Versuch von Beadle und Tatum Verändertes Gen -> veränderter Phänotyp

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Versuch von Beadle und Tatum Verändertes Gen -> veränderter Phänotyp"

Transkript

1 Versuch von Beadle und Tatum Verändertes Gen -> veränderter Phänotyp Neurospora crassa Ein-Gen-ein-Enzym Hypothese Ein-Gen-ein-Polypeptid-Hypothese Ein-Gen-ein-Genprodukt-Hypothese Purves et al

2 Das zentral Dogma: Von der DNA zum Protein Replikation Transkription Translation Purves et al

3 Genexpression: Gen Abschnitt auf der DNA, der für ein Genprodukt kodiert, inkl. Kontrollregionen Expression Fluss von der genetischen Information (DNA) zum Genprodukt beteiligte Vorgänge sind: Transkription (DNA in RNA) Translation (RNA in Protein) findet in allen lebenden Zellen statt RNA Protein 3

4 Bei Prokaryoten in einem Kompartiment Purves et al Purves et al

5 Pro- und eukaryotische Genexpression DNA Nicht-Matrizenstrang (+) Matrizenstrang, codogen (-) RNA Transkription des Matrizenstranges Translation Protein 5

6 Transkription Purves et al

7 Die chemische Struktur der RNA RNA DNA RNA enthält den Zucker Ribose RNA enthält Uracil anstelle von Thymin 7

8 Die RNA-Polymerase transkribiert DNA RNA-Polymerase aus E. coli DNA-abhängige RNA-Polymerase Katalyse von Phosphatdiesterbindungen Verlängerung der wachsenden RNA Kette in 5 ->3 Richtung Substrat: Ribonukleosidtriphosphate, kein Primer α α σ β β Minimal (Core) Enzym, 4 UE: α 2,β,β Holoenzym, 5 UE: α 2,β,β,σ α: Struktur des Enzyms σ: Erkennung β: RNA-Synthese des Transkriptionsstarts β : Bindung an DNA 8

9 Promotor: Erkennungs- und Startpunkt für die RNA-Polymerase -35 -Region upstream -Bereich -10 -Region -1 keine 0 +1 Start der Transkription ATG nicht-transkribierte DNA transkribierte DNA Start der Translation Konsensussequenzen prokaryotischer Promotoren -10-Region = Pribnow-Box -35-Region lac ACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAA trp AAATGAGCTGTTGACAATTAATCATCGAACTAGTTAACTAGTACGCA pl TCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACAT Kons.-S TTGACA---17+/-1 bp-----tataat

10 Transkriptionszyklus einer bakteriellen RNA-Polymerase RNA σ-faktor Promotor Haarnadel RNA-Polymerase DNA 1. Bindung des RNA-Pol-Holoenzyms an den Promotor (geschlossener Komplex) 7. Freisetzung des Transkripts 6. Termination 2. Aufwinden der DNA (offener Komplex) 5. Elongationsphase mit hoher Prozessivität (50 nt/s) 3. Anfängliche Transkription (10 nt) Ribonukleosidtriphosphate RNA RNA 4. Ablösung des σ-faktors 10

11 Alternative Sigmafaktoren: Regulation der Genexpression bei E. coli Sigmafaktor Größe (kda) Funktion σ Standard-Sigmafaktor σ S 38 Hunger, Stress σ Hitzeschock 11

12 Transkriptionstermination bei E. coli Rho-unabhängige Termination Rho-abhängige Termination Haarnadelförmige Sekundärstruktur im 3 Nichtkodierungsbereich einer mrna Rho-Protein (Hexamer) lagert sich an mrna spaltet ATP 12

13 Transkripte sind länger als die kodierende Region Promotor +1 Ende Terminator DNA Kodierende Region 5 3 RNA-Transkript Leadersequenz 5 untranslatierter Bereich Trailer-Abschnitt 3 untranslatierter Bereich 13

14 Prokaryot Eukaryot RNA-Polymerase polycistronische mrna RNA-Polymerase Cap-Struktur monocistronische mrna Poly(A)-Schwanz Kernpore Translation noch während der Transkription mrna muss aus dem Kern ausgeschleust werden 14

15 Die drei durch die Transkription erzeugten Haupttypen von RNA-Molekülen Brown

16 Eukaryoten: drei DNA-abhängige RNA-Polymerasen im Kern RNA-Polymerase Produkt Lokalisierung RNA-Pol I: rrna (28S, 18S, 5,8S) Nukleolus RNA-Pol II: mrna (Protein-kodierende Gene) Nukleoplasma snornas, einige snrnas RNA-Pol III: 5S rrna, trnas, viele snrnas Nukleoplasma interne Promotoren! Zusätzlich RNA-Polymerasen in Mitochondrien und Chloroplasten mt-rna-pol mitochondriale Transkripte Mitochondrien (nur eine UE) (kernkodiert) pt-rna-pol (PEP) plastidäre Transkripte Plastiden (E.coli-ähnlich) (plastidenkodiert) pt-rna-pol (NEP) plastidäre Transkripte Plastiden (nur eine UE) (kernkodiert) 16

17 Eukaryotische Promotoren sind weniger konserviert prokaryotischer Promotor eukaryotischer RNA-Pol II Promotor Jannig & Knust

18 Struktur und Transkription eines eukaryotischen Gens Purves et al

19 Transkription eukaryotischer DNA durch die RNA-Polymerase II benötigt viele allgemeine Transkriptionsfaktoren (TF) TFIIH 19

20 Eukaryotische Gene enthalten kodierende Exon- und nicht-kodierende Intron-Bereiche, eukaryotische RNA-Pol II-Transkripte werden prozessiert 1. Anfügen des Cap am 5 Ende 2. Polyadenylierung am 3 Ende 3. Spleißen Alle drei Prozesse finden im Zellkern statt! 20

21 Capping des Transkriptes am 5 Ende: Anfügen eines modifizierten Guaninnukleotids 5 Cap signalisiert 5 Ende eukaroytischer mrnas Wird während der Transkription Methylgruppe angehängt 5 Cap wichtig für Export der mrna ins Cytosol und die Translation 5-5--Bindung 7-Methyl-Guanosintriphosphat 21

