Genregulation in Bakterien. Das LAC Operon

Größe: px
Ab Seite anzeigen:

Download "Genregulation in Bakterien. Das LAC Operon"

Transkript

1 Genregulation in Bakterien Das LAC Operon

2 Der Fluss der genetischen Information Transkription Translation DNA mrna Protein Replikation (Reverse Transkription) Modifikation DNA Funktionelles Protein Horizontaler Gentransfer DNA

3 Struktur des Lac-Operons

4 Lactose Monosaccharides Glucose and Galactose Glucose Galactose Disaccharide Lactose consists of Galactose and Glucose Lactose

5 Lactose ist gleichzeitig Substrat und Induktor... substrate inductor

6 Diauxie: Wachstum von E.coli in Glucose/Sorbit 1:3 2:2 3:1 Monod 1942

7 System-Mutanten im Lac-Operon PlacI laci CAP-Bdg Plac O 1 Z Promotor laci Lac Repressor Lac Promotor Operator: Bindungsregion für LacI ß-Galaktosidase laciq erhöhte Produktion von LacI lacikonstitutive ß- Galaktosidase keine Synthese von funktionellem Repressor lacpl8 verminderte Bdg von CAP: Promotorstärke auf 1/50 reduziert lacuv5 verbesserte Promotorstärke durch zwei Austausche in -10 Region lacoc laci kann an veränderte Operatorregion nicht binden lacz- keine funktionelle ß-Galaktosidase laci s auch in Anwesen heit vom Induktor:keine ß-Gal "Superrepressor" - permanente Bdg an Operator

8 Synthesis of ß-Gal and Transacetylase genotype ß-Gal noninduced ß-Gal induced Transacetylase induced Transacetylase noninduced O+Z+Y+ < <1 100 OcZ+Y O+Z+Y F OcZ+Y+ O+Z-Y <1 220 F OcZ+Y- Monod,F.Jacob, F. 1961, J.Mol. Biol.3,

9 ß-Gal-Bildung in heterozygoten E.coli-Stämmen I- O+ Z+ Y I+ O+ Z- Y+ I- O+ Z+ Y+ I+ O+ Z- Y+ Y Y Z Z Z I I I Y Y F Y Z Y I Y Y - Lactose : keine ß Gal + Lactose: ß Gal aktiv Z+ ist dominant über Z- I+ ist dominant über I-

10 Das Operon Modell von Jacob und Monod 1961 Monod,F.Jacob, F. 1961, J.Mol. Biol.3,

11 Isolierung der Lac-Operatorregion Operatorregion / LacI Bindungsregion: Dyadische Symmetrie erlaubt Bindung des lac-repressors als Dimer Gilbert & Maxam, 1973; N. Maizels, 1973 Strategie: 1. Spezialtransduzierende Phagen-DNA λ dlac wird in ca bp Fragmente "zerlegt" 2. Mix DNA + Lac-Repressor und Bindung der DNA- Fragmente an Nitrocellulose 3. Verdau mit Pankreas-DNAse 4. Isolierung eines geschützten 28 bp Fragmentes 5 - TGTGTGGAATTGTGAGCGGATAACAATTTCACACA ACACACCTTAACACTCGC CTATTGTTAAAGTGTGT Sequenzbestimmung

12 lac-promotorstruktur llregion camp-cap footprint LacI footprint RNAP footprint mrna STOP laci ATG lacz O cmutationen AGGCTTTACAC TATGTTGT AATTGTGAGCGGATAACAAT A A AA A T GTTA C T

13 HTH Bindung an DNA

14 Molekulare Struktur des Lac-Repressors (Dimer) Headpiece:1-49 with HTH motif binds to the major groove of the operator Hinge helix, binds to the center of operator in the minor groove Core domain, consists of two subdomains: NH2l, CO Effector IPTG binds to a pocket n their junction Helical Tetramerization domain

15 Unterschiedliche Konformationen des Lac-Repressors Different structure of NH2 terminal subdomain if repressor is bound to operator (red) and to IPTG (blue)

