Neue DNA Sequenzierungstechnologien im Überblick

Größe: px
Ab Seite anzeigen:

Download "Neue DNA Sequenzierungstechnologien im Überblick"

Transkript

1 Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany

2 Max-Planck-Gesellschaft 80 Institute und Forschungseinrichtungen Mitarbeiter Budget 1,400 Mrd. Euro Max Planck Institut für molekulare Genetik

3 Entwicklung des Sequenzierungsdurchsatzes 1000,000,000 Durchsatz pro Gerät [Kilobasen/Tag] 100,000,000 10,000,000 1,000, , , Gel basierte Systeme Kapillarsequenzierung erste Generation Kapillarsequenzer Next Generation Sequencing zweite Generation Kapillarsequenzer Short Read Sequencer Microwell Pyrosequencing Jahr Modifiziert nach MR Stratton et al. Nature 458, (2009)

4 Entwicklung der Sequenzierungstechnologien Humanes Genomprojekt 1000 Genomes Project 96 Sequenzen parallel 3.2 Milliarden Sequenzen pro Gerätelauf

5 Roche/454 Genome Sequencer FLX Illumina HiSeq 2000/GAIIx de novo Sequenzierung Metagenome Analysen Sequenzierung von PCR Produkten Analyse von Transkripten Sequenzierung von Zielregionen Identifizierung von Transkriptionsfaktoren Methylierungsanalysen Identifizierung von mirnas Expressionsanalysen Sequenzierung von Zielregionen Re-Sequenzierung von Genomen

6 Grundlagen Illumina Sequenzierung Probenvorbereitung Generierung von DNA Clustern Bindung von Einzelmolekülen auf einer festen Oberfläche Clusterbildung durch monoclonale Verfielfältigung

7 3 5 Sequenzierung durch Synthese Cycle 1: Zuführung der Nukleotide und Polymerase A T C A G T C T G C T A C G A Einbau der ersten Base Entfernen der nicht eingebauten Daten Signaldetektion Cycle 2-n: Erneute Zufuhr von Nukleotiden und Enzymen G T C A G T A C C C G A T C G A T 5

8 Umwandlung der Bilddaten in die DNA Sequenz Sequence Reads TCGGGAGTCCTAATGAGCCCGTAATCCCGTTAGTA TGAAGTCGGGAGTCCTAATGAGCCCGTAATCCCGTT CGAATGAAGTCGGGAGTCCTAATGAGCCCGTAATCC GAGCGAATGAAGTCGGGAGTCCTAATGAGCCCGTAA CGAGCGAATGAAGTCGGGAGTCCTAATGAGCCCGTA Referenzsequenz...CGAGCGAATGAAGTCGGGAGTCGTAATGAGCCCGTAATCCCGTTAGTA...

9 Fakten Illumina Sequenzierung (HiSeq 2000) Ausgangsmaterial: ~ 1-3 µg DNA Library Preparation: Cluster Generation: ~ 1 Tag ~ 1 Tag Laufzeit/ Single read ~ 2 Tage (36 b) Leselänge: Paired End ~ 10 Tage (2 x 100 b) Datenprozessierung: ~ 1 Tag Datenmenge: Paired End ~ 500 Gigabasen Anzahl der Sequenzen: bis zu 3200 Mio

10 Fakten 454 Sequenzierung Ausgangsmaterial: Probenvorbereitung: Emulsions PCR: Gerätelaufzeit: Datenprozessierung: Datenmenge: ~ 0.5 µg DNA ~ 4 Stunden ~ 1 Tag 20 Stunden ~ 10 Stunden Megabasen Anzahl der Sequenzen: Leselänge: Basen

11 454 Sequencing Instrument 2. Load PicoTiter plate into instrument 3. Load Reagents in a single rack 4. Sequencing 1. Genome is loaded into a PicoTiter plate

12 Ziele Erstellung einer öffentlichen Datenbank mit allen SNVs und CNVs mit einer Allelfrequenz von >1% in verschiedenen Populationen Entwicklung und Evaluierung von Methoden: Generierung von Daten durch verschiedene Next-Generation Sequencing Plattformen Austausch und Kombination von Daten und analytischen Methoden Identifizierung der genetischen Variation aus Nextgen Daten (Nature 2010, Science 2010 and Nature 2011)

13 Protein Tumor / Kontrollgewebe Mutations Methylation DNA mrna RNA mirna Sequenzierung Bioinformatik

14 Anreicherung von Zielregionen DNA Preparation Anreicherung Sequenzierung genomic DNA Hybridization Fragments ( bp) Selection with streptavidin beads Ligation of adapters A1 SP1 Amplification and Quantification A2