22 Polyadenylierung am 3 -Ende 3 -Poly(A)-Schwanz signalisiert 3 -Ende eukaroytischer mrnas Poly(A)-Polymerase (Polymerisation ohne Matrize!) A-Nukleotide werden angehängt 3 -Poly(A)-Schwanz wichtig für Export der mrna ins Cytosol, für die Stabilität und die Translation Nukleotide < 30 Nukleotide Spaltung durch Endonukleasekomplex wird abgebaut Poly(A)-Anheftung durch Poly(A)-Polymerase 22

23 Spleißen des Transkripts Spleißen = Entfernen der Intronsequenzen aus dem Primärtranskript, Verknüpfung der Exons Nukleotidsequenzen markieren die Spleißstellen Spleißen wird durch Spleißosomen ausgeführt Spleißosomen sind aus Proteinen und snrnas zusammengesetzt Intron wird entfernt Teil der mrna 23 Janning & Knust 14.9

24 Das Spleißosom, eine Spleißmaschine Purves et al

25 Eukaryoten: Kontrolle der Transkription durch die Chromatinstruktur Modifikation (z. B. Acetylierung) der Chromatinproteine (Histone) reguliert die Transkription Nukleosom 10 nm Histonoktamer Histon- Deacetylierung Histon-Deacetylase (HDAC) DNA offenes Chromatin -> transkriptionsaktiv Histon- Acetylierung Histon-Acetyltransferase (HAT) kondensiertes Chromatin -> transkriptionsinaktiv 30 nm 25 Janning & Knust 17.16

26 Histon-Acetyltransferase (HAT) Reguliert Zugänglichkeit der DNA für Proteine der Transkriptionsmaschinerie Histon-Acetyltransferase (HAT) acetyliert Histone in der Nähe der TATA-Box Transkriptionsfaktor RNA-Polymerase II Histone DNA Ac Transkription Nukleosom 26

27 Modifikation des Chromatins Histon- Deacetylierung Histon-Methylierung DNA-Methylierung Histon- Acetylierung Histon-Demethylierung DNA-Demethylierung 27

28 Initiation der Genexpression: Unterschiede zwischen Pro- und Eukaryoten Prokaryoten Eukaryoten RNA-Polymerase eine RNA-Polymerase, drei RNA-Polymerasen, einige Sigma-Faktoren viele allgemeine Transkriptionsfaktoren regulatorische Transkriptions- ja ja; zahlreich faktoren Transkript meist polycistronisch, monocistronisch, keine Modifikation Modifikation am 5 - u. 3 -Ende Introns i.d.r. nicht vorhanden, meist vorhanden, kein Spleißen Spleißen Trennung von Transkription u. nein ja (Kern/Cytoplasma) Translation Einfluss der Chromatinstruktur kein Chromatin! ja 28

29 Die drei durch die Transkription erzeugten Haupttypen von RNA-Molekülen Brown

30 Ribosomale RNA Purves et al Ribosomen bestehen aus RNA (rrna) und Proteinen und sind aus zwei Untereinheiten zusammengesetzt 30

31 Ribosomen 31

32 Svedbergeinheit S Maß für Sedimentationsgeschwindigkeit bei Zentrifugation in einem Dichtegradienten S-Wert abhängig von Größe, Form, Volumen und Dichte des Partikels/Moleküls je größer und kompakter, desto größer ist Wanderungsgeschwindigkeit Zellfraktionierung durch differentielle Zentrifigation, Sedimentationsanalyse oder Dichtegradientenzentrifugation (Saccharose) 32

33 Dichten und S-Werte von Zellmaterial 33

34 Zusammensetzung der Ribosomen bei Pro- und Eukaryoten Prokaryoten Eukaryoten Größe rrna Proteine Größe rrna Proteine (Nukleotide) (Nukleotide) große UE 50S 23S rrna (2904) 5S rrna (120) L1, L2, L3, etc. Ges.: >30 60S 28S rrna (4818) 5,8S rrna (160) L1, L2, L3, etc. Ges.: ca. 50 5S rrna (120) kleine UE 30S 16S rrna (1542) S1, S2, S3, etc. Ges.: >20 40S 18S rrna (1874) S1, S2, S3, etc. Ges.: ca

35 Molekulare Feinstruktur eines 70S Ribosoms Purves et al b 35

36 Sekundärstruktur der 16 S rrna von E. coli 36

37 Prozessierung der eukaryotischen rrna Janning & Knust 15.1e 37

38 DNA, die rrna kodiert ist repetitiv Purves et al

39 Nukleolus Kernkompartiment Ort der rrna Synthese Nukleolus besteht aus DNA, RNA und Proteinen Prozessierung der prä-rrna, Zusammensetzung präribosomaler Partikel Nukleolus-Organisator (NO) besteht aus rdna, die von mehreren Chromosomen stammen kann und tandemartig abgeordnete rdna enthält 39

40 trnas fungieren als Adapter ( trna Moleküle pro Bakterien-Zelle) 40

41 trnas bestehen aus Nukleotiden Kleeblattstruktur Akzeptorarm bindet Aminosäure; 3 Ende endet immer auf -CCA DHU-Arm enthält ungewöhnliches Pyrimidin Dihydrouracil Anticodonarm erkennt mrna Variabler Arm enthält variable Anzahl an Nukleotiden TψC enthält die Abfolge T, Pseudouracil und C 41

42 Tertiärstruktur der trna jede trna hat individuelle 3D-Struktur 42

43 Uridin Zucker 43

44 Der genetische Code 44

45 Die 20 in Proteinen vorkommenden Aminosäuren Janning & Knust

46 Problem: 4 Buchstaben A,T,G,C -> aber 20 Aminosäuren Singulet-Code: 4 Codons Duplett-Code: 4 2 = 16 Codons Triplett-Code: 4 3 = 64 Codons Purves et al

47 Frage: Welches Triplett codiert für welche Aminosäure? Versuch von Nirenberg und Matthaei Purves et al

48 Der Code ist degeneriert, d.h. mehrere Tripletts codieren eine Aminosäure (Ausnahme: Tryptophan und Methionin) Synonyme Codons sind sich meist ähnlich, so dass die ersten beiden Basen eines Tripletts oft schon die Aminosäure spezifizieren (Ausnahmen: Leucin und Arginin) Leucin Leucin Arginin Arginin Purves et al