16 Interaction of the Lac Repressor with operator and inducer Inducer binding pocket. Residues contacting ONPF are shown Interaction between the hinge helices of the repressor (blue and brown) and the minor groove of the operator (green and yellow)

17 Mapping of mutations in laci by J. Miller, laci- missense mutations were mapped by selection of I+ recombinants. I - constitutive, I ts heat sensitive, I s noninducible

18 CAP acts as positive regulator Kooperative Bindung von CAP und Polymerase an RNA

19 CAP Bindungsprotein Positiver Regulator des C-Katabolisms 1982: Klonierung und Sequenzierung von CAP (209 AS) Dimer: jedes Monomer hat eine DNA-Bindungsstelle (nur in Gegenwart von c-amp) Consensus-DNA-Bindungssequenz (CAP-Bindungsstelle): 5 CGAAAAGTGTGACAT ATGTCACACTTTTCG GCTTTTCACACTGTA TACAGTGTGAAAAGC 5 Positiver Regulator durch DNA "bending" Abhängigkeit von camp-konzentration: Niedrige Glukosekonz. Glucose PTS:Enzym IIGlu PTS:Enzym IIGlu-P Adenylatcyclase inaktiv Adenylatcyclase aktiv ATP -> camp

20 Das CAP Protein kann in verschiedenen Bereichen des Promotors binden Start mrna gal lac ara Promoter

21 Die drei Stadien der lac Gene basal Positive control active Negative control off

22 LAC-Promotor Kontrolle LacI ß-Gal Permeas e Transacetylase RNA laci lac DNA O3 O1 O2 CAP O1 O2 CAP LacI O3 + Glucose - Lactose CAP CAP O1 RNAP - Glucose + Lactose O3 O2 LacI - Glucose - Lactose

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt 5 mrna Nukleotid 3 N-Terminus Protein C-Terminus Aminosäure Es besteht

Mehr

Genstruktur und Genregulation bei Pro- und Eukaryoten (Pt.2)

Genstruktur und Genregulation bei Pro- und Eukaryoten (Pt.2) WS 2015/16 Grundvorlesung Allgemeine und Molekulare Genetik Genstruktur und Genregulation bei Pro- und Eukaryoten (Pt.2) Kap. 33, 36 Thomas Hankeln Institut für Molekulargenetik hankeln@uni-mainz.de Was?

Mehr

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers

Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Praktikum Biochemie Biotechnologie (Molekularbiologie & Biochemie) Bettina Siebers Protein Expression Genomische DNA PCR Vektormolekül (Plasmid) Escherichia coli Reinigung Protein (1) Plasmidpräparation

Mehr

H.Schwab Genetik. Überblick

H.Schwab Genetik. Überblick Überblick Einleitung: Historisches Klassische - Mendel DNA, Aufbau, übergeordnete Strukturen, Konfigurationen, zelluläre Organisation Chromatin, Chromosomenaufbau, Genome Extrachromosomale Elemente, mobile

Mehr

1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3

1. Nachschreibeklausur zur Vorlesung Genetik im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3 1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A Modul: Studiengang: Matrikel-Nr.: Versuch: 1 2 3 Vollständiger Name in Druckbuchstaben (Vorname Nachname): Jena, 01.04.2010, 10 12 Uhr; Unterschrift:

Mehr

05_10_Genes_info.jpg

05_10_Genes_info.jpg Übertragung der Information von DNA auf RNA - Transkription von RNA auf Protein - Translation Übertragung der Information vom Gen auf Protein 05_10_Genes_info.jpg 1 Figure 6-2 Molecular Biology of the

Mehr

Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:

Frage 1 A: Wieviele Codone des Universellen genetisches Codes kodieren: Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren: Aminosäuren Translationsstart Translationsstop? B: Welche biochemische Reaktion wird von Aminoazyl-tRNA-Synthetasen katalysiert?