15 Sequenzierung in der Diagnostik IRON Study Interlaboratory Robustness of NGS

16 Sequenzierung in der Diagnostik IRON Study Interlaboratory Robustness of NGS

17 Sequenzierung in der Diagnostik IRON Studie Ergebnisse Insgesamt wurden 92 Varianten identifiziert Im Vergleich zu den Vergleichsdaten aus der Sanger Sequenzierung, konnten mit der verwendeten 454 Technologien alle bekannten Varianten von allen Teilnehmern der Ringstudie sicher bestimmt werden In dieser Multicenterstudie konnte gezeigt werden, daß Amplicon-basiertes NGS in der Diagnostik technisch machbar ist, eine hohe Concordance zwischen den verschiedenen Laboren erreichbar ist und so auch für die Charakterisierung von hämatologischen Malignomen geeignet ist. Kohlmann et al. (2011), Leukemia

18 Bestimmung von Varianten

19 Qualität der Mutationsdetektion Concordance mit Affymetrix Array "genome-wide human SNP array 6.0"

20 Sensitivität der Detektion von Mutationen Querings et al. (2011), PlosOne

21 Vergleichende Sequenzierung des menschlichen Genoms über 3,7 Millionen Unterschiede zum Referenzgenom Abweichungen in Abhängigkeit von der verwendeten Technologie. Lam et al. (2012), Nat Biotechnol

22 Vielen Dank für Ihr Interesse!

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory Sequenzierung Norbert Arnold Neue Sequenziertechnologien (seit 2005) Next Generation Sequenzierung (NGS, Erste Generation) Unterschiedliche Plattformen mit unterschiedlichen Strategien Roche 454 (basierend

Mehr

Erbgutanalyse mit wachsendem Automatisierungsgrad

Erbgutanalyse mit wachsendem Automatisierungsgrad Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/erbgutanalyse-mitwachsendem-automatisierungsgrad/ Erbgutanalyse mit wachsendem Automatisierungsgrad Mit einer eigens

Mehr

Center for Biotechnology, Bielefeld

Center for Biotechnology, Bielefeld Andreas Albersmeier CeBiTec Bielefeld 3. Life Science Conference Analytik Jena Jena 14.05.2014 Center for Biotechnology, Bielefeld sketchup.google.com Genomik Transkriptomik Proteomics Metabolomics Genom

Mehr

Hochdurchsatz HLA-Typisierung mit Next Generation Sequencing und Hamilton Robotics

Hochdurchsatz HLA-Typisierung mit Next Generation Sequencing und Hamilton Robotics Hochdurchsatz HLA-Typisierung mit Next Generation Sequencing und Hamilton Robotics Dr. med. Kaimo Hirv Zentrum für Humangenetik und Laboratoriumsmedizin Dr. Klein & Dr. Rost Lochhamer Str. 29 D-82152 Martinsried

Mehr

Einblicke in das menschliche Erbgut (Genom) am Computer

Einblicke in das menschliche Erbgut (Genom) am Computer Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Binger Nacht der Wissenschaft - 16.04.2010 Das menschliche Genom ist entschlüsselt

Mehr

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung FRAUNHOFER-INSTITUT FÜR GRENZFLÄCHEN- UND BIOVERFAHRENSTECHNIK IGB NEXT-GENERATION SEQUENCING Von der Probenvorbereitung bis zur bioinformatischen Auswertung »Progress in science depends on new techniques,

Mehr

Next Generation Sequencing für die Primärdiagnostik. Focus: Resistenztestung

Next Generation Sequencing für die Primärdiagnostik. Focus: Resistenztestung Next Generation Sequencing für die Primärdiagnostik Focus: Resistenztestung Stefan Niemann Molekulare Mykobakteriologie Forschungszentrum Borstel TTU-TB Deutsches Zentrum für Infektionsforschung Outline

Mehr

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1 I... I Abbildungs- und Tabellenverzeichnis... VI Abkürzungsverzeichnis... IX 1 Einleitung... 1 1.1 Untersuchte uro-rektale Fehlbildungen... 1 1.1.1 Blasenekstrophie-Epispadie-Komplex (BEEK)... 1 1.1.1.1

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien Branford, CT, USA, 29. Januar 2009 Forscher nutzen das 454 Sequencing System bei der Identifizierung Herpesähnlicher Viren in Zusammenhang mit Korallensterben Mit metagenomischen

Mehr

Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32

Mehr

Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94.

