Versuch von Beadle und Tatum Verändertes Gen -> veränderter Phänotyp

Größe: px
Ab Seite anzeigen:

Download "Versuch von Beadle und Tatum Verändertes Gen -> veränderter Phänotyp"

Transkript

1 Versuch von Beadle und Tatum Verändertes Gen -> veränderter Phänotyp Neurospora crassa Ein-Gen-ein-Enzym Hypothese Ein-Gen-ein-Polypeptid-Hypothese Ein-Gen-ein-Genprodukt-Hypothese Purves et al

2 Das zentral Dogma: Von der DNA zum Protein Replikation Transkription Translation Purves et al

3 Genexpression: Gen Abschnitt auf der DNA, der für ein Genprodukt kodiert, inkl. Kontrollregionen Expression Fluss von der genetischen Information (DNA) zum Genprodukt beteiligte Vorgänge sind: Transkription (DNA in RNA) Translation (RNA in Protein) findet in allen lebenden Zellen statt RNA Protein 3

4 Bei Prokaryoten in einem Kompartiment Purves et al Purves et al

5 Pro- und eukaryotische Genexpression DNA Nicht-Matrizenstrang (+) Matrizenstrang, codogen (-) RNA Transkription des Matrizenstranges Translation Protein 5

6 Transkription Purves et al

7 Die chemische Struktur der RNA RNA DNA RNA enthält den Zucker Ribose RNA enthält Uracil anstelle von Thymin 7

8 Die RNA-Polymerase transkribiert DNA RNA-Polymerase aus E. coli DNA-abhängige RNA-Polymerase Katalyse von Phosphatdiesterbindungen Verlängerung der wachsenden RNA Kette in 5 ->3 Richtung Substrat: Ribonukleosidtriphosphate, kein Primer α α σ β β Minimal (Core) Enzym, 4 UE: α 2,β,β Holoenzym, 5 UE: α 2,β,β,σ α: Struktur des Enzyms σ: Erkennung β: RNA-Synthese des Transkriptionsstarts β : Bindung an DNA 8

9 Promotor: Erkennungs- und Startpunkt für die RNA-Polymerase -35 -Region upstream -Bereich -10 -Region -1 keine 0 +1 Start der Transkription ATG nicht-transkribierte DNA transkribierte DNA Start der Translation Konsensussequenzen prokaryotischer Promotoren -10-Region = Pribnow-Box -35-Region lac ACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAA trp AAATGAGCTGTTGACAATTAATCATCGAACTAGTTAACTAGTACGCA pl TCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACAT Kons.-S TTGACA---17+/-1 bp-----tataat

10 Transkriptionszyklus einer bakteriellen RNA-Polymerase RNA σ-faktor Promotor Haarnadel RNA-Polymerase DNA 1. Bindung des RNA-Pol-Holoenzyms an den Promotor (geschlossener Komplex) 7. Freisetzung des Transkripts 6. Termination 2. Aufwinden der DNA (offener Komplex) 5. Elongationsphase mit hoher Prozessivität (50 nt/s) 3. Anfängliche Transkription (10 nt) Ribonukleosidtriphosphate RNA RNA 4. Ablösung des σ-faktors 10

11 Alternative Sigmafaktoren: Regulation der Genexpression bei E. coli Sigmafaktor Größe (kda) Funktion σ Standard-Sigmafaktor σ S 38 Hunger, Stress σ Hitzeschock 11

12 Transkriptionstermination bei E. coli Rho-unabhängige Termination Rho-abhängige Termination Haarnadelförmige Sekundärstruktur im 3 Nichtkodierungsbereich einer mrna Rho-Protein (Hexamer) lagert sich an mrna spaltet ATP 12

13 Transkripte sind länger als die kodierende Region Promotor +1 Ende Terminator DNA Kodierende Region 5 3 RNA-Transkript Leadersequenz 5 untranslatierter Bereich Trailer-Abschnitt 3 untranslatierter Bereich 13

14 Prokaryot Eukaryot RNA-Polymerase polycistronische mrna RNA-Polymerase Cap-Struktur monocistronische mrna Poly(A)-Schwanz Kernpore Translation noch während der Transkription mrna muss aus dem Kern ausgeschleust werden 14

15 Die drei durch die Transkription erzeugten Haupttypen von RNA-Molekülen Brown

16 Eukaryoten: drei DNA-abhängige RNA-Polymerasen im Kern RNA-Polymerase Produkt Lokalisierung RNA-Pol I: rrna (28S, 18S, 5,8S) Nukleolus RNA-Pol II: mrna (Protein-kodierende Gene) Nukleoplasma snornas, einige snrnas RNA-Pol III: 5S rrna, trnas, viele snrnas Nukleoplasma interne Promotoren! Zusätzlich RNA-Polymerasen in Mitochondrien und Chloroplasten mt-rna-pol mitochondriale Transkripte Mitochondrien (nur eine UE) (kernkodiert) pt-rna-pol (PEP) plastidäre Transkripte Plastiden (E.coli-ähnlich) (plastidenkodiert) pt-rna-pol (NEP) plastidäre Transkripte Plastiden (nur eine UE) (kernkodiert) 16

17 Eukaryotische Promotoren sind weniger konserviert prokaryotischer Promotor eukaryotischer RNA-Pol II Promotor Jannig & Knust

18 Struktur und Transkription eines eukaryotischen Gens Purves et al

19 Transkription eukaryotischer DNA durch die RNA-Polymerase II benötigt viele allgemeine Transkriptionsfaktoren (TF) TFIIH 19