Mehr

7. Regulation der Genexpression

7. Regulation der Genexpression 7. Regulation der Genexpression 7.1 Regulation der Enzymaktivität Stoffwechselreaktionen können durch Kontrolle der Aktivität der Enzyme, die diese Reaktionen katalysieren, reguliert werden Feedback-Hemmung

Mehr

Genexpressionsregulation

Genexpressionsregulation Genexpressionsregulation Genexpressionsregulation Different tissue types 1 2 3 4 5 6 7 8 Taken from Caron et al., 2001 Verschiedene Ebenen der Genexpressionsregulation Epigenetic mechanisms Transkriptionskontrolle

Mehr

RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase

Mehr

Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005

Optimality and evolutionary tuning of the expression level of a protein. Erez Dekel & Uri Alon Nature Vol 436, July 2005 Optimality and evolutionary tuning of the expression level of a protein Erez Dekel & Uri Alon Nature Vol 436, July 2005 Wie Zellen Denken Übersicht Hintergrund Mathematische Formulierung (cost-benefit-theory)

Mehr

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin

Mehr

Stochastische Genexpression

Stochastische Genexpression Stochastische Genexpression Genetische Schalter und Multistabilität Vorlesung System-Biophysik 12. Dez. 2008 Literatur Kaern et al. Nature Reviews Genetics Vol.6 p.451 (2005) Ozbudak, Oudenaarden et al

Mehr

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die

Mehr

Molekulare Mechanismen der Signaltransduktion

Molekulare Mechanismen der Signaltransduktion Molekulare Mechanismen der Signaltransduktion 07 - Identifizierung von ARF1 + Hinweise für Vorträge Folien: http://tinyurl.com/modul-mms http://www.pnas.org/content/111/14/5427/f1.large.jpg neues Modell

Mehr

RNA-Regulationsmechanismen: RNA Interferenz

RNA-Regulationsmechanismen: RNA Interferenz RNA-Regulationsmechanismen: RNA Interferenz Vorlesung System-Biophysik 19. Dez. 2008 Literatur Martens: BIOspektrum 4/02 8. Jahrgang M. Kuhlmann: Biol. Unserer Zeit Nr.3 (2004), S. 142. Genregulation durch

Mehr

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine

Mehr

Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Assoc. Prof. PD Mag. Dr. Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Wien, 2013 Währinger Straße 10, A-1090 Wien helmut.dolznig@meduniwien.ac.at www.meduniwien.ac.at/medizinische-genetik

Mehr

Grundlegende Experimente der Molekulargenetik

Grundlegende Experimente der Molekulargenetik Übung 12 Wiederholung/Zusatzübung Inhalte: Mendelscher Erbgang Grundlegende Experimente der Molekulargenetik Transposons Methoden 1. Sie haben drei runde, gelbe Erbsen (A, B und C). Aus jeder der drei

Mehr

Kapitel 8 Ò Chromosomen und Genregulation

Kapitel 8 Ò Chromosomen und Genregulation Kapitel 8 Ò Chromosomen und Genregulation 8.1 Struktur eukaryontischer Chromosomen Ein menschlicher Zellkern ist nur zehn Mikrometer gross und (10-9 ) hat zwei Meter DNA drin. Damit es da kein Durcheinander

Mehr

VII. Inhalt. Vorwort...

VII. Inhalt. Vorwort... VII Vorwort... V 1 Physikalische und chemische Grundlagen... 1 1.1 Reaktionskinetik... 1 1.2 Reaktionsgeschwindigkeit... 1 1.3 Reaktionsordnung... 2 1.4 Energie... 3 1.4.1 Reaktionsenergie... 3 1.4.2 Enthalpie......

Mehr

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

L2 DNA & RNA-Protein Interaktionen Protein-DNA and -RNA interactions

L2 DNA & RNA-Protein Interaktionen Protein-DNA and -RNA interactions L2 DNA & RNA-Protein Interaktionen Protein-DNA and -RNA interactions 1. Eukaryotische Chromosomenstruktur: chromosome structure 2. Histone und Nucleosomenstruktur Histones and nucleosome 3. Regulatorische

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

Protein Expression. Expression, homolog oder heterolog?

