Genregulation in Bakterien. Das LAC Operon

Save this PDF as:

Größe: px
Ab Seite anzeigen:

Download "Genregulation in Bakterien. Das LAC Operon"


1 Genregulation in Bakterien Das LAC Operon

2 Der Fluss der genetischen Information Transkription Translation DNA mrna Protein Replikation (Reverse Transkription) Modifikation DNA Funktionelles Protein Horizontaler Gentransfer DNA

3 Struktur des Lac-Operons

4 Lactose Monosaccharides Glucose and Galactose Glucose Galactose Disaccharide Lactose consists of Galactose and Glucose Lactose

5 Lactose ist gleichzeitig Substrat und Induktor... substrate inductor

6 Diauxie: Wachstum von E.coli in Glucose/Sorbit 1:3 2:2 3:1 Monod 1942

7 System-Mutanten im Lac-Operon PlacI laci CAP-Bdg Plac O 1 Z Promotor laci Lac Repressor Lac Promotor Operator: Bindungsregion für LacI ß-Galaktosidase laciq erhöhte Produktion von LacI lacikonstitutive ß- Galaktosidase keine Synthese von funktionellem Repressor lacpl8 verminderte Bdg von CAP: Promotorstärke auf 1/50 reduziert lacuv5 verbesserte Promotorstärke durch zwei Austausche in -10 Region lacoc laci kann an veränderte Operatorregion nicht binden lacz- keine funktionelle ß-Galaktosidase laci s auch in Anwesen heit vom Induktor:keine ß-Gal "Superrepressor" - permanente Bdg an Operator

8 Synthesis of ß-Gal and Transacetylase genotype ß-Gal noninduced ß-Gal induced Transacetylase induced Transacetylase noninduced O+Z+Y+ < <1 100 OcZ+Y O+Z+Y F OcZ+Y+ O+Z-Y <1 220 F OcZ+Y- Monod,F.Jacob, F. 1961, J.Mol. Biol.3,

9 ß-Gal-Bildung in heterozygoten E.coli-Stämmen I- O+ Z+ Y I+ O+ Z- Y+ I- O+ Z+ Y+ I+ O+ Z- Y+ Y Y Z Z Z I I I Y Y F Y Z Y I Y Y - Lactose : keine ß Gal + Lactose: ß Gal aktiv Z+ ist dominant über Z- I+ ist dominant über I-

10 Das Operon Modell von Jacob und Monod 1961 Monod,F.Jacob, F. 1961, J.Mol. Biol.3,

11 Isolierung der Lac-Operatorregion Operatorregion / LacI Bindungsregion: Dyadische Symmetrie erlaubt Bindung des lac-repressors als Dimer Gilbert & Maxam, 1973; N. Maizels, 1973 Strategie: 1. Spezialtransduzierende Phagen-DNA λ dlac wird in ca bp Fragmente "zerlegt" 2. Mix DNA + Lac-Repressor und Bindung der DNA- Fragmente an Nitrocellulose 3. Verdau mit Pankreas-DNAse 4. Isolierung eines geschützten 28 bp Fragmentes 5 - TGTGTGGAATTGTGAGCGGATAACAATTTCACACA ACACACCTTAACACTCGC CTATTGTTAAAGTGTGT Sequenzbestimmung

12 lac-promotorstruktur llregion camp-cap footprint LacI footprint RNAP footprint mrna STOP laci ATG lacz O cmutationen AGGCTTTACAC TATGTTGT AATTGTGAGCGGATAACAAT A A AA A T GTTA C T

13 HTH Bindung an DNA

14 Molekulare Struktur des Lac-Repressors (Dimer) Headpiece:1-49 with HTH motif binds to the major groove of the operator Hinge helix, binds to the center of operator in the minor groove Core domain, consists of two subdomains: NH2l, CO Effector IPTG binds to a pocket n their junction Helical Tetramerization domain

15 Unterschiedliche Konformationen des Lac-Repressors Different structure of NH2 terminal subdomain if repressor is bound to operator (red) and to IPTG (blue)