20 Eukaryotische Gene enthalten kodierende Exon- und nicht-kodierende Intron-Bereiche, eukaryotische RNA-Pol II-Transkripte werden prozessiert 1. Anfügen des Cap am 5 Ende 2. Polyadenylierung am 3 Ende 3. Spleißen Alle drei Prozesse finden im Zellkern statt! 20

21 Capping des Transkriptes am 5 Ende: Anfügen eines modifizierten Guaninnukleotids 5 Cap signalisiert 5 Ende eukaroytischer mrnas Wird während der Transkription Methylgruppe angehängt 5 Cap wichtig für Export der mrna ins Cytosol und die Translation 5-5--Bindung 7-Methyl-Guanosintriphosphat 21

22 Polyadenylierung am 3 -Ende 3 -Poly(A)-Schwanz signalisiert 3 -Ende eukaroytischer mrnas Poly(A)-Polymerase (Polymerisation ohne Matrize!) A-Nukleotide werden angehängt 3 -Poly(A)-Schwanz wichtig für Export der mrna ins Cytosol, für die Stabilität und die Translation Nukleotide < 30 Nukleotide Spaltung durch Endonukleasekomplex wird abgebaut Poly(A)-Anheftung durch Poly(A)-Polymerase 22

23 Spleißen des Transkripts Spleißen = Entfernen der Intronsequenzen aus dem Primärtranskript, Verknüpfung der Exons Nukleotidsequenzen markieren die Spleißstellen Spleißen wird durch Spleißosomen ausgeführt Spleißosomen sind aus Proteinen und snrnas zusammengesetzt Intron wird entfernt Teil der mrna 23 Janning & Knust 14.9

24 Das Spleißosom, eine Spleißmaschine Purves et al

25 Eukaryoten: Kontrolle der Transkription durch die Chromatinstruktur Modifikation (z. B. Acetylierung) der Chromatinproteine (Histone) reguliert die Transkription Nukleosom 10 nm Histonoktamer Histon- Deacetylierung Histon-Deacetylase (HDAC) DNA offenes Chromatin -> transkriptionsaktiv Histon- Acetylierung Histon-Acetyltransferase (HAT) kondensiertes Chromatin -> transkriptionsinaktiv 30 nm 25 Janning & Knust 17.16

26 Histon-Acetyltransferase (HAT) Reguliert Zugänglichkeit der DNA für Proteine der Transkriptionsmaschinerie Histon-Acetyltransferase (HAT) acetyliert Histone in der Nähe der TATA-Box Transkriptionsfaktor RNA-Polymerase II Histone DNA Ac Transkription Nukleosom 26

27 Modifikation des Chromatins Histon- Deacetylierung Histon-Methylierung DNA-Methylierung Histon- Acetylierung Histon-Demethylierung DNA-Demethylierung 27

28 Initiation der Genexpression: Unterschiede zwischen Pro- und Eukaryoten Prokaryoten Eukaryoten RNA-Polymerase eine RNA-Polymerase, drei RNA-Polymerasen, einige Sigma-Faktoren viele allgemeine Transkriptionsfaktoren regulatorische Transkriptions- ja ja; zahlreich faktoren Transkript meist polycistronisch, monocistronisch, keine Modifikation Modifikation am 5 - u. 3 -Ende Introns i.d.r. nicht vorhanden, meist vorhanden, kein Spleißen Spleißen Trennung von Transkription u. nein ja (Kern/Cytoplasma) Translation Einfluss der Chromatinstruktur kein Chromatin! ja 28

29 Die drei durch die Transkription erzeugten Haupttypen von RNA-Molekülen Brown

30 Ribosomale RNA Purves et al Ribosomen bestehen aus RNA (rrna) und Proteinen und sind aus zwei Untereinheiten zusammengesetzt 30

31 Ribosomen 31

32 Svedbergeinheit S Maß für Sedimentationsgeschwindigkeit bei Zentrifugation in einem Dichtegradienten S-Wert abhängig von Größe, Form, Volumen und Dichte des Partikels/Moleküls je größer und kompakter, desto größer ist Wanderungsgeschwindigkeit Zellfraktionierung durch differentielle Zentrifigation, Sedimentationsanalyse oder Dichtegradientenzentrifugation (Saccharose) 32

33 Dichten und S-Werte von Zellmaterial 33

34 Zusammensetzung der Ribosomen bei Pro- und Eukaryoten Prokaryoten Eukaryoten Größe rrna Proteine Größe rrna Proteine (Nukleotide) (Nukleotide) große UE 50S 23S rrna (2904) 5S rrna (120) L1, L2, L3, etc. Ges.: >30 60S 28S rrna (4818) 5,8S rrna (160) L1, L2, L3, etc. Ges.: ca. 50 5S rrna (120) kleine UE 30S 16S rrna (1542) S1, S2, S3, etc. Ges.: >20 40S 18S rrna (1874) S1, S2, S3, etc. Ges.: ca

35 Molekulare Feinstruktur eines 70S Ribosoms Purves et al b 35

36 Sekundärstruktur der 16 S rrna von E. coli 36

37 Prozessierung der eukaryotischen rrna Janning & Knust 15.1e 37

38 DNA, die rrna kodiert ist repetitiv Purves et al

39 Nukleolus Kernkompartiment Ort der rrna Synthese Nukleolus besteht aus DNA, RNA und Proteinen Prozessierung der prä-rrna, Zusammensetzung präribosomaler Partikel Nukleolus-Organisator (NO) besteht aus rdna, die von mehreren Chromosomen stammen kann und tandemartig abgeordnete rdna enthält 39