Protein Expression. Expression, homolog oder heterolog? Protein Expression Expression, homolog oder heterolog? Heterologe Expression in anderem Host Kompartment Codon usage Posttranslationale Modifikationen Kofaktoren Chaperone 1 promoter Expressionssystem

Mehr

Technologisches Arsenal der Molekularbiologie

Technologisches Arsenal der Molekularbiologie Technologisches Arsenal der Molekularbiologie Die zwei Sinne der Molekularbiologie 2. Ein technologisches System 1. Untersuchung der Lebensvorgänge zwischen den Ebenen der DNA und der Zelle Individuumebene

Mehr

Die Regulation der Transkription ist eine Schnittstelle zwischen Zellwachstum und HIV-stimulierter Genexpression

Die Regulation der Transkription ist eine Schnittstelle zwischen Zellwachstum und HIV-stimulierter Genexpression Schulte, Antje et al. Die Regulation der Transkription... Tätigkeitsbericht 2007 Struktur- und Zellbiologie Die Regulation der Transkription ist eine Schnittstelle zwischen Zellwachstum und HIV-stimulierter

Mehr

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen Aus der Reihe Daniels Genetik-Kompendium Erstellt von Daniel Röthgens Inhalt 1. Einleitung 2. RNA-Viren 3. DNA-Viren 1. Einleitung Im folgenden werden einige für die Genetik bedeutungsvolle Viren vorgestellt.

Mehr

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

Genregulation bei Eukaryoten II

Genregulation bei Eukaryoten II Genregulation bei Eukaryoten II Aktivierung und Repression der Transkription erfolgen durch Protein-Protein-Wechselwirkungen Protein-Protein-Wechselwirkungen spielen bei der Genregulation der Eukaryoten

Mehr

Übertragung der in der DNA gespeicherten Information

Übertragung der in der DNA gespeicherten Information Übertragung der in der DNA gespeicherten Information von DNA auf RNA - Transkription von RNA auf Protein - Translation Übertragung der Information vom Gen auf Protein 05_10_Genes_info.jpg 1 Figure 6-2

Mehr

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.

Molekulare Mechanismen der Signaltransduktion. 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl. Molekulare Mechanismen der Signaltransduktion 06 - Kartierung des AXR1 Gens + early auxin-induced genes Folien: http://tinyurl.com/modul-mms bisheriges Modell auxin auxin AXR1 auxin response AXR1 potentieller

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

Transkription bei Prokaryoten

Transkription bei Prokaryoten Transkription bei Prokaryoten Hinweis: Im Atelier finden Sie die CD "The Nature of Genes". Mittels Tutorials und Aufgaben werden die wichtigsten Themen der Molekularbiologie leicht verständlich vermittelt.

Mehr

Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale

Mehr

Thema Transkription und Genregulation 14.01.2011. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung

Thema Transkription und Genregulation 14.01.2011. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema Transkription und Genregulation 14.01.2011 Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema: Gene und Transkription Was ist ein Gen? Heute: Gendefinition:

Mehr

Q1 B1 KW 49. Genregulation

Q1 B1 KW 49. Genregulation Q1 B1 KW 49 Genregulation Transkription Posttranskription elle Modifikation Genregulation bei Eukaryoten Transkriptionsfaktoren (an TATA- Box) oder Silencer (verringert Transkription) und Enhancer (erhöht

Mehr

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise

'Agaroselels große DNA-Fragmente im Ethidiumbromid-gefärbten Agarosegel normalenrueise 4. (Kap2-Enzyme) a) KleinJDNA-Fragmente haben weniger negative Ladungen als große, aber das Masse/Ladungs-Verhältnis ist gleich. Warum wandern sie trotzdem schneller in der Agarose- Gelelektrophorese?

Mehr

Prüfungsfragenkatalog für Biochemie für Studierende der Pharmazie (Prof. A. Kungl)

Prüfungsfragenkatalog für Biochemie für Studierende der Pharmazie (Prof. A. Kungl) Prüfungsfragenkatalog für Biochemie für Studierende der Pharmazie (Prof. A. Kungl) Stand: Juli 2015 Termin: 07.07.2015 1. Detailieren Sie die unterschiedlichen Enzymklassen und erklären Sie deren Wirkmechanismus,

Mehr

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01.