49 Die "Wobble"-Hypothese (F. Crick 1965) "wobble" = "Schwanken, Wackeln" Eine einzelne z. B. mit Glycin beladene trna kann drei verschiedene Codons auf der mrna erkennen 49

50 "Wobble" Abweichungen bei der Bindung des Anticodons an das Codon 50

51 Der genetische Code ist fast universell und gilt für alle Organismen Es gibt wenige Ausnahmen (insbesondere in Mitochondrien- Genomen) z.b. UGA (normalerweise Stop) in Mitochondrien Tryptophan und AUA (normalerweise Isoleucin) in Mitochondrien Methionin 51

52 Verwendung von Code-Wörtern (Codon usage) Ein Beispiel: 6 Arginin Codons CGT 43% CGC 32% CGA 7% CGG 8% AGA 9% AGG 1% korrespondiert mit Vorkommen synonymer trnas d.h. es gibt seltene Codons (Speziesspezifisch) Regulation von Genaktivität, da seltene Codons zu schwächerer Expression führen 52

Eukaryotische messenger-rna

Eukaryotische messenger-rna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende u.u. nicht-codierende Bereiche (Introns) Spleißen von prä-mrna Viele Protein-codierende Gene in Eukaryoten sind durch nicht-codierende

Mehr

Posttranskriptionale RNA-Prozessierung

Posttranskriptionale RNA-Prozessierung Posttranskriptionale RNA-Prozessierung Spaltung + Modifikation G Q Spleissen + Editing U UUU Prozessierung einer prä-trna Eukaryotische messenger-rna Cap-Nukleotid am 5 -Ende Polyadenylierung am 3 -Ende

Mehr

Zentrales Dogma der Biologie

Zentrales Dogma der Biologie Zentrales Dogma der Biologie Transkription: von der DNA zur RNA Biochemie 01/1 Transkription Biochemie 01/2 Transkription DNA: RNA: Biochemie 01/3 Transkription DNA: RNA: Biochemie 01/4 Transkription RNA:

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 3. Aus welchen vier Nukleotiden ist RNA aufgebaut? 4. DNA RNA 5. Ein Wissenschaftler

Mehr

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine

Vom Gen zum Protein. Zusammenfassung Kapitel 17. Die Verbindung zwischen Gen und Protein. Gene spezifizieren Proteine Zusammenfassung Kapitel 17 Vom Gen zum Protein Die Verbindung zwischen Gen und Protein Gene spezifizieren Proteine Zellen bauen organische Moleküle über Stoffwechselprozesse auf und ab. Diese Prozesse

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten

DNA mrna Protein. Initiation Elongation Termination. RNA Prozessierung. Unterschiede Pro /Eukaryoten 7. Transkription Konzepte: DNA mrna Protein Initiation Elongation Termination RNA Prozessierung Unterschiede Pro /Eukaryoten 1. Aus welchen vier Nukleotiden ist RNA aufgebaut? 2. RNA unterscheidet sich

Mehr

KV: Genexpression und Transkription Michael Altmann

KV: Genexpression und Transkription Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Genexpression und Transkription Michael Altmann Herbstsemester 2008/2009 Übersicht VL Genexpression / Transkription 1.) Was ist ein Gen? 2.) Welche Arten

Mehr

KV: Translation Michael Altmann

KV: Translation Michael Altmann Institut für Biochemie und Molekulare Medizin KV: Translation Michael Altmann Herbstsemester 2008/2009 Übersicht VL Translation 1.) Genexpression 2.) Der genetische Code ist universell 3.) Punktmutationen

Mehr

Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Wobei jeweils eine AS von 3 Basen codiert wird..

Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Wobei jeweils eine AS von 3 Basen codiert wird.. Proteinbiosynthese Es ist die Zeit gekommen, zu verstehen, wie es zur Proteinbiosynthese kommt?! Alle Proteine, sind über die DNA codiert Wobei jeweils eine AS von 3 Basen codiert wird.. GENETISCHER CODE

Mehr

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit

In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit In den Proteinen der Lebewesen treten in der Regel 20 verschiedene Aminosäuren auf. Deren Reihenfolge muss in der Nucleotidsequenz der mrna und damit in der Nucleotidsequenz der DNA verschlüsselt (codiert)

Mehr

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.)

DNA Replikation ist semikonservativ. Abb. aus Stryer (5th Ed.) DNA Replikation ist semikonservativ Entwindung der DNA-Doppelhelix durch eine Helikase Replikationsgabel Eltern-DNA Beide DNA-Stränge werden in 5 3 Richtung synthetisiert DNA-Polymerasen katalysieren die

Mehr

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird

Molekularbiologie 6c Proteinbiosynthese. Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird Molekularbiologie 6c Proteinbiosynthese Bei der Proteinbiosynthese geht es darum, wie die Information der DNA konkret in ein Protein umgesetzt wird 1 Übersicht: Vom Gen zum Protein 1. 2. 3. 2 Das Dogma

Mehr

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten.

Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Was ist der Promotor? Antwort: Eine spezielle Nucleotidsequenz auf der DNA, an der die RNA-Polymerase bindet um die Transkription zu starten. Wie bezeichnet man den Strang der DNA- Doppelhelix, der die

Mehr

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt

Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt Bei der Translation wird die Aminosäuresequenz eines Polypeptids durch die Sequenz der Nukleotide in einem mrna- Molekül festgelegt 5 mrna Nukleotid 3 N-Terminus Protein C-Terminus Aminosäure Es besteht

Mehr

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren...

