Ein Patientenberatungsleitfaden zur reproduktiven Genetik. Bildungsinhalt bereitgestellt von

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Ein Patientenberatungsleitfaden zur reproduktiven Genetik. Bildungsinhalt bereitgestellt von"

Transkript

1 Ein Patientenberatungsleitfaden zur reproduktiven tik Bildungsinhalt bereitgestellt von

2 sverzeichnis zur tik Dieser Beratungsleitfaden richtet sich an Dienstleister im Gesundheitswesen und soll grundlegende Informationen zur genetischen Beratung bereitstellen. Er dient nur zu allgemeinen Bildungszwecken. Der Leitfaden ist nicht als Ersatz für die fachliche Beurteilung durch den Dienstleister im Gesundheitswesen bei der Bereitstellung professioneller Dienstleistungen vorgesehen. 2 zur tik

3 zur tik 3 zur tik

4 Zellen, Chromosomen und DNA Mensch Zellkern DNA Basispaare A T G C Zelle Chromosom US National Library of Medicine. Help Me Understand tics: Cells and DNA. Veröffentlicht am 30. Mai Aufgerufen am 6. Juni zur tik

5 Zellen, Chromosomen und DNA Der menschliche Körper besteht aus Trillionen von Zellen. Innerhalb des Zellkerns befinden sich Strukturen, die Chromosomen genannt werden. Chromosomen bestehen aus n. Bei n handelt es sich um individuelle Anweisungen an den Körper, wie er sich entwickeln und funktionieren soll. Die vier Basen der DNA (A, T, G, C) sind die Bausteine von n. Die Reihenfolge dieser Basen bestimmt die Anweisungen der an unsere Körper. Mensch Zellkern DNA Basispaare A T G C US National Library of Medicine. Help Me Understand tics: Cells and DNA. Veröffentlicht am 30. Mai Aufgerufen am 6. Juni Zelle Chromosom 5 zur tik

6 Menschliche Chromosomen Von der Mutter Vom Vater oder Autosome 22 X X X Y Frau Mann 23 Geschlechtschromosomen Bild in Anlehnung an Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and tic Counseling. 4th ed. New York, NY: Oxford University Press; zur tik

7 Menschliche Chromosomen Menschen haben gewöhnlich 23 Chromosomenpaare und damit insgesamt 46 Chromosomen. Die Hälfte der Chromosomen stammen von der Mutter und die andere Hälfte vom Vater. Die ersten 22 Paare sind bei Männern und Frauen gleich. Diese werden als Autosome bezeichnet. Die Chromosomen des letzten Paars werden als Geschlechtschromosomen bezeichnet. Gewöhnlich haben Frauen zwei Kopien des X-Chromosoms und Männer ein X- und ein Y-Chromosom. Von der Mutter Vom Vater oder Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and tic Counseling. 4th ed. New York, NY: Oxford University Press; Autosome X X X Y Frau Mann 23 Geschlechtschromosomen 7 zur tik

8 Zellteilung bei primären Keimzellen (Meiose) Primäre Keimzelle Kopierte Chromosomen 1. Meiose 2. Meiose Gameten (Spermium/Ei) 8 zur tik

9 Zellteilung bei primären Keimzellen (Meiose) Die menschlichen Gameten sind Spermien und Eier. Gewöhnlich verfügt jeder Gamet über nur einen Chromosomensatz (insgesamt 23). Bei der Befruchtung/Empfängnis verbindet sich das Spermium des Vaters mit dem Ei der Mutter und bildet eine Zygote, die zu einem Embryo mit 46 Chromosomen wird. Primäre Keimzelle Kopierte Chromosomen 1. Meiose 2. Meiose Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and tic Counseling. 4th ed. New York, NY: Oxford University Press; Gameten (Spermium/Ei) 9 zur tik

10 Non-Disjunction: ein Fehler bei der Zellteilung Typische Meiose Non-Disjunction Spermium Eier Befruchtung Trisomie Monosomie 10 zur tik

11 Non-Disjunction: ein Fehler bei der Zellteilung Aneuploidie: eine falsche Anzahl an Chromosomen Trisomie: drei Kopien eines bestimmten Chromosoms Monosomie: eine Kopie eines bestimmten Chromosoms Mögliche Folgen von Aneuploidie: Der Embryo kann sich nicht im Uterus einnisten Fehlgeburt Geburt eines Babys mit einer Chromosomenerkrankung (z. B. Trisomie 21, auch als Down-Syndrom bekannt) Typische Meiose Non-Disjunction Spermium Eier Befruchtung Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and tic Counseling. 4th ed. New York, NY: Oxford University Press; Trisomie Monosomie 11 zur tik

12 12 zur tik

13 Trisomie 21 (Down-Syndrom) X X 13 zur tik

14 Trisomie 21 (Down-Syndrom) Trisomie 21 ist die häufigste Chromosomenerkrankung bei Lebendgeburten. Trisomie 21 tritt bei ungefähr 1 von 660 Lebendgeburten auf. Häufige Merkmale von Trisomie 21: Geistige Behinderung Herzprobleme Niedriger oder geringer Muskeltonus Charakteristische Gesichtszüge Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X X 14 zur tik

15 Trisomie 18 (Edwards-Syndrom) X Y 15 zur tik

16 Trisomie 18 (Edwards-Syndrom) Trisomie 18 tritt bei ungefähr 1 von Lebendgeburten auf. Schwere Chromosomenerkrankung. Die Lebenserwartung liegt gewöhnlich bei weniger als 1 Jahr. Häufige Merkmale von Trisomie 18: Intrauterine Wachstumsverzögerung Ungewöhnliche Positionierung von Händen und/oder Füßen Schwere Entwicklungsstörungen und geistige Behinderung Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X Y 16 zur tik

17 Trisomie 13 (Pätau-Syndrom) X X 17 zur tik

18 Trisomie 13 (Pätau-Syndrom) Trisomie 13 tritt bei ungefähr 1 von Lebendgeburten auf. Schwere Chromosomenerkrankung. Die Lebenserwartung liegt gewöhnlich bei weniger als 1 Jahr. Häufige Merkmale von Trisomie 13: Herz-, Gehirn- und Nierenanomalien Lippe und/oder Gaumen nicht vollständig verbunden (Spalte) Schwere Entwicklungsstörungen und geistige Behinderung Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X X 18 zur tik

19 Monosomie X (Turner-Syndrom) X 19 zur tik

20 Monosomie X (Turner-Syndrom) Monosomie X tritt in 1 1,5 % der Schwangerschaften auf. Jedoch überleben die meisten (~99 %) dieser Schwangerschaften nicht. Monosomie X tritt bei ungefähr 1 von Lebendgeburten von Mädchen auf. Häufige Merkmale von Monosomie X: Herzfehler Kleiner als der Durchschnitt Verzögerte Pubertät Unfruchtbarkeit Hook EB, Warburton D. Hum t. 2014;133(4): Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X 20 zur tik

21 47,XXX (Triple-X-Syndrom) X X X 21 zur tik

22 47,XXX (Triple-X-Syndrom) 47,XXX tritt bei ungefähr 1 von Lebendgeburten von Mädchen auf. Bei vielen Frauen mit 47,XXX zeigen sich keine sichtbaren Merkmale. Variable Merkmale von 47,XXX: Größer als der Durchschnitt Lernschwierigkeiten, Rede- und Sprachverzögerung Verzögerte Entwicklung der motorischen Fähigkeiten Verhaltensstörungen und emotionale Schwierigkeiten Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X X X 22 zur tik

23 47,XXX (Triple-X-Syndrom) X X Y 23 zur tik

24 47,XXY (Klinefelter -Syndrom) Das Klinefelter-Syndrom tritt bei ungefähr 1 von 500 Lebendgeburten von Jungen auf. Bei vielen Männern mit 47,XXY zeigen sich keine sichtbaren Merkmale. Variable Merkmale des Klinefelter-Syndroms: Sprach- und/oder Lernschwierigkeiten Große Statur Kleine Hoden Unfruchtbarkeit Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X X Y 24 zur tik

25 47,XYY (Jacobs-Syndrom) X Y Y 25 zur tik

26 47,XYY (Jacobs-Syndrom) 47,XYY tritt bei ungefähr 1 von 840 Lebendgeburten von Jungen auf. Bei vielen Männern mit 47,XYY zeigen sich keine sichtbaren Merkmale. Variable Merkmale von 47,XYY: Verzögerte Entwicklung von Rede- und Sprachfähigkeiten Lernschwächen Autismus-Spektrum-Störung Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X Y Y 26 zur tik

27 Deletionen und Mikrodeletionen von Chromosomen Telomer Telomer Telomer p-arm p-arm p-arm p-arm Zentromer Zentromer Zentromer Zentromer q-arm q-arm q-arm q-arm Telomer Telomer Telomer Telomer Normal Deletion Normal Mikrodeletion 27 zur tik

28 Deletionen und Mikrodeletionen von Chromosomen Deletionen und Mikrodeletionen werden durch fehlende Abschnitte von Chromosomenmaterial verursacht. Mikrodeletionen sind kleiner als Deletionen und unter einem Mikroskop nicht sichtbar. Deletionen und Mikrodeletionen von Chromosomen können zu geistiger Behinderung, Entwicklungsverzögerungen und/oder Geburtsdefekten führen. Telomer Telomer Telomer p-arm p-arm p-arm p-arm Zentromer Zentromer Zentromer Zentromer q-arm q-arm q-arm q-arm Telomer Telomer Telomer Telomer Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and tic Counseling. 4th ed. New York, NY: Oxford University Press; Normal Deletion Normal Mikrodeletion 28 zur tik

29 Deletionen und Mikrodeletionen von Chromosomen Telomer Telomer Telomer p-arm p-arm p-arm p-arm Zentromer Zentromer Zentromer Zentromer q-arm q-arm q-arm q-arm Telomer Telomer Telomer Telomer Normal Duplikation Normal Mikroduplikaion 29 zur tik

