

10 Maxam-Gilbert-Verfahren

11 Beispiel : Untersuchungsobjekt ist eine Sequenz aus 20 Basen : 5 AGAATTCTACAGTAAATGCT Diese wird so modifiziert, dass jeweils die auf Cytosin folgende Phosphodiesterbindung gespalten wird : 5 AGGATTC / TAC / AGTAAATGC / T

12 Beispiel : Man erhält 3 am 5 -Ende markierte Fragmente : (5 AGGATTCTACAGTAAATGCT) 1.) 5 AGGATTC (7 Basen) 2.) 5 AGGATTCTAC (10 Basen) 3.) 5 AGGATTCTACAGTAAATGC (19 Basen) Diese werden durch Gelelektrophorese nach ihrer relativen Molekülmasse getrennt

13 Auswertung Maxam-Gilbert

14 Auswertung Maxam-Gilbert So wie in dem Beispiel dargestellt, erfolgt in den anderen 3 Reaktionsgefäßen ebenfalls eine geeignete Modifizierung, so dass man Fragmente erhält, die mit A, G oder T enden. Phosphodiesterbindung wird gespalten Fragment enthält negativ geladene Phosphatgruppen, die im elektrischen Feld zur Anode wandern. (Größenausschlusschromatographie das kleinste am schnellsten)

15 Auswertung Maxam-Gilbert

16 Verfahren nach Sanger Arbeitet mit einer enzymatischen Kettenabbruchmethode Wird heute am häufigsten eingesetzt

17 Verfahren nach Sanger der zu sequenzierende DNA-Abschnitt wird an seinem 3 -Ende mit einer komplementären DNA-Matrize hybridisiert

18 Verfahren nach Sanger mit Hilfe der DNA-Polymerase I kann an diesem Primer ein zu dem zu sequenzierenden DNA-Abschnitt komplementärer Strang synthetisiert werden Vorraussetzung : alle 4 Basen müssen als Desoxyribonukleotidtriphosphate vorhanden sein; diese sind radioaktiv markiert

19 Verfahren nach Sanger Sequenzierungsansatz wird in 4 gleiche Teile geteilt und in jeden eine geringe Menge eines entsprechenden 2,3 -Didesoxyanalogons gegeben. jedes Mal wenn das Didesoxyanalogon eingebaut wird, wird das Kettenwachstum beendet. (keine 3 -OH-Gruppe nötig für Polymerisation) Daraus folgt : Fragmente haben eine unterschiedliche Länge

20 Verfahren nach Sanger

21 Verfahren nach Sanger Zur Erinnerung :

22 Verfahren nach Sanger Matrize : 5 ACGTGCAAT GAG-3

23 Auswertung Sanger Trennung erfolgt durch Gelelektrophorese

24 Auswertung Sanger Daraus ergibt sich :

25 Auswertung Sanger Autoradiogramm : Die 4 Ansätze mit den Kettenabbruchfragmenten werden elektrophoretisch aufgetrennt, und aus dem Autoradiogramm der 4 Spuren kann die Basensequenz abgelesen werden

26 Auswertung Sanger Fluoreszenzdetektion : Anstatt der radioaktiven Markierung können auch Fluoreszenzmarker kovalent an die Nucleotidprimer gebunden werden. In jedes Gemisch kommt ein anderer Fluoreszenzmarker jedes Gemisch fluoresziert in einer anderen Farbe

27 Auswertung Sanger

28 Zusammenfassung Maxam-Gilbert-Verfahren : arbeitet mit chemischen Abbaumethoden (Basen werden so modifiziert, dass die nachfolgende Phosphodiesterbindung gespalten wird ) Sanger-Verfahren arbeitet mit dem basenspezifischen Abbruch einer enzymatischen DNA-Synthese

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien


Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055

Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Das Prinzip der DNA-Sequenzierung Best.- Nr. 201.3055 Allgemeine Informationen Prinzip der DNA-Sequenzierung Ziel dieses Versuchs ist einen genauen Überblick über die Verfahrensweise der DNA- Sequenzierung


Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen


DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet


1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?


Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.


Weitergabe genetischer Information: DNA-Replikation Beispiel: Escherichia coli.

Weitergabe genetischer Information: DNA-Replikation Beispiel: Escherichia coli. Weitergabe genetischer Information: DNA-Replikation Beispiel: Escherichia coli. zirkuläres bakterielles Chromosom Replikation (Erstellung einer identischen Kopie des genetischen Materials) MPM 1 DNA-Polymerasen


Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine


NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts


DNA versus RNA. RNA Instabilität

DNA versus RNA. RNA Instabilität DNA versus RNA DNA stellt den eigentlichen Speicher genetischer Information dar, während RNA als Informationsüberträger und katalytisch in der Proteinbiosynthese agiert. Warum dient DNA und nicht RNA als


Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung

Sequenzierung. Sequenzierung. DNA in den letzten 50 Jahren. Warum Sequenzierung Sequenzierung von Thomas Grunwald Abteilung für Med. und Mol. Virologie Sequenzierung Hintergrund Allgemeiner Überblick Funktionsweise der Sequenzierung Sequenzierungsprotokoll Auswertung der Daten Probleme


3 DNA-Replikation. 3.1 Grundschema der Replikation. Inge Kronberg, Jörg Soppa (3.4), Beate Schultze (3.5)

3 DNA-Replikation. 3.1 Grundschema der Replikation. Inge Kronberg, Jörg Soppa (3.4), Beate Schultze (3.5) .1 Grundschema der Replikation 89 DNA-Replikation Inge Kronberg, Jörg Soppa (.4), Beate Schultze (.5).1 Grundschema der Replikation Als Replikation bezeichnet man einen zellulären Vorgang, bei dem eine


Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.


Rekombinante Wirkstoffe

Rekombinante Wirkstoffe Gentechnik/Biotechnik Rekombinante Wirkstoffe Vorlesung im WS 2010/2011 Prof. Theo Dingermann Institut für Pharmazeutische Biologie Goethe-Universität Frankfurt/Main Dingermann@em.uni-frankfurt.de Die


1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli


Luke Alphey. DNA-Sequenzierung. Aus dem Englischen übersetzt von Kurt Beginnen. Spektrum Akademischer Verlag

Luke Alphey. DNA-Sequenzierung. Aus dem Englischen übersetzt von Kurt Beginnen. Spektrum Akademischer Verlag Luke Alphey DNA-Sequenzierung Aus dem Englischen übersetzt von Kurt Beginnen Spektrum Akademischer Verlag Inhalt Abkürzungen 11 Vorwort 15 Danksagung 16 Teil 1: Grundprinzipien und Methoden 1. 1.1 1.2


2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)


Verbesserte Basenpaarung bei DNA-Analysen

Verbesserte Basenpaarung bei DNA-Analysen Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/verbesserte-basenpaarungbei-dna-analysen/ Verbesserte Basenpaarung bei DNA-Analysen Ein Team aus der Organischen


Alternative Methoden der RNA-Analyse

Alternative Methoden der RNA-Analyse Alternative Methoden der RNA-Analyse In diesem Versuch wurde die Northern Blot Hybridisierung zur Analyse isolierter mrna eingesetzt. Mit dieser Technik können Größe und Menge einer spezifischen RNA bestimmt


DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die


Anabole Prozesse in der Zelle

Anabole Prozesse in der Zelle Anabole Prozesse in der Zelle DNA Vermehrung RNA Synthese Protein Synthese Protein Verteilung in der Zelle Ziel: Zellteilung (Wachstum) und Differenzierung (Aufgabenteilung im Organismus). 2016 Struktur


Europäisches Patentamt European Patent Office Dffice europeen des brevets 3> J ) 2) Veröffentlichungsnummer: 0 409 078 AZ