40 trnas fungieren als Adapter ( trna Moleküle pro Bakterien-Zelle) 40

41 trnas bestehen aus Nukleotiden Kleeblattstruktur Akzeptorarm bindet Aminosäure; 3 Ende endet immer auf -CCA DHU-Arm enthält ungewöhnliches Pyrimidin Dihydrouracil Anticodonarm erkennt mrna Variabler Arm enthält variable Anzahl an Nukleotiden TψC enthält die Abfolge T, Pseudouracil und C 41

42 Tertiärstruktur der trna jede trna hat individuelle 3D-Struktur 42

43 Uridin Zucker 43

44 Der genetische Code 44

45 Die 20 in Proteinen vorkommenden Aminosäuren Janning & Knust

46 Problem: 4 Buchstaben A,T,G,C -> aber 20 Aminosäuren Singulet-Code: 4 Codons Duplett-Code: 4 2 = 16 Codons Triplett-Code: 4 3 = 64 Codons Purves et al

47 Frage: Welches Triplett codiert für welche Aminosäure? Versuch von Nirenberg und Matthaei Purves et al

48 Der Code ist degeneriert, d.h. mehrere Tripletts codieren eine Aminosäure (Ausnahme: Tryptophan und Methionin) Synonyme Codons sind sich meist ähnlich, so dass die ersten beiden Basen eines Tripletts oft schon die Aminosäure spezifizieren (Ausnahmen: Leucin und Arginin) Leucin Leucin Arginin Arginin Purves et al

49 Die "Wobble"-Hypothese (F. Crick 1965) "wobble" = "Schwanken, Wackeln" Eine einzelne z. B. mit Glycin beladene trna kann drei verschiedene Codons auf der mrna erkennen 49

50 "Wobble" Abweichungen bei der Bindung des Anticodons an das Codon 50

51 Der genetische Code ist fast universell und gilt für alle Organismen Es gibt wenige Ausnahmen (insbesondere in Mitochondrien- Genomen) z.b. UGA (normalerweise Stop) in Mitochondrien Tryptophan und AUA (normalerweise Isoleucin) in Mitochondrien Methionin 51

52 Verwendung von Code-Wörtern (Codon usage) Ein Beispiel: 6 Arginin Codons CGT 43% CGC 32% CGA 7% CGG 8% AGA 9% AGG 1% korrespondiert mit Vorkommen synonymer trnas d.h. es gibt seltene Codons (Speziesspezifisch) Regulation von Genaktivität, da seltene Codons zu schwächerer Expression führen 52

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die

Mehr

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt 5 mrna Nukleotid 3 N-Terminus Protein C-Terminus Aminosäure Es besteht

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat

Mehr

RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase

Mehr

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine

Mehr

Proteinbiosynthese. Prof. Dr. Albert Duschl

Proteinbiosynthese. Prof. Dr. Albert Duschl Proteinbiosynthese Prof. Dr. Albert Duschl DNA/RNA/Protein Im Bereich von Genen sind die beiden Stränge der DNA nicht funktionell äquivalent, weil nur einer der beiden Stränge transkribiert, d.h. in RNA

Mehr

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3

1. Nachschreibeklausur zur Vorlesung Genetik im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3 1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A Modul: Studiengang: Matrikel-Nr.: Versuch: 1 2 3 Vollständiger Name in Druckbuchstaben (Vorname Nachname): Jena, 01.04.2010, 10 12 Uhr; Unterschrift:

Mehr

4. Genetische Mechanismen bei Bakterien

4. Genetische Mechanismen bei Bakterien 4. Genetische Mechanismen bei Bakterien 4.1 Makromoleküle und genetische Information Aufbau der DNA Phasen des Informationsflusses Vergleich der Informationsübertragung bei Pro- und Eukaryoten 4.2 Struktur

Mehr

Eine neue RNA-Welt. Uralte RNA-Welt Am Anfang der Entstehung des Lebens. Bekannte RNA-Welt Protein-Synthese. Neue RNA-Welt Regulatorische RNA-Moleküle

Eine neue RNA-Welt. Uralte RNA-Welt Am Anfang der Entstehung des Lebens. Bekannte RNA-Welt Protein-Synthese. Neue RNA-Welt Regulatorische RNA-Moleküle RNAs Eine neue RNA-Welt 1. Uralte RNA-Welt Am Anfang der Entstehung des Lebens Bekannte RNA-Welt Protein-Synthese Neue RNA-Welt Regulatorische RNA-Moleküle 2. Eine neue RNA-Welt die Anzahl der nicht-kodierenden

Mehr

Unterschiede zwischen Prokaryoten und. Eukaryont. Unterschiede prokaryotische eukaryotische Zelle. Zellaufbau Prokaryoten. Zellaufbau Eukaryoten

Unterschiede zwischen Prokaryoten und. Eukaryont. Unterschiede prokaryotische eukaryotische Zelle. Zellaufbau Prokaryoten. Zellaufbau Eukaryoten Unterschiede zwischen Prokaryoten und Prokaryoten lassen sich in 2 Reiche unterteilen: Eubakterien und Archaebakterien werden in 4 Reiche unterteilt: Protozoen (Einzeller), Pilze, Pflanzen und Tiere Unterschiede

Mehr

Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

Transkription bei Pro- und Eukaryoten

Transkription bei Pro- und Eukaryoten Transkription bei Pro- und Eukaryoten Im Rahmen der Transkription liefert ein Strang der DNA die Information für die Synthese eines RNA-Stranges. Die Enzyme, die in Pro- und Eukaryotenzellen für die Transkription

Mehr

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Assoc. Prof. PD Mag. Dr. Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Wien, 2013 Währinger Straße 10, A-1090 Wien helmut.dolznig@meduniwien.ac.at www.meduniwien.ac.at/medizinische-genetik

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01.

