Kinderneurologie - STIM-CP

Größe: px
Ab Seite anzeigen:

Download "Kinderneurologie - STIM-CP"

Transkript

1 Kinderneurologie - STIM-CP Prüfplancode ISRCTN EudraCT Clinicaltrials.gov DRKS 1603 NCT Effekt der Tiefen Hirnstimulation im Globus Pallidus internus auf die Lebensqualität von jungen Patienten mit dyston-dyskinetischer Zerebralparese (STIM-CP) Status: Aktiv Studienziel / Fragestellung Primäres Prüfziel Veränderung im CPCHILD vor und 12 Monate nach GPi-THS (Ansprechen=Verbesserung> 10%) Sekundäre Prüfziele Erfassung des Effektes der bilateralen GPi-THS auf - Dystonie - Dyskinesie - Schmerzen - Gedächtnis - Affekt - Spastik - Motorische Funktion/Behinderung - Kognition - Aufmerksamkeit - Sprache Diagnose Kinderneurologie G Dyskinetische Zerebralparese

2 Patientenmerkmale Alter 7-18 Einschlusskriterien GPi-THS erfolgt aus ärztlicher Indikation Geschlecht: männlich und weiblich Sekundäre Dystonie im Rahmen einer infantilen Zerebralparese durch einen perinatalen hypoxischen Hirnschaden Ineffektive antidystone medikamentöse Therapie (z.b. Jankovic J. Medical treatment of dystonia. Movement disorders, Vol. 28, No. 7, 2013) Stabile antidystone Medikation während der letzten 30 Tage Globus pallidus internus (pars posterior) und Thalamus (motorischer Teil) intakt (MRT möglichst nicht älter als zwei Jahre)

3 Ausreichende Compliance des Patienten und oder des offiziellem Vormund, um an der Studie teilzunehmen Patienteneinverständnis, die vom Patienten und/oder dem offiziellem Vormund unterzeichnet ist Ausschlusskriterien 1. Patienten mit bekannter primärer (z.b. Dyt1) oder idiopatischer Dystonie 2. Schwere axiale Hypotonie mit vollständigem Verlust der Kopfkontrolle (z.b. "absence of control at upper thoracic level" in der SATCo Skala) (Medikamentenwirkung ausgeschlossen) 3. Fixierte Hemidystonie 4. Schwere Spastik in Knie- und Ellebeuger (Modifizierte Ashworth Skala>3) 5. Fixierte skeletale Kontrakturen mit Funktionsverlust, die eine unmittelbare chirurgische Intervention erforderlich machen 6. Patienten mit anderen schweren neurologischen Begleiterkrankungen (z.b. Hirntumor,neurodegenerative Erkrankungen,Trauma etc.) 7. Umstände, die die Durchführung eines MRTs in Zukunft erforderlcih machen 8. Intrakranielle Fehlbildung oder andere medizinische Gründe, die eine Kontraindikation für die THS bedeuten 9. Dauerhafter Drogen- und/oder Alkoholabusus 10. Häufige, pharmakologisch nicht einstellbare Grand-Mal- Anfälle 11. Andere aktive implantierte Medizinprodukte (z.b. Cochlea-Implantat, Schrittmacher) im an-oder ausgestelltem Zustand sind erlaubt, wenn sie nicht die Funktion des Medizinproduktes stören 12. Eine bekannte Unverträglichkeit gegenüber dem Medizinprodukt

4 13. Gerinnungshemmende Medikation, die während der perioperativen Zeit nicht unterbrochen werden darf 14. Medizinische Gründe, die Studienmaßnahmen oder die Auswertung von Zielparametern stören könnten, einschließlich unheilbarer Erkrankungen mit einer Überlebensdauer unter 12 Monaten 15. Aktuelle Teilnahme oder Teilnahme während der vergangenen 30 Tage an einer anderen Arzneimittelprüfung. Andere Studienteilnahme sollten vom Leiter der klinischen Prüfung geprüft werden 16. Eine weibliche Patientin, die stillt oder eine Patientin im gebärfähigen Alter, die einen positiven Schwangerschaftstest vorweist oder keine adäquate Empfängnisverhütung mit einem Pearl Index< 1% (Antibabypille, Hormonpflaster, NuvaRing, Implanom, hormonelle Depot-Injektionen, kontrazeptive Spirale) und Tubenligatur (weibliche Sterilisation) Studiendesign Einarmig,Multizentrisch,Prospektiv Dokumente (passwortgeschützt) (noch keine Dokumente) Zuständigkeiten Gesamtstudie Sponsor Universität zu Köln Leiter der klinischen Prüfung Prof. Dr. Lars Timmermann Prüfzentren Köln Klinik und Poliklinik für Kinder- und Jugendmedizin (UK Köln)

5 Status Aktiv Prüfer (Hauptprüfer im Zentrum) Prof. Dr. Lars Timmermann Stellvertretender Prüfer Dr. med. Anne Koy

1 von :09

1 von :09 1 von 5 09.06.2011 15:09 2 von 5 09.06.2011 15:09 Klinische Studien CAI Prüfplancode ISRCTN EudraCT Clinicaltrials.gov DRKS CAI n/a NCT00126321 Therapie von Patienten mit rezidivierter akuter myeloischer

Mehr

PATIENTENINFORMATION. Caregiver Burden bei betreuenden Angehörigen schwer betroffener Parkinsonpatienten

PATIENTENINFORMATION. Caregiver Burden bei betreuenden Angehörigen schwer betroffener Parkinsonpatienten Version 1.2 Neurologische Klinik mit Klinischer Neurophysiologie Kommissarischer Direktor: Prof. Dr. med. M. Stangel PD Dr. med. F. Wegner Telefon: (0511) 532-3110 Fax: (0511) 532-3115 Carl-Neuberg-Straße

Mehr

Tiefe Hirnstimulation - Wann ist eine Operation sinnvoll. Florian Hatz Ethan Taub

Tiefe Hirnstimulation - Wann ist eine Operation sinnvoll. Florian Hatz Ethan Taub Tiefe Hirnstimulation - Wann ist eine Operation sinnvoll Florian Hatz Ethan Taub Parkinson-Erkrankung Parkinson-Erkrankung Dopaminkonzentration Im Gehirn Therapie - Wirkung Dauer -> Dopaminkonzentration

Mehr

Kriterienkatalog des Sponsorbevollmächtigten (GHSG) (Auswahl angemessen qualifizierter Mitglieder der Prüfgruppe)