Molekulargenetik Biologie am Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... Molekulargenetik Inhaltsverzeichnis Die Begriffe DNA, Nukleotid, Gen, Chromosom und Epigenom definieren... 2 Beschreiben, wie die DNA aufgebaut ist... 3 Den Ablauf der Replikation erklären und dabei die

Mehr

Molekulargenetik der Eukaryoten WS 2014/15, VL 11. Erwin R. Schmidt Institut für Molekulargenetik

Molekulargenetik der Eukaryoten WS 2014/15, VL 11. Erwin R. Schmidt Institut für Molekulargenetik Molekulargenetik der Eukaryoten WS 2014/15, VL 11 Erwin R. Schmidt Institut für Molekulargenetik Abhängig von der Genklasse: Genstruktur der Eukaryoten 1. RNA Pol I Gene: 18S, 5,8S, 28S rrna 2. RNA Pol

Mehr

1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie:

1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie: 1. Skizzieren Sie schematisch ein Gen mit flankierender Region. Bezeichnen und beschriften Sie: - 5 UTR (leader) - 3 UTR (trailer) - Terminator - Stopp-Kodon - Initiationskodon - Transkriptionsstartstelle

Mehr

Expression der genetischen Information Skript: Kapitel 5

Expression der genetischen Information Skript: Kapitel 5 Prof. A. Sartori Medizin 1. Studienjahr Bachelor Molekulare Zellbiologie FS 2013 12. März 2013 Expression der genetischen Information Skript: Kapitel 5 5.1 Struktur der RNA 5.2 RNA-Synthese (Transkription)

Mehr

Biochemie Vorlesung Die ersten 100 Seiten

Biochemie Vorlesung Die ersten 100 Seiten Biochemie Vorlesung 11-15 Die ersten 100 Seiten 1. Unterschiede der Zellen Eukaryoten- Prokaryoten Eukaryoten: - Keine Zellwand - Intrazelluläre Membransysteme - Kernhülle mit 2 Membranen und Kernporen

Mehr

Biochemie Tutorium 9. RNA, Transkription

Biochemie Tutorium 9. RNA, Transkription Biochemie Tutorium 9 RNA, Transkription IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der Desoxyribonukleinsäure (DNA); Exon, Intron 3.1.2

Mehr

Genaktivierung und Genexpression

Genaktivierung und Genexpression Genaktivierung und Genexpression Unter Genexpression versteht man ganz allgemein die Ausprägung des Genotyps zum Phänotyp einer Zelle oder eines ganzen Organismus. Genotyp: Gesamtheit der Informationen

Mehr

Promotor kodierende Sequenz Terminator

Promotor kodierende Sequenz Terminator 5.2 Genexpression Sequenz in eine RNA-Sequenz. Die Enzyme, die diese Reaktion katalysieren, sind die DNA-abhängigen RNA-Polymerasen. Sie bestehen aus mehreren Untereinheiten, die von den Pro- bis zu den

Mehr

Thema Transkription und Genregulation Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung

Thema Transkription und Genregulation Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema Transkription und Genregulation 21.12.2012 Erwin R. Schmidt Institut für Molekulargenetik Gentechnologische Sicherheitsforschung & Beratung Thema: Gene und Transkription Was ist ein Gen? Heute: Gendefinition:

Mehr

Proteinbiosynthese. Prof. Dr. Albert Duschl

Proteinbiosynthese. Prof. Dr. Albert Duschl Proteinbiosynthese Prof. Dr. Albert Duschl DNA/RNA/Protein Im Bereich von Genen sind die beiden Stränge der DNA nicht funktionell äquivalent, weil nur einer der beiden Stränge transkribiert, d.h. in RNA

Mehr

Transkription 3. Teil. Posttranskriptionale Modifikationen

Transkription 3. Teil. Posttranskriptionale Modifikationen Transkription 3. Teil Posttranskriptionale Modifikationen Gliederung des Vortrags 1. Reifung der t-rna 2. Modifikationen der Prä-mRNA 5 Capping 3 Schwanzbildung RNA-Editing Spleißen Alternatives Spleißen

Mehr

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016

Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Biologie I/B: Klassische und molekulare Genetik, molekulare Grundlagen der Entwicklung Theoretische Übungen SS 2016 Fragen für die Übungsstunde 4 (20.06. 24.06.) Regulation der Transkription II, Translation

Mehr

Transkription und Regulation der Genexpression

Transkription und Regulation der Genexpression Transkription und Regulation der Genexpression Dr. Laura Bloch Laura.Bloch@med.uni-jena.de 1. Das zentrale Dogma der Molekularbiologie 24.11.2014 Laura Bloch 2 2. RNA vs. DNA Desoxyribose und Ribose die

Mehr

Transkription Teil 2. - Transkription bei Eukaryoten -

Transkription Teil 2. - Transkription bei Eukaryoten - Transkription Teil 2 - Transkription bei Eukaryoten - Inhalte: Unterschiede in der Transkription von Pro- und Eukaryoten Die RNA-Polymerasen der Eukaryoten Cis- und trans-aktive Elemente Promotoren Transkriptionsfaktoren

Mehr

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang.

Die DNA Replikation. Exakte Verdopplung des genetischen Materials. Musterstrang. Neuer Strang. Neuer Strang. Eltern-DNA-Doppelstrang. Die DNA Replikation Musterstrang Neuer Strang Eltern-DNA-Doppelstrang Neuer Strang Musterstrang Exakte Verdopplung des genetischen Materials Die Reaktion der DNA Polymerase 5`-Triphosphat Nächstes Desoxyribonucleosidtriphosphat

Mehr

Das zentrale Dogma der Molekularbiologie:

Das zentrale Dogma der Molekularbiologie: Das zentrale Dogma der Molekularbiologie: DNA Transkription RNA Translation Protein 1 Begriffserklärungen GENOM: Ist die allgemeine Bezeichnung für die Gesamtheit aller Gene eines Organismus GEN: Ist ein

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus:

Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Die gentechnische Produktion von Insulin - Selbstlerneinheit zur kontextorientierten Wiederholung der molekularen Genetik Das komplette

Mehr

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.)

Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen. Abb. aus Stryer (5th Ed.) Elektronenmikroskopie zeigte die Existenz der A-, P- und E- trna-bindungsstellen Die verschiedenen Ribosomen-Komplexe können im Elektronenmikroskop beobachtet werden Durch Röntgenkristallographie wurden

Mehr

Spleißen und Prozessieren von mrna

Spleißen und Prozessieren von mrna Spleißen und Prozessieren von mrna Spleißen, die Aneinanderreihung von Exons: Prä-mRNAs sind 4-10x länger als die eigentlichen mrnas. Funktionelle Sequenzabschnitte in den Introns der Prä-mRNA: 5 -Spleißstelle

Mehr

RNA und Expression RNA

RNA und Expression RNA RNA und Expression Biochemie RNA 1) Die Transkription. 2) RNA-Typen 3) RNA Funktionen 4) RNA Prozessierung 5) RNA und Proteinexpression/Regelung 1 RNA-Typen in E. coli Vergleich RNA-DNA Sequenz 2 Die Transkriptions-Blase

Mehr

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination

Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation Elongation Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation Elongation Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse huma n bacter

Mehr

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom

Von der DNA zum Eiweißmolekül Die Proteinbiosynthese. Ribosom Von der DNA zum Eiweißmolekül Die Proteinbiosynthese Ribosom Wiederholung: DNA-Replikation und Chromosomenkondensation / Mitose Jede Zelle macht von Teilung zu Teilung einen Zellzyklus durch, der aus einer

Mehr

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang.