Europäisches Patentamt European Patent Office Dffice europeen des brevets 3> J ) 2) Veröffentlichungsnummer: 0 409 078 AZ 3> J ) Europäisches Patentamt European Patent Office Dffice europeen des brevets 2) Veröffentlichungsnummer: 0 409 078 AZ 3> EUROPAISCHE PATENTANMELDUNG Anmeldenummer: 90113328.0 ) Int. CIA C1 20. 1/68


4. Genetische Mechanismen bei Bakterien

4. Genetische Mechanismen bei Bakterien 4. Genetische Mechanismen bei Bakterien 4.1 Makromoleküle und genetische Information Aufbau der DNA Phasen des Informationsflusses Vergleich der Informationsübertragung bei Pro- und Eukaryoten 4.2 Struktur


Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)


Tierartbestimmung mittels spezifischer Polymerasekettenreaktion

Tierartbestimmung mittels spezifischer Polymerasekettenreaktion Einleitung Der Tierart-Kit SK1-12 enthält die notwendigen Materialien, um verarbeitete Tierarten in gängigen Fleisch- und Milchprodukten, z.b. Wurst oder Käse zu bestimmen. Ein Lehrerheft und fünf Schülerhefte,


Grundriss 1 EINIGE GRUNDLAGEN DER VERERBUNG. DNA ein Bote aus der Vergangenheit. Vertiefungen. Anhang

Grundriss 1 EINIGE GRUNDLAGEN DER VERERBUNG. DNA ein Bote aus der Vergangenheit. Vertiefungen. Anhang Grundriss 6. Gen-Bäume in Populationen.............................. 66 Rekonstruktion der Populationsgeschichte anhand von DNA-Sequenzen.................................. 68 Die Genealogie einer Stichprobe..............................


2. DNA-Fingerprinting

2. DNA-Fingerprinting Obwohl die Untersuchung von Mikrosatelliteninstabilität und LOH nicht Ziel der vorliegenden Arbeit war, kann es im Rahmen der Vaterschaftsbegutachtung dazu kommen, dass von einem verstorbenen Putativvater


B E S C H L U S S. des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 309. Sitzung am 27. Juni 2013

B E S C H L U S S. des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 309. Sitzung am 27. Juni 2013 B E S C H L U S S des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 309. Sitzung am 27. Juni 2013 zur Änderung des Einheitlichen Bewertungsmaßstabes (EBM) mit Wirkung zum 1. Oktober 2013


Europäisches Patentamt J» European Patent Office @ Veröffentlichungsnummer: 0 2 1 2 5 3 6 Office europeen des brevets EUROPAISCHE PATENTANMELDUNG

Europäisches Patentamt J» European Patent Office @ Veröffentlichungsnummer: 0 2 1 2 5 3 6 Office europeen des brevets EUROPAISCHE PATENTANMELDUNG Europäisches Patentamt J» European Patent Office @ Veröffentlichungsnummer: 0 2 1 2 5 3 6 Office europeen des brevets EUROPAISCHE PATENTANMELDUNG @ Anmeldenummer: 86111117.7 @ Int. Cl.4: C 07 H 19/14 @


ANALYTISCHE CHEMIE I Trennmethoden 6. Elektrophorese-Methoden Kapillarelektrophorese / Gelelektrophorese WS 2007/2008

ANALYTISCHE CHEMIE I Trennmethoden 6. Elektrophorese-Methoden Kapillarelektrophorese / Gelelektrophorese WS 2007/2008 ANALYTISCHE CHEMIE I Trennmethoden 6. Elektrophorese-Methoden Kapillarelektrophorese / Gelelektrophorese WS 2007/2008 Definition Elektrophorese bezeichnet die Wanderung elektrisch geladener Teilchen durch


Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94.

Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94. In diesem Skript wird der Versuch unternommen, der Prozess Pyrosequencing so zu erklären, dass Schüler die Chance haben Pyrosequencing zu verstehen. Es basiert auf einem Vortrag im Rahmen des Science Bridge


G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010

G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Institut für f r Biochemische Verfahren und Analysen (IBVA) Genomik?! Tobias Schäfer Institut für f r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Inhalt Methoden der Gensequenzierung Nutzen genetischer


Analytische Chemie (für Biol. / Pharm. Wiss.)