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. Thema: Eukaryotische Genregulation und RNA- Prozessierung Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. 2013 Worin unterscheiden sich die Gene bzw. die Genprodukte von Eukaryoten

Mehr

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna

Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Regulation der Genexpression: regulierbare Promotoren, Proteine und sirna Biochemie Praktikum Christian Brendel, AG Grez Ebenen der Genregulation in Eukaryoten Cytoplasma DNA Zellkern Introns Exons Chromatin

Mehr

Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide

Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide O:/Wiley/Reihe_verdammt_klever/Fletcher/3d/c01.3d from 15.08.2013 17:16:38 1 Molekulargenetik 1 In diesem Kapitel geht es um diese Themen: DNA-Struktur Gene Der genetische Code Von der DNA zum Protein

Mehr

Inhaltsverzeichnis. 1. Lebensformen: Zellen mit und ohne Kern... 3. 2. DNA: Träger der genetischen Information... 9

Inhaltsverzeichnis. 1. Lebensformen: Zellen mit und ohne Kern... 3. 2. DNA: Träger der genetischen Information... 9 Vorwort IX Teil I Grundlagen 1. Lebensformen: Zellen mit und ohne Kern... 3 Eukaryoten... 4 Prokaryoten... 6 Literatur... 8 2. DNA: Träger der genetischen Information... 9 Bausteine: Nucleotide... 10 Doppelhelix...

Mehr

Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen

Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen Die Organellen der Zelle sind sozusagen die Organe die verschiedene Funktionen in der Zelle ausführen. Wir unterscheiden Tierische

Mehr

Kapitel 8 Ò Chromosomen und Genregulation

Kapitel 8 Ò Chromosomen und Genregulation Kapitel 8 Ò Chromosomen und Genregulation 8.1 Struktur eukaryontischer Chromosomen Ein menschlicher Zellkern ist nur zehn Mikrometer gross und (10-9 ) hat zwei Meter DNA drin. Damit es da kein Durcheinander

Mehr

Grundlagen der Molekulargenetik

Grundlagen der Molekulargenetik Mathematik und Naturwissenschaften Psychologie Differentielle- & Persönlichkeitspsychologie Grundlagen der Molekulargenetik Dresden, 11.11.2010 Charlotte Bauer Gliederung 1. Speicherung genetischer Information

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Transkription bei Prokaryoten

Transkription bei Prokaryoten Transkription bei Prokaryoten Hinweis: Im Atelier finden Sie die CD "The Nature of Genes". Mittels Tutorials und Aufgaben werden die wichtigsten Themen der Molekularbiologie leicht verständlich vermittelt.

Mehr

DNA, RNA und der Fluss der genetischen Information

DNA, RNA und der Fluss der genetischen Information Vertretung durch Frank Breitling (Institut für Mikrostrukturtechnik (IMT), Campus Nord; www.imt.kit.edu/529.php) Vorlesungsdoppelstunde am 25.06.2015 Basis der Vorlesung: Stryer, Biochemie, 6. Auflage,

Mehr

Replikation. Allgemeine Grundlagen. Replikation Transkription Translation Signaltransduktion. 1. Allgemeines. 2. Meselson-Stahl-Experiment

Replikation. Allgemeine Grundlagen. Replikation Transkription Translation Signaltransduktion. 1. Allgemeines. 2. Meselson-Stahl-Experiment Allgemeine Grundlagen Replikation Transkription Translation Signaltransduktion Replikation 1. Allgemeines DA dient als Matrize, d.h. als Vorlage für die Vervielfältigung und Weitergabe der genetischen

Mehr

Übertragung der in der DNA gespeicherten Information

Übertragung der in der DNA gespeicherten Information Übertragung der in der DNA gespeicherten Information von DNA auf RNA - Transkription von RNA auf Protein - Translation Übertragung der Information vom Gen auf Protein 05_10_Genes_info.jpg 1 Figure 6-2

Mehr

Thema Transkription und Genregulation 14.01.2011. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung

Thema Transkription und Genregulation 14.01.2011. Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema Transkription und Genregulation 14.01.2011 Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema: Gene und Transkription Was ist ein Gen? Heute: Gendefinition:

Mehr

Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren:

Frage 1 A: Wieviele Codone des Universellen genetisches Codes kodieren: Frage 1 A: Wieviele Codone des "Universellen genetisches Codes" kodieren: Aminosäuren Translationsstart Translationsstop? B: Welche biochemische Reaktion wird von Aminoazyl-tRNA-Synthetasen katalysiert?

Mehr

Träger der Erbinformation sind die Nukleinsäuren. Es handelt sich hierbei um hochmolekulare lineare Kettenmoleküle, die aus durch

Träger der Erbinformation sind die Nukleinsäuren. Es handelt sich hierbei um hochmolekulare lineare Kettenmoleküle, die aus durch Achtung Die folgenden Texte sind als Stichworte für die Klausurvorbereitung zu sehen. Keinesfalls sind die Fragen in der Klausur auf den Inhalt dieser Folien beschränkt, sondern werden aus dem Stoff der

Mehr

Eukaryontische DNA-Bindedomänen

Eukaryontische DNA-Bindedomänen 1. Viele eukaryotische (und auch prokaryotische) Transkriptionsfaktoren besitzen eine DNA-bindende Domäne, die an eine ganz bestimmte DNA- Sequenz binden kann. Aufgrund von Ähnlichkeiten in der Struktur