30 Deletionen und Mikrodeletionen von Chromosomen Duplikationen und Mikroduplikationen werden durch zusätzliche Abschnitte von Chromosomenmaterial verursacht. Mikroduplikationen sind kleiner als Duplikationen und unter einem Mikroskop nicht sichtbar. Duplikationen und Mikroduplikationen von Chromosomen können zu geistiger Behinderung, Entwicklungsverzögerungen und/oder Geburtsdefekten führen. Telomer Telomer Telomer p-arm p-arm p-arm p-arm Zentromer Zentromer Zentromer Zentromer q-arm q-arm q-arm q-arm Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and tic Counseling. 4th ed. New York, NY: Oxford University Press; Telomer Telomer Telomer Telomer Normal Duplikation Normal Mikroduplikaion 30 zur tik

31 Chromosomentranslokation: Reziproke Elternteil A Träger einer balancierten Translokation Elternteil B Nicht-Träger Mögliche Gameten von Elternteil (Träger) Gamet von Elternteil (Nicht-Träger) Befruchtung Mögliche Zygoten Nicht-Träger Träger einer balancierten Translokation Partielle Trisomie + partielle Monosomie Partielle Trisomie + partielle Monosomie 31 zur tik

32 Chromosomentranslokation: Reziproke Es kommt zu einer reziproken Translokation, wenn zwei Chromosomen Segmente austauschen. Reziproke Translokationen treten bei ungefähr 1 von 500 Personen auf. Bei den meisten Personen mit reziproker Translokation zeigen sich keine sichtbaren Merkmale. Bei Trägern einer reziproken Translokation besteht ein Risiko für: Unfruchtbarkeit Wiederholte Fehlgeburten Babys mit Geburtsdefekten und/oder geistiger Behinderung Elternteil A Träger einer balancierten Translokation Elternteil B Nicht-Träger Mögliche Gameten von Elternteil (Träger) Gamet von Elternteil (Nicht-Träger) Befruchtung Mögliche Zygoten Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and tic Counseling. 4th ed. New York, NY: Oxford University Press; Nicht-Träger Träger einer balancierten Translokation Partielle Trisomie + partielle Monosomie Partielle Trisomie + partielle Monosomie 32 zur tik

33 Chromosomentranslokation: Robertsonsche Elternteil A Träger einer balancierten Translokation Elternteil B Nicht-Träger Mögliche Gameten von Elternteil (Träger) Gamet von Elternteil (Nicht-Träger) Befruchtung Mögliche Zygoten Nicht-Träger Träger einer Translokation Trisomie Monosomie Trisomie Monosomie 33 zur tik

34 Chromosomentranslokation: Robertsonsche Es kommt zu einer Robertsonschen Translokation, wenn zwei bestimmte Chromosomen (13, 14, 15, 21, 22) sich verbinden. Robertsonsche Translokationen treten bei ungefähr 1 von Personen auf. Bei den meisten Personen mit Robertsonscher Translokation zeigen sich keine sichtbaren Merkmale. Bei Trägern einer Robertsonschen Translokation besteht ein Risiko für: Unfruchtbarkeit Wiederholte Fehlgeburten Babys mit Geburtsdefekten und/oder geistiger Behinderung Elternteil A Träger einer balancierten Translokation Elternteil B Nicht-Träger Mögliche Gameten von Elternteil (Träger) Gamet von Elternteil (Nicht-Träger) Befruchtung Mögliche Zygoten Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and tic Counseling. 4th ed. New York, NY: Oxford University Press; Nicht-Träger Träger einer Translokation Trisomie Monosomie Trisomie Monosomie 34 zur tik

35 Mosaizismus (ein Fehler bei der Zellteilung, der zu Zellen mit einer genetischen Veränderung führt) Befruchtung Embryo Somatische Zellteilung (Mitose) Mosaik Normale Zellen Zellen mit genetischer Veränderung In Anlehnung an: Campbell IM, Shaw CA, Stankiewicz P, Lupski JR. Somatic mosaicism: implications for disease and transmission genetics. Trends t. 2015;31(7): zur tik

36 Mosaizismus (ein Fehler bei der Zellteilung, der zu Zellen mit einer genetischen Veränderung führt) Mosaizimus ist das Vorhandensein von zwei oder mehr Zellen mit verschiedenen genetischen Strukturen. Er wird durch einen Fehler während der Zellteilung (Mitose) verursacht. Der Anteil jeder Zelllinie ist variabel. Die klinischen Auswirkungen von Mosaizismus auf eine Person variieren je nach Anzahl und Typ der betroffenen Zellen. Befruchtung Embryo Somatische Zellteilung (Mitose) Mosaik Normale Zellen Zellen mit genetischer Veränderung U.S. National Library of Medicine. Medical Encyclopedia: Mosaicism. Aktualisiert am 3. Mai Aufgerufen am 3. Juni zur tik

37 37 zur tik

38 Autosomale dominante Vererbung Eltern Mutation Normal Betroffen Nicht betroffen Kinder Betroffen (50 %) Nicht betroffen (50 %) 38 zur tik

39 Autosomale dominante Vererbung Bei autosomaler dominanter Vererbung ist nur eine Kopie eines mutierten Gens für das Bestehen der Erkrankung erforderlich. Bei einem betroffenen Elternteil bestehen die folgenden reproduktiven Risiken bei einer Schwangerschaft: Mit einer Wahrscheinlichkeit von 50 % ist der Fötus von der Erkrankung betroffen. Mit einer Wahrscheinlichkeit von 50 % ist der Fötus von der Erkrankung nicht betroffen. Für Männer und Frauen besteht dasselbe Risiko. Eltern Mutation Normal Betroffen Nicht betroffen Kinder US National Library of Medicine. Help Me Understand tics: Inheriting tic Conditions. Veröffentlicht am 6. Juni Aufgerufen am 7. Juni Betroffen (50 %) Nicht betroffen (50 %) 39 zur tik

40 Autosomale rezessive Vererbung Eltern Mutation Mutation Normal Normal Träger Träger Kinder Betroffen (25 %) Träger (50 %) Nicht betroffener Nicht-Träger (25 %) 40 zur tik

41 Autosomale rezessive Vererbung Bei autosomaler rezessiver Vererbung sind zwei Kopien eines mutierten Gens für das Bestehen der Erkrankung erforderlich. Personen mit nur einer Kopie eines mutierten Gens werden als Träger bezeichnet und sind in der Regel nicht betroffen. Wenn beide Elternteile Träger derselben Erkrankung sind, bestehen die folgenden reproduktiven Risiken bei einer Schwangerschaft: Mit einer Wahrscheinlichkeit von 25 % ist der Fötus von der Erkrankung betroffen. Mit einer Wahrscheinlichkeit von 50 % ist der Fötus Träger der Erkrankung. Mit einer Wahrscheinlichkeit von 25 % ist der Fötus von der Erkrankung nicht betroffen und kein Träger (nicht betroffener Nicht-Träger). Für Männer und Frauen besteht dasselbe Risiko. Eltern Kinder Mutation Normal Träger Mutation Normal Träger US National Library of Medicine. Help Me Understand tics: Inheriting tic Conditions. Veröffentlicht am 6. Juni Aufgerufen am 7. Juni Betroffen (25 %) Träger (50 %) Nicht betroffener Nicht-Träger (25 %) 41 zur tik

42 X-gebundene rezessive Vererbung Eltern Mutation Normal X Y X X Nicht betroffen Träger Kinder X Y X X X X X Y Nicht betroffen (25 %) Nicht betroffener Nicht-Träger (25 %) Träger (25 %) Betroffen (25 %) 42 zur tik

43 X-gebundene rezessive Vererbung X-gebundene Vererbung ist mit einem mutierten Gen auf dem X-Chromosom verknüpft. Männer mit einem mutierten Gen auf ihrem X-Chromosom sind von der Erkrankung betroffen. Frauen mit einem mutierten Gen auf einem ihrer beiden X-Chromosomen werden als Träger der Erkrankung bezeichnet. Weibliche Träger sind gewöhnlich nicht betroffen. Jedoch können einige weibliche Träger Merkmale der Erkrankung aufweisen. Bei Frauen, die Träger einer X-gebundenen rezessiven Erkrankung sind, bestehen die folgenden reproduktiven Risiken bei einer Schwangerschaft: Mit einer Wahrscheinlichkeit von 25 % wird es ein Sohn, der von der Erkrankung nicht betroffen ist. Eltern Mit einer Wahrscheinlichkeit von 25 % wird es eine Tochter, die nicht Trägerin der Erkrankung ist. Mit einer Wahrscheinlichkeit von 25 % wird es eine Tochter, die Trägerin der Erkrankung ist. Nicht betroffen Träger Mit einer Wahrscheinlichkeit von 25 % wird es Kinder ein Sohn, der von der Erkrankung betroffen ist. Mutation X Y X X Normal US National Library of Medicine. Your guide to understanding genetic conditions: What are the different ways in which a genetic condition can be inherited? Veröffentlicht am 31. Mai Aufgerufen am 3. Juni X Y X X X X X Y Nicht betroffen (25 %) Nicht betroffener Nicht-Träger (25 %) Träger (25 %) Betroffen (25 %) 43 zur tik

44 44 zur tik

45 Künstliche Befruchtung (IVF) Uterus Eierstock 1 Stimulation der Eierstöcke und Eientnahme 3 Embryotransfer 2 Befruchtung 45 zur tik

46 Künstliche Befruchtung (IVF) Ein IVF-Zyklus umfasst drei Hauptschritte: 1. Stimulation der Eierstöcke und Eientnahme 2. Befruchtung Spermium und Ei werden im Labor vereinigt, um ein Embryo zu bilden 3. Embryotransfer in den Uterus oder Einfrierung zur späteren Verwendung Uterus Eierstock 1 Stimulation der Eierstöcke und Eientnahme 3 Embryotransfer 2 Befruchtung 46 zur tik