Analytische Chemie (für Biol. / Pharm. Wiss.) Analytische Chemie (für Biol. / Pharm. Wiss.) Teil: Trenntechniken (Chromatographie, Elektrophorese) Dr. Thomas Schmid HCI D323 schmid@org.chem.ethz.ch http://www.analytik.ethz.ch/ Elektrophorese 2 Elektrophorese


Trennungsverfahren Techniken (in der Biologie)

Trennungsverfahren Techniken (in der Biologie) Trennungsverfahren Techniken (in der Biologie)? Biomoleküle können getrennt werden aufgrund ihrer - chemischen Eigenschaften: Ladung, Löslichkeit, Wechselwirkung mit spezifischen Reagenzen, Molmasse -


Kapillarelektrophorese DNA-Sequenzierung

Kapillarelektrophorese DNA-Sequenzierung Kapillarelektrophorese DNA-Sequenzierung DNA Kettenanalyse oder DNA-Sequenzierung wird bei der Anordnung der Primärstruktur und Bestimmung der Nukleotid-Basensequenz verwendet. Die Analyse basiert auf


Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Unter Next Generation Sequencing (NGS) werden verschiedene neue Technologien zusammengefasst, die nicht auf kapillar basierenden Sequenzierautomaten beruhen. Das 1990 ins Leben


XNA: Die fremde Erbsubstanz

XNA: Die fremde Erbsubstanz XNA: Die fremde Erbsubstanz Stefan Dörsam, Sebastian Meister und Oliver Rauh Xeno-Nukleinsäuren (XNAs) sind Biopolymere, die wie die Erbsubstanz DNA genetische Informationen speichern können. Mit Hilfe


PCR (polymerase chain reaction)

PCR (polymerase chain reaction) PCR (polymerase chain reaction) Ist ein in vitro Verfahren zur selektiven Anreicherung von Nukleinsäure-Bereichen definierter Länge und definierter Sequenz aus einem Gemisch von Nukleinsäure-Molekülen


Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,


1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener


Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch

Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch Durchführung einer Gel-Elektrophorese mit einem DNA-Gemisch (Fotos vom 6. März 2013 Molekularbiologisches Praktikum 12 G-Kurs Biologie Herr Korne - am KOMM Homburg/Saar unter Anleitung von Frau Dr. Amoroso)


Platzhalter für Bild

Platzhalter für Bild Instrumentelle Bioanalytik in der Molekularbiologie Anke Neumann Platzhalter für Bild KIT die Kooperation von Forschungszentrum Karlsruhe GmbH und Universität Karlsruhe (TH) www.kit.edu Motivation und


1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S.

1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2. 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. Inhaltsverzeichnis 1. Einleitung S. 1 1.1. Zelladhäsionsmoleküle S. 1 1.2. Die Immunglobulin-Superfamilie S. 2 1.2.1. Das neurale Zelladhäsionsmolekül NCAM S. 4 Molekulare Struktur von NCAM S.


Chromosomendarstellung und -identifizierung

Chromosomendarstellung und -identifizierung Chromosomendarstellung und -identifizierung Bei den 46 Chromosomen des Menschen unterscheidet man 22 homologe Autosomenpaare und 2 Geschlechtschromosomen, das homologe XX-Paar im weiblichen und das nicht-homologe


Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und


DNA-Synthese in vivo und in vitro

DNA-Synthese in vivo und in vitro DNA-Synthese in vivo und in vitro 4 Einführung Replikation der DNA Entwindung der DNA Priming der DNA-Synthese Struktur und Funktion der DNA-Polymerase Synthese des Folgestranges Fehlpaarungsreparatur


Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt.