Mehr

Synthese und Prozessierung von RNA

Synthese und Prozessierung von RNA Vertretung durch Frank Breitling (Institut für Mikrostrukturtechnik (IMT), Campus Nord) Vorlesungsdoppelstunde am 25.06.2015 Basis der Vorlesung: Stryer, Biochemie, 6. Auflage, Kapitel 29 Synthese und

Mehr

05_10_Genes_info.jpg

05_10_Genes_info.jpg Übertragung der Information von DNA auf RNA - Transkription von RNA auf Protein - Translation Übertragung der Information vom Gen auf Protein 05_10_Genes_info.jpg 1 Figure 6-2 Molecular Biology of the

Mehr

Expressionskontrolle in Eukaryonten

Expressionskontrolle in Eukaryonten Expressionskontrolle in Eukaryonten Warum muss Genexpression kontrolliert werden? 1. Gewebsspezifische Kontrolle - nicht jedes Genprodukt ist in allen Zellen erforderlich - manche Genprodukte werden ausschliesslich

Mehr

Aufbau, Struktur, Funktion von DNA, RNA und Proteinen

Aufbau, Struktur, Funktion von DNA, RNA und Proteinen Aufbau, Struktur, Funktion von DNA, RNA und Proteinen Mitarbeiterseminar der Medizinischen Fakultät Ruhr-Universität Bochum Andreas Friebe Abteilung für Pharmakologie und Toxikologie Aufbau, Struktur,

Mehr

Funktion. Transkriptionsfaktor in der Ethylen-Signaltransduktion

Funktion. Transkriptionsfaktor in der Ethylen-Signaltransduktion Modifiziertes Funktion Funktionen Protein des Target Ubiquitinierung Phytochrom Polyubi.: (Ubiquitylierung) AUX/IAA EIN2 Auxin-Signaltransduktion Transkriptionsfaktor in der Ethylen-Signaltransduktion

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2014 Fragen für die Übungsstunde 8 (14.07-18.07.) 1) Von der DNA-Sequenz zum Protein Sie können

Mehr

Einführung Nukleinsäuren

Einführung Nukleinsäuren Einführung Nukleinsäuren Dr. Kristian M. Müller Institut für Biologie III Albert-Ludwigs-Universität Freiburg Einführung 1. Semester, WiSe 2007/2008 Historischer Überblick Literatur Bilder aus: Taschenatlas

Mehr

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10

IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 IV. Übungsaufgaben für die Jahrgangstufe 9 & 10 Von der Erbanlage zum Erbmerkmal: 34) Welche Aufgaben haben Chromosomen? 35) Zeichne und benenne die Teile eines Chromosoms, wie sie im Lichtmikroskop während

Mehr

DNA Reparatur. Häufige Ursachen von DNA Schäden und ihre. Reparaturmechanismen. Syndrome mit defekter DNA-Reparatur

DNA Reparatur. Häufige Ursachen von DNA Schäden und ihre. Reparaturmechanismen. Syndrome mit defekter DNA-Reparatur DNA Reparatur Häufige Ursachen von DNA Schäden und ihre Reparaturmechanismen Syndrome mit defekter DNA-Reparatur Karzinogene und ihre Wirkungsweise Direkte Reparatur I: die meisten Fehler werden bei der

Mehr

Molekulare Diagnostik

Molekulare Diagnostik Molekulare Diagnostik Andreas Prokesch, Dipl.-Ing. Dr.techn. 1 Molekulare Diagnostik in der Medizin Palliative Behandlung Molekulare Diagnostik Präventivmedizin (=>Personalisierte Medizin) Kurative Therapie

Mehr

GENE UND TRANSKRIPTION. Genstruktur (schematisch) Gendefinition

GENE UND TRANSKRIPTION. Genstruktur (schematisch) Gendefinition GENE UND TRANSKRIPTION Genstruktur (schematisch) Gendefinition Gen ist DNA-Abschnitt, von dem eine biologische aktive RNA transkribiert werden kann. zu Genen gehören neben transkribierten Bereich auch

Mehr

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen

Mehr

Genregulation bei Eukaryoten II

Genregulation bei Eukaryoten II Genregulation bei Eukaryoten II Aktivierung und Repression der Transkription erfolgen durch Protein-Protein-Wechselwirkungen Protein-Protein-Wechselwirkungen spielen bei der Genregulation der Eukaryoten

Mehr

Nachlese zu den Referaten

Nachlese zu den Referaten Nachlese zu den Referaten Referate Die Themen Phylogenie Aminosäurematrizen für die Eukaryontenphylogenie Ansätze für die Prokaryontenphylogenie Vergleichende Sequenzierung Spezieswahl zur Informationsoptimierung

Mehr

Center for Biotechnology, Bielefeld

Center for Biotechnology, Bielefeld Andreas Albersmeier CeBiTec Bielefeld 3. Life Science Conference Analytik Jena Jena 14.05.2014 Center for Biotechnology, Bielefeld sketchup.google.com Genomik Transkriptomik Proteomics Metabolomics Genom

Mehr

5 Expression der genetischen Information - März 2009

5 Expression der genetischen Information - März 2009 Page 1 of 21 GRUNDLAGEN DER MOLEKULARBIOLOGIE Prof. Dr. Anne Müller 5 Expression der genetischen Information 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription) 5.3 RNA-Polymerase 5.4 Promotoren 5.5

Mehr

1. Definition und Mechanismen

1. Definition und Mechanismen Zusammenfassung 1. Definition und Mechanismen Epigenetik (von griechisch epi- über ) bezeichnet erbliche Veränderungen in der Genexpression, die nicht von Veränderungen in der DNA Sequenz (Mutationen)