1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! nicht-codogener Strang. ARBEITSBLATT 1 Transkription 1. Beschriften Sie in der Abbildung die verschiedenen Bereiche auf der DNA und beschreiben Sie ihre Funktion! Bindungsstelle für RNA-Polymerase RNA-Polymerase nicht-codogener

Mehr

TRANSKRIPTION I. Die Herstellung von RNA bei E-Coli

TRANSKRIPTION I. Die Herstellung von RNA bei E-Coli TRANSKRIPTION I Die Herstellung von RNA bei E-Coli Inhalt Aufbau der RNA-Polymerase Promotoren Sigma-Untereinheit Entwindung der DNA Elongation Termination der Transkription Modifizierung der RNA Antibiotika

Mehr

Proteinbiosynthese. Prof. Dr. Albert Duschl

Proteinbiosynthese. Prof. Dr. Albert Duschl Proteinbiosynthese Prof. Dr. Albert Duschl DNA/RNA/Protein Im Bereich von Genen sind die beiden Stränge der DNA nicht funktionell äquivalent, weil nur einer der beiden Stränge transkribiert, d.h. in RNA

Mehr

Gen Protein Aufgaben: Edel LK-Bio BI-3

Gen Protein Aufgaben: Edel LK-Bio BI-3 Proteinbiosynthese Von der DNA zum Protein Dieses Lernprogramm zeigt Ihnen in einem vereinfachten Modell den im Zellinneren ablaufenden Prozess vom Gen auf der DNA zum Protein. Aufgaben: 1 Betrachten Sie

Mehr

Einleitung. Replikation

Einleitung. Replikation (C) 2014 - SchulLV 1 von 9 Einleitung Der Action-Film von gestern Abend war wieder ziemlich spannend. Mal wieder hat es der Superheld geschafft, alle Zeichen richtig zu deuten, diverse Geheimcodes zu knacken

Mehr

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05

Überblick von DNA zu Protein. Biochemie-Seminar WS 04/05 Überblick von DNA zu Protein Biochemie-Seminar WS 04/05 Replikationsapparat der Zelle Der gesamte Replikationsapparat umfasst über 20 Proteine z.b. DNA Polymerase: katalysiert Zusammenfügen einzelner Bausteine

Mehr

Struktur und Eigenschaften der DNA in Pro und Eukaryonten

Struktur und Eigenschaften der DNA in Pro und Eukaryonten Struktur und Eigenschaften der DNA in Pro und Eukaryonten Bausteine von Nukleinsäuren: Nukleotide bestehen aus 3 Komponenten: C5-Zucker (RNA: D-Ribose, DNA: 2-Deoxy-D-ribose) Purin- und Pyrimidin-Basen

Mehr

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie

Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß in der Zelle - Grundlagen der Biochemie Datenspeicherung und Datenfluß der Zelle Transkription DNA RNA Translation Protein Aufbau I. Grundlagen der organischen Chemie und

Mehr

Zentrales Dogma der Biochemie Zyklus eines Retrovirus Der Fluss der genetischen Information verläuft von der DNA zur RNA zum Protein. Zumindest bis 19

Zentrales Dogma der Biochemie Zyklus eines Retrovirus Der Fluss der genetischen Information verläuft von der DNA zur RNA zum Protein. Zumindest bis 19 Unterschiede DNA < > RNA Posttranskriptionale Veränderungen EML BIORUNDE DNA/RNA II Zentrales Dogma der Biochemie Der Fluss der genetischen Information verläuft von der DNA zur RNA zum Protein. Outline

Mehr

PROTEINBIOSYNTHESE "Das zentrale Dogma der Molekularbiologie"

PROTEINBIOSYNTHESE Das zentrale Dogma der Molekularbiologie PROTEINBIOSYNTHESE "Das zentrale Dogma der Molekularbiologie" Die für die Synthese von Eiweißstoffen notwendigen Schritte sind: (1) Replikation der DNA: Vor jeder Zellteilung wird die gesamte zelluläre

Mehr

Übung 11 Genregulation bei Prokaryoten

Übung 11 Genregulation bei Prokaryoten Übung 11 Genregulation bei Prokaryoten Konzepte: Differentielle Genexpression Positive Genregulation Negative Genregulation cis-/trans-regulation 1. Auf welchen Ebenen kann Genregulation stattfinden? Definition

Mehr

Biologie für Mediziner

Biologie für Mediziner Biologie für Mediziner - Zellbiologie 1 - Zellkern Endoplasmatisches Retikulum Golgi-Apparat Eukaryoten: Kompartimentierung Zellkern: Aufbau umgeben von einer Doppelmembran äussere Membran geht direkt

Mehr

Transkription und Translation sind in Eukaryoten räumlich und zeitlich getrennt. Abb. aus Stryer (5th Ed.)

Transkription und Translation sind in Eukaryoten räumlich und zeitlich getrennt. Abb. aus Stryer (5th Ed.) Transkription und Translation sind in Eukaryoten räumlich und zeitlich getrennt Die Initiation der Translation bei Eukaryoten Der eukaryotische Initiationskomplex erkennt zuerst das 5 -cap der mrna und

Mehr

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene

Entwicklungs /gewebespezifische Genexpression. Coexpression funktional überlappender Gene Übung 11 Genregulation bei Prokaryoten Konzepte: Entwicklungs /gewebespezifische Genexpression Coexpression funktional überlappender Gene Positive Genregulation Negative Genregulation cis /trans Regulation

Mehr

Vorlesung Molekulare Humangenetik

Vorlesung Molekulare Humangenetik Vorlesung Molekulare Humangenetik WS 2013/2014 Dr. Shamsadin DNA-RNA-Protein Allgemeines Prüfungen o. Klausuren als indiv. Ergänzung 3LP benotet o. unbenotet Seminar Block 2LP Vorlesung Donnerstags 14-16