Western Blot. Zuerst wird ein Proteingemisch mit Hilfe einer Gel-Elektrophorese aufgetrennt. Western Blot Der Western Blot ist eine analytische Methode zum Nachweis bestimmter Proteine in einer Probe. Der Nachweis erfolgt mit spezifischen Antikörpern, die das gesuchte Protein erkennen und daran


Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Bioinformatik


Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische



MOLEKULARBIOLOGISCHE METHODEN 45 MOLEKULARBIOLOGISCHE METHODEN Die Technik der DNA-Rekombination, auch als Gentechnik bezeichnet, erlaubt die Isolierung von DNA-Abschnitten (genomische oder cdna), deren Sequenzbestimmung, Modifikation


Erbgutanalyse mit wachsendem Automatisierungsgrad

Erbgutanalyse mit wachsendem Automatisierungsgrad Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/erbgutanalyse-mitwachsendem-automatisierungsgrad/ Erbgutanalyse mit wachsendem Automatisierungsgrad Mit einer eigens





Molekularbiologische / gentechnische Methoden

Molekularbiologische / gentechnische Methoden Molekularbiologische / gentechnische Methoden MPM 1 Wie lässt sich ein spezifisches Gen/Genprodukt molekular analysieren? Fundamentales Problem: Komplexität biologischer Systeme MPM 2 Ein Ausschnitt aus


Q1 B1 KW 49. Genregulation

Q1 B1 KW 49. Genregulation Q1 B1 KW 49 Genregulation Transkription Posttranskription elle Modifikation Genregulation bei Eukaryoten Transkriptionsfaktoren (an TATA- Box) oder Silencer (verringert Transkription) und Enhancer (erhöht


Medizinische Fakultät Auswertestrategien von Microarrays Einführung

Medizinische Fakultät Auswertestrategien von Microarrays Einführung Medizinische Fakultät Auswertestrategien von Microarrays Einführung PD Dr. Knut Krohn IZKF Leipzig Dr. Markus Eszlinger Med. Klinik III Forschungslabor DNA RNA Hintergrund Charakteristisches Muster der


Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt USERGUIDE Seite 1 No. 201 Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt Temperierbereich: (RT 13 C) bis 99 C [MTPs: (RT 10 C) bis 70 C], Minimal


Seminar Visual Analytics im Wintersemester 2007/2008 bei Steffen Oeltze Fakultät für Informatik der O.v.G Universität Magdeburg

Seminar Visual Analytics im Wintersemester 2007/2008 bei Steffen Oeltze Fakultät für Informatik der O.v.G Universität Magdeburg Ausarbeitung zu dem Vortrag von Wolf Geisler über das Paper Hawkeye: An interactive visual analytics tool for genome assemblies von Schatz, Shneiderman et al. Seminar Visual Analytics im Wintersemester


"Gentechnik II - Identifizierungsmethoden" (Biologie Sek. II)

Gentechnik II - Identifizierungsmethoden (Biologie Sek. II) Inhalt und Einsatz im Unterricht "Gentechnik II - Identifizierungsmethoden" (Biologie Sek. II) Diese DVD behandelt das Unterrichtsthema "Gentechnik" für die Sekundarstufe II. Das DVD-Hauptmenü bietet folgende


Einführung Nukleinsäuren

Einführung Nukleinsäuren Einführung Nukleinsäuren Dr. Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Einführung 1. Semester, WiSe 2007/2008 Historischer Überblick Literatur Bilder aus: Taschenatlas



Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing


Die zeitliche Entwicklung der DNA-Analyse lässt sich in den wesentlichen Schritten wie folgt zusammenfassen:

Die zeitliche Entwicklung der DNA-Analyse lässt sich in den wesentlichen Schritten wie folgt zusammenfassen: 1. Bis Anfang 1970 war die Desoxyribonukleinsäure (DNA), das am schwersten zu analysierende zelluläre Molekül. Durch ihre enorme Länge und ihren monotonen chemischen Aufbau konnte man sich ihrer Primärstruktur


Mit Rekordgeschwindigkeit zum menschlichen Genom

Mit Rekordgeschwindigkeit zum menschlichen Genom Mit Rekordgeschwindigkeit zum menschlichen Genom Timo Bäroth, Sonja Wendenburg Im Jahre 2141 Erschöpft und mit pochendem Schmerz im Unterleib sitzt Ute Klopfer vor Dr. med. Hennings. Die Diagnose: Krebs.