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. Thema: Eukaryotische Genregulation und RNA- Prozessierung Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. 2013 Worin unterscheiden sich die Gene bzw. die Genprodukte von Eukaryoten

Mehr

Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.

Mehr

GENE UND TRANSKRIPTION. Genstruktur (schematisch) Gendefinition

GENE UND TRANSKRIPTION. Genstruktur (schematisch) Gendefinition GENE UND TRANSKRIPTION Genstruktur (schematisch) Gendefinition Gen ist DNA-Abschnitt, von dem eine biologische aktive RNA transkribiert werden kann. zu Genen gehören neben transkribierten Bereich auch

Mehr

Transgene Organismen

Transgene Organismen Transgene Organismen Themenübersicht 1) Einführung 2) Komplementäre DNA (cdna) 3) Vektoren 4) Einschleusung von Genen in Eukaryontenzellen 5) Ausmaß der Genexpression 6) Genausschaltung (Gen-Knockout)

Mehr

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und

1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und 10. Methoden 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet und welche Funktion haben diese bei der Sequenzierungsreaktion?

Mehr

DNA- Rekombinationstechnik. Gentechnik

DNA- Rekombinationstechnik. Gentechnik DNA- Rekombinationstechnik Gentechnik 1 Verwendung von Plasmiden in der Gentechnik Campbell 19.1 2 Die wichtigsten Schritte bei der DNA-Klonierung (Plasmid) Transformation 3 Durch Klonierung kann man DNA-Fragmente

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

Center for Biotechnology, Bielefeld

Center for Biotechnology, Bielefeld Andreas Albersmeier CeBiTec Bielefeld 3. Life Science Conference Analytik Jena Jena 14.05.2014 Center for Biotechnology, Bielefeld sketchup.google.com Genomik Transkriptomik Proteomics Metabolomics Genom

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Nachlese zu den Referaten

Nachlese zu den Referaten Nachlese zu den Referaten Referate Die Themen Phylogenie Aminosäurematrizen für die Eukaryontenphylogenie Ansätze für die Prokaryontenphylogenie Vergleichende Sequenzierung Spezieswahl zur Informationsoptimierung

Mehr

6. Übung. a) Meiose. b) Reverse TranskripEon. 1) λ- Phage f. c) Prokaryont. d) KonjugaEon. e) Mitochondrien. 4) A. thaliana a, e, g.

6. Übung. a) Meiose. b) Reverse TranskripEon. 1) λ- Phage f. c) Prokaryont. d) KonjugaEon. e) Mitochondrien. 4) A. thaliana a, e, g. 6. Übung 1) Ordnen Sie die unten gelisteten Modellsysteme den Begriffen zu. Anmerkung: Mehrfachzuordnungen sind möglich und einer der Begriffe passt zu keinem der genannten Modellsysteme a) Meiose 1) λ-

Mehr

DNA Sequenzierung. Transkriptionsstart bestimmen PCR

DNA Sequenzierung. Transkriptionsstart bestimmen PCR 10. Methoden DNA Sequenzierung Transkriptionsstart bestimmen PCR 1. Erklären Sie das Prinzip der Sanger Sequenzierung. Klären Sie dabei folgende Punkte: a) Welche besondere Art von Nukleotiden wird verwendet

Mehr

DNA-Sequenzierung. Martina Krause

DNA-Sequenzierung. Martina Krause DNA-Sequenzierung Martina Krause Inhalt Methoden der DNA-Sequenzierung Methode nach Maxam - Gilbert Methode nach Sanger Einleitung Seit 1977 stehen zwei schnell arbeitende Möglichkeiten der Sequenzanalyse

Mehr

Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7. Einführung 19

Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7. Einführung 19 Inhaltsverzeichnis Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7 Einführung 19 Über dieses Buch 19 Konventionen in diesem Buch 19 Was Sie nicht lesen müssen 20 Törichte Annahmen über

Mehr

Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32

Mehr

Kontrolle des Zellzyklus: Checkpoints. kann an bestimmten Kontrollpunkten gestoppt werden