16 Interaction of the Lac Repressor with operator and inducer Inducer binding pocket. Residues contacting ONPF are shown Interaction between the hinge helices of the repressor (blue and brown) and the minor groove of the operator (green and yellow)

17 Mapping of mutations in laci by J. Miller, laci- missense mutations were mapped by selection of I+ recombinants. I - constitutive, I ts heat sensitive, I s noninducible

18 CAP acts as positive regulator Kooperative Bindung von CAP und Polymerase an RNA

19 CAP Bindungsprotein Positiver Regulator des C-Katabolisms 1982: Klonierung und Sequenzierung von CAP (209 AS) Dimer: jedes Monomer hat eine DNA-Bindungsstelle (nur in Gegenwart von c-amp) Consensus-DNA-Bindungssequenz (CAP-Bindungsstelle): 5 CGAAAAGTGTGACAT ATGTCACACTTTTCG GCTTTTCACACTGTA TACAGTGTGAAAAGC 5 Positiver Regulator durch DNA "bending" Abhängigkeit von camp-konzentration: Niedrige Glukosekonz. Glucose PTS:Enzym IIGlu PTS:Enzym IIGlu-P Adenylatcyclase inaktiv Adenylatcyclase aktiv ATP -> camp

20 Das CAP Protein kann in verschiedenen Bereichen des Promotors binden Start mrna gal lac ara Promoter

21 Die drei Stadien der lac Gene basal Positive control active Negative control off

22 LAC-Promotor Kontrolle LacI ß-Gal Permeas e Transacetylase RNA laci lac DNA O3 O1 O2 CAP O1 O2 CAP LacI O3 + Glucose - Lactose CAP CAP O1 RNAP - Glucose + Lactose O3 O2 LacI - Glucose - Lactose

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition


Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon


Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt 5 mrna Nukleotid 3 N-Terminus Protein C-Terminus Aminosäure Es besteht


Genstruktur und Genregulation bei Pro- und Eukaryoten (Pt.2)

Genstruktur und Genregulation bei Pro- und Eukaryoten (Pt.2) WS 2015/16 Grundvorlesung Allgemeine und Molekulare Genetik Genstruktur und Genregulation bei Pro- und Eukaryoten (Pt.2) Kap. 33, 36 Thomas Hankeln Institut für Molekulargenetik Was?


Eukaryontische DNA-Bindedomänen

Eukaryontische DNA-Bindedomänen 1. Viele eukaryotische (und auch prokaryotische) Transkriptionsfaktoren besitzen eine DNA-bindende Domäne, die an eine ganz bestimmte DNA- Sequenz binden kann. Aufgrund von Ähnlichkeiten in der Struktur


Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli Reinigung Protein (1) Plasmidpräparation


H.Schwab Genetik. Überblick

H.Schwab Genetik. Überblick Überblick Einleitung: Historisches Klassische - Mendel DNA, Aufbau, übergeordnete Strukturen, Konfigurationen, zelluläre Organisation Chromatin, Chromosomenaufbau, Genome Extrachromosomale Elemente, mobile


1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3

1. Nachschreibeklausur zur Vorlesung Genetik im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3 1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A Modul: Studiengang: Matrikel-Nr.: Versuch: 1 2 3 Vollständiger Name in Druckbuchstaben (Vorname Nachname): Jena, 01.04.2010, 10 12 Uhr; Unterschrift:



05_10_Genes_info.jpg Übertragung der Information von DNA auf RNA - Transkription von RNA auf Protein - Translation Übertragung der Information vom Gen auf Protein 05_10_Genes_info.jpg 1 Figure 6-2 Molecular Biology of the


7. Regulation der Genexpression

7. Regulation der Genexpression 7. Regulation der Genexpression 7.1 Regulation der Enzymaktivität Stoffwechselreaktionen können durch Kontrolle der Aktivität der Enzyme, die diese Reaktionen katalysieren, reguliert werden Feedback-Hemmung


Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:

Frage 1 A: Wieviele Codone des Universellen genetisches Codes kodieren: Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren: Aminosäuren Translationsstart Translationsstop? B: Welche biochemische Reaktion wird von Aminoazyl-tRNA-Synthetasen katalysiert?