Basierend auf Publikation: Ahmadian A, Ehn M, Hober S. (2006): Pyrosequencing: history, biochemistry and future; Clin Chim Acta. 363(1-2):83-94. In diesem Skript wird der Versuch unternommen, der Prozess Pyrosequencing so zu erklären, dass Schüler die Chance haben Pyrosequencing zu verstehen. Es basiert auf einem Vortrag im Rahmen des Science Bridge

Mehr

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held ACT/CVS neueste gendiagnostische Verfahren 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held DNA, Gene, Chromosomen DNA besteht aus den Basenpaaren Adenin - Thymin

Mehr

Molekulare Diagnostik in der Dermato-Onkologie: Wie? Wann? Warum? Was? Und was kostet es?

Molekulare Diagnostik in der Dermato-Onkologie: Wie? Wann? Warum? Was? Und was kostet es? Molekulare Diagnostik in der Dermato-Onkologie: Wie? Wann? Warum? Was? Und was kostet es? Ralf Gutzmer Klinik für Dermatologie, Allergologie und Venerologie Haut- Tumor- Zentrum Hannover Wann+Warum? Wenn

Mehr

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Unter Next Generation Sequencing (NGS) werden verschiedene neue Technologien zusammengefasst, die nicht auf kapillar basierenden Sequenzierautomaten beruhen. Das 1990 ins Leben

Mehr

Leistungskatalog. Core Facilities. Juli 2014. Seite 1 von 6

Leistungskatalog. Core Facilities. Juli 2014. Seite 1 von 6 Leistungskatalog Core Facilities Juli 2014 Seite 1 von 6 Inhalt 1 Core Facilities... 3 1.1 Core Facility: Genomics für Globale Genanalysen... 3 1.1.1 Next Generation Sequencing - DNA... 3 1.1.2 Next Generation

Mehr

Individuelle Genomsequenzen Aussichten für die Tierzucht

Individuelle Genomsequenzen Aussichten für die Tierzucht Individuelle Genomsequenzen Aussichten für die Tierzucht Ruedi Fries WZW / Lehrstuhl für Tierzucht Agrarw. Symposium - 1 Auswirkungen der Genomischen Revolution auf die Tierzucht (und Pflanzenzucht) Agrarw.

Mehr

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14 Evolution II Molekulare Variabilität Bachelorkurs Evolutionsbiolgie II WS 2013/14 Molekulare Variabilität 1) rten der molekularen Variabilität und ihre Entstehung (rten der Mutation) 2) Wie kann man molekulare

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

Der neue cobas T BRAF V600 Mutation Test (CE-IVD) Was wäre, wenn Sie ihr die richtige Antwort früher geben könnten?

Der neue cobas T BRAF V600 Mutation Test (CE-IVD) Was wäre, wenn Sie ihr die richtige Antwort früher geben könnten? Der neue cobas T BRAF V600 Mutation Test (CE-IVD) Was wäre, wenn Sie ihr die richtige Antwort früher geben könnten? cobas T BRAF V600 Mutation Test Diagnostik für die personalisierte Hautkrebstherapie

Mehr

Next Generation Sequencing Vorder- und Rückseite des kompletten Genoms

Next Generation Sequencing Vorder- und Rückseite des kompletten Genoms Next Generation Sequencing Vorder- und Rückseite des kompletten Genoms Thomas Karn Klinik für Gynäkologie und Geburtshilfe J.W. Frankfurt Direktor Prof. S. Becker Whole Genome Sequencing Therapeutische

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 011 9. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (.000.000.000 Basenpaare)

Mehr

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats

Das humane Genom. Alle Genome sind individuell, selbst jene eineiiger Zwillinge! Molekulare Diagnostik. satellites and single repeats Das humane Genom satellites and single repeats protein coding & non-protein coding mobile (transposable) DNA elements Alle Genome sind individuell, selbst jene eineiiger Zwillinge! 1 Variationen im humanen

Mehr

DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet

Mehr

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07

Sequenzierung. Aufklärung der Primärstruktur von DNA. Biotechnik Kurs WS 2006/07 Sequenzierung Aufklärung der Primärstruktur von DNA Biotechnik Kurs WS 2006/07 AK Engels Angelika Keller Übersicht Geschichtlicher Hintergrund Maxam-Gilbert Sequenzierung Sanger Sequenzierung Neuere Sequenzierungstechnologien

Mehr

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Christian-Albrechts-Universität zu Kiel Next-Generation Sequencing (NGS) Nach Sanger Sequencing (1977) zweite Generation

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen

Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen Humangenom Größe 150 m 3.000.000.000 Nukleotide 3000 x 1000 x 1000 Bücher Seiten Buchstaben 1953 2003 Watson, J.D., and F.H.C.Crick.