47 Prozentsatz an Embryonen mit einer Chromosomenanomalie (Aneuploidie) steigt mit dem Alter der Mutter 90 % der Embryos mit Aneuploidie < > 42 Alter der Mutter Harton GL, et al. Fertil Steril. 2013;100(6): zur tik

48 Prozentsatz an Embryonen mit einer Chromosomenanomalie (Aneuploidie) steigt mit dem Alter der Mutter Embryonen mit Aneuploidie kann es bei Frauen in allen Altersstufen geben, aber das Risiko steigt mit dem Alter der Mutter. Risiken in Verbindung mit einem Embryo mit Aneuploidie: Implantationsfehler Fehlgeburt Babys mit Geburtsdefekten/geistiger Behinderung 90 % der Embryos mit Aneuploidie Harton GL, et al. Fertil Steril. 2013;100(6): Scott RT Jr., et al. Fertil Steril. 2012;97(4): < > 42 Alter der Mutter Harton GL, et al. Fertil Steril. 2013;100(6): zur tik

49 Stufen der 2-Zell-Stadium 8-Zell-Stadium (Teilungsstadium) Blastozyste (mind. 100 Zellen) Innere Zellmasse Äußere Schicht (Trophoblast) Befruchtung Tag 2 Tag 3 Tag 5 49 zur tik

50 Stufen der Nach der Eientnahme erfolgt im Labor die Befruchtung. In den Tagen nach der Befruchtung kommt es zur Zellteilung. An Tag 5 hat sich eine Blasozyste mit einer äußeren Schicht und einer inneren Zellmasse gebildet. 2-Zell-Stadium 8-Zell-Stadium (Teilungsstadium) Blastozyste (mind. 100 Zellen) Innere Zellmasse Äußere Schicht (Trophoblast) Befruchtung Tag 2 Tag 3 Tag 5 Harton GL, et al. Fertil Steril. 2013;100(6): zur tik

51 51 zur tik

52 Embryo mit geringer Wahrscheinlichkeit für Aneuploidie Embryo mit hoher Wahrscheinlichkeit für Aneuploidie Embryobiopsie Chromosomen-Screening Embryotransfer 52 zur tik

53 PGS-Prozess: 1. Embryobiopsie: Eine oder mehrere Zellen werden von jedem Embryo zu Screening- Zwecken entnommen. 2. Chromosomen-Screening: Für die Zellen von der Biopsie erfolgt ein Screening auf Aneuploidie (zu viele oder zu wenige Chromosomen). 3. Embryotransfer: Embryonen, die mit hoher Wahrscheinlichkeit nicht von Aneuploidie betroffen sind, können in den Uterus überführt oder zur späteren Verwendung eingefroren werden. Mögliche Vorteile: Erhöhte Raten für Implantation, Schwangerschaft und Lebendgeburten. Geringere Raten für Fehlgeburten. Auswahl des lebensfähigsten Embryos für den Transfer eines einzelnen Embryos. Einschränkungen: Bei PGS erfolgt das Screening nur auf Aneuploidie. Bei PGS erfolgt kein Screening auf andere Erkrankungen. Die Genauigkeit von PGS liegt nicht bei 100 %. Forman EJ, et al. Fertil Steril. 2013;100(1): Scott RT Jr, et al. Fertil Steril. 2013;100(3): Harton GL, et al. Fertil Steril. 2013;100(6): Dahdouh EM, et al. J Obstet Gynaecol Can. 2015;37(5): Embryo mit geringer Wahrscheinlichkeit für Aneuploidie Embryo mit hoher Wahrscheinlichkeit für Aneuploidie Embryobiopsie Chromosomen-Screening Embryotransfer 53 zur tik

54 54 zur tik

55 Embryo mit hoher Wahrscheinlichkeit, nicht betroffen zu sein Embryo mit hoher Wahrscheinlichkeit, betroffen zu sein Embryobiopsie tische Tests Embryotransfer 55 zur tik

56 PID-Prozess: 1. Embryobiopsie: Eine oder mehrere Zellen werden von jedem Embryo zu Testzwecken entnommen. 2. tische Tests: Die Zellen von der Biopsie werden auf die in Frage kommenden Erbkrankheiten getestet. 3. Embryotransfer: Embryonen, die mit hoher Wahrscheinlichkeit nicht von der Krankheit betroffen sind, können in den Uterus überführt oder zur späteren Verwendung eingefroren werden. Vorteile: Geringeres Risiko, ein Baby mit einer Erbkrankheit zu bekommen. Einschränkungen: Über PID können nicht alle möglichen Erkrankungen getestet werden. Die Genauigkeit von PID liegt nicht bei 100 %. Embryo mit hoher Wahrscheinlichkeit, nicht betroffen zu sein Embryo mit hoher Wahrscheinlichkeit, betroffen zu sein Embryobiopsie tische Tests Embryotransfer Practice Committee of Society for Assisted Reproductive Technology; Practice Committee of American Society for Reproductive Medicine. Fertil Steril. 2008;90(5 Suppl):S Dahdouh EM, et al. J Obstet Gynaecol Can. 2015;37(5): zur tik

57 57 zur tik

58 * Nach Beratung entscheidet sich Patient für pränatale Tests NEIN JA Serum- Screening cfdna- Screening Diagnostik Schwangerschaftswoche 10 0/7 22 6/7 Schwangerschaftswoche 10 bis zur Geburt CVS/Amniozentese CVS: Schwangerschaftswoche Amniozentese: gewöhnlich Schwangerschaftswoche JA Ist das Ergebnis positiv in Bezug auf eine Chromosomenerkrankung? NEIN Ist das Ergebnis positiv in Bezug auf eine Chromosomenerkrankung? NEIN JA Weitere Beratung und diagnostische Tests anbieten Patient und Dienstleister besprechen die nächsten Schritte Patient und Dienstleister besprechen die nächsten Schritte Patient und Dienstleister besprechen die nächsten Schritte ACOG Practice Bulletins Prenatal Diagnostic Testing for tic Disorders. Obstet Gynecol. 2016;127:e108 e122. ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e137. *Typisch in den USA, kann jedoch in anderen Ländern davon abweichen. 58 zur tik

59 * auf Aneuploidie beurteilt das Risiko einer Frau, mit einem Fötus mit bestimmten schwanger zu sein. Fällt ein Screening-Ergebnis positiv aus, sollten weiterführende Beratung und diagnostische Tests angeboten werden. Diagnostische Tests können definitive Informationen zu Folgendem liefern: Bestimmten genetischen Erkrankungen Nach Beratung entscheidet sich Patient für pränatale Tests NEIN JA Serum- Screening cfdna- Screening Diagnostik Schwangerschaftswoche 10 0/7 22 6/7 Schwangerschaftswoche 10 bis zur Geburt CVS/Amniozentese CVS: Schwangerschaftswoche Amniozentese: gewöhnlich Schwangerschaftswoche ACOG Practice Bulletins Prenatal Diagnostic Testing for tic Disorders. Obstet Gynecol. 2016;127:e108 e122. ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e137. *Typisch in den USA, kann jedoch in anderen Ländern davon abweichen. Ist das Ergebnis positiv JA in Bezug auf eine Chromosomenerkrankung? NEIN Patient und Dienstleister besprechen die nächsten Schritte Ist das Ergebnis positiv in Bezug auf eine JA Chromosomenerkrankung? NEIN Patient und Dienstleister besprechen die nächsten Schritte Weitere Beratung und diagnostische Tests anbieten Patient und Dienstleister besprechen die nächsten Schritte 59 zur tik

60 Zellfreies DNA-Screening (cfdna-screening) Nicht betroffene Schwangerschaft Betroffene Schwangerschaft CCCTTAGCGCTTTAACGTACGTAAAACCCTT AACGTACGTAAAAACGGGGTCAAAGGTTCCC GACTTAAAATCGGAATCGATGCCCAAACTT AATCGATGCCCAAACGGGGTCAAAGTTCCC Mütterliche cfdna Fötale cfdna Blutabnahme bei der Mutter und Isolierung von cfdna Sequenzierung von cfdna Analyse durch Zählen 60 zur tik

61 Zellfreies DNA-Screening (cfdna-screening) cfdna-screening-prozess: 1. Der Schwangeren wird in der 10. Schwangerschaftswoche oder später über den Arm Blut abgenommen. Die cfdna wird im Labor vom mütterlichen Blut isoliert. 2. Die cfdna wird sequenziert, um ursprüngliche Chromosomen zu bestimmen. 3. Die sequenzierte cfdna wird zum Screenen auf gezählt. Vorteile: Hohe Erkennungsraten für getestete Erkrankungen Sehr niedrige falsch positive Raten Weniger Patienten benötigen nachfolgende diagnostische Tests im Vergleich zum Serum-Screening. Einschränkungen: Nicht diagnostisch (falsch positive und falsch negative Ergebnisse können auftreten). Nicht betroffene Betroffene Schwangerschaft Schwangerschaft In einigen Fällen können Ergebnisse eine mütterliche Erkrankung anstelle einer fötalen anzeigen. Mütterliche cfdna Fötale cfdna CCCTTAGCGCTTTAACGTACGTAAAACCCTT AACGTACGTAAAAACGGGGTCAAAGGTTCCC GACTTAAAATCGGAATCGATGCCCAAACTT AATCGATGCCCAAACGGGGTCAAAGTTCCC Gil MM, et al. Ultrasound Obstet Gynecol. 2015;45(3): ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e Blutabnahme bei der Mutter und Isolierung von cfdna Sequenzierung von cfdna Analyse durch Zählen 61 zur tik

62 Klassifizierung von Ergebnissen des cfdna-screenings Negative cfdna-ergebnisse Positive cfdna-ergebnisse Richtig negative Ergebnisse Richtig positive Ergebnisse Falsch positive und falsch negative Ergebnisse 62 zur tik