Genexpressionsregulation Genexpressionsregulation Genexpressionsregulation Different tissue types 1 2 3 4 5 6 7 8 Taken from Caron et al., 2001 Verschiedene Ebenen der Genexpressionsregulation Epigenetic mechanisms Transkriptionskontrolle


RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase


Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin


Stochastische Genexpression

Stochastische Genexpression Stochastische Genexpression Genetische Schalter und Multistabilität Vorlesung System-Biophysik 12. Dez. 2008 Literatur Kaern et al. Nature Reviews Genetics Vol.6 p.451 (2005) Ozbudak, Oudenaarden et al


Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005

Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005 Optimality and evolutionary tuning of the expression level of a protein Erez Dekel & Uri Alon Nature Vol 436, July 2005 Wie Zellen Denken Übersicht Hintergrund Mathematische Formulierung (cost-benefit-theory)


DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die


Molekulare Mechanismen der Signaltransduktion

Molekulare Mechanismen der Signaltransduktion Molekulare Mechanismen der Signaltransduktion 07 - Identifizierung von ARF1 + Hinweise für Vorträge Folien: neues Modell


RNA-Regulationsmechanismen: RNA Interferenz

RNA-Regulationsmechanismen: RNA Interferenz RNA-Regulationsmechanismen: RNA Interferenz Vorlesung System-Biophysik 19. Dez. 2008 Literatur Martens: BIOspektrum 4/02 8. Jahrgang M. Kuhlmann: Biol. Unserer Zeit Nr.3 (2004), S. 142. Genregulation durch


Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine


Weitere genetische Schalter. Gen-Regulation mit Feedback produziert einen Schalter

Weitere genetische Schalter. Gen-Regulation mit Feedback produziert einen Schalter Weitere genetische Schalter Gen-Regulation mit Feedback produziert einen Schalter Robuste vs. ultrasensitive Schalter Einfaches Netzwerk mit positiver Rückkopplung Ohne Hysterese: Ultrasensitiver Schalter,


Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2


Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)


Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Assoc. Prof. PD Mag. Dr. Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Wien, 2013 Währinger Straße 10, A-1090 Wien


Grundlegende Experimente der Molekulargenetik

Grundlegende Experimente der Molekulargenetik Übung 12 Wiederholung/Zusatzübung Inhalte: Mendelscher Erbgang Grundlegende Experimente der Molekulargenetik Transposons Methoden 1. Sie haben drei runde, gelbe Erbsen (A, B und C). Aus jeder der drei


Kapitel 8 Ò Chromosomen und Genregulation

Kapitel 8 Ò Chromosomen und Genregulation Kapitel 8 Ò Chromosomen und Genregulation 8.1 Struktur eukaryontischer Chromosomen Ein menschlicher Zellkern ist nur zehn Mikrometer gross und (10-9 ) hat zwei Meter DNA drin. Damit es da kein Durcheinander


Technologisches Arsenal der Molekularbiologie

Technologisches Arsenal der Molekularbiologie Technologisches Arsenal der Molekularbiologie Die zwei Sinne der Molekularbiologie 2. Ein technologisches System 1. Untersuchung der Lebensvorgänge zwischen den Ebenen der DNA und der Zelle Individuumebene


VII. Inhalt. Vorwort...

VII. Inhalt. Vorwort... VII Vorwort... V 1 Physikalische und chemische Grundlagen... 1 1.1 Reaktionskinetik... 1 1.2 Reaktionsgeschwindigkeit... 1 1.3 Reaktionsordnung... 2 1.4 Energie... 3 1.4.1 Reaktionsenergie... 3 1.4.2 Enthalpie......


Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen Aus der Reihe Daniels Genetik-Kompendium Erstellt von Daniel Röthgens Inhalt 1. Einleitung 2. RNA-Viren 3. DNA-Viren 1. Einleitung Im folgenden werden einige für die Genetik bedeutungsvolle Viren vorgestellt.


Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat


L2 DNA & RNA-Protein Interaktionen Protein-DNA and -RNA interactions

L2 DNA & RNA-Protein Interaktionen Protein-DNA and -RNA interactions L2 DNA & RNA-Protein Interaktionen Protein-DNA and -RNA interactions 1. Eukaryotische Chromosomenstruktur: chromosome structure 2. Histone und Nucleosomenstruktur Histones and nucleosome 3. Regulatorische


Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und


Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können


Protein Expression. Expression, homolog oder heterolog?

Protein Expression. Expression, homolog oder heterolog? Protein Expression Expression, homolog oder heterolog? Heterologe Expression in anderem Host Kompartment Codon usage Posttranslationale Modifikationen Kofaktoren Chaperone 1 promoter Expressionssystem


Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse


Genregulation bei Eukaryoten II

Genregulation bei Eukaryoten II Genregulation bei Eukaryoten II Aktivierung und Repression der Transkription erfolgen durch Protein-Protein-Wechselwirkungen Protein-Protein-Wechselwirkungen spielen bei der Genregulation der Eukaryoten


Übertragung der in der DNA gespeicherten Information

Übertragung der in der DNA gespeicherten Information Übertragung der in der DNA gespeicherten Information von DNA auf RNA - Transkription von RNA auf Protein - Translation Übertragung der Information vom Gen auf Protein 05_10_Genes_info.jpg 1 Figure 6-2


Genregulation bei Eukaryoten

Genregulation bei Eukaryoten Genregulation bei Eukaryoten 1. Allgemeines über Genregulation 2. Aufbau der DNA 3. Enhancer 4. Aktivierung und Repression 5. System, das Östrogene wahrnimmt und auf sie anspricht - DNA- Bindungsdomäne


Regulation der Genexpression. Überwiegend Prokaryonten

Regulation der Genexpression. Überwiegend Prokaryonten Regulation der Genexpression Überwiegend Prokaryonten Dezember 2009 Elmar Schiebel Was versteht man unter Regulation der Genexpression? Was versteht man unter Regulation der Genexpression? Jeder Organismus


Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl. Molekulare Mechanismen der Signaltransduktion 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: bisheriges Modell auxin auxin AXR1 auxin response AXR1 potentieller


Die Regulation der Transkription ist eine Schnittstelle zwischen Zellwachstum und HIV-stimulierter Genexpression

Die Regulation der Transkription ist eine Schnittstelle zwischen Zellwachstum und HIV-stimulierter Genexpression Schulte, Antje et al. Die Regulation der Transkription... Tätigkeitsbericht 2007 Struktur- und Zellbiologie Die Regulation der Transkription ist eine Schnittstelle zwischen Zellwachstum und HIV-stimulierter


Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige


Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale


Transgene Organismen

Transgene Organismen Transgene Organismen Themenübersicht 1) Einführung 2) Komplementäre DNA (cdna) 3) Vektoren 4) Einschleusung von Genen in Eukaryontenzellen 5) Ausmaß der Genexpression 6) Genausschaltung (Gen-Knockout)


Thema Transkription und Genregulation 14.01.2011. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung

Thema Transkription und Genregulation 14.01.2011. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema Transkription und Genregulation 14.01.2011 Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema: Gene und Transkription Was ist ein Gen? Heute: Gendefinition:



GENEXPRESSION BIOCHEMISCHE GRUNDLAGEN 37 GENEXPRESSION BIOCHEMISCHE GRUNDLAGEN Bakterien besitzen die Fähigkeit, auf Veränderungen ihrer Umgebung sehr flexibel zu reagieren. Besonders ausgeprägt ist dabei die Anpassung von Enzymaktivitäten


Transkription bei Prokaryoten

Transkription bei Prokaryoten Transkription bei Prokaryoten Hinweis: Im Atelier finden Sie die CD "The Nature of Genes". Mittels Tutorials und Aufgaben werden die wichtigsten Themen der Molekularbiologie leicht verständlich vermittelt.


Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute


Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01.