Mehr

Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens

Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens Wolfgang Hulla KFJ-Sital / SMZ-Süd, Wien Grundlagen Historischer Ausgangspunkt Anwendungen und klinische Relevanz Methodik Auswertung

Mehr

Der neue cobas T KRAS Mutation Test (CE-IVD) Hinter jedem Ergebnis steht ein Patient, der darauf vertraut

Der neue cobas T KRAS Mutation Test (CE-IVD) Hinter jedem Ergebnis steht ein Patient, der darauf vertraut Der neue cobas T KRAS Mutation Test (CE-IVD) Hinter jedem Ergebnis steht ein Patient, der darauf vertraut cobas T KRAS Mutation Test (CE-IVD) Diagnostik für die personalisierte Darmkrebstherapie Unkontrollierte

Mehr

Nicht invasive Chromosomendiagnostik aus maternalem Blut: Möglichkeiten und Grenzen

Nicht invasive Chromosomendiagnostik aus maternalem Blut: Möglichkeiten und Grenzen Nicht invasive Chromosomendiagnostik aus maternalem Blut: Möglichkeiten und Grenzen PD Dr. rer. nat. Markus Stumm Zentrum für Pränataldiagnostik und Humangenetik Kudamm-199 stumm@kudamm-199.de Nicht invasive

Mehr

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien III. Interdisziplinärer Kongress JUNGE NATURWISSENSCHAFT

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 26.06.2015 bis 25.03.2017 Ausstellungsdatum: 26.06.2015 Urkundeninhaber:

Mehr

Algorithmische Bioinformatik

Algorithmische Bioinformatik Algorithmische Bioinformatik Biologische Daten als Strings Ulf Leser Wissensmanagement in der Bioinformatik Ziele für heute Wert von Reduktionismus: Genome als Strings Reinschmecken in Stringmatching Erster

Mehr

Mit Rekordgeschwindigkeit zum menschlichen Genom

Mit Rekordgeschwindigkeit zum menschlichen Genom Mit Rekordgeschwindigkeit zum menschlichen Genom Timo Bäroth, Sonja Wendenburg Im Jahre 2141 Erschöpft und mit pochendem Schmerz im Unterleib sitzt Ute Klopfer vor Dr. med. Hennings. Die Diagnose: Krebs.

Mehr

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Prof. Dr. med. Brigitte Schlegelberger 670513011/15 Olaparib Zulassung in Europa: Rezidiv eines Platin-sensitiven Ovarialkarzinoms

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Einblicke in das menschliche Genom aus Sicht der Bioinformatik Prof. Dr. Antje Krause FH Bingen a.krause@fh-bingen.de Kurzer Ausflug in die Genetik DNA (Desoxyribonukleinsäure)

Mehr

Anlage zur Akkreditierungsurkunde D PL 13372 01 00

Anlage zur Akkreditierungsurkunde D PL 13372 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13372 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 22.05.2014 bis 25.03.2017 Ausstellungsdatum: 22.05.2014 Urkundeninhaber:

Mehr

Der neue cobas T EGFR Mutation Test (CE-IVD) Weil jeder Tag zählt das richtige Ergebnis früher

Der neue cobas T EGFR Mutation Test (CE-IVD) Weil jeder Tag zählt das richtige Ergebnis früher Der neue cobas T EGFR Mutation Test (CE-IVD) Weil jeder Tag zählt das richtige Ergebnis früher cobas T EGFR Mutation Test Diagnostik für die personalisierte Therapie beim NSCLC Unkontrollierte Zellproliferation

Mehr

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

Blitzschnell in die Tiefe

Blitzschnell in die Tiefe Active Motif La Hulpe, Belgien www.activemotif.com Matthias Lehne Tel. +49 176 7074 1430 lehne@activemotif.com Amsbio www.amsbio.com Tel. +49 69 779099 info@amsbio.com BioCat Heidelberg www.biocat.com

Mehr

Was ist ein genetischer Fingerabdruck?

Was ist ein genetischer Fingerabdruck? Was ist ein genetischer Fingerabdruck? Genetischer Fingerabdruck od. DNA-Fingerprint ist ein molekularbiologisches Verfahren zur individuellen Identifizierung von Lebewesen Der genetische Fingerabdruck

Mehr

Methodik der Genomsequenzierung

Methodik der Genomsequenzierung WS2015/2016 Genomforschung und Sequenzanalyse - Einführung in Methoden der Bioinformatik- Thomas Hankeln Methodik der Genomsequenzierung Meilensteine Phi X 174 1977 5.386 bp λ Phage 1982 48.502 bp M. genitalium

Mehr

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Assoc. Prof. PD Mag. Dr. Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Wien, 2013 Währinger Straße 10, A-1090 Wien helmut.dolznig@meduniwien.ac.at www.meduniwien.ac.at/medizinische-genetik

Mehr

Pathologie und Prädiktion - neue Aspekte. Prof. Dr. med. C. Wickenhauser Institut für Pathologie