63 Klassifizierung von Ergebnissen des cfdna-screenings Richtig positiv: ein positives Ergebnis und der Fötus hat die Erkrankung. Falsch positiv: ein positives Ergebnis, aber der Fötus hat die Erkrankung nicht. Richtig negativ: ein negatives Ergebnis und der Fötus hat die Erkrankung nicht. Falsch negativ: ein negatives Ergebnis, aber der Fötus hat die Erkrankung. Negative cfdna-ergebnisse Positive cfdna-ergebnisse Richtig negative Ergebnisse Richtig positive Ergebnisse Falsch positive und falsch negative Ergebnisse 63 zur tik

64 cfdna: Negative Ergebnisse Negative cfdna-ergebnisse Föten mit der Erkrankung (falsch negative Ergebnisse) 64 zur tik

65 cfdna: Negative Ergebnisse Die Wahrscheinlichkeit, dass der Fötus die Erkrankung nicht hat, liegt bei über 99 %. Es kommt selten zu falsch negativen Ergebnissen. Die Ergebnisse gelten nur für die getesteten Erkrankungen. Es sollten keine zusätzlichen Screening-Tests für Aneuploidie angeboten werden, da dies die Wahrscheinlichkeit eines falsch positiven Ergebnisses erhöht. Negative cfdna-ergebnisse ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e137. Gil MM, et al. Ultrasound Obstet Gynecol. 2015;45(3): Föten mit der Erkrankung (falsch negative Ergebnisse) 65 zur tik

66 cfdna: Positive Ergebnisse Keine weiteren Risikofaktoren vorhanden Weitere(r) Risikofaktor(en) vorhanden Alle positiven cfdna-ergebnisse Föten mit der Erkrankung 66 zur tik

67 cfdna: Positive Ergebnisse Ein positives Ergebnis bedeutet, dass für den Fötus ein erhöhtes Risiko einer Chromosomenerkrankung besteht. Das Gesamtrisiko für die Erkrankung ist abhängig von einer Kombination des cfdna-ergebnisses und anderer, zusätzlicher Risikofaktoren, einschließlich: Alter der Mutter Ergebnisse des Ultraschalls Ergebnisse des Serum-Screenings Familiengeschichte zu Weiterführende Beratung Tests sollten angeboten werden. Keine weiteren Risikofaktoren vorhanden Weitere(r) Risikofaktor(en) vorhanden Alle positiven cfdna-ergebnisse Föten mit der Erkrankung ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e zur tik

68 Diagnostische Tests: Chorionzottenbiopsie (CVS) Plazenta Ultraschallkopf Plazenta Ultraschallkopf Chorionzotten Chorionzotten Transzervikale CVS Transabdominale CVS 68 zur tik

69 Diagnostische Tests: Chorionzottenbiopsie (CVS) Kann bestimmen, wie hoch die Wahrscheinlich ist, dass eine Chromosomenerkrankung vorliegt. Zusätzliche genetische Tests können bei Indikation durchgeführt werden. Umfasst Tests von Zellen, die der Plazenta entnommen werden. Wird gewöhnlich zwischen der 10. und 13. Schwangerschaftswoche durchgeführt. Birgt ein gewisses Risiko für eine Fehlgeburt. Plazenta Ultraschallkopf Plazenta Ultraschallkopf Chorionzotten Chorionzotten Transzervikale CVS Transabdominale CVS ACOG Practice Bulletins Prenatal Diagnostic Testing for tic Disorders. Obstet Gynecol. 2016;127:e108 e zur tik

70 Diagnostische Tests: Amniozentese Ultraschallkopf Fruchtwasser Uteruswand 70 zur tik

71 Diagnostische Tests: Amniozentese Kann bestimmen, wie hoch die Wahrscheinlich ist, dass eine Chromosomenerkrankung vorliegt. Zusätzliche genetische Tests können bei Indikation durchgeführt werden. Umfasst Tests von fötalen Zellen, die aus der den Fötus umgebenden Flüssigkeit (Fruchtwasser) entnommen werden. Wird gewöhnlich zwischen der 15. und 20. Schwangerschaftswoche durchgeführt. Birgt ein gewisses Risiko für eine Fehlgeburt. Ultraschallkopf Fruchtwasser Uteruswand ACOG Practice Bulletins Prenatal Diagnostic Testing for tic Disorders. Obstet Gynecol. 2016;127:e108 e zur tik

72 Arten des fötalen chromosomalen Mosaizismus Normale Zellen Chromosomal abnormale Zellen Allgemeiner Mosaizismus Begrenzter plazentaler Mosaizismus Fötaler Mosaizismus Kalousek DK. Pediatr Pathol. 1990;10(1-2): Kalousek DK. Pediatr Pathol. 1990;10(1-2): zur tik

73 Arten des fötalen chromosomalen Mosaizismus Allgemeiner Mosaizismus: Vorhandensein von zwei oder mehr chromosomal verschiedenen Zelllinien sowohl in der Plazenta als auch im Fötus. Kann zu einem falsch positiven oder falsch negativen cfdna-ergebnis führen. Begrenzter plazentaler Mosaizismus: Vorhandensein von zwei oder mehr chromosomal verschiedenen Zelllinien in der Plazenta, aber nicht im Fötus. Kann zu einem falsch positiven cfdna-ergebnis führen. Fötaler Mosaizismus: Vorhandensein von zwei oder mehr chromosomal verschiedenen Zelllinien im Fötus, aber nicht in der Plazenta. Kann zu einem falsch negativen cfdna-ergebnis führen. Normale Zellen Chromosomal abnormale Zellen Allgemeiner Mosaizismus Begrenzter plazentaler Mosaizismus Fötaler Mosaizismus Grati FR. J Clin Med. 2014;3(3): Van Opstal D, et al. PLoS One. 2016;11(1):e Kalousek DK. Pediatr Pathol. 1990;10(1-2): zur tik

74 Dieser Beratungsleitfaden richtet sich an Dienstleister im Gesundheitswesen und soll grundlegende Informationen zur genetischen Beratung bereitstellen. Er dient nur zu allgemeinen Bildungszwecken. Der Leitfaden ist nicht als Ersatz für die fachliche Beurteilung durch den Dienstleister im Gesundheitswesen bei der Bereitstellung professioneller Dienstleistungen vorgesehen Illumina, Inc. Alle Rechte vorbehalten. Pub.- Nr A-DEU zur tik

Fragen Sie Ihren Arzt/Ihrer Ärztin

Fragen Sie Ihren Arzt/Ihrer Ärztin Ein einfacher, sicherer Bluttest, der verlässliche Ergebnisse bietet Ein nicht-invasiver Test zur Bewertung des Risikos einer chromosomalen Erkrankung wie Down-Syndrom, der auch eine freiwillige Analyse

Mehr

Der Wert von nicht-invasiven pränatalen Tests (NIPT) Ein Zusatz zum Handbuch für Genetikberater

Der Wert von nicht-invasiven pränatalen Tests (NIPT) Ein Zusatz zum Handbuch für Genetikberater Der Wert von nicht-invasiven pränatalen Tests (NIPT) Ein Zusatz zum Handbuch für Genetikberater NIPTs verwenden zellfreie DNA. Blutprobe von der Mutter Mütterliche cfdna Fötale cfdna NIPTs verwenden zellfreie

Mehr

Erklärung genetischer Begriffe

Erklärung genetischer Begriffe 12 Erklärung genetischer Begriffe Bearbeitung eines Glossars der London IDEAS Genetischer Wissenspark, Vereinigtes Königreich Januar 2008 Dieser Text wurde mit Unterstützung von EuroGentest angefertigt,

Mehr

Qualität aus ärztlichen Händen. Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter

Qualität aus ärztlichen Händen. Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter Qualität aus ärztlichen Händen Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter Liebe Schwangere, als werdende Mutter befinden Sie sich wahrscheinlich in einer der emotionalsten Phasen

Mehr

Trisomie 21: Entstehung - Folgen - Lebenserwartung/-standard - Auftretenswahrscheinlichkeit

Trisomie 21: Entstehung - Folgen - Lebenserwartung/-standard - Auftretenswahrscheinlichkeit Naturwissenschaft Lorenz Wächter Trisomie 21: Entstehung - Folgen - Lebenserwartung/-standard - Auftretenswahrscheinlichkeit Studienarbeit Inhaltsverzeichnis 1. Begriffsbestimmung 1 2. Entstehung...1

Mehr

Patienteninformation zur Präimplantationsdiagnostik V3 07/2015 Seite 1 von 5

Patienteninformation zur Präimplantationsdiagnostik V3 07/2015 Seite 1 von 5 Medizinisch Genetisches Zentrum Prof. Dr. med. Dipl. chem. Elke Holinski-Feder, PD Dr. med. Angela Abicht Fachärztinnen für Humangenetik, MVZ Patienteninformation zur Präimplantationsdiagnostik Begriffserläuterung

Mehr

numerischen Chromosomenstörungen bzw. von Fehlverteilungen der Chromosomen strukturelle Chromosomenstörungen Mosaike

numerischen Chromosomenstörungen bzw. von Fehlverteilungen der Chromosomen strukturelle Chromosomenstörungen Mosaike Sehr geehrte Ärztin, sehr geehrte Arzt, folgenden Text stellen wir Ihnen zur Verfügung, damit Sie ihn als Basisinformation für Ihr Aufklärungsgespräch zum PraenaTest verwenden können. Wir weisen Sie jedoch

Mehr

Pränatale Analytik Informationen für die Eltern

Pränatale Analytik Informationen für die Eltern Pränatale Analytik Informationen für die Eltern Liebe Eltern Sie entscheiden. Diese Broschüre vermittelt Ihnen wichtige Informationen zur pränatalen Diagnostik fetaler Trisomien. Die Entscheidung, einen