Mehr

Mechanismen funktioneller Varianten: die Liste wächst

Mechanismen funktioneller Varianten: die Liste wächst Mechanismen funktioneller Varianten: die Liste wächst Martin Hersberger Abteilung für Klinische Chemie und Biochemie Universitäts-Kinderspital Zürich Genetische Varianten gestern Funktionelle Varianten

Mehr

RNA-Prozessierung Hans-Georg Kräusslich Abteilung Virologie 08.05.07

RNA-Prozessierung Hans-Georg Kräusslich Abteilung Virologie 08.05.07 RNA-Prozessierung Hans-Georg Kräusslich Abteilung Virologie 08.05.07 Hinzufügen von Sequenzen 5 cap 3 PolyA Einige nt durch Editing Entfernen von Sequenzen Splicing von Introns Degradation Sequenzänderung

Mehr

7. Regulation der Genexpression

7. Regulation der Genexpression 7. Regulation der Genexpression 7.1 Regulation der Enzymaktivität Stoffwechselreaktionen können durch Kontrolle der Aktivität der Enzyme, die diese Reaktionen katalysieren, reguliert werden Feedback-Hemmung

Mehr

Genexpressionsregulation

Genexpressionsregulation Genexpressionsregulation Genexpressionsregulation Different tissue types 1 2 3 4 5 6 7 8 Taken from Caron et al., 2001 Verschiedene Ebenen der Genexpressionsregulation Epigenetic mechanisms Transkriptionskontrolle

Mehr

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden.

Foliensatz; Arbeitsblatt; Internet. Je nach chemischem Wissen können die Proteine noch detaillierter besprochen werden. 03 Arbeitsauftrag Arbeitsauftrag Ziel: Anhand des Foliensatzes soll die Bildung und der Aufbau des Proteinhormons Insulin erklärt werden. Danach soll kurz erklärt werden, wie man künstlich Insulin herstellt.

Mehr

Seminar Biochemie. Nukleotide - Nukleinsäuren - Nukleotidstoffwechsel - DNA-Replikation. Dr. Christian Hübbers

Seminar Biochemie. Nukleotide - Nukleinsäuren - Nukleotidstoffwechsel - DNA-Replikation. Dr. Christian Hübbers Seminar Biochemie Nukleotide - Nukleinsäuren - Nukleotidstoffwechsel - DNA-Replikation Dr. Christian Hübbers Lernziele Zusammensetzung der Nukleotide (Basen, Zucker) Purin-und Pyrimidinbiosynthese (prinzipieller

Mehr

Nothing in Biology makes sense except in the light of evolution.

Nothing in Biology makes sense except in the light of evolution. Meine Referenz an Charles Darwin...ist ein Zitat von Theodosius Dobzhansky: Nothing in Biology makes sense except in the light of evolution. Collegium Generale, 18. März 2009 Genetik versus Epigenetik

Mehr

Methoden der Gentechnik

Methoden der Gentechnik Methoden der Gentechnik *** DNA-Rekombination und Klonierung *** 1. Allgemeine Grundprinzipien 1.1. Wesen der Gentechnik 1.2. Allgemeine Ziele der Gentechnik 1.3. Molekulare Voraussetzungen 1.4. Wichtige

Mehr

Klausur zur Vorlesung Biochemie III im WS 2000/01

Klausur zur Vorlesung Biochemie III im WS 2000/01 Klausur zur Vorlesung Biochemie III im WS 2000/01 am 15.02.2001 von 15.30 17.00 Uhr (insgesamt 100 Punkte, mindestens 40 erforderlich) Bitte Name, Matrikelnummer und Studienfach unbedingt angeben (3 1.

Mehr

1 Lebensformen: Zellen mit und ohne Kern... 23. 2 DNA: Träger der genetischen Information... 29

1 Lebensformen: Zellen mit und ohne Kern... 23. 2 DNA: Träger der genetischen Information... 29 Teil 1 Grundlagen 1 Lebensformen: Zellen mit und ohne Kern... 23 1.1 Einleitung... 23 1.2 Eukaryoten... 24 1.3 Prokaryoten... 26 1.3.1 Literatur... 27 2 DNA: Träger der genetischen Information... 29 2.1

Mehr

6. DNA -Bakteriengenetik

6. DNA -Bakteriengenetik 6. DNA -Bakteriengenetik Konzepte: Francis Crick DNA Struktur DNA Replikation Gentransfer in Bakterien Bakteriophagen 2. Welcher der folgenden Sätze entspricht der Chargaff-Regel? A) Die Menge von Purinen

Mehr

Q1 B1 KW 49. Genregulation

Q1 B1 KW 49. Genregulation Q1 B1 KW 49 Genregulation Transkription Posttranskription elle Modifikation Genregulation bei Eukaryoten Transkriptionsfaktoren (an TATA- Box) oder Silencer (verringert Transkription) und Enhancer (erhöht

Mehr

Molekularbiologie. fur Biologen, Biochemiker, Pharmazeuten und Mediziner. Verdammt clever!

Molekularbiologie. fur Biologen, Biochemiker, Pharmazeuten und Mediziner. Verdammt clever! Brochure More information from http://www.researchandmarkets.com/reports/3148661/ Molekularbiologie. fur Biologen, Biochemiker, Pharmazeuten und Mediziner. Verdammt clever! Description: Kompakt und»verdammt

Mehr

Grundlagen der Physiologie

Grundlagen der Physiologie (2) Grundlagen der Physiologie Klassifizierung und Stammbaum aller Lebewesen www.icbm.de/pmbio Taxonomie Ziel: System mit Übereinstimmung zur natürlichen Verwandtschaft, der Phylogenie 1 Taxonomie 2 Was

Mehr

Nukleinsäuren. 1.Theoretischer Hintergrund... 2. 1.1 Aufbau der DNA... 2. 1.2 Struktur und Replikation der DNA... 3

Nukleinsäuren. 1.Theoretischer Hintergrund... 2. 1.1 Aufbau der DNA... 2. 1.2 Struktur und Replikation der DNA... 3 Inhaltsverzeichnis 1.Theoretischer Hintergrund... 2 1.1 Aufbau der DNA... 2 1.2 Struktur und Replikation der DNA... 3 1.3 Struktur und Aufgaben der verschiedenen RNAs... 6 1.4 Methoden der Molekularbiologie...