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. Thema: Eukaryotische Genregulation und RNA- Prozessierung Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. 2013 Worin unterscheiden sich die Gene bzw. die Genprodukte von Eukaryoten


Prüfungsfragenkatalog für Biochemie für Studierende der Pharmazie (Prof. A. Kungl)

Prüfungsfragenkatalog für Biochemie für Studierende der Pharmazie (Prof. A. Kungl) Prüfungsfragenkatalog für Biochemie für Studierende der Pharmazie (Prof. A. Kungl) Stand: Juli 2015 Termin: 07.07.2015 1. Detailieren Sie die unterschiedlichen Enzymklassen und erklären Sie deren Wirkmechanismus,


Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.


GENE UND TRANSKRIPTION. Genstruktur (schematisch) Gendefinition

GENE UND TRANSKRIPTION. Genstruktur (schematisch) Gendefinition GENE UND TRANSKRIPTION Genstruktur (schematisch) Gendefinition Gen ist DNA-Abschnitt, von dem eine biologische aktive RNA transkribiert werden kann. zu Genen gehören neben transkribierten Bereich auch


Klausur zur Genetik Name, Stud.- Sem. Punkte Vorname gang

Klausur zur Genetik Name, Stud.- Sem. Punkte Vorname gang Klausur zur Genetik Name, Stud.- Sem. Punkte 13.07.2005 Vorname gang Gesamtzahl der Punkte: 79 FRAGE Nr.1 7 Punkte Die nachstehenden Bilder zeigen Zellen einer seltenen Pflanzenart. Die Zellen befinden


1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener


1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?


Center for Biotechnology, Bielefeld

Center for Biotechnology, Bielefeld Andreas Albersmeier CeBiTec Bielefeld 3. Life Science Conference Analytik Jena Jena 14.05.2014 Center for Biotechnology, Bielefeld Genomik Transkriptomik Proteomics Metabolomics Genom


Q1 B1 KW 49. Genregulation

Q1 B1 KW 49. Genregulation Q1 B1 KW 49 Genregulation Transkription Posttranskription elle Modifikation Genregulation bei Eukaryoten Transkriptionsfaktoren (an TATA- Box) oder Silencer (verringert Transkription) und Enhancer (erhöht


'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?


Nachlese zu den Referaten

Nachlese zu den Referaten Nachlese zu den Referaten Referate Die Themen Phylogenie Aminosäurematrizen für die Eukaryontenphylogenie Ansätze für die Prokaryontenphylogenie Vergleichende Sequenzierung Spezieswahl zur Informationsoptimierung


4. Genetische Mechanismen bei Bakterien

4. Genetische Mechanismen bei Bakterien 4. Genetische Mechanismen bei Bakterien 4.1 Makromoleküle und genetische Information Aufbau der DNA Phasen des Informationsflusses Vergleich der Informationsübertragung bei Pro- und Eukaryoten 4.2 Struktur


6. Übung. a) Meiose. b) Reverse TranskripEon. 1) λ- Phage f. c) Prokaryont. d) KonjugaEon. e) Mitochondrien. 4) A. thaliana a, e, g.

6. Übung. a) Meiose. b) Reverse TranskripEon. 1) λ- Phage f. c) Prokaryont. d) KonjugaEon. e) Mitochondrien. 4) A. thaliana a, e, g. 6. Übung 1) Ordnen Sie die unten gelisteten Modellsysteme den Begriffen zu. Anmerkung: Mehrfachzuordnungen sind möglich und einer der Begriffe passt zu keinem der genannten Modellsysteme a) Meiose 1) λ-


8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria


Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7. Einführung 19

Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7. Einführung 19 Inhaltsverzeichnis Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7 Einführung 19 Über dieses Buch 19 Konventionen in diesem Buch 19 Was Sie nicht lesen müssen 20 Törichte Annahmen über


DNA-Sequenzierung. Martina Krause

DNA-Sequenzierung. Martina Krause DNA-Sequenzierung Martina Krause Inhalt Methoden der DNA-Sequenzierung Methode nach Maxam - Gilbert Methode nach Sanger Einleitung Seit 1977 stehen zwei schnell arbeitende Möglichkeiten der Sequenzanalyse


Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32


DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet


Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein


Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email:

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,


DNA- Rekombinationstechnik. Gentechnik

DNA- Rekombinationstechnik. Gentechnik DNA- Rekombinationstechnik Gentechnik 1 Verwendung von Plasmiden in der Gentechnik Campbell 19.1 2 Die wichtigsten Schritte bei der DNA-Klonierung (Plasmid) Transformation 3 Durch Klonierung kann man DNA-Fragmente


Mechanismen funktioneller Varianten: die Liste wächst

Mechanismen funktioneller Varianten: die Liste wächst Mechanismen funktioneller Varianten: die Liste wächst Martin Hersberger Abteilung für Klinische Chemie und Biochemie Universitäts-Kinderspital Zürich Genetische Varianten gestern Funktionelle Varianten



VORANGEGANGENE MODELLE VORANGEGANGENE MODELLE UNSER THEMA HEUTE Ziel dieses Papers: - Nähere Charakterisierung der AuxREs - Analyse eines zu den AuxREs gehörenden Transkriptionsfaktors WAS BEREITS BEKANNT WAR: - Auxin moduliert


Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn


Inhalt. 1. Einleitung 2. Struktur 3. Infektion 4. Virusfamilien

Inhalt. 1. Einleitung 2. Struktur 3. Infektion 4. Virusfamilien Viren Inhalt 1. Einleitung 2. Struktur 3. Infektion 4. Virusfamilien Einleitung 1 VERÄNDERLICHKEIT Infektion Genom Struktur - Viren infizieren alle Lebensformen: Archea, Eubakterien, Eukaryoten (Einzeller,


Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath Grundlagen Genetik Dipl.- Psych. Silja Bellingrath Infos zur Klausur Dauer: 11/2 Stunden (maximal) Keine Noten, nur bestanden versus nicht bestanden Inhalt: Grundlage sind die Folien zum Seminar; geprüft


Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?


Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden

Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden Forschungszentrum Karlsruhe Technik und Umwelt Wissenschaftliche Berichte FZKA 6087 Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden Stefanie


Kontrolle des Zellzyklus: Checkpoints. kann an bestimmten Kontrollpunkten gestoppt werden

Kontrolle des Zellzyklus: Checkpoints. kann an bestimmten Kontrollpunkten gestoppt werden Kontrolle des Zellzyklus: Checkpoints kann an bestimmten Kontrollpunkten gestoppt werden G2 checkpoint komplette DNA Replikation? sind DNA Schäden vorhanden? ist die Zelle groß genug? ist die Umgebung


Proteinbiosynthese. Prof. Dr. Albert Duschl

Proteinbiosynthese. Prof. Dr. Albert Duschl Proteinbiosynthese Prof. Dr. Albert Duschl DNA/RNA/Protein Im Bereich von Genen sind die beiden Stränge der DNA nicht funktionell äquivalent, weil nur einer der beiden Stränge transkribiert, d.h. in RNA


Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983


Versuch 9 SDS - PAGE

Versuch 9 SDS - PAGE Versuch 9 SDS - PAGE Protokollant: E-mail: Studiengang: Gruppen-Nr: Semester: Betreuer: Max Mustermann X X X Dr. Tina Endres & Dr. Claudia Prinzen Wird benotet?: Einleitung Ziel des


Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer


Die verführerische Illusion einfacher Konzepte

Die verführerische Illusion einfacher Konzepte PDF B: Abbildungen zum Vortrag Gehalten am 20. November 2014 Die verführerische Illusion einfacher Konzepte!! Kritische Betrachtungen zum Prinzip Einfachheit anhand von Beispielen aus Molekularbiologie


Die Evolution. Molekularer Netzwerke. Sarah A. Teichmann

Die Evolution. Molekularer Netzwerke. Sarah A. Teichmann Die Evolution Molekularer Netzwerke Sarah A. Teichmann Embryonale Entwicklung des Seeigels (Strongylocentrotus purpuratus) Systembiologie: Biologen als molekulare Ingenieure Schaltkreise der embryonalen


Die molekularbiologische Untersuchung von Morbus Wilson Durchmusterung des ATP7B Gens auf Mutationen

Die molekularbiologische Untersuchung von Morbus Wilson Durchmusterung des ATP7B Gens auf Mutationen Die molekularbiologische Untersuchung von Morbus Wilson Durchmusterung des ATP7B Gens auf Mutationen Dr. Alfred Cornelis Looman - Gene Analysis Service GmbH - Berlin Posterpresentation Morbus Wilson Symposium


Chelatisierende Koordination von Glucopyranose an ein Metallzentrum.