Klonierung und Sequenzierung von DNA

Klonierung und Sequenzierung von DNA Klonierung und Sequenzierung von DNA Heike Mitternacht ( 10.08.2001 ) Inhalt Klonierung von DNA 1. Allgemeines 1.1. Klonierungsvektoren 1.1.1. Plasmidvektoren 1.1.2. Phagenvektoren 1.1.3. Cosmide, Phasmide


Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Lernwerkstatt Gentechnik: Dem genetischen Fingerabdruck auf der Spur Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Gentechnik: Dem genetischen Fingerabdruck auf der Spur Das komplette Material finden Sie hier: School-Scout.de 8.-11. Schuljahr Dipl.-Bio.


Synthese von eukaryotischen RNA-Modifikationen

Synthese von eukaryotischen RNA-Modifikationen Dissertation zur Erlangung des Doktorgrades der Fakultät für Chemie und Pharmazie der Ludwig-Maximilians-Universität München Synthese von eukaryotischen RNA-Modifikationen und Quantifizierung nicht kanonischer


11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese

11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese 11. Isolierung von Plasmid DNA, Restriktionsverdau und DNA-Elektrophorese 11.1 Einführung in die Problemstellung 11.1.1 Plasmid-DNA In der Gentechnik spielen Plasmide als Vektoren eine herausragende Rolle


Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen


Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute


DNS-Modell Best.-Nr. 2015801

DNS-Modell Best.-Nr. 2015801 DNS-Modell Best.-Nr. 2015801 1. Produktvorstellung Ziel des Produktes Dieses Modell soll das DNS-Molekül visualisieren: es soll die Doppelspirale, Stickstoffbasen mit Wasserstoffbrückenbindung, Zucker-Phosphatskelette


Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese

Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die. Regulation der enterobakteriellen Kapselbiosynthese Das Rcs-System und die RcsAB-Box: Identifikation eines neuen, essentiellen Operators für die Regulation der enterobakteriellen Kapselbiosynthese Inaugural-Dissertation zur Erlangung der Doktorwürde vorgelegt


1.Theoretischer Hintergrund

1.Theoretischer Hintergrund 1.Theoretischer Hintergrund Die Molekularbiologie oder Molekulargenetik befasst sich mit den zellulären Vorgängen bei der Vervielfältigung, Übertragung und Expression des genetischen Materials. Bei der


3 Ergebnisse. 3.1 Isolierung von leukozytärer Gesamt-RNA

3 Ergebnisse. 3.1 Isolierung von leukozytärer Gesamt-RNA 3 Ergebnisse 3.1 Isolierung von leukozytärer Gesamt-RNA Um Ausgangsmaterial zur Isolierung von CD44-RNA zu erhalten, wurde aus einem Buffy coat (siehe Abschnitt Materialen und Methoden ) der Leukozytenanteil


3 DNA-Synthese (Replikation) - Dezember 2008

3 DNA-Synthese (Replikation) - Dezember 2008 Page 1 of 16 GRUNDLAGEN DER MOLEKULARBIOLOGIE Prof. Dr. Anne Müller 3 DNA-Synthese (Replikation) 3.1 Ursprung der Replikation 3.2 Primase 3.3 DNA-Polymerasen 3.4 Leitstrang-Synthese 3.5 Folgestrang-Synthese


Anhang 1 Sequenzierung von DNA

Anhang 1 Sequenzierung von DNA Anhang 1 Sequenzierung von DNA (Carolina Río Bártulos, Hella Tappe) Zur Bestimmung der Basensequenz von DNA existieren unterschiedliche Verfahren. Die ersten routinemäßigen Sequenzierungen erfolgten nach


Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983


Duale Reihe Medizinische Mikrobiologie

Duale Reihe Medizinische Mikrobiologie Duale Reihe Medizinische Mikrbilgie vn Herbert Hf, Rüdiger Dörries erweitert, überarbeitet Duale Reihe Medizinische Mikrbilgie Hf / Dörries schnell und prtfrei erhältlich bei beck-shp.de DIE FAHBUHHANDLUNG


KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation


Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat


Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005

Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005 Johannes Gutenberg-Universität Mainz Fachbereich Biologie, Institut für Zoologie Leitung: Prof. Dr. Wolfrum Datum: 15. April 2005 F1 Molekulare Zoologie Teil II: Expressionsanalyse Proteinexpressionsanalyse


Das Paper von heute. Samuel Grimm & Jan Kemna

Das Paper von heute. Samuel Grimm & Jan Kemna Das Paper von heute Samuel Grimm & Jan Kemna Bisheriges Modell Was bereits bekannt war - TIR1 ist an Auxinantwort (Zellteilung, Elongation, Differenzierung) beteiligt, im selben Signalweg wie AXR1 - TIR1


S E M I N A R A R B E I T. Thema der Arbeit: Identifizierung eines Täterprofils mittels PCR und des genetischen Fingerabdrucks

S E M I N A R A R B E I T. Thema der Arbeit: Identifizierung eines Täterprofils mittels PCR und des genetischen Fingerabdrucks Schyren-Gymnasium Pfaffenhofen Abiturjahrgang 2013/2015 S E M I N A R A R B E I T Rahmenthema des Wissenschaftspropädeutischen Seminars: Forensik Leitfach: Chemie Thema der Arbeit: Identifizierung eines


Aus der Reihe Daniels Genetik-Kompendium

Aus der Reihe Daniels Genetik-Kompendium Aus der Reihe Daniels Genetik-Kompendium Erstellt von Daniel Röthgens Inhalt : 1. Einleitung 2. Bestandteile der Nukleinsäuren 3. DNA / Struktur und genetische Spezifität 1 1. Einleitung Die Frage nach


"Dexamethason und Selenige Säure als Beispiele für ultraschnell wirksame direkte Radikalfänger: Quantenpharmakologische Untersuchungen"

Dexamethason und Selenige Säure als Beispiele für ultraschnell wirksame direkte Radikalfänger: Quantenpharmakologische Untersuchungen "Dexamethason und lenige Säure als Beispiele für ultraschnell wirksame direkte Radikalfänger: Quantenpharmakologische Untersuchungen" Priv.-Doz. Dr. ans-georg Mack (hans-georg.mack@uni-tuebingen.de) Computational


- Polymerase-Kettenreaktion (PCR) - Theorie und Darstellung als digitales Medium

- Polymerase-Kettenreaktion (PCR) - Theorie und Darstellung als digitales Medium Gymnasium Penzberg Kollegstufenjahrgang 2006/2008 F a c h a r b e i t aus dem Fach Chemie - Polymerase-Kettenreaktion (PCR) - Theorie und Darstellung als digitales Medium Verfasser: Thomas Jungwirth Leistungskurs:


IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während


Foto:D.Höwing - im Labor werden die DNA-Abschnitte kopiert

Foto:D.Höwing - im Labor werden die DNA-Abschnitte kopiert Forschung - Genforschung: RZPD - Europas größtes Servicezentrum für funktionelle Genomforschung Das Deutsche Ressourcenzentrum (RZPD) ist Europas größtes Servicezentrum für die funktionelle Genomforschung.


PATENTSCHRIFT. int. ci.5: C12Q 1/68

PATENTSCHRIFT. int. ci.5: C12Q 1/68 Europäisches Patentamt European Patent Office Office europeen des brevets Veröffentlichungsnummer: 0 409 078 B1 EUROPÄISCHE PATENTSCHRIFT Veröffentlichungstag der Patentschrift: 09.11.94 int. ci.5: C12Q


'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?


Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom...