Kontrolle des Zellzyklus: Checkpoints. kann an bestimmten Kontrollpunkten gestoppt werden Kontrolle des Zellzyklus: Checkpoints kann an bestimmten Kontrollpunkten gestoppt werden G2 checkpoint komplette DNA Replikation? sind DNA Schäden vorhanden? ist die Zelle groß genug? ist die Umgebung

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

Mechanismen funktioneller Varianten: die Liste wächst

Mechanismen funktioneller Varianten: die Liste wächst Mechanismen funktioneller Varianten: die Liste wächst Martin Hersberger Abteilung für Klinische Chemie und Biochemie Universitäts-Kinderspital Zürich Genetische Varianten gestern Funktionelle Varianten

Mehr

Die Evolution. Molekularer Netzwerke. Sarah A. Teichmann

Die Evolution. Molekularer Netzwerke. Sarah A. Teichmann Die Evolution Molekularer Netzwerke Sarah A. Teichmann Embryonale Entwicklung des Seeigels (Strongylocentrotus purpuratus) Systembiologie: Biologen als molekulare Ingenieure Schaltkreise der embryonalen

Mehr

VORANGEGANGENE MODELLE

VORANGEGANGENE MODELLE VORANGEGANGENE MODELLE UNSER THEMA HEUTE Ziel dieses Papers: - Nähere Charakterisierung der AuxREs - Analyse eines zu den AuxREs gehörenden Transkriptionsfaktors WAS BEREITS BEKANNT WAR: - Auxin moduliert

Mehr

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath Grundlagen Genetik Dipl.- Psych. Silja Bellingrath Infos zur Klausur Dauer: 11/2 Stunden (maximal) Keine Noten, nur bestanden versus nicht bestanden Inhalt: Grundlage sind die Folien zum Seminar; geprüft

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden

Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden Forschungszentrum Karlsruhe Technik und Umwelt Wissenschaftliche Berichte FZKA 6087 Transkriptionelle Repression als molekulare Grundlage der anti-inflammatorischen Wirkung von Glucocorticoiden Stefanie

Mehr

4. Genetische Mechanismen bei Bakterien

4. Genetische Mechanismen bei Bakterien 4. Genetische Mechanismen bei Bakterien 4.1 Makromoleküle und genetische Information Aufbau der DNA Phasen des Informationsflusses Vergleich der Informationsübertragung bei Pro- und Eukaryoten 4.2 Struktur

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Proteinbiosynthese. Prof. Dr. Albert Duschl

Proteinbiosynthese. Prof. Dr. Albert Duschl Proteinbiosynthese Prof. Dr. Albert Duschl DNA/RNA/Protein Im Bereich von Genen sind die beiden Stränge der DNA nicht funktionell äquivalent, weil nur einer der beiden Stränge transkribiert, d.h. in RNA

Mehr

ACTIVITY AND DIVERSITY OF NITROGEN-FIXING MICROORGANISMS: NOVEl TOOlS TO CHARACTERIZE POPULATIONS IN. SOll. A dissertation submitted to the

ACTIVITY AND DIVERSITY OF NITROGEN-FIXING MICROORGANISMS: NOVEl TOOlS TO CHARACTERIZE POPULATIONS IN. SOll. A dissertation submitted to the DISS. ETHNO. 15127 ACTIVITY AND DIVERSITY OF NITROGEN-FIXING MICROORGANISMS: NOVEl TOOlS TO CHARACTERIZE POPULATIONS IN SOll A dissertation submitted to the SWISS FEDERAL INSTITUT OF TECHNOLOGY ZURICH

Mehr

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR)

Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) PCR Genisolierung in 2 Stunden : Die Polymerase-Ketten-Reaktion (PCR) von Kary B. Mullis entwickelt (1985) eigentlich im Mai 1983 bei einer nächtlichen Autofahrt erstes erfolgreiches Experiment am 16.12.1983