Mehr

I Allgemeine Grundlagen und Präanalytik

I Allgemeine Grundlagen und Präanalytik I Allgemeine Grundlagen und Präanalytik Leitfaden Molekulare Diagnostik. Herausgegeben von Frank Thiemann, Paul M. Cullen und Hanns-Georg Klein Copyright 2006 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Mehr

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS)

Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) N U C L E I N S Ä U R E N Der Träger aller genetischen Informationen ist die D N A - Desoxyribonucleic acid (Desoxyribonucleinsäure, DNS) BAUSTEINE DER NUCLEINSÄUREN Die monomeren Bausteine der Nucleinsäuren

Mehr

BCDS - Biochemische Datenbanken und Software

BCDS - Biochemische Datenbanken und Software BCDS - Biochemische Datenbanken und Software Seminarinhalte Bioinformatische Genom- und Proteomanalyse Literaturrecherche und Zitation Naturwissenschaftliche Software Termine 25. Mai, 1. Juni, 8. Juni,

Mehr

Institut für Biochemie und Molekulare Medizin. Lecture 1 Translational components. Michael Altmann FS 2011

Institut für Biochemie und Molekulare Medizin. Lecture 1 Translational components. Michael Altmann FS 2011 Institut für Biochemie und Molekulare Medizin Lecture 1 Translational components Michael Altmann FS 2011 Gene Expression Fliessdiagramm der eukaryotischen Genexpression Die Expression eines Gens kann auf

Mehr

Vorlesung Allgemeine und Molekulare Genetik Transkription und Genregulation Erwin R. Schmidt

Vorlesung Allgemeine und Molekulare Genetik Transkription und Genregulation Erwin R. Schmidt Vorlesung Allgemeine und Molekulare Genetik Transkription und Genregulation Erwin R. Schmidt 16. 01. 2015 Gen für Lac-Repressor Lac(tose)-Operon Lac-Repressor Ohne Lactose bindet der Repressor an den Operator

Mehr

1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3

1. Nachschreibeklausur zur Vorlesung Genetik im WS 09/10 A. Matrikel-Nr.: Versuch: 1 2 3 1. Nachschreibeklausur zur Vorlesung "Genetik" im WS 09/10 A Modul: Studiengang: Matrikel-Nr.: Versuch: 1 2 3 Vollständiger Name in Druckbuchstaben (Vorname Nachname): Jena, 01.04.2010, 10 12 Uhr; Unterschrift:

Mehr

15.2 Transkription bei E. coli

15.2 Transkription bei E. coli 494 15 Genexpression und ihre Kontrolle Abb. 15.3 Schema des Transkriptions-/Translationskomplexes in E. coli. Aus dem dichten Knäuel der chromosomalen DNA im Nucleoid (rot) ragen DNA-Domänen hervor, die

Mehr

Eukaryoten und Prokaryoten

Eukaryoten und Prokaryoten Eukaryoten und Prokaryoten Biochemie Inhalt Zellen Prokaryoten, Eukaryoten Unterschiede und Ähnlichkeiten Zellstrukturen Evolution der Zellen Entwicklung von Mitochondrien und Chloroplasten Angriffsmöglichkeiten

Mehr

Zellstrukturen und ihre Funktionen Zellkern (inkl. Chromosomen)

Zellstrukturen und ihre Funktionen Zellkern (inkl. Chromosomen) Zellstrukturen und ihre Funktionen Zellkern (inkl. Chromosomen) Nukleus aufgebaut aus Kernmembran = Kontinuum aus rauem Endoplasmatischem Reticulum, Kernplasma, Chromatin, Nucleolen 3 verschiedene Zustände

Mehr

Vorlesungsthemen Mikrobiologie

Vorlesungsthemen Mikrobiologie Vorlesungsthemen Mikrobiologie 1. Einführung in die Mikrobiologie B. Bukau 2. Zellaufbau von Prokaryoten B. Bukau 3. Bakterielles Wachstum und Differenzierung B. Bukau 4. Bakterielle Genetik und Evolution

Mehr

Eine neue RNA-Welt. Uralte RNA-Welt Am Anfang der Entstehung des Lebens. Bekannte RNA-Welt Protein-Synthese. Neue RNA-Welt Regulatorische RNA-Moleküle

Eine neue RNA-Welt. Uralte RNA-Welt Am Anfang der Entstehung des Lebens. Bekannte RNA-Welt Protein-Synthese. Neue RNA-Welt Regulatorische RNA-Moleküle RNAs Eine neue RNA-Welt 1. Uralte RNA-Welt Am Anfang der Entstehung des Lebens Bekannte RNA-Welt Protein-Synthese Neue RNA-Welt Regulatorische RNA-Moleküle 2. Eine neue RNA-Welt die Anzahl der nicht-kodierenden

Mehr

GENETIK. für Studierende. Michaela Aubele. für Ahnungslose. Eine Einstiegshilfe. 2. Auflage. Dr. Michaela Aubele, München.

GENETIK. für Studierende. Michaela Aubele. für Ahnungslose. Eine Einstiegshilfe. 2. Auflage. Dr. Michaela Aubele, München. Michaela Aubele GENETIK für Ahnungslose Eine Einstiegshilfe für Studierende 2. Auflage von Prof. Dr. Michaela Aubele, München Mit 52 Abbildungen und 33 Tabellen S. Hirzel Verlag die VII Vorwort V Kurzer

Mehr

Genetik für Ahnungslose

Genetik für Ahnungslose Genetik für Ahnungslose Eine Einstiegshilfe für Studierende von Michaela Aubele Mit 50 Abbildungen, 29 Tabellen S. Hirzel Verlag Stuttgart VII Inhalt Vorwort V 1 Die kleinste Einheit des Lebens - die Zelle

Mehr

Wiederholunng. Klassische Genetik

Wiederholunng. Klassische Genetik Wiederholunng Klassische Genetik Mendelsche Regeln Uniformitätsregel Spaltungsregel Freie Kombinierbarkeit Koppelung von Genen Polygene: mehre Gene für ein Merkmal Pleiotropie: 1 Gen steuert mehrere Merkmale