Abkürzungsverzeichnis... 7. Inhaltsverzeichnis... 11. Abbildungsverzeichnis... 17. 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... Inhaltsverzeichnis Abkürzungsverzeichnis... 7 Inhaltsverzeichnis... 11 Abbildungsverzeichnis... 17 1 Einleitung... 21 1.1 Proteomik... 21 1.1.1 Proteom... 21 1.1.2 Protein-Protein Interaktionen allgemein...


Elektrophorese. Zentrum für Mikro- und Nanotechnologien http://www.tu-ilmenau.de/nano

Elektrophorese. Zentrum für Mikro- und Nanotechnologien http://www.tu-ilmenau.de/nano Elektrophorese Die SDS- Polyacrylamidgelelektrophorese ist eine schnelle und empfindliche Methode, die zudem eine hohe Auflösung erlaubt. Schon 1 μg (2 pmol) eines Proteins ergeben eine erkennbare Bande.


Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Einblicke in das menschliche Genom aus Sicht der Bioinformatik Prof. Dr. Antje Krause FH Bingen a.krause@fh-bingen.de Kurzer Ausflug in die Genetik DNA (Desoxyribonukleinsäure)



DATENQUALITÄT IN GENOMDATENBANKEN DATENQUALITÄT IN GENOMDATENBANKEN Alexander Fehr 28. Januar 2004 Gliederung Motivation Biologische Grundkonzepte Genomdaten Datenproduktion und Fehler Data Cleansing 2 Motivation (1) Genomdatenbanken enthalten


Praktisches Arbeiten mit gentechnischen Methoden in der Schule

Praktisches Arbeiten mit gentechnischen Methoden in der Schule Praktisches Arbeiten mit gentechnischen Methoden in der Schule Comenius - Projekt "come together - work together" Arno Hirtler Kollegium Kalksburg Klasse 8. A Schuljahr 2003/04 Prof. Mag. Gabriele Premauer


Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen

Versuch 2: Polymerasekettenreaktion. Betreuer: Knut Jahreis. Versuchsinhalt. Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Versuch 2: Polymerasekettenreaktion Betreuer: Knut Jahreis Versuchsinhalt Polymerasekettenreaktion, Gelelektrophorese auf Agarosegelen Zwei verschiedene Plasmide werden als Matrizen für eine Polymerasekettenreaktion


Station 1. Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese

Station 1. Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese Station 1 Analyse von strahleninduzierten DNA-Schäden durch Gel-Elektrophorese 1 I. Vorinformationen An der GSI wurde eine weltweit neuartige Krebstherapie mit Ionenstrahlen entwickelt. Dazu werden in


Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide

Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide O:/Wiley/Reihe_verdammt_klever/Fletcher/3d/c01.3d from 15.08.2013 17:16:38 1 Molekulargenetik 1 In diesem Kapitel geht es um diese Themen: DNA-Struktur Gene Der genetische Code Von der DNA zum Protein


Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Algorithmische


Modul 10B: Übungen zur Bioinformatik. Teil 1 DNA-Sequenzanalyse und Gensuche

Modul 10B: Übungen zur Bioinformatik. Teil 1 DNA-Sequenzanalyse und Gensuche Modul 10B: Übungen zur Bioinformatik Teil 1 DNA-Sequenzanalyse und Gensuche 13.08.-17.08.2012 AG Hankeln Institut für Molekulargenetik J. J. Becherweg 30a 55128 Mainz 1. OLD SCHOOL: mit Fred Sanger zur


Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung

Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung Carnobakterien im Wein- Methoden zur Identifizierung von einem Hefen- und Bakterienisolates an GH140 in der Weinbereitung In Zusammenarbeit mit Katharina Mumm, Alexander Prange Gewinnung des Hefe - Bakterienisolates


Was ist ein genetischer Fingerabdruck?

Was ist ein genetischer Fingerabdruck? Was ist ein genetischer Fingerabdruck? Genetischer Fingerabdruck od. DNA-Fingerprint ist ein molekularbiologisches Verfahren zur individuellen Identifizierung von Lebewesen Der genetische Fingerabdruck