Mehr

Nicht-invasive molekulargenetische Pränataldiagnostik

Nicht-invasive molekulargenetische Pränataldiagnostik Nicht-invasive molekulargenetische Pränataldiagnostik Dr. rer. medic. Wera Hofmann Medical Director LifeCodexx AG Dr. Wera Hofmann, Medical Director Porto, ECA 2011 July 2, 2011 page 1 2011 LifeCodexx

Mehr

prenatal Nicht invasiver pränataler Test

prenatal Nicht invasiver pränataler Test prenatal Nicht invasiver pränataler Test 1 Sie sind schwanger. Herzlichen Glückwunsch! 2 Liebe zukünftige Eltern, wahrscheinlich ist alles gerade sehr aufregend für Sie, und es ist nur natürlich, dass

Mehr

Bsp.: Trisomie 21 (früher: Mongolismus, heute: DOWN-Syndrom)

Bsp.: Trisomie 21 (früher: Mongolismus, heute: DOWN-Syndrom) 3.3.4.5 Genommutationen Def.: Mutation = durch einen Verursacher hervorgerufene oder spontane Veränderung im Erbgut, die an die Nachkommen weiter gegeben wird. Mutationen können einzelne Gene betreffen,

Mehr

Unsere Patienten-Information. Pränatales Screening auf Chromosomenstörungen LABOR ENDERS. Leitfaden für werdende Mütter und Väter

Unsere Patienten-Information. Pränatales Screening auf Chromosomenstörungen LABOR ENDERS. Leitfaden für werdende Mütter und Väter Unsere Patienten-Information Pränatales Screening auf Chromosomenstörungen Leitfaden für werdende Mütter und Väter Unsere Patienten-Information Liebe Patientin, Eine Fruchtwasseruntersuchung und auch die

Mehr

In memoriam Lisa. und aller Kinder, die nur viel zu kurz das Licht dieser Welt erblicken durften. Matthias Bloechle

In memoriam Lisa. und aller Kinder, die nur viel zu kurz das Licht dieser Welt erblicken durften. Matthias Bloechle In memoriam Lisa und aller Kinder, die nur viel zu kurz das Licht dieser Welt erblicken durften Matthias Bloechle 1 Mit Gentest zum Wunschkind? Prof. Dr. rer. nat. Wolfgang Schumann Institut für Genetik

Mehr

1.-Trimester-Test (1.-TT) Informationen für die Eltern

1.-Trimester-Test (1.-TT) Informationen für die Eltern 1.-Trimester-Test (1.-TT) Informationen für die Eltern Liebe Eltern Sie entscheiden! Dieses Faltblatt wurde geschrieben, um Ihnen wichtige Informationen zum 1.-Trimester-Test (1.-TT) zu vermitteln. Die

Mehr

Humangenetik. Zytogenetik Teil 2. Vorlesungsmitschrift SS 05

Humangenetik. Zytogenetik Teil 2. Vorlesungsmitschrift SS 05 Humangenetik Zytogenetik Teil 2 Vorlesungsmitschrift SS 05 1 Humangenetik: Zytogenetik - Teil II Entstehungsweise von Chromosomenanomalien - de novo ( Neumutation ) geringes Wiederholungsrisiko < 1% -

Mehr

Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia

Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Grundwissen Pränataldiagnostik 4 Grafik Pränataldiagnostiken 6 Die Produktefamilie 9 Robustheit von

Mehr

Alter Mann was nun? oder. Ältere Väter eine genetische Zeitbombe?

Alter Mann was nun? oder. Ältere Väter eine genetische Zeitbombe? ANDROLOGY LETTER Alter Mann was nun? oder Ältere Väter eine genetische Zeitbombe? Wichtig zu wissen: Immer häufiger werden Männer erst im späteren Leben Väter genetisches Risiko, Abortrisiko und perinatale

Mehr

Ersttrimester- Screening Was wird untersucht? MUSTER

Ersttrimester- Screening Was wird untersucht? MUSTER Ersttrimester- Screening Was wird untersucht? Sehr geehrte Patientin, schon seit vielen Jahrzehnten besteht die Möglichkeit durch eine Fruchtwasseruntersuchung (Amniocentese, AC) oder einer Mutterkuchenprobe

Mehr

Die Chromosomen sind im Zellkern immer paarweise vorhanden. In der menschlichen Zelle befinden sich 23 Chromosomenpaare. Diese bilden den diploiden

Die Chromosomen sind im Zellkern immer paarweise vorhanden. In der menschlichen Zelle befinden sich 23 Chromosomenpaare. Diese bilden den diploiden Die Chromosomen Die Chromosomen sind Träger der Erbinformation. Unter dem Mikroskop erscheinen sie in verschiedenen Formen. Einmal als gekrümmte oder gedrungene Stäbchen, in deren Mitte sich eine Ein-schnürung

Mehr

2. Übung: Chromosomentheorie

2. Übung: Chromosomentheorie Konzepte: 2. Übung: Chromosomentheorie Mitose/Meiose Geschlechtschromosomale Vererbung Chromosomentheorie Zellzyklus G 1 Phase: postmitotische Phase oder Präsynthesephase Zelle beginnt wieder zu wachsen

Mehr

Listen Sie auf, welche Verdachtsdiagnosen mit dem First-Trimester-Screening abgeklärt werden können!

Listen Sie auf, welche Verdachtsdiagnosen mit dem First-Trimester-Screening abgeklärt werden können! Ersttrimester-Screening Fallbeschreibung 37-jährige Patientin. Sie befindet sich in der 11. Schwangerschaftswoche (SSW) ihrer ersten Schwangerschaft und lässt in ein Ersttrimester-Screening (First-Trimester-Screening)

Mehr

NEWSLETTER. Gehalt. Genetische Präimplanationsdiagnostik neue Methode des Screenings von 24 Chromosomen mittels Methode Array CGH...

NEWSLETTER. Gehalt. Genetische Präimplanationsdiagnostik neue Methode des Screenings von 24 Chromosomen mittels Methode Array CGH... August 2012 8 Gehalt Genetische Präimplanationsdiagnostik neue Methode des Screenings von 24 Chromosomen mittels Methode Array CGH...2 Beibehaltung der Fertilität neue Möglichkeiten in GENNET...3 Hysteroskopie

Mehr

Chromosomale Veränderungen

Chromosomale Veränderungen Chromosomale Veränderungen Januar 2008 Dieser Text wurde mit Unterstützung von EuroGentest angefertigt, ein vom EU-FP6 gefördertes Network of Excellence, Kontrakt Nr: E 512148 Übersetzung: Prof. Dr. R.

Mehr

Alcaiseda, 22.5.2015

Alcaiseda, 22.5.2015 Alcaiseda, 22.5.2015 Nicht-invasive Diagnostik Ersttrimester Screening (Ultraschall + Biochemie) Cell-Free Fetal DNA im mütterlichen Blut (NIPT) PRC Risk Calculation-Programm der FMF Deutschland mit einem

Mehr

Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia

Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Grundwissen Pränataldiagnostik 4 Grafik Pränataldiagnostiken 6 Die Produktefamilie 9 Robustheit von

Mehr

Autosomal-rezessiver Erbgang

Autosomal-rezessiver Erbgang 12 Autosomal-rezessiver Erbgang Bearbeitetes Informationsblatt herausgegeben vom Guy s and St. Thomas Hospital, London und dem London IDEAS Genetic Knowledge Park, entsprechend deren Qualitätsstandards.

Mehr

Methoden der invasiven Pränataldiagnostik. Methoden zur Beurteilung der fetalen Kondition

Methoden der invasiven Pränataldiagnostik. Methoden zur Beurteilung der fetalen Kondition Pränataldiagnostik Nicht-invasive invasive Methoden der Pränataldiagnostik Sonographie-Screening (10., 20., 30. SSW) und weiterführende Sonographie Ersttrimesterscreening Methoden der invasiven Pränataldiagnostik

Mehr

Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen

Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen Normatives Fundament und anwendungspraktische Geltungskraft des Rechts auf Nichtwissen Fallkonferenz Schwerpunkt Humangenetik Genetische Beratung Genetische Beratung ist ein Kommunikationsprozess, der

Mehr

NIPT Nicht-invasive pränatale Tests Integration ins heutige Screening gesetzliche Bestimmungen welcher Test, wann?

NIPT Nicht-invasive pränatale Tests Integration ins heutige Screening gesetzliche Bestimmungen welcher Test, wann? NIPT Nicht-invasive pränatale Tests Integration ins heutige Screening gesetzliche Bestimmungen welcher Test, wann? Tilo Burkhardt Klinik für Geburtshilfe Trisomie-21-Blutanalysen steigen markant an Recherchen

Mehr

Klare ANTWORTEN auf wichtige Fragen

Klare ANTWORTEN auf wichtige Fragen Klare ANTWORTEN auf wichtige Fragen Der HARMONY PRÄNATAL-TEST ist ein neuartiger, DNA-basierter Bluttest zur Erkennung von Trisomie 21 (Down-Syndrom). Der Harmony- Test ist zuverlässiger als herkömmliche

Mehr

BEISPIELFRAGEN zum ÜBEN...ähnliche Fragen könnten zum Test kommen

BEISPIELFRAGEN zum ÜBEN...ähnliche Fragen könnten zum Test kommen BIOLOGIETEST Sommersemester 3. Klasse Teststoff: Meiose Intersexualität Transsexualität Pubertät und Hormone Menstruationszyklus Embryonalentwicklung Plazenta BEISPIELFRAGEN zum ÜBEN...ähnliche Fragen

Mehr

AUF WICHTIGE FRAGEN. HARMONY PRENATAL TEST ist ein zellfreier DNA-Test zur Bewertung des Risikos für Trisomien 21, 18 und 13.

AUF WICHTIGE FRAGEN. HARMONY PRENATAL TEST ist ein zellfreier DNA-Test zur Bewertung des Risikos für Trisomien 21, 18 und 13. KLARE ANTWORTEN AUF WICHTIGE FRAGEN HARMONY PRENATAL TEST ist ein zellfreier DNA-Test zur Bewertung des Risikos für Trisomien 21, 18 und 13. Der Harmony Prenatal Test wurde von Ariosa Diagnostics entwickelt.