Pathologie und Prädiktion - neue Aspekte. Prof. Dr. med. C. Wickenhauser Institut für Pathologie Pathologie und Prädiktion - neue Aspekte Paradigmenwechsel in der Pathologie -Pathologe zentraler Lotse bei der individuellen Therapieentscheidung -Gewebeuntersuchung nicht nur aus diagnostischen sondern

Mehr

Zukünftige Entwicklungen und Anwendungen der genomischen Selektion (GS)

Zukünftige Entwicklungen und Anwendungen der genomischen Selektion (GS) SV agung vom 29. März 2012, Universität Irchel, Zürich Zukünftige Entwicklungen und nwendungen der genomischen Selektion (GS) Ruedi Fries und Hubert Pausch Lehrstuhl für ierzucht echnische Universität

Mehr

QTL$MAPPING$OF$IMPORTANT$AGRICULTURAL$AND$LIFE$HISTORY$TRAITS$ IN$THE$PLANT$PATHOGENIC$FUNGUS!ZYMOSEPTORIA!TRITICI$ $

QTL$MAPPING$OF$IMPORTANT$AGRICULTURAL$AND$LIFE$HISTORY$TRAITS$ IN$THE$PLANT$PATHOGENIC$FUNGUS!ZYMOSEPTORIA!TRITICI$ $ DISS.ETHNO.22827 QTLMAPPINGOFIMPORTANTAGRICULTURALANDLIFEHISTORYTRAITS INTHEPLANTPATHOGENICFUNGUS!ZYMOSEPTORIA!TRITICI Athesissubmittedtoattainthedegreeof DOCTOROFSCIENCESofETHZURICH (Dr.sc.ETHZurich)

Mehr

Inhaltsverzeichnis... I. Ein Vorwort... VII. Synopse der Arbeit... IX. Synopsis of the thesis... XIII

Inhaltsverzeichnis... I. Ein Vorwort... VII. Synopse der Arbeit... IX. Synopsis of the thesis... XIII I INHALTSVERZEICHNIS Inhaltsverzeichnis... I Ein Vorwort... VII Synopse der Arbeit... IX Synopsis of the thesis... XIII A. Untersuchungen über die Stereoselektivität bakterieller, Pyruvat-abhängiger Aldolasen...

Mehr

Applied Bioinformatics. maria.fischer@i-med.ac.at http://icbi.at/courses/bioinformatics_ex

Applied Bioinformatics. maria.fischer@i-med.ac.at http://icbi.at/courses/bioinformatics_ex Applied Bioinformatics SS 2013 maria.fischer@i-med.ac.at http://icbi.at/courses/bioinformatics_ex Organisatorisches Termine Mo 18.03.2013 RR19 9:00 Di 19.03.2013 RR19 9:00 Mi 20.03.2013 RR19 9:00 Übungsziele

Mehr

Leibniz-Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute Jena, Germany

Leibniz-Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute Jena, Germany Leibniz-Institute for Natural Product Research and Infection Biology Hans-Knoell-Institute Jena, Germany R. Guthke: Zur Bedeutung der Bioinformatik im Kontext der -omics -Technologien Gliederung 1. -omics

Mehr

PCR basierte- Detektionstechniken

PCR basierte- Detektionstechniken PCR basierte- Detektionstechniken Warum überhaupt? Forensische Analysen: Vaterschaftstests, Kriminalistik Mikrobielle Gemeinschaften: Biofilme, medizinische Mikrobiologie 2 Warum überhaupt? minimale Mengen

Mehr

Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: "Hip or Hype"

Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: Hip or Hype Liquid Biopsy-Diagnostik von zellfreier DNA und zirkulierenden Tumorzellen: "Hip or Hype" 3. Nationales Biobankensymposium 2014 Berlin, 04.12.2014 Prof. Dr. rer. nat Edgar Dahl RWTH zentralisierte Biomaterialbank

Mehr

G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010

G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Institut für f r Biochemische Verfahren und Analysen (IBVA) Genomik?! Tobias Schäfer Institut für f r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Inhalt Methoden der Gensequenzierung Nutzen genetischer

Mehr

Inhalt 1 Modellorganismen

Inhalt 1 Modellorganismen Inhalt 1 Modellorganismen....................................... 1 1.1 Escherichia coli....................................... 1 1.1.1 Historisches...................................... 3 1.1.2 Lebenszyklus.....................................