Mehr

Die verführerische Illusion einfacher Konzepte

Die verführerische Illusion einfacher Konzepte PDF B: Abbildungen zum Vortrag Gehalten am 20. November 2014 Die verführerische Illusion einfacher Konzepte!! Kritische Betrachtungen zum Prinzip Einfachheit anhand von Beispielen aus Molekularbiologie

Mehr

Die molekularbiologische Untersuchung von Morbus Wilson Durchmusterung des ATP7B Gens auf Mutationen

Die molekularbiologische Untersuchung von Morbus Wilson Durchmusterung des ATP7B Gens auf Mutationen Die molekularbiologische Untersuchung von Morbus Wilson Durchmusterung des ATP7B Gens auf Mutationen Dr. Alfred Cornelis Looman - Gene Analysis Service GmbH - Berlin Posterpresentation Morbus Wilson Symposium

Mehr

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010)

Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Kursinhalte der Weiterbildung Molekulare Biotechnologie (MNr.: 237 / 0411 / 2010) Schwerpunkte im Bereich BIOANALYTIK Polyacrylamidelektrophorese von Nukleinsäuren im Vertikalsystem Agarosegelelektrophorese

Mehr

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer

Mehr

Kohlenhydrate. Diese Abbildung zeigt Strukturformeln von Zellulose und Stärke.

Kohlenhydrate. Diese Abbildung zeigt Strukturformeln von Zellulose und Stärke. Lerntext Ernährung Bisher haben sich fast alle Empfehlungen der Ernährungswissenschaftler als falsch erwiesen. Gültig blieben zwei Regeln, die Menschen schon lange vor den Wissenschaftlern kannten. Man

Mehr

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010

Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Phylogenetisches Praktikum im ITZ 08.02.2010-19.02.2010 Zellzyklus- und neuronale Gene in Trichoplax adhaerens S. Sagasser Praktikanten: Patrick Reinke und Jan Kleveman Betreuerin: Karolin von der Chevallerie

Mehr

Inhalt. 1. Einleitung 2. Struktur 3. Infektion 4. Virusfamilien

Inhalt. 1. Einleitung 2. Struktur 3. Infektion 4. Virusfamilien Viren Inhalt 1. Einleitung 2. Struktur 3. Infektion 4. Virusfamilien Einleitung 1 VERÄNDERLICHKEIT Infektion Genom Struktur - Viren infizieren alle Lebensformen: Archea, Eubakterien, Eukaryoten (Einzeller,

Mehr

Promotoren und Transkriptionsfaktoren (TF)

Promotoren und Transkriptionsfaktoren (TF) Promotoren und Transkriptionsfaktoren (TF) Übersicht Promoteranalyse Transiente Genexpression DNA/TF Bindung TFs in Eukaryoten Anzahl Klassen Domain shuffling Kombinatorische Kontrolle Methoden zur Isolation

Mehr

Übung II. Einführung. Teil 1 Arbeiten mit Sequenzen recombinante DNA

Übung II. Einführung. Teil 1 Arbeiten mit Sequenzen recombinante DNA Übung II Einführung Teil 1 Arbeiten mit Sequenzen recombinante DNA Recombinante DNA Technologie Protein Synthese In vitro Expression Libraries Gene Transfer in Tieren und Pflanzen Recombinante DNA Technologie

Mehr

Gentransfer in höhere Eukaryonten

Gentransfer in höhere Eukaryonten 63 Gentransfer in höhere Eukaryonten von Florian Rüker, Wien Mit Hilfe der Methoden der DNA-Rekombination ist es möglich geworden, eine Vielzahl von Genen zu isolieren und zu charakterisieren. Die funktionelle

Mehr

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl Übung II Einführung, Teil 1 Arbeiten mit Ensembl Ensembl Genome Browser (Bereitstellung von Vielzeller Genomen) Projekt wurde 1999 initiiert Projektpartner EMBL European Bioinformatics Institute (EBI)

Mehr

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden

Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich immer mehr werden Molbi Nachklausur 2009 Hier mal so die Fragen die mir noch so einfallen. Also es war gefragt: Warum man nicht schon in der SDS- Page eine Immunfärbung machen kann. Warum bei A-Tailingzyklus die A s nich