Mehr

Kapitel 19 Pränataldiagnostik bei Fanconi-Anämie

Kapitel 19 Pränataldiagnostik bei Fanconi-Anämie 183 Kapitel 19 Pränataldiagnostik bei Fanconi-Anämie Prof. Dr. rer. nat. Susan Olson Oregon Health Sciences University, Portland OR, USA Pränatale Diagnose Mit Hilfe der pränatalen Diagnose kann man feststellen,

Mehr

2. Übung: Chromosomentheorie

2. Übung: Chromosomentheorie Konzepte: 2. Übung: Chromosomentheorie Mitose/Meiose Geschlechtschromosomale Vererbung Chromosomentheorie Regeln zur Vererbung Autosomal rezessiv: - Merkmal tritt auf in Nachkommen nicht betroffener Eltern

Mehr

Medizinethische Fragen am Lebensanfang

Medizinethische Fragen am Lebensanfang Medizinethische Fragen am Lebensanfang Dr. med. Gisbert Voigt Kinder- und Jugendarzt / Kinderpneumologe Stellv. Vorsitzender PID Kommission Nord Symposium zur Medizinethik 23.09.2015 23. September 2015

Mehr

X-chromosomaler Erbgang

X-chromosomaler Erbgang 12 Deutsche Gesellschaft für Humangenetik e.v.: Web: www.gfhev.de X-chromosomaler Erbgang Orphanet Frei zugängliche Webseite; dort finden Sie Informationen zu seltenen Erkrankungen, klinischen Studien,

Mehr

An den Chromatiden entstehen durch Anfärbung sichtbare Querbanden. Sie sind auf beiden Chromatiden gleich. (nur Autosome nicht Gonosome)

An den Chromatiden entstehen durch Anfärbung sichtbare Querbanden. Sie sind auf beiden Chromatiden gleich. (nur Autosome nicht Gonosome) Zusammenfassung / Vorbereitung auf Biologie Klausur Die Arme von Chromosomen werden unterteilt in: 1. kurzes Stück oben = p-arm 2. langes Stück unten = q-arm Die Arme der Chromosomen werden Chromatiden

Mehr

Chromosomen & Populationsgenetik (1)

Chromosomen & Populationsgenetik (1) Übungsblatt Molekularbiologie und Genetik für Studierende der Bioinformatik II 1 Name des Studierenden: Datum: 1 Karyogramme Chromosomen & Populationsgenetik (1) Bestimmen Sie den Karyotyp der folgenden

Mehr

Hilfe 1. Wissenschaft. Traditionen und. Hilfe 1

Hilfe 1. Wissenschaft. Traditionen und. Hilfe 1 Hilfe 1 Hilfe 1 Erklärt euch gegenseitig die Aufgabe noch einmal in euren eigenen Worten. Klärt dabei, wie ihr die Aufgabe verstanden habt und was euch noch unklar ist. Antwort 1 Wir sollen einen Stammbaum

Mehr

Kapitel 8 Grundsätzliche Informationen über die autosomal rezessive Vererbung

Kapitel 8 Grundsätzliche Informationen über die autosomal rezessive Vererbung 97 Kapitel 8 Grundsätzliche Informationen über die autosomal rezessive Vererbung von Sandra Grilliot (Der Artikel wurde - mit unserem Dank - der Frühjahrsausgabe 1991 von TEXGENE entnommen.) Wie schwer

Mehr

Gendiagnose. Als nächstes möchte ich einige Verfahren von Gentests nennen und erläutern.

Gendiagnose. Als nächstes möchte ich einige Verfahren von Gentests nennen und erläutern. Gendiagnose Gentest Der Gentest ist ein molekularbiologisches Verfahren. Bei diesem wird die DNA untersucht, um Rückschlüsse auf genetische Aspekte zu erhalten. Gentests haben vielfältige Anwendungsmöglichkeiten,

Mehr

PATIENTENINFORMATION

PATIENTENINFORMATION PATIENTENINFORMATION Dr. med. Peter Bernhard Dr. med. Birgit Kirschey Fachärzte für Frauenheilkunde und Geburtshilfe SCHWERPUNKTPRAXIS FÜR GYNÄKOLOGISCHEN UND PRÄNATALEN ULTRASCHALL DEGUM II ERSTTRIMESTER-SCREENING

Mehr

Informationsbogen zum Aufklärungsgespräch

Informationsbogen zum Aufklärungsgespräch Informationsbogen zum Aufklärungsgespräch Patientinneninformation zum PraenaTest Vorgeburtliche Untersuchung aus dem Blut der Schwangeren zur Abklärung einer möglichen fetalen Trisomie 21 Sehr geehrte

Mehr

Pränataldiagnostik Dr. med. Regina Rasenack Universitäts-Frauenklinik Freiburg

Pränataldiagnostik Dr. med. Regina Rasenack Universitäts-Frauenklinik Freiburg Pränataldiagnostik Dr. med. Regina Rasenack Universitäts-Frauenklinik Freiburg Pränataldiagnostik Definition Untersuchungen zur Erkennung von angeborenen Fehlbildungen und Krankheiten Kleine Fehlbildungen:

Mehr

Wie erblich sind Epilepsien?

Wie erblich sind Epilepsien? Wie erblich sind Epilepsien? Häufigkeit Epilepsie in Bevölkerung 5% erleiden ein Mal einen epileptischen Anfall 1% erkranken an Epilepsie Folie 2 Folie 3 3-5 % Epidemiologische Studie 1989 Rochester, Minnesota,

Mehr

ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie)

ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie) ERBKRANKHEITEN (mit den Beispielen Albinismus, Chorea Huntington, Bluterkrankheit u. Mitochondriopathie) Als Erbkrankheit werden Erkrankungen und Besonderheiten bezeichnet, die entweder durch ein Gen (monogen)

Mehr

Beinhaltet Kontrollultraschalluntersuchungen, Spermaaufbereitung, Insemination

Beinhaltet Kontrollultraschalluntersuchungen, Spermaaufbereitung, Insemination Gültig ab 12. 5. 2014 Beim Erstgespräch bzw. Ihrer Erstvorstellung in unserer Klinik, ist ein Betrag von 100 zu entrichten. Diese Summe kann nicht zurückerstattet werden und wird von den Behandlungskosten

Mehr

Einstieg: Fortpflanzung

Einstieg: Fortpflanzung Einstieg: Fortpflanzung Wozu ist Sex gut? - Nachkommen werden gezeugt --> Erhalt der Spezies. - Es entstehen Nachkommen mit Merkmalen (z.b. Aussehen), die denen von Vater und Mutter ähneln. Beide Eltern

Mehr

Genetische pränatale Beratung Sicht des Genetikers

Genetische pränatale Beratung Sicht des Genetikers Genetische pränatale Beratung Sicht des Genetikers Ersttrimester-Ultraschall-Kurs mit praktischen Übungen zum Erhalt des Fähigkeitsausweises Schwangerschafts-Ultraschall Neue Frauenklinik, Kantonsspital

Mehr

Humangenetik. Dr. Sabine Hentze

Humangenetik. Dr. Sabine Hentze Humangenetik Diagnostik Indikationen Ethische Fragen Dr. Sabine Hentze 1 Genetik ist Medizin Forschung Technologie und Informatik Politik 2 Humangenetik Diagnostik Indikationen Ethische Fragen 3 Diagnostische

Mehr

Vorsorge durch Nackentransparenzmessung. Frühschwangerschaft. Patienteninformation. Entdeckungsraten für das Down-Syndrom

Vorsorge durch Nackentransparenzmessung. Frühschwangerschaft. Patienteninformation. Entdeckungsraten für das Down-Syndrom Patienteninformation 100 n für das Down-Syndrom 95 90 85 80 75 70 65 60 55 50 45 40 NT-Screening First Trimester Test Triple Test Quadruple Test Integriertes Screening Vorsorge durch Nackentransparenzmessung

Mehr

ERFOLGSRATE BEI DEN IVF- BEHANDLUNGEN IM JAHRE 2014

ERFOLGSRATE BEI DEN IVF- BEHANDLUNGEN IM JAHRE 2014 Wir möchten Ihnen gern unsere Ergebnisse der IVF-Zyklen im Jahre 2014 vorlegen. - 1 - Da es immer Spekulationen auftauchen, wie die Ergebnisse gerechnet werden und ob sie objektiv und wahr sind, möchten

Mehr

SS07 Klausur Humangenetik

SS07 Klausur Humangenetik Seite 1 von 8 SS07 Klausur Humangenetik 13.07.2007 1. Welche Aussage über strukturelle Chromosomenaberrationen trifft nicht zu? A) Ein Isochromosom ist in der Regel akrozentrisch. B) Unter einer Robertson'schen

Mehr

Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind. Information für Schwangere

Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind. Information für Schwangere Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind Information für Schwangere Liebe Schwangere, Vorgeburtliche Untersuchungsmethoden im Vergleich Ultraschall, Analyse bestimmter

Mehr

Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind

Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind Information und Aufklärung für Schwangere Qualität aus Deutschland Vorgeburtliche Untersuchungsmethoden im Vergleich PraenaTest

Mehr

GENTECHNIKBUCH: 7. KAPITEL GENETISCHE ANALYSEN IM RAHMEN EINER PRÄIMPLANTATIONSDIAGNOSTIK (PID)

GENTECHNIKBUCH: 7. KAPITEL GENETISCHE ANALYSEN IM RAHMEN EINER PRÄIMPLANTATIONSDIAGNOSTIK (PID) GENTECHNIKBUCH: 7. KAPITEL GENETISCHE ANALYSEN IM RAHMEN EINER PRÄIMPLANTATIONSDIAGNOSTIK (PID) (beschlossen von der Gentechnikkommission am 29. Jänner 2016) I. Einleitung Die Präimplantationsdiagnostik