Mehr

4. Genetische Mechanismen bei Bakterien

4. Genetische Mechanismen bei Bakterien 4. Genetische Mechanismen bei Bakterien 4.1 Makromoleküle und genetische Information Aufbau der DNA Phasen des Informationsflusses Vergleich der Informationsübertragung bei Pro- und Eukaryoten 4.2 Struktur

Mehr

Inhalt Genexpression Microarrays E-Northern

Inhalt Genexpression Microarrays E-Northern Inhalt Genexpression Microarrays E-Northern Genexpression Übersicht Definition Proteinbiosynthese Ablauf Transkription Translation Transport Expressionskontrolle Genexpression: Definition Realisierung

Mehr

Translation. Auflesung- Proteinsynthese

Translation. Auflesung- Proteinsynthese Translation Auflesung- Proteinsynthese Proteinsynthese DNA mrna Transkription elágazási hely Translation Polypeptid Vor dem Anfang Beladen der trnas spezifische Aminosäure + spezifische trna + ATP Aminoacyl-tRNA

Mehr

Unterschiede zwischen Prokaryoten und. Eukaryont. Unterschiede prokaryotische eukaryotische Zelle. Zellaufbau Prokaryoten. Zellaufbau Eukaryoten

Unterschiede zwischen Prokaryoten und. Eukaryont. Unterschiede prokaryotische eukaryotische Zelle. Zellaufbau Prokaryoten. Zellaufbau Eukaryoten Unterschiede zwischen Prokaryoten und Prokaryoten lassen sich in 2 Reiche unterteilen: Eubakterien und Archaebakterien werden in 4 Reiche unterteilt: Protozoen (Einzeller), Pilze, Pflanzen und Tiere Unterschiede

Mehr

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion

Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Assoc. Prof. PD Mag. Dr. Aufbau und Funktion des Genoms: Von der Genstruktur zur Funktion Wien, 2013 Währinger Straße 10, A-1090 Wien helmut.dolznig@meduniwien.ac.at www.meduniwien.ac.at/medizinische-genetik

Mehr

Proteinbiosynthese: Transkripion:

Proteinbiosynthese: Transkripion: Proteinbiosynthese: - Basensequenz der DNA wird in die Basensequenz der RNA übersetzt (Transkription) - Übersetzen der mrna in die spezifische Aminosäuresequenz (Translation) - Bei Eukaryoten sind Transkription

Mehr

Genexpression und Genregulation in Prokaryoten

Genexpression und Genregulation in Prokaryoten Genexpression und Genregulation in Prokaryoten Genregulation: Mechanismen bakterieller Genregulation, Grundbegriffe: nicht alle Gene eines Bakteriums sind ständig aktiv deren Induktion der Expression erfolgt

Mehr

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de

Dr. Jens Kurreck. Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Dr. Jens Kurreck Otto-Hahn-Bau, Thielallee 63, Raum 029 Tel.: 83 85 69 69 Email: jkurreck@chemie.fu-berlin.de Prinzipien genetischer Informationsübertragung Berg, Tymoczko, Stryer: Biochemie 5. Auflage,

Mehr

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination

8. Translation. Konzepte: Translation benötigt trnas und Ribosomen. Genetischer Code. Initiation - Elongation - Termination 8. Translation Konzepte: Translation benötigt trnas und Ribosomen Genetischer Code Initiation - Elongation - Termination 1. Welche Typen von RNAs gibt es und welches sind ihre Funktionen? mouse human bacteria

Mehr

Biologie für Mediziner

Biologie für Mediziner Biologie für Mediziner - Zellbiologie 1 - Prof. Dr. Reiner Peters Institut für Medizinische Physik und Biophysik/CeNTech Robert-Koch-Strasse 31 Tel. 0251-835 6933, petersr@uni-muenster.de Dr. Martin Kahms

Mehr

Struktur und Funktion der DNA

Struktur und Funktion der DNA Struktur und Funktion der DNA Wiederholung Nucleotide Nucleotide Nucleotide sind die Untereinheiten der Nucleinsäuren. Sie bestehen aus einer N-haltigen Base, einer Pentose und Phosphat. Die Base hängt

Mehr

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008

Musterlösung - Übung 5 Vorlesung Bio-Engineering Sommersemester 2008 Aufgabe 1: Prinzipieller Ablauf der Proteinbiosynthese a) Erklären Sie folgende Begriffe möglichst in Ihren eigenen Worten (1 kurzer Satz): Gen Nukleotid RNA-Polymerase Promotor Codon Anti-Codon Stop-Codon

Mehr

Inhaltsverzeichnis. Teil I: Grundlagen. 1. Lebensformen: Zellen mit und ohne Kern Proteine: Ein Überblick in Stichwörtern 37 VII

Inhaltsverzeichnis. Teil I: Grundlagen. 1. Lebensformen: Zellen mit und ohne Kern Proteine: Ein Überblick in Stichwörtern 37 VII VII Inhaltsverzeichnis Teil I: Grundlagen 1. Lebensformen: Zellen mit und ohne Kern 3 Eukaryoten 4 Prokaryoten 6 Literatur 7 2. DNA: Träger der genetischen Information 9 Bausteine: Nucleotide 9 Doppelhelix

Mehr

11 Nukleinsäuren Die DNA: Der Speicher der Erbinformation

11 Nukleinsäuren Die DNA: Der Speicher der Erbinformation 11 Nukleinsäuren Übersicht: 11.1 Die DNA: Speicher der Erbinformation 11.2 Der Aufbau und die Komponenten der DNA 11.3 Doppelstrang und Doppelhelix 11.4 Der genetische Code 11.5 Die Biosynthese der DNA

Mehr

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name

Beschreiben Sie in Stichworten zwei der drei Suppressormutationen, die man in Hefe charakterisiert hat. Starzinski-Powitz, 6 Fragen, 53 Punkte Name Starzinski-Powitz, 6 Fragen, 53 Punkte Name Frage 1 8 Punkte Nennen Sie 2 Möglichkeiten, wie der Verlust von Heterozygotie bei Tumorsuppressorgenen (Z.B. dem Retinoblastomgen) zum klompletten Funktionsverlust

Mehr

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend

Vererbung. Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Vererbung Die durch Fortpflanzung entstandene Nachkommenschaft gleicht den Elternorganismen weitgehend Klassische Genetik Äußeres Erscheinungsbild: Phänotypus setzt sich aus einer Reihe von Merkmalen (Phänen))