Kriterienkatalog des Sponsorbevollmächtigten (GHSG) (Auswahl angemessen qualifizierter Mitglieder der Prüfgruppe) Studienkurztitel: HD 16 EudraCT-Nr.: 2007-004474-24 Prüfplan-Code: Uni-Koeln-987 Sponsor: Universität zu Köln Studienfunktion Qualifikationsanforderungen Qualifikationsnachweis Studienaufgabe (Codierung

Mehr

Neue Behandlungsmöglichkeit für Patienten

Neue Behandlungsmöglichkeit für Patienten Erstmals europaweit Hirnschrittmacher gegen Epilepsie implantiert Neue Behandlungsmöglichkeit für Patienten Tübingen (26. November 2010) - Ich bin ins Büro gekommen, habe mir einen Kaffee geholt - und

Mehr

Kognitive Defizite bei der bipolaren Störung

Kognitive Defizite bei der bipolaren Störung Kognitive Defizite bei der bipolaren Störung Einfluss von Schlaf und sub-syndromaler Depression DP Julia Volkert Klinik und Poliklinik für Psychiatrie, Psychosomatik und Psychotherapie Direktor: Prof.

Mehr

Therapie von Patienten bis 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Fludarabin/Cyclophosphamid

Therapie von Patienten bis 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Fludarabin/Cyclophosphamid 10 CLL4-Protokoll der deutschen CLL-Studiengruppe Therapie von Patienten bis 65 Jahren mit fortgeschrittener chronischer lymphatischer Leukämie mit Fludarabin versus Fludarabin/Cyclophosphamid - CLL4-Protokoll

Mehr

Neuromodulation in Schmerztherapie. Dr. Yaroslav Parpaley Klinik für Neurochirurgie Direktorin: Prof. Dr. K. Schmieder

Neuromodulation in Schmerztherapie. Dr. Yaroslav Parpaley Klinik für Neurochirurgie Direktorin: Prof. Dr. K. Schmieder Neuromodulation in Schmerztherapie Dr. Yaroslav Parpaley Klinik für Neurochirurgie Direktorin: Prof. Dr. K. Schmieder Chronische Schmerzen 19% der Bevölkerung / etwa jeder 5. Erwachsene in Europa leidet

Mehr

1. Zusammenfassung Einleitung Historie der Bisphosphonate Das Bisphosphonat - ein Medikament 4

1. Zusammenfassung Einleitung Historie der Bisphosphonate Das Bisphosphonat - ein Medikament 4 Inhaltsverzeichnis 1. Zusammenfassung 1 2. Einleitung 3 2.1 Historie der Bisphosphonate 3 2.2 Das Bisphosphonat - ein Medikament 4 2.2.1 Struktur der Bisphosphonate 4 2.2.2 Einteilung der Bisphosphonate

Mehr

Version: V1.0 basierend auf Amendment 1 vom 15. Juli 2016

Version: V1.0 basierend auf Amendment 1 vom 15. Juli 2016 Pertuzumab in First Line Treatment of HER2-positive metastatic breast Cancer patients: A cohort study of patients treated either with docetaxel and Trastuzumab or docetaxel, trastuzumab and, NCT02642458

Mehr

Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin, Clomipramin, Doxepin und Maprotilin unter naturalistischen Bedingungen

Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin, Clomipramin, Doxepin und Maprotilin unter naturalistischen Bedingungen Aus der Klinik und Poliklinik für Psychiatrie, Psychosomatik und Psychotherapie der Universität Würzburg Direktor: Professor Dr. med. J. Deckert Therapeutisches Drug Monitoring der Antidepressiva Amitriptylin,

Mehr

Cannabis und Multiple Sklerose

Cannabis und Multiple Sklerose Neurologische Abteilung Chefarzt Dr. med. Konrad Luckner Dr. med. Christiane Pollnau Cannabis und Multiple Sklerose Dr. med. C. Pollnau Ass.-Ärztin Neurologie Krankenhaus Buchholz Cannabis und Multiple

Mehr

Empfehlungen zur Indikationsstellung der Hysterektomie

Empfehlungen zur Indikationsstellung der Hysterektomie Empfehlungen zur Indikationsstellung der Hysterektomie Im Unterschied zur interventionellen Kardiologie sind jedem Kapitel Empfehlungen zum Vorgehen vor der Hysterektomie vorgeschaltet. Übersicht über

Mehr

Sexuelle Übertragbarkeit von Borrelien- Erste Ergebnisse der Studie mit der Universität Jyväskylä, Finnland

Sexuelle Übertragbarkeit von Borrelien- Erste Ergebnisse der Studie mit der Universität Jyväskylä, Finnland Sexuelle Übertragbarkeit von Borrelien- Erste Ergebnisse der Studie mit der Universität Jyväskylä, Finnland Ärztliche Fortbildung Augsburg, 27.2.2016 Dr. H.G.Maxeiner, BCA-lab, Augsburg, Germany Literatur

Mehr

Intravitreale Injektion von Triamcinolonacetat zur Behandlung diffuser Makulaödeme

Intravitreale Injektion von Triamcinolonacetat zur Behandlung diffuser Makulaödeme Aus der Augenklinik und Poliklinik der Universitätsmedizin der Johannes Gutenberg-Universität Mainz Intravitreale Injektion von Triamcinolonacetat zur Behandlung diffuser Makulaödeme Inauguraldissertation

Mehr

7. Symposium Parkinson/ Bewegungsstörungen

7. Symposium Parkinson/ Bewegungsstörungen 7. Symposium Parkinson/ Bewegungsstörungen Donnerstag, 5. März 2009, 14.00 Uhr Modifizierte Zeichnung nach Charcot Liebe Kolleginnen und Kollegen Gerne möchten wir Sie zu unserem 7. Symposium «Parkinson/

Mehr

Protokol ID: AGO-OVAR OP.4 (AGO DESKTOP OVAR III)

Protokol ID: AGO-OVAR OP.4 (AGO DESKTOP OVAR III) EINE RANDOMISIERTE, MULTIZENTRISCHE STUDIE ZUM VERGLEICH DER WIRKSAMKEIT EINER ZUSÄTZLICHEN TUMORDEBULKING-OPERATION GEGEN EINE ALLEINIGE CHEMOTHERAPIE BEI PATIENTINNEN MIT EINEM PLATIN-SENSIBLEN OVARIALKARZINOM-REZIDIV

Mehr

Treffen der Kontaktgruppe Neurale Muskelatrophie der DGM e.v. Bad Sooden-Allendorf,