Mehr

ARVC / ARVD PRÄIMPLANTATIONSDIAGNOSTIK

ARVC / ARVD PRÄIMPLANTATIONSDIAGNOSTIK ARVC / ARVD PRÄIMPLANTATIONSDIAGNOSTIK 2. Treffen ARVC Selbsthilfe 30. Januar 2016 Teresa Neuhann MGZ München ARVC Arrhythmogene rechtsventrikuläre Dysplasie / Kardiomyopathie ARVD/C Klinik Progressiver

Mehr

Down Syndrom Trisomie 21

Down Syndrom Trisomie 21 Patienteninformation Down Syndrom Trisomie 21 Dr. med. Gabriele Schlüter Dr. rer. nat. Peter Schranz Prof. Dr. med. H.-P. Seelig Menschlicher Chromosomensatz mit Trisomie 21 Normaler Zellkern Zellkern

Mehr

auf den Lösungsbogen.

auf den Lösungsbogen. Test-Fragen für die Klausur Humangenetik Test-Fragen für die Klausur Humangenetik Es folgen 9 Fragen und der Lösungsbogen (blanko). Sie haben 13,5 min Zeit zum Beantworten der Fragen und zum Übertragen

Mehr

Humangenetik. Zytogenetik Teil 3. Vorlesungsmitschrift SS 05

Humangenetik. Zytogenetik Teil 3. Vorlesungsmitschrift SS 05 Humangenetik Zytogenetik Teil 3 Vorlesungsmitschrift SS 05 1 Humangenetik: Zytogenetik - Teil III Triploidie: - 3 facher Chromosomensatz - pränataler Tod - bei Lebendgeborenen Mosaike von normalen und

Mehr

Unerfüllter Kinderwunsch. Ursachen erkennen, Lösungen finden. Informationen für Paare, die auf ein Baby warten

Unerfüllter Kinderwunsch. Ursachen erkennen, Lösungen finden. Informationen für Paare, die auf ein Baby warten Unerfüllter Kinderwunsch Ursachen erkennen, Lösungen finden Informationen für Paare, die auf ein Baby warten Das lange Warten auf ein Baby. Was können Sie tun? Wann sollten Sie sich untersuchen lassen?

Mehr

Molekulare Grundlagen der Humangenetik

Molekulare Grundlagen der Humangenetik Molekulare Grundlagen der Humangenetik Aufbau und Funktion des Genoms... Grundlagen... Eukaryontengenom... Variabilität des Genoms... Transkription und Translation der genetischen Information... DNAundRNA...

Mehr

Diagnostik. Dies ist der Titel der Präsentation. Referent/-in. Universitäts-Frauenklinik, Abteilung Gyn. Endokrinologie und. Reproduktionsmedizin

Diagnostik. Dies ist der Titel der Präsentation. Referent/-in. Universitäts-Frauenklinik, Abteilung Gyn. Endokrinologie und. Reproduktionsmedizin Michael von Wolff 1 Reproduktionsmedizin Dies ist der Titel der Präsentation und pränatale Diagnostik Referent/-in Prof. Michael von Wolff Universitäts-Frauenklinik, Abteilung Gyn. Endokrinologie und Reproduktionsmedizin

Mehr

Übung Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli

Übung Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli 1. Beschreiben Sie die Funktionen des RecA Proteins aus E. coli! SOS-Antwort in E. coli 2. Wieviele DNA-Stränge finden sich in einem Bivalent (= ein in der Metaphase der ersten meiotischen Teilung vorliegendes

Mehr

Pränatales Screening auf Chromosomenstörungen. Pränatales Screening. Leitfaden für werdende Mütter und Väter. Leitfaden für werdende Mütter und Väter

Pränatales Screening auf Chromosomenstörungen. Pränatales Screening. Leitfaden für werdende Mütter und Väter. Leitfaden für werdende Mütter und Väter Unsere Patienten-Information Pränatales auf Chromosomenstörungen Pränatales auf Chromosomenstörungen Leitfaden für werdende Mütter und Väter Leitfaden für werdende Mütter und Väter Labor Enders & Partner,

Mehr

Positionen. Fachthema: Reproduktionsmedizin Ethik, Beratung, Recht

Positionen. Fachthema: Reproduktionsmedizin Ethik, Beratung, Recht Fachthema: Reproduktionsmedizin Ethik, Beratung, Recht 21. Mai 2005 Grand Hotel am Dom in Erfurt Positionen Bundesregierung Nationaler Ethikrat Bundesärztekammer Bundesverband Reproduktionsmedizinischer

Mehr

"Chromosomen Didac 2" Einzelsatz Best.- Nr / Paket von 6 Sätzen

Chromosomen Didac 2 Einzelsatz Best.- Nr / Paket von 6 Sätzen "Chromosomen Didac 2" Einzelsatz Best.- Nr. 2013336 / 2013337 Paket von 6 Sätzen Zusammensetzung Der Einzelsatz besteht aus: 2 blauen Sätzen mit 3 Chromosomen + 1 Geschlechtschromosom + 1 Stück von einem

Mehr

Schmid M. Klinische Anwendung von Microarrays ( Genchips ) in der Pränataldiagnostik. Homepage:

Schmid M. Klinische Anwendung von Microarrays ( Genchips ) in der Pränataldiagnostik. Homepage: Geburtshilfe / Frauen-Heilkunde / Strahlen-Heilkunde / Forschung / Konsequenzen Schmid M Klinische Anwendung von Microarrays ( Genchips ) in der Pränataldiagnostik Speculum - Zeitschrift für Gynäkologie

Mehr

Ersttrimesterscreening

Ersttrimesterscreening Universitäts-Frauenklinik Essen Ersttrimesterscreening Was ist das Ersttrimesterscreening? Im Ersttrimesterscreening wird das individuelle Risiko der Mutter/des Paares für ein Kind mit einer numerischen

Mehr

Fehlgeburten. Erkennen, was fehlt und was hilft. Wenn Ihre Schwangerschaften zu früh zu Ende gehen

Fehlgeburten. Erkennen, was fehlt und was hilft. Wenn Ihre Schwangerschaften zu früh zu Ende gehen Fehlgeburten Erkennen, was fehlt und was hilft Wenn Ihre Schwangerschaften zu früh zu Ende gehen Die größte Sorge: Kann mir das noch einmal passieren? Fehlgeburt: Was bedeutet das für Sie? Fehlgeburt oder

Mehr

ANDROLOGY LETTER. Empfehlungen zur genetischen Diagnostik beim Mann in Fällen von habituellen Aborten

ANDROLOGY LETTER. Empfehlungen zur genetischen Diagnostik beim Mann in Fällen von habituellen Aborten ANDROLOGY LETTER Empfehlungen zur genetischen Diagnostik beim Mann in Fällen von habituellen Aborten Wichtig zu wissen 1. Bestimmung des DNA Fragmentations Index von Einzelstrang wie Doppelstrangbrüchen

Mehr

Die α (alpha)-thalassämien- Informationen für Patienten

Die α (alpha)-thalassämien- Informationen für Patienten Die Alpha Thalassämien Seite 1 von 1 Die α (alpha)-thalassämien- Informationen für Patienten Erstellung Prüfung Prof. Dr. med. Roswitha Dickerhoff Prof. Dr. med. R. Dickerhoff Gültigkeitsbeginn 01.05.2013

Mehr

Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind

Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind Nicht-invasive Untersuchung auf Chromosomenstörungen beim ungeborenen Kind Information und Aufklärung für Schwangere Pioneering Cell-Free Fetal DNA Testing Liebe Schwangere, Vorgeburtliche Untersuchungsmethoden

Mehr

Kennen Sie Morbus Hunter? Warum ist der HNO-Arzt bei der Diagnose wichtig?

Kennen Sie Morbus Hunter? Warum ist der HNO-Arzt bei der Diagnose wichtig? Kennen Sie Morbus Hunter? Warum ist der HNO-Arzt bei der Diagnose wichtig? Viele der Symptome betreffen den HNO-Bereich! Was ist Morbus Hunter? Häufige Merkmale und Symptome Morbus Hunter auch Mukopolysaccharidose

Mehr

Non-Invasive Prenatal Testing (NIPT)

Non-Invasive Prenatal Testing (NIPT) Non-Invasive Prenatal Testing (NIPT) Methode & klinische Anwendung Information für Fachkreise Qualität aus Deutschland Non-Invasive Prenatal Testing (NIPT) Die Untersuchungsmethode des PraenaTest basiert

Mehr

Diese Kombination von multiplen Geburtsfehlern ist relativ häufig (ca. 1/ 8500 Neugeborene). Selten zeigen Betroffene eine normale Intelligenz.

Diese Kombination von multiplen Geburtsfehlern ist relativ häufig (ca. 1/ 8500 Neugeborene). Selten zeigen Betroffene eine normale Intelligenz. Praxis für Humangenetik Heinrich-von-Stephan-Str. 5 D-79100 Freiburg Information CHARGE-Syndrom Molekulargenetische Untersuchung des Gens CHD7 Praxis für Humangenetik Prof. Dr. med. Jürgen Kohlhase Facharzt

Mehr

Was bedeutet Pränataldiagnostik für mich in der Praxis?

Was bedeutet Pränataldiagnostik für mich in der Praxis? Was bedeutet Pränataldiagnostik für mich in der Praxis? 1 Dr. Johannes Hovhannesian Zukunftsweg 15, 1210 Wien Mitarbeiter des Ultraschallteams in der Semmelweisfrauenklinik Wien 2 Was ist Pränataldiagnostik?

Mehr

Sehr geehrte Ratsuchende!

Sehr geehrte Ratsuchende! Genetische Beratung Sehr geehrte Ratsuchende! Sie möchten sich über die Risiken einer erblichen Erkrankung informieren, die bei Ihnen selbst, Ihren Kindern oder Verwandten aufgetreten ist? Sie möchten

Mehr

Das Alpha-Fetoprotein (AFP) ist ein Einweiß, das vom Kind während der Schwangerschaft gebildet wird.