Mehr

Next Generation Sequencing. Mit Roche auf dem Weg in die Diagnostik

Next Generation Sequencing. Mit Roche auf dem Weg in die Diagnostik Next Generation Sequencing Mit Roche auf dem Weg in die Diagnostik Leonardo Royal Hotel München 22. 23.5.2012 22. Mai 2012 Programm Bis 12.00 Uhr Individuelle Anreise der Teilnehmer 12.00 13.00 Uhr Mittagsimbiss

Mehr

BMBF Verbundübergreifendes Projekt

BMBF Verbundübergreifendes Projekt BMBF Verbundübergreifendes Projekt Phylogenie, Bioinformatik und Amplikon Re- Sequenzierung von Zoonose-Erregern (PBA-Zoo) Dag Harmsen University of Münster, Germany BMBF PBA-Zoo Querschnittsaktivität

Mehr

Genexpressionsregulation

Genexpressionsregulation Genexpressionsregulation Genexpressionsregulation Different tissue types 1 2 3 4 5 6 7 8 Taken from Caron et al., 2001 Verschiedene Ebenen der Genexpressionsregulation Epigenetic mechanisms Transkriptionskontrolle

Mehr

Genomische Selektion in der Pflanzenzüchtung

Genomische Selektion in der Pflanzenzüchtung Genomische Selektion in der Pflanzenzüchtung Chris-CarolinCarolin Schön 30. März 2012 Hybridzüchtung Population 1 Population 2 Kreuzungen 10.000000 Linieni Prüfung 1 Umwelt Kreuzungen 10.000000 Linen 2.000

Mehr

cobas T HSV 1/2 Test Erweiterung Ihres STI Menüs mit Dual-Target Detektion für zuverlässige Befunde

cobas T HSV 1/2 Test Erweiterung Ihres STI Menüs mit Dual-Target Detektion für zuverlässige Befunde cobas T HSV 1/2 Test Erweiterung Ihres STI Menüs mit Dual-Target Detektion für zuverlässige Befunde Zuverlässige HSV 1/2 Ergebnisse, zukunftssicher Herpes simplex Viren zählen zu den am häufigsten sexuell

Mehr

Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen

Mehr

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN

II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN II. GENOMIK: GLEICHZEITIGE UNTERSUCHUNG VON MEHREREN MAKROMOLEKÜLEN Strukturelle Genomik Genomische Bibliothek, EST Datenbank DNA-Sequenzierung Genomprogramme Polymorphismen RFLP Herstellung einer DNA-Bibliothek

Mehr

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl. Molekulare Mechanismen der Signaltransduktion 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.com/modul-mms bisheriges Modell auxin auxin AXR1 auxin response AXR1 potentieller

Mehr

Molekulares Profiling/Individualisierung - Konsequenzen für Standards, Studien und Therapien der Zukunft -

Molekulares Profiling/Individualisierung - Konsequenzen für Standards, Studien und Therapien der Zukunft - PATHOLOGIE LEIPZIG Pathologie Bochum Molekulares Profiling/Individualisierung - Konsequenzen für Standards, Studien und Therapien der Zukunft - Andrea Tannapfel Institut für Pathologie Ruhr-Universität

Mehr

FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom

FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom HAMBURG SCHOOL OF FOOD SCIENCE Institut für Lebensmittelchemie Universität Hamburg, AiF/

Mehr

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese

Mehr

Transcriptomics: Analysis of Microarrays

Transcriptomics: Analysis of Microarrays Transcriptomics: Analysis of Microarrays Dion Whitehead dion@uni-muenster.de Division of Bioinformatics, Westfälische Wilhelms Universität Münster Microarrays Vorlesungsüberblick : 1. Überblick von Microarray

Mehr

ASSEMBLY ALGORITHMS FOR NEXT-GENERATION SEQUENCING DATA

ASSEMBLY ALGORITHMS FOR NEXT-GENERATION SEQUENCING DATA ASSEMBLY ALGORITHMS FOR NEXT-GENERATION SEQUENCING DATA Jason R. Miller*, Sergey Koren, Granger Sutton Ein Vortrag von Sergej Tschernyschkow Friedrich-Schiller-Universität Jena 03. Mai 2010 SERGEJ TSCHERNYSCHKOW

Mehr

Platzhalter für Bild

Platzhalter für Bild Instrumentelle Bioanalytik in der Molekularbiologie Anke Neumann Platzhalter für Bild KIT die Kooperation von Forschungszentrum Karlsruhe GmbH und Universität Karlsruhe (TH) www.kit.edu Motivation und

Mehr

Abkürzungsverzeichnis. 1. Einleitung 1. 2. Material und Methoden 8

Abkürzungsverzeichnis. 1. Einleitung 1. 2. Material und Methoden 8 Inhaltsverzeichnis I Abkürzungsverzeichnis VI 1. Einleitung 1 1.1 Stabilisierung von Makromolekülen 1 1.2 Natürliche Umgebungen von Proteinen 4 1.3 Künstliche Umgebungen von Proteinen 5 1.4 Ziel der vorliegenden