Treffen der Kontaktgruppe Neurale Muskelatrophie der DGM e.v. Bad Sooden-Allendorf, CAMPUS INNENSTADT : Warum braucht man so was? Treffen der Kontaktgruppe Neurale Muskelatrophie der DGM e.v. Bad Sooden-Allendorf, Dr. med. Olivia Schreiber-Katz, Friedrich-Baur-Institut, München www.cmt-register.de

Mehr

Eine Klinik der LVA Rheinprovinz

Eine Klinik der LVA Rheinprovinz - SeKoNa-Studie - Eine Klinik der LVA Rheinprovinz 25.5.25 1 SeKoNa-Studie Sekundärprävention bei Patienten mit koronarer Herzkrankheit durch Anschlussheilbehandlung und anschließender konzeptintegrierter

Mehr

Schriftliche Einwilligung und datenschutzrechtliche Erklärung zur Teilnahme an der Studie mit dem Namen

Schriftliche Einwilligung und datenschutzrechtliche Erklärung zur Teilnahme an der Studie mit dem Namen Prüfstelle: Schriftliche Einwilligung und datenschutzrechtliche Erklärung zur Teilnahme an der Studie mit dem Namen Simultaneous Study of Docetaxel Based Anthracycline Free Adjuvant Treatment Evaluation,

Mehr

Als Krebspatient an einer Studie teilnehmen was sollte man wissen?

Als Krebspatient an einer Studie teilnehmen was sollte man wissen? Als Krebspatient an einer Studie teilnehmen was sollte man wissen? Krebsinformationsdienst, Heidelberg Dr. Susanne Weg-Remers Seite 2 Grundlage für evidenzbasiertes medizinisches Wissen sind klinische

Mehr

Klinische Studien mit Medizinprodukten aus der Sicht des Klinikers

Klinische Studien mit Medizinprodukten aus der Sicht des Klinikers Klinische Studien mit Medizinprodukten aus der Sicht des Klinikers Prof. Dr. med. Volker A. Coenen Stereotaktische und Funktionelle Neurochirurgie Universitätsklinikum Freiburg volker.coenen@uniklinik-freiburg.de

Mehr

Programm Demenz-Prävention

Programm Demenz-Prävention Programm Demenz-Prävention Mehr Lebensqualität durch individuelle Maßnahmen im Frühstadium der Erkrankung Ministère de la Santé Villa Louvigny/Allée Marconi L-2120 Luxembourg Tel. 00352/ 27861312 info@demence.lu/info@demenz.lu

Mehr

K3A Was kostet HIV? Prof. Dr. rer. pol. Jürgen Wasem Dipl.-Ges.-ök. Sarah Mostardt Dr. med. Dr. rer. pol. Anja Neumann

K3A Was kostet HIV? Prof. Dr. rer. pol. Jürgen Wasem Dipl.-Ges.-ök. Sarah Mostardt Dr. med. Dr. rer. pol. Anja Neumann K3A Was kostet HIV? Prof. Dr. rer. pol. Jürgen Wasem Dipl.-Ges.-ök. Sarah Mostardt Dr. med. Dr. rer. pol. Anja Neumann 1 Inhaltsverzeichnis 1. Hintergrund 2. Studiendesign der Krankheitskosten-Kohortenanalyse

Mehr

Informations- und Wissensstand der Mütter von Kindern mit angeborenem Herzfehler

Informations- und Wissensstand der Mütter von Kindern mit angeborenem Herzfehler Informations- und Wissensstand der Mütter von Kindern mit angeborenem Herzfehler A Löbel 1, U Grosser 2, A Wessel 2, S Geyer 1 1 Medizinische Soziologie, Medizinische Hochschule Hannover 2 Pädiatrische

Mehr

Infantile Zerebralparese

Infantile Zerebralparese Häufigkeit von Entwicklungsbeeinträchtigung 1% erheblich behindert 2 3 %o CP 5-8%o geistige Behinderung Infantile Zerebralparese Manuela Baumgartner Ambulanz für Entwicklungsneurologie und Neuropädiatrie

Mehr

Die Evidenzüberprüfung für diese Richtlinie basierte auf zwei vorangegangenen

Die Evidenzüberprüfung für diese Richtlinie basierte auf zwei vorangegangenen Ergänzenden Online-Materialien METHODEN UND PROZESS Die Evidenzüberprüfung für diese Richtlinie basierte auf zwei vorangegangenen detaillierten Überprüfungsprozessen. Der erste war eine 2000 abgehaltene

Mehr

Aus der Klinik für Unfallchirurgie und Orthopädie der DRK-Kliniken-Köpenick, akademisches Lehrkrankenhaus der Charité Universität Berlin DISSERTATION

Aus der Klinik für Unfallchirurgie und Orthopädie der DRK-Kliniken-Köpenick, akademisches Lehrkrankenhaus der Charité Universität Berlin DISSERTATION Aus der Klinik für Unfallchirurgie und Orthopädie der DRK-Kliniken-Köpenick, akademisches Lehrkrankenhaus der Charité Universität Berlin DISSERTATION Untersuchungen zur Ätiologie des Karpaltunnelsyndroms

Mehr

Gesundheitsbezogene Lebensqualität 5 bis 10 Jahre nach einer Darmkrebsdiagnose

Gesundheitsbezogene Lebensqualität 5 bis 10 Jahre nach einer Darmkrebsdiagnose 07.09.2010 Gesundheitsbezogene Lebensqualität 5 bis 10 Jahre nach einer Darmkrebsdiagnose Eine prospektive Studie über 10 Jahre (VERDI) Lina Jansen¹, Antje Kiesel¹, Christa Stegmaier², Susanne Singer³,

Mehr

EINFLUSS DER OSTEOPATHISCHEN BEHANDLUNG AUF DEM ERHÖHTEN AUGENINNENDRUCK EINE EXPERIMENTALSTUDIE

EINFLUSS DER OSTEOPATHISCHEN BEHANDLUNG AUF DEM ERHÖHTEN AUGENINNENDRUCK EINE EXPERIMENTALSTUDIE 1. ABSTRACT EINFLUSS DER OSTEOPATHISCHEN BEHANDLUNG AUF DEM ERHÖHTEN AUGENINNENDRUCK EINE EXPERIMENTALSTUDIE Von Oskar Kuhmann Ziel: Ziel der Studie ist die Fragestellung ob osteopathische Behandlungen

Mehr

Neurologische Rehabilitation II. PD.Dr.H.Gerhard Philippusstift KKENW SS 2011

Neurologische Rehabilitation II. PD.Dr.H.Gerhard Philippusstift KKENW SS 2011 Neurologische Rehabilitation II PD.Dr.H.Gerhard Philippusstift KKENW SS 2011 Ohne Neuroplastizität keine Rehabilitation Planung der Rehabilitation Die Planung der Rehabilitation beginnt auf der Stroke