Mehr

Humangenetik 3. 1 Sexuelle Fortpflanzung

Humangenetik 3. 1 Sexuelle Fortpflanzung Humangenetik 3. 1 Sexuelle Fortpflanzung Lehrplaneinheit Keimzellenbildung und Befruchtung 1 3. Genetik Hinweise Bedeutung der Meiose ohne Betrachtung der einzelnen Phasen Bedeutung der Meiose (Reduktion

Mehr

Aus der Reihe Daniels Genetik-Kompendium

Aus der Reihe Daniels Genetik-Kompendium Aus der Reihe Daniels Genetik-Kompendium Erstellt von Daniel Röthgens Inhalt : 1. Einleitung 2. Bestandteile der Nukleinsäuren 3. DNA / Struktur und genetische Spezifität 1 1. Einleitung Die Frage nach

Mehr

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath

Grundlagen Genetik. Dipl.- Psych. Silja Bellingrath Grundlagen Genetik Dipl.- Psych. Silja Bellingrath Infos zur Klausur Dauer: 11/2 Stunden (maximal) Keine Noten, nur bestanden versus nicht bestanden Inhalt: Grundlage sind die Folien zum Seminar; geprüft

Mehr

DNA versus RNA. RNA Instabilität

DNA versus RNA. RNA Instabilität DNA versus RNA DNA stellt den eigentlichen Speicher genetischer Information dar, während RNA als Informationsüberträger und katalytisch in der Proteinbiosynthese agiert. Warum dient DNA und nicht RNA als

Mehr

Bio Data Management. Kapitel 1 Motivation und Grundlagen

Bio Data Management. Kapitel 1 Motivation und Grundlagen Bio Data Management Kapitel 1 Motivation und Grundlagen Wintersemester 2014/15 Anika Groß Universität Leipzig, Institut für Informatik, Abteilung Datenbanken http://dbs.uni-leipzig.de Vorläufiges Inhaltsverzeichnis

Mehr

Chemische Evolution. Biologie-GLF von Christian Neukirchen Februar 2007

Chemische Evolution. Biologie-GLF von Christian Neukirchen Februar 2007 Chemische Evolution Biologie-GLF von Christian Neukirchen Februar 2007 Aristoteles lehrte, aus Schlamm entstünden Würmer, und aus Würmern Aale. Omne vivum ex vivo. (Alles Leben entsteht aus Leben.) Pasteur

Mehr

1. Fragentyp A Welche Aussage über Introns und Exons ist f a 1 sc h? A. Exons enthalten Protein-codierende Sequenzen. B. Reife mrna enthält Exon- und Intron-Abschnitte. C. Intron-Sequenzen werden im Zellkern

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Spleissen Dezember 2009 Elmar Schiebel, ZMBH

Spleissen Dezember 2009 Elmar Schiebel, ZMBH Spleissen Dezember 2009 Elmar Schiebel, ZMBH Bis 1970s: Eine Gen besteht aus einem Stück doppelsträngiger DNA. Dieses einfache Bild wurde 1977 durch die Entdeckung von Richard J. Roberts (Cold Spring Harbor

Mehr

Anabole Prozesse in der Zelle

Anabole Prozesse in der Zelle Anabole Prozesse in der Zelle DNA Vermehrung RNA Synthese Protein Synthese Protein Verteilung in der Zelle Ziel: Zellteilung (Wachstum) und Differenzierung (Aufgabenteilung im Organismus). 2016 Struktur

Mehr

Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7. Einführung 19

Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7. Einführung 19 Inhaltsverzeichnis Über die Autorin 7 Über die Überarbeiterin 7 Über die Übersetzer 7 Einführung 19 Über dieses Buch 19 Konventionen in diesem Buch 19 Was Sie nicht lesen müssen 20 Törichte Annahmen über

Mehr

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS

NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS (C) 2014 - SchulLV 1 von 8 Wortherkunft NEWS NEWS NEWS Banküberfall in der 11 Avenue NEWS NEWS NEWS Das ist dein erster Fall als Kriminalpolizist und gleich eine so große Sache: Ein Bankräuber ist nachts

Mehr

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen

Die kleinsten Viren kommen daher mit einem sehr geringen Informationsgehalt von nur 4 Genen aus, von denen Aus der Reihe Daniels Genetik-Kompendium Erstellt von Daniel Röthgens Inhalt 1. Einleitung 2. RNA-Viren 3. DNA-Viren 1. Einleitung Im folgenden werden einige für die Genetik bedeutungsvolle Viren vorgestellt.