Mehr

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen Fotos: M. Rindlisbacher Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen H. Hasler 1, F. Berruex 3, B. Haase 2, C. Flury 1, T. Leeb 2, V. Gerber 4, H. Simianer 5, D. Burger 3, P.A. Poncet

Mehr

Read Mapping Projektmanagement im So3warebereich SeqAn

Read Mapping Projektmanagement im So3warebereich SeqAn Read Mapping Projektmanagement im So3warebereich SeqAn David Weese April 2010 Inhalt Einführung Reads erzeugen read simulator SWP Teilprojekte Projektplan EINFÜHRUNG 2 nd /Next GeneraGon Sequencing Technologien:

Mehr

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht

Mehr

1. PCR Polymerase-Kettenreaktion

1. PCR Polymerase-Kettenreaktion entechnische Verfahren 1. PCR Polymerase-Kettenreaktion Die PCR (engl. Polymerase Chain Reaction) ist eine Methode, um die DNA zu vervielfältigen, ohne einen lebenden Organismus, wie z.b. Escherichia coli

Mehr

Next Generation Gene Sequencing bei Brustkrebs

Next Generation Gene Sequencing bei Brustkrebs Institut für Medizinische Genetik Next Generation Gene Sequencing bei Brustkrebs Prof. Dr. med. Anita Rauch 08.10.2015 Seite 1 Benefit der Krebsfrüherkennung Antilla et al. 2014 08.10.2015 Anita Rauch

Mehr

DNA-Sequenzierung. Martina Krause

DNA-Sequenzierung. Martina Krause DNA-Sequenzierung Martina Krause Inhalt Methoden der DNA-Sequenzierung Methode nach Maxam - Gilbert Methode nach Sanger Einleitung Seit 1977 stehen zwei schnell arbeitende Möglichkeiten der Sequenzanalyse

Mehr

HIV-1 NAT-Testversager durch Mutationen

HIV-1 NAT-Testversager durch Mutationen HIV-1 NAT-Testversager durch Mutationen Dr. B. Müller, NAT-Labor, Hagen Aktueller Fall in Österreich vom 28.02.2013 Diagnostische Fensterspende Folie 2 Überblick Prävalenz bei Neuspendern100.000 Untersuchungen:

Mehr

Nationales Centrum für Tumor Erkrankungen. Genom Aktivitäten

Nationales Centrum für Tumor Erkrankungen. Genom Aktivitäten 2.5 µm Nationales Centrum für Tumor Erkrankungen Genom Aktivitäten Grundlegende Ebenen funktioneller Analysen DNA RNA Protein Methylation Transcription Expression Structure Localisation Splicing Organisation

Mehr

Interdisziplinarität als Erfolgsfaktor Dr. Dirk Biskup

Interdisziplinarität als Erfolgsfaktor Dr. Dirk Biskup Interdisziplinarität als Erfolgsfaktor Dr. Dirk Biskup Agenda CeGaT GmbH Gründer Geschäftsmodell Entwicklung Science2Business 2 Saskia Biskup Geb. Frankfurt 1971 MD, Universität Würzburg 1999 MD PhD -

Mehr

Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren

Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren Institut für Medizinische Genetik Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren Prof. Dr. med. Anita Rauch Seite 1 Häufigkeit von Intelligenzminderung (ID) IQ

Mehr

Zusätzliche Behandlungs möglichkeiten für Ihre Patienten

Zusätzliche Behandlungs möglichkeiten für Ihre Patienten Zusätzliche Behandlungs möglichkeiten für Ihre Patienten Über FoundationOne Bei dem validierten umfassenden Tumorprofil von FoundationOne wird die gesamte codierende Sequenz von 315 krebsassoziierten Genen

Mehr

Genomik und Bioinformatik für komplexe Krankheiten

Genomik und Bioinformatik für komplexe Krankheiten Genomik und Bioinformatik für komplexe Krankheiten Univ.-Prof. DI Dr. Zlatko Trajanoski Institut für Elektro- und Biomedizinische Technik und Christian-Doppler-Labor für Genomik und Bioinformatik Technische

Mehr

Bioinformatik an der FH Bingen

Bioinformatik an der FH Bingen Bioinformatik an der FH Bingen Prof. Dr. Antje Krause 05.11.2010 Wie alles begann... 1955 erste Proteinsequenz (nach 12 Jahren Arbeit) veröffentlicht (Insulin vom Rind) Frederick Sanger MALWTRLRPLLALLALWPPPPA

Mehr

ANDROLOGY LETTER. Christian Sigg. DNA Methylation und idiopathische Infertilität des Mannes

ANDROLOGY LETTER. Christian Sigg. DNA Methylation und idiopathische Infertilität des Mannes ANDROLOGY LETTER Christian Sigg DNA Methylation und idiopathische Infertilität des Mannes Die Epigenetik revolutioniert die andrologische Diagnostik Allein schon die Tatsache, dass bis zu 15% aller Paare

Mehr

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik Ruprecht Kuner Abteilung Molekulare Genomanalyse DKFZ Heidelberg Vortragsübersicht Folie 1 1. Was ist ein Biochip / Microarray?