Mehr

SCREENING / V1. Empfang. Studientitel und Studiennummer. Name:... o männlich o weiblich. o Hispanisch oder Latino. o Nicht hispanisch oder Latino

SCREENING / V1. Empfang. Studientitel und Studiennummer. Name:... o männlich o weiblich. o Hispanisch oder Latino. o Nicht hispanisch oder Latino SCREENING / V1 Empfang Datum Screening Adresse Geschlecht o männlich o weiblich Ethnie o Hispanisch oder Latino o Nicht hispanisch oder Latino Rekrutierungsquelle Patientennummer Rasse o kaukasisch o andere:

Mehr

HECTOR (Hycamtin plus Carboplatin versus Established Regimens for the Treatment of Ovarian Cancer Relapse) EudraCT Number: 2006-004628-34

HECTOR (Hycamtin plus Carboplatin versus Established Regimens for the Treatment of Ovarian Cancer Relapse) EudraCT Number: 2006-004628-34 Topotecan plus Carboplatin im Vergleich zur Standardtherapie (Paclitaxel plus Carboplatin oder Gemcitabin plus Carboplatin) in der Therapie von Patientinnen mit Platin-sensitivem rezidivierten epithelialen

Mehr

Patienteninformation und Einwilligungserklärung. zur Teilnahme am Nephronophthise-Register

Patienteninformation und Einwilligungserklärung. zur Teilnahme am Nephronophthise-Register Patienteninformation und Einwilligungserklärung zur Teilnahme am Nephronophthise-Register Auftraggeber der Studie: Prof. Dr. med. Heymut Omran Direktor der Klinik und Poliklinik für Kinder- und Jugendmedizin

Mehr

Klinikum der Universität München Medizinische Klinik und Poliklinik III Großhadern

Klinikum der Universität München Medizinische Klinik und Poliklinik III Großhadern Möglichkeiten und Grenzen der Einbeziehung von Patienten in die Entscheidungsfindung: eine klinisch-ethische Studie zu Entscheidungen zum Therapieverzicht. E. Winkler Klinikum der Universität München Medizinische

Mehr

Aus dem Institut für Medizinische Soziologie und Sozialmedizin Prof. Dr. phil. Dr. med. Ulrich Otto Mueller

Aus dem Institut für Medizinische Soziologie und Sozialmedizin Prof. Dr. phil. Dr. med. Ulrich Otto Mueller Aus dem Institut für Medizinische Soziologie und Sozialmedizin Prof. Dr. phil. Dr. med. Ulrich Otto Mueller des Fachbereichs Medizin der Philipps-Universität Marburg Patient-Empowerment-Effekte auf den

Mehr

Parkinson: (differentielle) Diagnosis

Parkinson: (differentielle) Diagnosis Parkinson: (differentielle) Diagnosis Professor Bastiaan R. Bloem Parkinson Center Nijmegen (ParC) Medizinisches Zentrum der Universität Radboud @BasBloem Teilnehmende Organisationen: Eine faszinierende

Mehr

Inhaltsverzeichnis. Bibliografische Informationen http://d-nb.info/992492254. digitalisiert durch

Inhaltsverzeichnis. Bibliografische Informationen http://d-nb.info/992492254. digitalisiert durch Inhaltsverzeichnis 1 Einleitung 1.1 Die transkranielle Magnetstimulation (TMS) - allgemeine Einführung 1.1.1 Die TMS - technisches Prinzip 17-18 1.1.2 Einsatz der TMS in der neuro-psychiatrischen Forschung

Mehr

Die Bedeutung von interprofessioneller Teamarbeit für die Patientenzufriedenheit in der Behandlung chronischer Erkrankungen

Die Bedeutung von interprofessioneller Teamarbeit für die Patientenzufriedenheit in der Behandlung chronischer Erkrankungen Die Bedeutung von interprofessioneller Teamarbeit für die Patientenzufriedenheit in der Behandlung chronischer Erkrankungen Zimmermann, Linda 1 ; Müller, Christian 1 ; Michaelis, Martina 2 & Körner, Mirjam

Mehr

Objektivierung der kardiovaskulären Dysfunktion im ambulanten und hausärztlichen Bereich mittels handgehaltener Echokardiographie

Objektivierung der kardiovaskulären Dysfunktion im ambulanten und hausärztlichen Bereich mittels handgehaltener Echokardiographie Objektivierung der kardiovaskulären Dysfunktion im ambulanten und hausärztlichen Bereich mittels handgehaltener Echokardiographie und dem BNP-Schnelltest. Multicenter-Studie des Teilprojekts 6 im Kompetenznetz

Mehr

Symptome und Diagnosestellung des Morbus Parkinson

Symptome und Diagnosestellung des Morbus Parkinson meine Hand zittert habe ich etwa Parkinson? Symptome und Diagnosestellung des Morbus Parkinson Dr. med. Sabine Skodda Oberärztin Neurologische Klinik Morbus Parkinson chronisch fortschreitende neurodegenerative

Mehr

Langzeitergebnisse der Behandlung von erwachsenen Patienten mit Spina bifida H. Wolko, D. Class, R. Firsching Universitätsklinik für Neurochirurgie

Langzeitergebnisse der Behandlung von erwachsenen Patienten mit Spina bifida H. Wolko, D. Class, R. Firsching Universitätsklinik für Neurochirurgie 1 Langzeitergebnisse der Behandlung von erwachsenen Patienten mit Spina bifida H. Wolko, D. Class, R. Firsching Universitätsklinik für Neurochirurgie 2 Gliederung Kindheit vs. Erwachsenenalter Veränderungen

Mehr

Studienprojekt Candidämie des NRZ für Systemische Mykosen

Studienprojekt Candidämie des NRZ für Systemische Mykosen Studienprojekt Candidämie des NRZ für Systemische Mykosen PD Dr. med. Margarete Borg-von Zepelin Institut für Medizinische Mikrobiologie; Universitätsklinikum Göttingen Nationales Referenzzentrum für systemische

Mehr

Arbeitsgruppe: Spastik. Fragestellung: Motorische Übungsbehandlung

Arbeitsgruppe: Spastik. Fragestellung: Motorische Übungsbehandlung Arbeitsgruppe: Spastik Fragestellung: Motorische Übungsbehandlung 1 Intervention: Physioterapie Ref.- Nr. Autor, Jahr 1 Sunderlan d et al 1992 Erhebung sbogen Originalarbeit Studie ntyp RCT während der