Mehr

Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich

Mehr

Mobile Genetische Elemente / Transposition

Mobile Genetische Elemente / Transposition Mobile Genetische Elemente / Transposition Transposition Retrotransposition / Retroviren repetitive Elemente mobile Elemente und Genomevolution / -regulation Gentherapie Berit Jungnickel Institut für Klinische

Mehr

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt

Seite 1 No. 201 Anwendungsmöglichkeiten. Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt USERGUIDE Seite 1 No. 201 Eppendorf Thermomixer comfort/compact Eppendorf ThermoStat plus Thermomixer comfort heizt, mischt, kühlt Temperierbereich: (RT 13 C) bis 99 C [MTPs: (RT 10 C) bis 70 C], Minimal

Mehr

Protein Expression. Purification. Tag-nology

Protein Expression. Purification. Tag-nology Protein Expression Purification Tag-nology Expression, homolog oder heterolog? Heterologe Expression in anderem Host Kompartment Codon usage Posttranslationale Modifikationen Kofaktoren Chaperone Non-leaky

Mehr

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen

Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Untersuchungen zur differenziellen Genexpression im ZNS von Noradrenalintransporter-Knockout- und Wildtyp-Mäusen Inaugural-Dissertation zur Erlangung des Doktorgrades (Dr. rer. nat.) der Mathematisch-Naturwissenschaftlichen

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Unterschiede zwischen Prokaryoten und. Eukaryont. Unterschiede prokaryotische eukaryotische Zelle. Zellaufbau Prokaryoten. Zellaufbau Eukaryoten

Unterschiede zwischen Prokaryoten und. Eukaryont. Unterschiede prokaryotische eukaryotische Zelle. Zellaufbau Prokaryoten. Zellaufbau Eukaryoten Unterschiede zwischen Prokaryoten und Prokaryoten lassen sich in 2 Reiche unterteilen: Eubakterien und Archaebakterien werden in 4 Reiche unterteilt: Protozoen (Einzeller), Pilze, Pflanzen und Tiere Unterschiede

Mehr

Nothing in Biology makes sense except in the light of evolution.

Nothing in Biology makes sense except in the light of evolution. Meine Referenz an Charles Darwin...ist ein Zitat von Theodosius Dobzhansky: Nothing in Biology makes sense except in the light of evolution. Collegium Generale, 18. März 2009 Genetik versus Epigenetik

Mehr

Versuch 9 SDS - PAGE

Versuch 9 SDS - PAGE Versuch 9 SDS - PAGE Protokollant: E-mail: Studiengang: Gruppen-Nr: Semester: Betreuer: Max Mustermann max@quantentunnel.de X X X Dr. Tina Endres & Dr. Claudia Prinzen Wird benotet?: Einleitung Ziel des

Mehr

Auswahlverfahren Medizin Prüfungsgebiet Chemie. 6.Termin Organische Chemie Naturstoffe

Auswahlverfahren Medizin Prüfungsgebiet Chemie. 6.Termin Organische Chemie Naturstoffe Auswahlverfahren Medizin Prüfungsgebiet Chemie 6.Termin Organische Chemie Naturstoffe Kursleiter Mag. Wolfgang Mittergradnegger IFS Kurs 2009 Organische Chemie Naturstoffe Fette Kohlenhydrate Proteine

Mehr

11a. Genaustausch bei Bakterien II: Transformation

11a. Genaustausch bei Bakterien II: Transformation Experiment 11 / Student report Laboratory to Biology III Diversity of Microorganisms / Wintersemester 2002/03 / page 1 11a. Genaustausch bei Bakterien II: Transformation VerfasserInnen: Yvonne Schwarzenbach,

Mehr

Grundlagen der Physiologie

Grundlagen der Physiologie Grundlagen der Physiologie Regulation www.icbm.de/pmbio Mensch und Affe Was unterscheidet uns vom Affen? 5 %? 1 Nachbar Was unterscheidet Sie von Ihrem Nachbarn? Was unterscheidet uns vom Affen? Was unterscheidet

Mehr