Mehr

Identifizierung von CNVs (copy number variations) Antje Krause TFH Wildau akrause@tfh-wildau.de

Identifizierung von CNVs (copy number variations) Antje Krause TFH Wildau akrause@tfh-wildau.de Identifizierung von CNVs (copy number variations) Antje Krause TFH Wildau akrause@tfh-wildau.de http://www.eva.mpg.de/genetics/images/chimp_human.jpg Sequenzierung des menschlichen Genoms (2001) Vergleiche

Mehr

Erkennung von Protein-kodierenden Genen/Genstruktur

Erkennung von Protein-kodierenden Genen/Genstruktur Erkennung von Protein-kodierenden Genen/Genstruktur Prokaryonten: Konsekutiv (keine Introns- Exons), Suche nach langen ORFs, Operons, Codon-Präferenzen Eurkaryonten: Intron-Exon Struktur Using slides and

Mehr

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik

BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik BioChip-Microarrays: Grundlagenforschung und Chancen für die Krankheitsdiagnostik Ruprecht Kuner Abteilung Molekulare Genomanalyse DKFZ Heidelberg Vortragsübersicht Folie 1 1. Was ist ein Biochip? 2. Zielmoleküle

Mehr

Molekulare Diagnostik Hans Nitschko

Molekulare Diagnostik Hans Nitschko Molekulare Diagnostik Hans Nitschko Nachweis viraler Erreger durch molekularbiologische Methoden Antikörpernachweise Nachweis antigenspezifischer T-Zellen Neutralisationsteste Nachweis Therapie-resistenter

Mehr

Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.

Mehr

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Algorithmische

Mehr

Molekularbiologische Datenbanken

Molekularbiologische Datenbanken Molekularbiologische Datenbanken ESTs und cdnas Microarrays Ulf Leser Wissensmanagement in der Bioinformatik Sequenzierung Methode nach Sanger Verarbeitungsschritte Base Calling Assembly Finishing Ulf

Mehr

Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst

Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst Was sagen uns genetische Marker über gebietsheimische Wildobstarten? Genetische Charakterisierung von Wildobst Überblick Einleitung und Zielstellung Was ist ein Marker? Analyse mit Mikrosatelliten-Markern

Mehr

Personalisierte Medizin: Genetische Analyse zirkulierender Tumorzellen mittels eines mikrofluidischen Chipsystems

Personalisierte Medizin: Genetische Analyse zirkulierender Tumorzellen mittels eines mikrofluidischen Chipsystems 16. Heiligenstädter Kolloquium, IBA Heilbad Heiligenstadt, 2012-09-25 Personalisierte Medizin: Genetische Analyse zirkulierender Tumorzellen mittels eines mikrofluidischen Chipsystems Christine Steinbach

Mehr

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Bioinformatik

Mehr

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Zellzyklus- und neuronale Gene in Trichoplax adhaerens S. Sagasser Praktikanten: Patrick Reinke und Jan Kleveman Betreuerin: Karolin von der Chevallerie

Mehr

Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus

Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus Real time RT-PCR Verfahren zur Detektion, Quantifizierung und Genotypisierung von Hepatitis-C-Virus Seminar Molekulare Diagnostik 2011 30. November 2011, Wien AnDiaTec Kernkompetenz Entwicklung und Produktion

Mehr

Molekulare Mechanismen der Signaltransduktion

Molekulare Mechanismen der Signaltransduktion Molekulare Mechanismen der Signaltransduktion 07 - Identifizierung von ARF1 + Hinweise für Vorträge Folien: http://tinyurl.com/modul-mms http://www.pnas.org/content/111/14/5427/f1.large.jpg neues Modell

Mehr

Zentronukleäre Myopathien von der Diagnose zur Therapie

Zentronukleäre Myopathien von der Diagnose zur Therapie MTM Familientreffen Göttingen, 5./6. Juni 2014 Zentronukleäre Myopathien von der Diagnose zur Therapie Dr. Johann Böhm IGBMC, Strasbourg Ein paar Worte über Strasbourg.and über das IGBMC Ein paar Worte

Mehr