Mehr

Bedeutung von MAO-B-Hemmern

Bedeutung von MAO-B-Hemmern DGN-Kongress 2014: Rasagilin verlässlicher Therapiepartner im Krankheitsverlauf Individuelle Konzepte in der Parkinson-Therapie: Bedeutung von MAO-B-Hemmern München (17. September 2014) - Wie kann der

Mehr

wissen kooperation betreuung

wissen kooperation betreuung wissen kooperation betreuung Parkinsonzentrum Rheinfelden Basel Parkinsonzentrum Rheinfelden Basel Gemeinsam bieten wir Ihnen umfassendes Wissen und Betreuung Bereits seit 2004 besteht auf dem Gebiet der

Mehr

Einsatzmöglichkeiten administrativer Patientenverwaltungssysteme. Fallstudie am Klinikum der Universität München. Klaus Adelhard

Einsatzmöglichkeiten administrativer Patientenverwaltungssysteme. Fallstudie am Klinikum der Universität München. Klaus Adelhard Das Bild kann nicht angezeigt werden. Dieser Computer verfügt möglicherweise über zu wenig Arbeitsspeicher, um das Bild zu öffnen, oder das Bild ist beschädigt. Starten Sie den Computer neu, und öffnen

Mehr

Forschungsgruppe THICS Entwicklung und Evaluation des Therapieprogramms für Kinder und Jugendlichen mit Tic-Störungen

Forschungsgruppe THICS Entwicklung und Evaluation des Therapieprogramms für Kinder und Jugendlichen mit Tic-Störungen Forschungsgruppe THICS Entwicklung und Evaluation des Therapieprogramms für Kinder und Jugendlichen mit Tic-Störungen Mitglieder der Forschungsgruppe: Katrin Woitecki, Dr. Dipl.-Psych. (AKiP) Manfred Döpfner,

Mehr

Dossierbewertung A15-20 Version 1.0 Secukinumab Nutzenbewertung gemäß 35a SGB V

Dossierbewertung A15-20 Version 1.0 Secukinumab Nutzenbewertung gemäß 35a SGB V 2 Nutzenbewertung 2.1 Kurzfassung der Nutzenbewertung Hintergrund Der G-BA hat das IQWiG mit der Nutzenbewertung des Wirkstoffs Secukinumab gemäß 35a SGB V beauftragt. Die Bewertung erfolgte auf Basis

Mehr

Standardarbeitsanweisung (SOP) zur (Nicht)Einstufung von Studienvorhaben als klinische Prüfung nach AMG

Standardarbeitsanweisung (SOP) zur (Nicht)Einstufung von Studienvorhaben als klinische Prüfung nach AMG Standardarbeitsanweisung (SOP) zur (Nicht)Einstufung von Studienvorhaben als klinische Prüfung nach AMG Die folgende SOP basiert auf dem EU-Guidance Dokument vom März 2010 mit seinem Decision Tree (siehe

Mehr

NEUE FORSCHUNG ZEIGT SIGNIFIKANTE VORTEILE DER TIEFEN HIRNSTIMULATION IN EINEM FRÜHEREN STADIUM DER PARKINSON ERKRANKUNG

NEUE FORSCHUNG ZEIGT SIGNIFIKANTE VORTEILE DER TIEFEN HIRNSTIMULATION IN EINEM FRÜHEREN STADIUM DER PARKINSON ERKRANKUNG MITTEILUNG FÜR DIE PRESSE Auskünfte Deutschland: Jennifer Disper Wilmsen, Sabine Günther Presse und Öffentlichkeitsarbeit Tel: ++49 (0) 2159 8149 440, 277 Fax: ++49 (0) 2159 8149 252 email: presse@medtronic.de

Mehr

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen

Neue Strategien und Studien zur Therapie des Angelman-Syndroms. B. Horsthemke, Essen Neue Strategien und Studien zur Therapie des Angelman-Syndroms B. Horsthemke, Essen DNA und Erbinformation Chromosom - AGTCCGTAAGCTGAACGCTGAGTGCACATGCAGTCATGTGCATGGCTGTACAAAGTCTGCTAGTCAGT - TCAGGCATTCGACTTGCGACTCACGTGTACGTCAGTACACGTACCGACATGTTTCAGACGATCAGTCA

Mehr

Der Liverpool Care Pathway Ein Behandlungspfad in der Palliativmedizin

Der Liverpool Care Pathway Ein Behandlungspfad in der Palliativmedizin Der Liverpool Care Pathway Ein Behandlungspfad in der Palliativmedizin Palliativzentrum Dr. Michael Schwarz-Eywill Christine Scheve Palliativzentrum am Evangelischen Krankenhaus Oldenburg 8. Mai 2009 Palliativmedizin

Mehr

FUNKTIONELLE GYMNASTIK

FUNKTIONELLE GYMNASTIK FUNKTIONELLE GYMNASTIK Philipp Hausser GluckerSchule OSTEOPOROSE 1 Definition: bezeichnet einen pathologischen Knochenschwund. Dabei wird mehr Knochen abgebaut als aufgebaut. Die Dichte des Knochens ist

Mehr

Neurologische/ Neurogeriatrische Erkrankungen des höheren Lebensalters

Neurologische/ Neurogeriatrische Erkrankungen des höheren Lebensalters Neurologische/ Neurogeriatrische Erkrankungen des höheren Lebensalters J. Bufler Neurologische Klinik des ISK Wasserburg Präsentation, Stand November 2008, Martin Spuckti Seite 1 Vier Giganten der Geriatrie

Mehr

Hausärztliche Überweisungs- und Behandlungsstrategien bei Rheumapatienten

Hausärztliche Überweisungs- und Behandlungsstrategien bei Rheumapatienten Aus der Klinik für Allgemeinmedizin, Naturheilkunde, Psychosomatik und Psychotherapie Abteilung f. Allgemeinmedizin mit Allgemeinpraxis der Freien Universität Berlin Leiter: Prof. Dr. med. P. Mitznegg

Mehr

Kraft und funktionelle Leistung im Alter

Kraft und funktionelle Leistung im Alter Kraft und funktionelle Leistung im Alter Heicumed Ausbildungscurriculum der medizinischen Fakultät der Universität Heidelberg Dr. Klaus Hauer Bethanien-Krankenhaus am Klinikum der Universität Heidelberg

Mehr

Hirnstimulation Was ist zu beachten?