Mehr

Studienprojekt DaMocles. Puromycin. von J. Primozic, A. Röblitz, M. Schorstein, D. Seelinger, Candeniz Simsek

Studienprojekt DaMocles. Puromycin. von J. Primozic, A. Röblitz, M. Schorstein, D. Seelinger, Candeniz Simsek Studienprojekt DaMocles 1. Einleitung von J. Primozic, A. Röblitz, M. Schorstein, D. Seelinger, Candeniz Simsek ist ein Nucleosid-Antibiotikum, das erstmals 1954 aus der Bakterien-Gattung Streptomycin

Mehr

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn

Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Einführung in die Grundlagen der Genetik Ausbildung zum Bienenwirtschaftsmeister Mai 2012 Christian Boigenzahn Molekularbiologische Grundlagen Die Zelle ist die grundlegende, strukturelle und funktionelle

Mehr

Genexpression. Introns, T7-Typ DNA Polymerase, RNA Editing, Transsplicing

Genexpression. Introns, T7-Typ DNA Polymerase, RNA Editing, Transsplicing Genexpression Übersicht Mais mtdna Reis mtdna u. ctdna Introns, T7-Typ DNA Polymerase, RNA Editing, Transsplicing Eukaryotische Genstruktur Aufbau eines Gens Promotor und regulatorische Sequenzen Exons

Mehr

Transkription bei Pro- und Eukaryoten

Transkription bei Pro- und Eukaryoten Transkription bei Pro- und Eukaryoten Im Rahmen der Transkription liefert ein Strang der DNA die Information für die Synthese eines RNA-Stranges. Die Enzyme, die in Pro- und Eukaryotenzellen für die Transkription

Mehr

DNA: Aufbau, Struktur und Replikation

DNA: Aufbau, Struktur und Replikation DNA: Aufbau, Struktur und Replikation Biochemie Die DNA als Träger der Erbinformation Im Genom sind sämtliche Informationen in Form von DNA gespeichert. Die Information des Genoms ist statisch, d. h. in

Mehr

Teil I Grundlagen der Zell- und Molekularbiologie

Teil I Grundlagen der Zell- und Molekularbiologie Teil I Grundlagen der Zell- und Molekularbiologie Molekulare Biotechnologie: Konzepte, Methoden und Anwendungen, 2. Aufl. Herausgegeben von Michael Wink Copyright 2011 WILEY-VCH Verlag GmbH & Co. KGaA,

Mehr

Biochemie Tutorium 10. Genetischer Code, Translation & Regulation der Proteinbiosynthese

Biochemie Tutorium 10. Genetischer Code, Translation & Regulation der Proteinbiosynthese Biochemie Tutorium 10 Genetischer Code, Translation & Regulation der Proteinbiosynthese IMPP-Gegenstandskatalog 3 Genetik 3.1 Nukleinsäuren 3.1.1 Molekulare Struktur, Konformationen und Funktionen der

Mehr

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01.

Thema: Eukaryotische Genregulation und RNA- Prozessierung. Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. Thema: Eukaryotische Genregulation und RNA- Prozessierung Spleißen, Capping, Polyadenylierung, RNA-Editieren Erwin R. Schmidt 11. 01. 2013 Worin unterscheiden sich die Gene bzw. die Genprodukte von Eukaryoten

Mehr

Teil I Allgemeine Grundlagen und Präanalytik

Teil I Allgemeine Grundlagen und Präanalytik O:/Wiley/Thiemann/3d/c01.3d from 30.09.2014 10:14:20 Teil I Allgemeine Grundlagen und Präanalytik O:/Wiley/Thiemann/3d/c01.3d from 30.09.2014 10:14:20 O:/Wiley/Thiemann/3d/c01.3d from 30.09.2014 10:14:20

Mehr

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz

mrna S/D UTR: untranslated region orf: open reading frame S/D: Shine-Dalgarno Sequenz 1. Nennen Sie die verschiedenen RNA-Typen, die bei der Translation wichtig sind. Erklären Sie die Funktion der verschiedenen RNA-Typen. Skizzieren Sie die Struktur der verschiedenen RNA-Typen und bezeichnen

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

DNA-Replikation. Konrad Beyreuther. Stefan Kins

DNA-Replikation. Konrad Beyreuther. Stefan Kins DNA-Replikation Konrad Beyreuther Stefan Kins DNA-Replikation Originalgetreue Verdopplung des genetischen Materials als Voraussetzung für die kontinuierliche Weitergabe der in der DNA verschlüsselten Information

Mehr

1. Welche Auswirkungen auf die Expression des lac-operons haben die folgenden Mutationen:

1. Welche Auswirkungen auf die Expression des lac-operons haben die folgenden Mutationen: Übung 10 1. Welche Auswirkungen auf die Expression des lac-operons haben die folgenden Mutationen: a. Eine Mutation, die zur Expression eines Repressors führt, der nicht mehr an den Operator binden kann.

Mehr

5.Epigenetische Regulierung

5.Epigenetische Regulierung 5.Epigenetische Regulierung Die Grundeinheit des Chromatins ist das Nukleosom DNA Linker DNA Nukleosom Kern DNS H1 10 nm 1. 30 nm Nukleosom Perle (4x2 Hyston Moleküle + 146 Paare Nukleotiden) 10 nm Strang

Mehr

Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen

Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen Unterschied Tiere, Pflanzen, Bakterien u. Pilze und die Zellorganellen Die Organellen der Zelle sind sozusagen die Organe die verschiedene Funktionen in der Zelle ausführen. Wir unterscheiden Tierische

Mehr

Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide

Molekulargenetik 1. 1.1 DNA-Struktur. 1.1.1 Nukleotide O:/Wiley/Reihe_verdammt_klever/Fletcher/3d/c01.3d from 15.08.2013 17:16:38 1 Molekulargenetik 1 In diesem Kapitel geht es um diese Themen: DNA-Struktur Gene Der genetische Code Von der DNA zum Protein

Mehr

Bakterielle Genetik. Dr. Thomas Seehaus

Bakterielle Genetik. Dr. Thomas Seehaus Dr. Thomas Seehaus Grundlagen Da die Eukaryoten aus den Prokaryoten entstanden sind, sind auch die Mechanismen der Weitergabe ihrer Erbinformationen von Generation zu Generation weitgehend identisch bakterielle

Mehr