Chelatisierende Koordination von Glucopyranose an ein Metallzentrum. Lars Jessen Dissertation 3 Zusammenfassung Ziel der vorliegenden Arbeit war, die Möglichkeit der Koordination von Kohlenhydratbausteinen, insbesondere von Glucopyranosen, als Diolatoliganden an (IV)- und


Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese


Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Zellzyklus- und neuronale Gene in Trichoplax adhaerens S. Sagasser Praktikanten: Patrick Reinke und Jan Kleveman Betreuerin: Karolin von der Chevallerie


Kohlenhydrate. Diese Abbildung zeigt Strukturformeln von Zellulose und Stärke.

Kohlenhydrate. Diese Abbildung zeigt Strukturformeln von Zellulose und Stärke. Lerntext Ernährung Bisher haben sich fast alle Empfehlungen der Ernährungswissenschaftler als falsch erwiesen. Gültig blieben zwei Regeln, die Menschen schon lange vor den Wissenschaftlern kannten. Man


Promotoren und Transkriptionsfaktoren (TF)

Promotoren und Transkriptionsfaktoren (TF) Promotoren und Transkriptionsfaktoren (TF) Übersicht Promoteranalyse Transiente Genexpression DNA/TF Bindung TFs in Eukaryoten Anzahl Klassen Domain shuffling Kombinatorische Kontrolle Methoden zur Isolation


KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation


Übung II. Einführung. Teil 1 Arbeiten mit Sequenzen recombinante DNA

Übung II. Einführung. Teil 1 Arbeiten mit Sequenzen recombinante DNA Übung II Einführung Teil 1 Arbeiten mit Sequenzen recombinante DNA Recombinante DNA Technologie Protein Synthese In vitro Expression Libraries Gene Transfer in Tieren und Pflanzen Recombinante DNA Technologie


Molekularbiologische Methoden

Molekularbiologische Methoden Molekularbiologische Methoden im Lebensmittel-Labor Dr. rer. nat. Armin Pahl LADR GmbH MVZ Dr. Kramer & Kollegen 04152 803-0 DNA 1866 Gregor Mendel veröffentlicht seine Versuche über Pflanzen-Hybriden,


Gentransfer in höhere Eukaryonten

Gentransfer in höhere Eukaryonten 63 Gentransfer in höhere Eukaryonten von Florian Rüker, Wien Mit Hilfe der Methoden der DNA-Rekombination ist es möglich geworden, eine Vielzahl von Genen zu isolieren und zu charakterisieren. Die funktionelle


Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden Molbi Nachklausur 2009 Hier mal so die Fragen die mir noch so einfallen. Also es war gefragt: Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich


Übung II. Einführung, Teil 1. Arbeiten mit Ensembl

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl Übung II Einführung, Teil 1 Arbeiten mit Ensembl Ensembl Genome Browser (Bereitstellung von Vielzeller Genomen) Projekt wurde 1999 initiiert Projektpartner EMBL European Bioinformatics Institute (EBI)


Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich


Protein Expression. Purification. Tag-nology

Protein Expression. Purification. Tag-nology Protein Expression Purification Tag-nology Expression, homolog oder heterolog? Heterologe Expression in anderem Host Kompartment Codon usage Posttranslationale Modifikationen Kofaktoren Chaperone Non-leaky


Mobile Genetische Elemente / Transposition

Mobile Genetische Elemente / Transposition Mobile Genetische Elemente / Transposition Transposition Retrotransposition / Retroviren repetitive Elemente mobile Elemente und Genomevolution / -regulation Gentherapie Berit Jungnickel Institut für Klinische