Hirnstimulation Was ist zu beachten? MRT und Patienten nach tiefer Hirnstimulation Was ist zu beachten? Neue Richtlinien S. Guhl Institut für Diagnostische Radiologie und Neuroradiologie Universitätsmedizin Greifswald 3. Greifswald Ryck Symposium

Mehr

Antiepileptika und Schwangerschaft

Antiepileptika und Schwangerschaft Antiepileptika und Schwangerschaft Bernhard J. Steinhoff Epilepsiezentrum Kork 83. Kongress der Deutschen Gesellschaft für Neurologie Mannheim, 25.09.2009 Große Fehlbildungen in Abhängigkeit von der Zahl

Mehr

Gesunde Frauen und Männer für unsere Arzneimittelstudie gesucht!

Gesunde Frauen und Männer für unsere Arzneimittelstudie gesucht! Gesunde Frauen und Männer für unsere Arzneimittelstudie gesucht! im Alter von 18 bis 55 Jahren BMI zwischen 18,5 kg/m² und 30 kg/m² Nichtraucher und Raucher (max. 10 Zig./Tag) Achtung: 48 Std. vor Dosierung

Mehr

Arthroskopie des Kniegelenks bei Arthrose: kein Nutzen erkennbar

Arthroskopie des Kniegelenks bei Arthrose: kein Nutzen erkennbar Einbezug neuer Studiendaten ändert nichts am Ergebnis des IQWiG-Vorberichts Arthroskopie des Kniegelenks bei Arthrose: kein Nutzen erkennbar Köln (12. Mai 2014) - Der Nutzen der therapeutischen Arthroskopie

Mehr

Frage: Führt die antibiotische Behandlung der Helicobacter pylori Infektion bei Patienten mit funktioneller Dyspepsie zur Beschwerdefreiheit?

Frage: Führt die antibiotische Behandlung der Helicobacter pylori Infektion bei Patienten mit funktioneller Dyspepsie zur Beschwerdefreiheit? Funktionelle Dyspepsie: Bei Patienten mit positivem Helicobacter pylori Nachweis hilft eine Eradikation, wenn überhaupt nur wenigen Patienten (Resultate von 2 Studien) Frage: Führt die antibiotische Behandlung

Mehr

Die Therapie der Zweierbeziehung. Jürg Willi

Die Therapie der Zweierbeziehung. Jürg Willi Die Therapie der Zweierbeziehung Jürg Willi Jürg Willi J.W. wurde 1934 in Zürich geboren Nach einem Medizinstudium erfolgt die Weiterbildung zum Facharzt für Psychiatrie und Psychotherapie Direktor der

Mehr

Was macht eine Therapie gut?

Was macht eine Therapie gut? Was macht eine Therapie gut? Wirksam gegen das Problem, für das sie eingesetzt wird Verhältnis von Wirkung und Nebenwirkungen akzeptabel Berücksichtigt individuelle Faktoren, z.b. Blutdruck Leber- und

Mehr

Paraklinische Befunde bei gemischten Episoden bipolar affektiver und schizoaffektiver Erkrankungen. Dissertation

Paraklinische Befunde bei gemischten Episoden bipolar affektiver und schizoaffektiver Erkrankungen. Dissertation Aus der Universitätsklinik und Poliklinik für Psychiatrie und Psychotherapie an der Martin-Luther-Universität Halle-Wittenberg (Direktor: Prof. Dr. med. Dr. h.c. Andreas Marneros) Paraklinische Befunde

Mehr

Gesunde Frauen & Männer für unsere Arzneimittelstudie gesucht!

Gesunde Frauen & Männer für unsere Arzneimittelstudie gesucht! Gesunde Frauen & Männer für unsere Arzneimittelstudie gesucht! im Alter von 18 bis 55 Jahren BMI zwischen 18,5 kg/m² und 30 kg/m² Nichtraucher (seit mind. 6 Monaten) Studiencode: N-A-PH1-15-060 Studienstart:

Mehr

Gesicherte Indikation, Aufklärung, Vorbereitung, Dokumentation

Gesicherte Indikation, Aufklärung, Vorbereitung, Dokumentation Gesicherte Indikation, Aufklärung, Vorbereitung, Dokumentation Dietmar Pierre König IQN 63. Fortbildungsveranstaltung - Hüftendoprothetik Primärendoprothetik - Anamnese - Klinische Untersuchung - Labordiagnostik

Mehr

Prozessmanagement im klinischen Alltag: Strukturierte Patientenaufklärung im Rahmen einer chirurgisch-anästhesiologischen Prämedikationsambulanz

Prozessmanagement im klinischen Alltag: Strukturierte Patientenaufklärung im Rahmen einer chirurgisch-anästhesiologischen Prämedikationsambulanz Universitätsklinikum des Saarlandes, Homburg / Saar Klinik für Allgemeine, Viszeral-, Gefäß- und Universitätsklinik Kinderchirurgie Homburg Prozessmanagement im klinischen Alltag: Strukturierte Patientenaufklärung

Mehr

Verbesserte Lebensqualität für Brustkrebspatientinnen unter Chemotherapie

Verbesserte Lebensqualität für Brustkrebspatientinnen unter Chemotherapie Neue Studie zu Iscador Verbesserte Lebensqualität für Brustkrebspatientinnen unter Chemotherapie Schwäbisch-Gmünd (2. Dezember 2009) - Eine prospektive randomisierte offene Pilotstudie ergab eine Verbesserung

Mehr

AKTUELLES ZUR DEMENZDIAGNOSTIK

AKTUELLES ZUR DEMENZDIAGNOSTIK AKTUELLES ZUR DEMENZDIAGNOSTIK GHF am Medizinische Diagnostik 2 Biomarker Cerebrale Atrophien (MRT) Cerebraler Hypometabolismus (PET) Liquor Erhöhte Konzentration Abeta 42 (Amyloidprotein) Erhöhte Konzentraion

Mehr

Das EKG bei Infarkt und reversibler Ischämie

Das EKG bei Infarkt und reversibler Ischämie Fortbildung der Medizinische Klinik und Poliklinik II Universität Bonn Mittwoch, den 23. Mai 2007 Das EKG bei Infarkt und reversibler Ischämie Klaus v. Olshausen III. Medizinische Abteilung Kardiologie,

Mehr

Gesunde Frauen und Männer für unsere Arzneimittelstudie gesucht!