Das Alpha-Fetoprotein (AFP) ist ein Einweiß, das vom Kind während der Schwangerschaft gebildet wird. Alpha-Fetoprotein Das Alpha-Fetoprotein (AFP) ist ein Einweiß, das vom Kind während der Schwangerschaft gebildet wird. Triple-Test Der Triple-Test ist als Screening-Test für das DOWN-Syndrom gebräuchlich.

Mehr

24. Mai E. Merz. E. Merz Zentrum für Ultraschall und Pränatale Medizin Frankfurt/Main - Deutschland

24. Mai E. Merz. E. Merz Zentrum für Ultraschall und Pränatale Medizin Frankfurt/Main - Deutschland 24. Mai 2016 E. Merz E. Merz Zentrum für Ultraschall und Pränatale Medizin Frankfurt/Main - Deutschland Nicht-invasive Tests Ersttrimester- Screening (Ultraschall + Biochemie) Zellfreie fetale DNA im mütterlichen

Mehr

Eine menschliche Körperzelle: 46 Chromosomen; 22 Autosomenpaare, 1 Gonosomenpaar

Eine menschliche Körperzelle: 46 Chromosomen; 22 Autosomenpaare, 1 Gonosomenpaar Eine menschliche Körperzelle: 46 Chromosomen; 22 Autosomenpaare, 1 Gonosomenpaar Chromosomenaberrationen 4Numerische Chromosomenanomalien Trisomie Monosomie Die Überzahl oder Unterzahl von Chromosomen

Mehr

Schmid M. Non-Invasive Prenatal Testing (NIPT) - Screening auf fetale Aneuploidien durch Analyse der zellfreien DNA im mütterlichen Blut.

Schmid M. Non-Invasive Prenatal Testing (NIPT) - Screening auf fetale Aneuploidien durch Analyse der zellfreien DNA im mütterlichen Blut. Geburtshilfe / Frauen-Heilkunde / Strahlen-Heilkunde / Forschung / Konsequenzen Schmid M Non-Invasive Prenatal Testing (NIPT) - Screening auf fetale Aneuploidien durch Analyse der zellfreien DNA im mütterlichen

Mehr

Einleitung. Die kurze Antwort lautet ja!

Einleitung. Die kurze Antwort lautet ja! Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Babys machen: eine Familie haben, der Huntington Weg Babys machen:

Mehr

Schmid M., Klaritsch P., Arzt W., Burkhardt T., Duba H. C., Häusler M., Hafner E., Lang U., Pertl B., Speicher M., et al.

Schmid M., Klaritsch P., Arzt W., Burkhardt T., Duba H. C., Häusler M., Hafner E., Lang U., Pertl B., Speicher M., et al. Persönliche PDF-Datei für Schmid M., Klaritsch P., Arzt W., Burkhardt T., Duba H. C., Häusler M., Hafner E., Lang U., Pertl B., Speicher M., et al. Mit den besten Grüßen vom Georg Thieme Verlag www.thieme.de

Mehr

Labor information. Pränatale Array-CGH (Comparative Genomic Hybridization) Microarray-basierte vergleichende genomische Hybridisierung

Labor information. Pränatale Array-CGH (Comparative Genomic Hybridization) Microarray-basierte vergleichende genomische Hybridisierung www.bioscientia-humangenetik.de Labor information Pränatale Array-CGH (Comparative Genomic Hybridization) Microarray-basierte vergleichende genomische Hybridisierung Die Array-CGH-Analyse (kurz: Array-CGH)

Mehr

Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren

Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren Institut für Medizinische Genetik Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren Prof. Dr. med. Anita Rauch Seite 1 Häufigkeit von Intelligenzminderung (ID) IQ

Mehr

Das Verfahren der FMF Deutschland zur Berechnung des Risikos von Chromosomenanomalien im 1. Trimester der Schwangerschaft. Erläuterungen zu den DoE

Das Verfahren der FMF Deutschland zur Berechnung des Risikos von Chromosomenanomalien im 1. Trimester der Schwangerschaft. Erläuterungen zu den DoE Das Verfahren der FMF Deutschland zur Berechnung des Risikos von Chromosomenanomalien im 1. Trimester der Schwangerschaft Erläuterungen zu den DoE Susanne Richter - Product Manager Prenatal Screening,

Mehr

1963: 27,4 2001: 28,4 2011: 30,0. Durchschnittliches Alter Geburt 1. Kind 2001: 26,5 2011: 28,5

1963: 27,4 2001: 28,4 2011: 30,0. Durchschnittliches Alter Geburt 1. Kind 2001: 26,5 2011: 28,5 Fact Sheet Facts & Figures Kinderwunschzentrum Ungewollte Kinderlosigkeit 30 % aller Frauen versuchen länger als 12 Monate schwanger zu werden 6 9 % sind ungewollt kinderlos 3 % bleiben ungewollt kinderlos

Mehr

Grundlegendes zur Genetik

Grundlegendes zur Genetik Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Die genetische 'Grauzone' der Huntington Krankheit: Was bedeutet

Mehr

Durchschnittliches Alter Geburt 1. Kind 1993: 25,5 2003: 27,5 2014: 29,0

Durchschnittliches Alter Geburt 1. Kind 1993: 25,5 2003: 27,5 2014: 29,0 Fact Sheet 38+ Ungewollte Kinderlosigkeit 30 % aller Frauen versuchen länger als 12 Monate schwanger zu werden 6 9 % sind ungewollt kinderlos 3 % bleiben ungewollt kinderlos Kinderanzahl / Frau sinkt 1963:

Mehr

Auffälliges Ersttrimesterscreening und normaler Karyotyp- was nun? Susanne Fröhlich praenatal.de Düsseldorf

Auffälliges Ersttrimesterscreening und normaler Karyotyp- was nun? Susanne Fröhlich praenatal.de Düsseldorf Auffälliges Ersttrimesterscreening und normaler Karyotyp- was nun? Susanne Fröhlich praenatal.de Düsseldorf Auffälliges ETS und normaler Karyotyp Auffälliger Ultraschall Verbreiterte Nackentransparenz

Mehr

Chorionzottenbiopsie. Abklären und vorsorgen. Informationen für Schwangere mit speziellen Risiken

Chorionzottenbiopsie. Abklären und vorsorgen. Informationen für Schwangere mit speziellen Risiken Chorionzottenbiopsie Abklären und vorsorgen Informationen für Schwangere mit speziellen Risiken Fragen und Sorgen, die geklärt werden können Meist wird eine Chorionzottenbiopsie empfohlen, wenn bei der

Mehr

Präimplantationsdiagnostik aus genetischer Sicht. P. Wieacker Institut für Humangenetik Münster

Präimplantationsdiagnostik aus genetischer Sicht. P. Wieacker Institut für Humangenetik Münster Präimplantationsdiagnostik aus genetischer Sicht P. Wieacker Institut für Humangenetik Münster Häufigkeit genetisch bedingter Erkrankungen Geburt Leben Chromosomenstörungen ca. 0,6% ca. 0,6% Monogene Erkrankungen

Mehr

Klonen. Ein Wahnsinn der Menschheit oder einfach nur wissenschaftliche Spielerei?

Klonen. Ein Wahnsinn der Menschheit oder einfach nur wissenschaftliche Spielerei? Klonen Ein Wahnsinn der Menschheit oder einfach nur wissenschaftliche Spielerei? Was ist Klonen? Das Klonieren setzt sich aus unterschiedlichen Verfahren und Techniken zusammen. Ziel aller Techniken ist

Mehr

Grundlagen der Vererbungslehre

Grundlagen der Vererbungslehre Grundlagen der Vererbungslehre Zucht und Fortpflanzung Unter Zucht verstehen wir die planvolle Verpaarung von Elterntieren, die sich in ihren Rassemerkmalen und Nutzleistungen ergänzen zur Verbesserung

Mehr

Pränatale genetische Diagnostik

Pränatale genetische Diagnostik Pränatale genetische Diagnostik Vorgeburtliche Diagnostik Überblick der Testverfahren Die pränatale Diagnostik ermöglicht den Nachweis von genetisch bedingten Erkrankungen und Entwicklungsstörungen vor

Mehr

ethische Probleme im Kontext der Humangenetik

ethische Probleme im Kontext der Humangenetik ethische Probleme im Kontext der Humangenetik ethische Probleme im Kontext der Humangenetik / Lernziele molekulargenetische Diagnostik pränatale Diagnostik / Interruptio Elternalter Human-Genetik A C Genetik

Mehr

Mutationen im Erbgut

Mutationen im Erbgut Jeder Mensch ist anders. Bei manchen ist die Nase lang, andere haben eine Stupsnase, manche haben lange dünne Finger und wiederum andere besitzen eher kurze dicke Finger an ihren Händen. Aber einige Merkmale

Mehr

Pränatale Diagnostik der Chromosomen

Pränatale Diagnostik der Chromosomen Pränatale Diagnostik der Chromosomen Einleitung Die kontinuierliche Weiterentwicklung der vorgeburtlichen (pränatalen) Untersuchungsmethoden ermöglicht heute verschiedene Ansätze in der pränatalen Diagnostik.

Mehr

Fäden des Lebens. Pränatal-Medizin München. Genetische Beratung. Pränatale Diagnostik Sonographie. Pränatale Diagnostik Invasive Methoden

Fäden des Lebens. Pränatal-Medizin München. Genetische Beratung. Pränatale Diagnostik Sonographie. Pränatale Diagnostik Invasive Methoden Fäden des Lebens 50 Jahre DNA - Doppelhelix Münchner Wissenschaftstage 16. - 20. Juli 2003 Pränatal-Medizin München Genetische Beratung Pränatale Diagnostik Sonographie Pränatale Diagnostik Invasive Methoden

Mehr