Mehr

KV: DNA-Replikation Michael Altmann

KV: DNA-Replikation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: DNA-Replikation Michael Altmann Herbstsemester 2008/2009 Übersicht VL DNA-Replikation 1.) Das Zentraldogma der Molekularbiologie 1.) Semikonservative Replikation

Mehr

Einsatz Neuronaler Netze für die Erkennung und Klassifizierung von Promotorstrukturen in genomischen DNA Sequenzen

Einsatz Neuronaler Netze für die Erkennung und Klassifizierung von Promotorstrukturen in genomischen DNA Sequenzen Informatik VII - Theoretische Informatik und Grundlagen der künstlichen Intelligenz Einsatz Neuronaler Netze für die Erkennung und Klassifizierung von Promotorstrukturen in genomischen DNA Sequenzen Korbinian

Mehr

Eine zentrale Frage der molekularen Biologie beschäftigt. Jenseits des Genoms Alternatives Spleißen erhöht die Vielfalt des Transkriptoms

Eine zentrale Frage der molekularen Biologie beschäftigt. Jenseits des Genoms Alternatives Spleißen erhöht die Vielfalt des Transkriptoms ÜBERSICHT Tino Köster, Bielefeld, John WS Brown, Invergowrie (Schottland), Dorothee Staiger, Bielefeld Jenseits des Genoms Alternatives Spleißen erhöht die Vielfalt des Transkriptoms Alternatives Spleißen

Mehr

If you can't study function, study structure. Vom Molekül in der Ursuppe bis zur ersten Zelle war es ein langer Weg:

If you can't study function, study structure. Vom Molekül in der Ursuppe bis zur ersten Zelle war es ein langer Weg: Kapitel 4: ANATOMIE EINER EUKARYOTENZELLE Inhalt: EINLEITUNG... 53 BESTANDTEILE EINER EUKARYOTENZELLE... 55 MEMBRANVERBINDUNGEN... 57 GEWEBE UND ORGANE... 57 LITERATUR...57 LINKS... 57 Einleitung If you

Mehr

4 Transkription, Translation und der genetische Code

4 Transkription, Translation und der genetische Code Literatur 9 Transkription, Translation und der genetische ode Die in der Überschrift genannten Begriffe sind unter Molekularbiologen so etwas wie llerweltswörter: man muss sie kennen und problemlos benutzen

Mehr

Abschlussbericht der Projektgruppe 583

Abschlussbericht der Projektgruppe 583 Abschlussbericht der Projektgruppe 58 VATRAM VAriant Tolerant ReAd Mapper Benjamin Kramer, Jens Quedenfeld Sven Schrinner, Marcel Bargull Kada Benadjemia, Jan Stricker David Losch. März 5 Betreuer: Sven

Mehr

Molekulare Mechanismen der Signaltransduktion Transkription und Chromatinmodifikation

Molekulare Mechanismen der Signaltransduktion Transkription und Chromatinmodifikation Molekulare Mechanismen der Signaltransduktion Transkription und Chromatinmodifikation (Christian Schwerk) Literatur Molecular Cell Biology (Lodish, Berk, Matsudaira et al.) 5th Edition (Kapitel 10 & 11)

Mehr

MOL.504 Analyse von DNA- und Proteinsequenzen

MOL.504 Analyse von DNA- und Proteinsequenzen MOL.504 Analyse von DNA- und Proteinsequenzen Kurs 1 Monika Oberer, Karl Gruber MOL.504 Modul-Übersicht Einführung, Datenbanken BLAST-Suche, Sequenzalignment Proteinstrukturen Virtuelles Klonieren Abschlusstest

Mehr

Weitergabe genetischer Information: DNA-Replikation Beispiel: Escherichia coli.

Weitergabe genetischer Information: DNA-Replikation Beispiel: Escherichia coli. Weitergabe genetischer Information: DNA-Replikation Beispiel: Escherichia coli. zirkuläres bakterielles Chromosom Replikation (Erstellung einer identischen Kopie des genetischen Materials) MPM 1 DNA-Polymerasen

Mehr

Bio-Datenbanken. Einführung in die Bioinformatik

Bio-Datenbanken. Einführung in die Bioinformatik Bio-Datenbanken Einführung in die Bioinformatik Bearbeiter: Torsten Glomb Betreuer: Dr. Dieter Sosna Inhalt Einleitung I Proteine I.1 Aminosäuren I.2 Peptidbindung I.3 Primärstuktur: Sequenz der Aminosäuren

Mehr

Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Julius-Maximilians-Universität Würzburg. vorgelegt von Markus Weniger Würzburg

Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Julius-Maximilians-Universität Würzburg. vorgelegt von Markus Weniger Würzburg Genome Expression Pathway Analysis Tool Analyse und Visualisierung von Microarray Genexpressionsdaten unter genomischen, proteomischen und metabolischen Gesichtspunkten Dissertation zur Erlangung des naturwissenschaftlichen

Mehr

Eine wunderbare Reise durch die Laborwelten.

Eine wunderbare Reise durch die Laborwelten. Eine wunderbare Reise durch die Laborwelten. DNA-Chip-Technologie in der Molekularbiologie medi Zentrum für medizinische Bildung Biomedizinische Analytik Max-Daetwyler-Platz 2 3014 Bern Tel. 031 537 32

Mehr

alle Lebewesen bestehen aus Zellen kleinste isoliert noch lebensfähige und selbständige Bauelemente des Körpers

alle Lebewesen bestehen aus Zellen kleinste isoliert noch lebensfähige und selbständige Bauelemente des Körpers Anatomie/Physiologie 23.04.04 Zytologie (die Zelle) alle Lebewesen bestehen aus Zellen kleinste isoliert noch lebensfähige und selbständige Bauelemente des Körpers Zytologie befasst sich mit der komplexen

Mehr

Zusammenfassung Zellbiologie

Zusammenfassung Zellbiologie Zusammenfassung Zellbiologie Fragezeichen sind Regieanweisungen an mich selbst. omnis celula e celula Alle Angaben ohne Gewähr Zusammenfassung Zellbiologie I Seite 1 von 105 Kapitel 1 Einführung in die

Mehr