Gesunde Frauen und Männer für unsere Arzneimittelstudie gesucht! Gesunde Frauen und Männer für unsere Arzneimittelstudie gesucht! im Alter von 18 bis 55 Jahren BMI zwischen 18,5 kg/m² und 30 kg/m² Nichtraucher und Raucher (max. 5 Zig./Tag) Achtung: 24 Std. vor Dosierung

Mehr

Gliederung des Vortrags

Gliederung des Vortrags Künstliche Ernährung bei Wachkoma und Demenz: Gebotene Grundversorgung oder sinnlose Leidensverlängerung? Dr. Alfred Simon Akademie für Ethik in der Medizin e.v. Hospiz-Forum, 10.10.2007 Gliederung des

Mehr

1. Neoadjuvante Therapie. 2. Adjuvante Therapie. 3. Metastasiertes Mamma-Ca. 4. Mamma-Ca. in der Schwangerschaft. 5. Nicht-interventionelle Studien

1. Neoadjuvante Therapie. 2. Adjuvante Therapie. 3. Metastasiertes Mamma-Ca. 4. Mamma-Ca. in der Schwangerschaft. 5. Nicht-interventionelle Studien 1. Neoadjuvante Therapie GeparOcto-Studie Penelope-Studie 2. Adjuvante Therapie GAIN II-Studie Katherine-Studie TREAT CTC-Studie OLYMPIA Studie 3. Metastasiertes Mamma-Ca. First-line Therapie: Ab Second-line

Mehr

Therapie. Klinik. Grundlage der RA Therapie ist die konservative Behandlung

Therapie. Klinik. Grundlage der RA Therapie ist die konservative Behandlung Klinik und Poliklinik für Orthopädie und orthopädische Chirurgie Direktor : Univ.-Prof. Dr. H. Merk Entzündliche Gelenkerkrankungen und Rheumatoide Arthritis Univ.-Prof. Dr. med. H. Merk Pathologie akut

Mehr

Konsens zur immunsuppressiven Therapie der erworbenen Hämophilie

Konsens zur immunsuppressiven Therapie der erworbenen Hämophilie GTH-Arbeitsgruppe Erworbene Hämophilie Konsens zur immunsuppressiven Therapie der erworbenen Hämophilie Datum: 29.12.2010 Version 29.12.2010 1 Inhalt Inhalt... 2 Definitionen... 2 Komplette Remission (CR):...

Mehr

Jahresbericht Klinik und Poliklinik für Nuklearmedizin. der Universität zu Köln. (Direktor: Prof. Dr. med. H. Schicha)

Jahresbericht Klinik und Poliklinik für Nuklearmedizin. der Universität zu Köln. (Direktor: Prof. Dr. med. H. Schicha) Jahresbericht 2010 Klinik und Poliklinik für Nuklearmedizin der Universität zu Köln (Direktor: Prof. Dr. med. H. Schicha) 1 Klinik und Poliklinik für Nuklearmedizin Im Jahr 2010 wurden die folgenden Leistungen

Mehr

Direktzugang zur Physiotherapie in der (Ost-)Schweiz

Direktzugang zur Physiotherapie in der (Ost-)Schweiz Direktzugang zur Physiotherapie in der (Ost-)Schweiz * Gamper U.N., *Grob U., *Pfenninger M.N., *Efting R., Keller U., Bachmann S., Oesch P. * Physionetz werdenberg sarganserland, Pizolcare AG, Kliniken

Mehr

Niedrigrisiko MDS Therapeutische Optionen Wolf-Karsten Hofmann

Niedrigrisiko MDS Therapeutische Optionen Wolf-Karsten Hofmann Niedrigrisiko MDS Therapeutische Optionen Wolf-Karsten Hofmann III. Medizinische Klinik, Universitätsmedizin Mannheim Therapie des Niedrigrisiko-MDS Heilung Nebenwirkungen Lebensqualität WHO Klassifikation

Mehr

Was wird aus Versicherten mit abgelehntem Reha-Antrag?

Was wird aus Versicherten mit abgelehntem Reha-Antrag? Rehabilitationswissenschaftliches Seminar Würzburg 2016 Was wird aus Versicherten mit abgelehntem Reha-Antrag? Ruth Deck Institut für Sozialmedizin und Epidemiologie Universität Lübeck Mögliche Probleme:

Mehr

Blasenspülung und intermittierender Selbstkatheterismus bei Patienten mit kontinentem katheterisierbarem Pouch: Vergleich zweier Methoden

Blasenspülung und intermittierender Selbstkatheterismus bei Patienten mit kontinentem katheterisierbarem Pouch: Vergleich zweier Methoden Blasenspülung und intermittierender Selbstkatheterismus bei Patienten mit kontinentem katheterisierbarem Pouch: Vergleich zweier Methoden Rita Willener Katharina Ochsner Frederic D. Birkhaeuser Urologische

Mehr

Qualifikationskurs ärztlicher Bereitschaftsdienst

Qualifikationskurs ärztlicher Bereitschaftsdienst Qualifikationskurs ärztlicher Bereitschaftsdienst (QÄB) am 26. / 27.04.2013 und 24. / 25.05.2013 Zertifiziert mit 33 Punkten Stand 8 Mar 13 2 Sie möchten fit sein für den KV-ärztlichen Bereitschaftsdienst?

Mehr

Ergebnisse der Evaluation von Station Silvia, einer Special Care Unit für Akutpatienten mit Demenz

Ergebnisse der Evaluation von Station Silvia, einer Special Care Unit für Akutpatienten mit Demenz Ergebnisse der Evaluation von Station Silvia, einer Special Care Unit für Akutpatienten mit Demenz Demenzkongress, 8. September 2016 Dr. Jochen G. Hoffmann, Köln Seite 0 Typische Probleme Demenzkranker

Mehr

1 von 5 17.08.2010 10:47» Home» Fachinformationen» Studien-Portal» Studien der GPOH» HIT-HGG-2007 HIT-HGG-2007 Autor: Julia Dobke, erstellt am: 19.03.2010, Zuletzt geändert: 30.06.2010 Titel Erkrankung,

Mehr

K. Müller 1, P. Wagner 1 & N. Kotschy-Lang 2. Universität Leipzig, 2 BG-Klinik Falkenstein

K. Müller 1, P. Wagner 1 & N. Kotschy-Lang 2. Universität Leipzig, 2 BG-Klinik Falkenstein Erfassung von Selbstwirksamkeitserwartungen bei pneumologischen Berufskrankheiten mit der deutschen Version der COPD Self-Efficacy Scale Zusammenhänge zur körperlichen Aktivität und Depressivität 1, P.

Mehr

CESAR-Studie: Was gibt es Neues in der ECMO-Therapie?

CESAR-Studie: Was gibt es Neues in der ECMO-Therapie? CESAR-Studie: Was gibt es Neues in der ECMO-Therapie? Einleitung Akutes schweres Lungenversagen ist trotz Fortschritten in der Intensivmedizin mit einer hoher Mortalität verbunden (ca. 40-70%) In zumeist

Mehr

PJ-Logbuch Physikalische Therapie (PRM)

PJ-Logbuch Physikalische Therapie (PRM) PJ-Logbuch Physikalische Therapie PJ-Logbuch Physikalische Therapie (PRM) Lehrkrankenhaus Beginn des Tertials Ende des Tertials 1. Tertial 2. Tertial 3. Tertial 2 PJ-Logbuch Physikalische Therapie Dokumentationsbereich

Mehr

Kooperative multizentrische Studie für Kinder und Jugendliche mit einem Gliom niedrigen Malignitätsgrades

Kooperative multizentrische Studie für Kinder und Jugendliche mit einem Gliom niedrigen Malignitätsgrades 1 von 5 15.12.2010 14:38» Home» Fachinformationen» Studien-Portal» Studien und Register der GPOH» SIOP-LGG 2004 Autor: Dr. med. Astrid Gnekow, erstellt 13.08.2003, Zuletzt geändert: 16.08.2010 Titel Erkrankung,

Mehr

Patienteninformation

Patienteninformation Anhang 1 zur Studie Tiefe Hirnstimulation zur Behandlung der therapieresistenten bipolaren Erkrankung Studienbeschreibung Diese Studie erforscht die Wirkung der tiefen Hirnstimulation bei Patienten mit

Mehr

Fragebogen zur Erhebung empirischer Daten zur Erkrankung von Demenz Für Betroffene und Angehörige. Ihr Wohnort (mit Postleitzahl):

Fragebogen zur Erhebung empirischer Daten zur Erkrankung von Demenz Für Betroffene und Angehörige. Ihr Wohnort (mit Postleitzahl): Fragebogen zur Erhebung empirischer Daten zur Erkrankung von Demenz Für Betroffene und Angehörige Persönliche Daten Geschlecht: Männlich Weiblich Ihr Wohnort (mit Postleitzahl): Ihr Alter: Unter 20 Jahre

Mehr

Lagerung in Neutralstellung

Lagerung in Neutralstellung Lagerung in Neutralstellung München, den 25.Oktober 2014 Workshop: LiN Lagerung in Neutralstellung auf dem MAIK 2014 www.lin-arge.de LiN Lagerung in Neutralstellung Heidrun Pickenbrock, M.Sc. Physiotherapeutin

Mehr

Operative Therapie der krankhaften Adipositas

Operative Therapie der krankhaften Adipositas Operative Therapie der krankhaften Adipositas Prof. Dr. med. Thomas Carus Klinik für Allgemeine, Visceral- und Unfallchirurgie Zentrum für minimal-invasive Chirurgie Klinikum Bremen-Ost Indikation zur

Mehr

Qualitätsbericht. der IKK classic. für das Behandlungsprogramm. IKK Promed Brustkrebs. in der Region Baden-Württemberg

Qualitätsbericht. der IKK classic. für das Behandlungsprogramm. IKK Promed Brustkrebs. in der Region Baden-Württemberg Qualitätsbericht der IKK classic für das Behandlungsprogramm IKK Promed Brustkrebs in der Region Baden-Württemberg vom 01.01.2013 bis 31.12.2013 Präambel Patienten können in Deutschland auf eine leistungsfähige

Mehr

Gesamtauswertung zum Nierenkarzinom - Weitere Ergebnisse Material und Methoden

Gesamtauswertung zum Nierenkarzinom - Weitere Ergebnisse Material und Methoden Material und Methoden 5. Bundesweite Onkologische Qualitätskonferenz 48.85 Patientinnen und Patienten der Diagnosejahre 22 bis 211. Das RKI schätzt die Neuerkrankungen im Jahre 21 auf 14.52. Hier 5.418

Mehr

Geschlechtsunterschiede und der Einfluss von Steroidhormonen auf das sich entwickelnde menschliche Gehirn

Geschlechtsunterschiede und der Einfluss von Steroidhormonen auf das sich entwickelnde menschliche Gehirn Kerstin Konrad LFG Klinische Neuropsychologie des Kindes- und Jugendalters Klinik für Kinder- und Jugendpsychiatrie und psychotherapie Universitätsklinikum der RWTH Aachen Geschlechtsunterschiede und der

Mehr

Tiefe Hirnstimulation

Tiefe Hirnstimulation Weitere Broschüren Zum THema ParKinson Bei Desitin können Sie weitere Patientenbroschüren bestellen. Bitte kreuzen Sie das gewünschte Thema an: Nr. 1 Die Parkinson-Krankheit (213041) Nr. 2 Medikamenteninduzierte

Mehr

Herzkrankheiten besser erkennen!

Herzkrankheiten besser erkennen! Herzkrankheiten besser erkennen! Magnetresonanztomographie und andere neue diagnostische Methoden Dr. Wolfgang Pistner Medizinische Klinik I Klinikum Aschaffenburg Herzsportgruppe TuS Leider, AOK Aschaffenburg

Mehr

Beschluss des Gemeinsamen Bundesausschusses. zur Richtlinie Ambulante Behandlung im Krankenhaus nach 116b SGB V

Beschluss des Gemeinsamen Bundesausschusses. zur Richtlinie Ambulante Behandlung im Krankenhaus nach 116b SGB V Beschluss des Gemeinsamen Bundesausschusses zur Richtlinie Ambulante Behandlung im Krankenhaus nach 116b SGB V Konkretisierung der Diagnostik und Versorgung von Patienten mit angeborenen Skelettsystemfehlbildungen,

Mehr

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien

Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Welt Lymphom Tag Seminar für Patienten und Angehörige 15. September 2007 Wien Ein Vortrag von Univ. Prof. Dr. Johannes Drach Medizinische Universität Wien Univ. Klinik für Innere Medizin I Klinische Abteilung

Mehr

Logbuch Zusatz-Qualifikation EMAH-Kardiologie der Interdisziplinären EMAH Task Force

Logbuch Zusatz-Qualifikation EMAH-Kardiologie der Interdisziplinären EMAH Task Force Logbuch Zusatz-Qualifikation EMAH-Kardiologie der Interdisziplinären EMAH Task Force Basierend auf: J. Hess, et al., Empfehlungen für Erwachsenen und Kinderkardiologen zum Erwerb der Zusatz-Qualifikation

Mehr