Evidence of strobilurine resistant isolates of A. solani and A. alternata in Germany

Größe: px
Ab Seite anzeigen:

Download "Evidence of strobilurine resistant isolates of A. solani and A. alternata in Germany"


1 Technische Universität München Evidence of strobilurine resistant isolates of A. solani and A. alternata in Germany H. Hausladen, B. Adolf and J. Leiminger

2 outline introduction material and methods results Alternaria solani Alternaria alternata summary and discussion

3 EB control with strobilurines EB control by strobilurines widely used due to important benefits and excellent disease control mode of action is highly specific (single site mode of action) high risk of fungicide resistance first evidence of the F129L mutation in A. solani by Gudmestad (2000) and G143A in A. alternata by Ma et al. (2003)

4 resistance to QoI fungicides effects Alternaria solani: F129L mutation resulting in a partial resistance (Gisi, Sierotzki, 2008) reduced fungicide sensitivity, reduced disease control (see also in Pyrenophora teres) Alternaria alternata: G143A mutation resulting in a high level of resistance (Gisi, Sierotzki, 2008) complete loss of disease control by use of QoI fungicides (see also in Mycosphaerella graminicola)

5 isolate monitoring examination of leaf samples for their occurence of Alternaria species (A. solani, A. alternata) German wide monitoring period:

6 monitoring 2008

7 monitoring 2010

8 detection of the F129L mutation in A. solani Technische Universität München

9 detection of the F129L mutation in A. solani Technische Universität München site mutation at position 129 from TTC to TTA, CTC, TTG substitution from phenylalanin to leucin (Phe Leu) F 129 L F129 Phenylanalin Leucin

10 detection of two different genotypes within in A. solani Technische Universität München Alt. sol. type II - USA 207 bp AGAA... exon ATGGCTACAGCTTTCCTGGGT Intron (139 bp sequenced, 90% homology to intron bi3 of P.teres (Sierotzky et al. 2007)... A126 G131 Alt. sol. type I - Europe 214 bp exon Intron (1140 bp) exon Intron (2157 bp) exon Intron (1760 bp) AGAA... ATGGCT... ACAGCTTTCCTGGGTTATGTTCTTCCTTATGGGCAAATGTCTTTATGAGGT A126 G131 G GCTACAGTT... (Grasso et al. 2006)

11 detection of the F129L mutation in A. solani Technische Universität München site mutation at position 129 from TTC to TTA, CTC, TTG substitution from phenylalaninen to leucin (Phe Leu) sequenzing of a 207 and 214 bp fragment of the cyt b complex in A. solani F 129 L F129 Phenylanalin Leucin

12 isolate-monitoring year isolates nr of locations Strobilurin applied Locations with F129L Nr mutants Frequency % F129L 5,1 15,3 56,5 17,0 37,7 32,2

13 detection of two different genotypes within in A. solani Technische Universität München Alt. sol. type II - USA 207 bp AGAA... exon ATGGCTACAGCTTTCCTGGGT Intron (139 bp sequenced, 90% homology to intron bi3 of P.teres (Sierotzky et al. 2007)... A126 G out of 147 F129L mutants were genotype II, carrying TTA, TTG mutation Alt. sol. type I - Europe 214 bp exon Intron (1140 bp) exon Intron (2157 bp) exon Intron (1760 bp) AGAA... ATGGCT... ACAGCTTTCCTGGGTTATGTTCTTCCTTATGGGCAAATGTCTTTATGAGGT A126 G131 G GCTACAGTT... (Grasso et al. 2006) only 3 out of 147 F129L mutants, were genotype I, carrying CTC mutation first observed in 2013 (2 isolates) and 2014 (one isolate) all wildtype isolates were genotype I

14 appearance of isolates with F129L mutation Wild-type isolate F129L mutant

15 site-specific distribution of F129L and wild-type isolates Technische Universität München investigation of various isolates out of each sampled location year sampling date aug 16 th aug 16 th aug 16 th sep 11 th aug 28 th sep 18 th sep 18 th location Aschheim Aiterhofen Kirchheim Laberweinting Freising Freising Freising treatment AZ, 4 times AZ, 4 times AZ, 4 times AZ, 3 times unknown untreated AZ, 4 times number of isolates proportion of wild-type isolates proportion of F129L isolates constant site-specific composition of species

16 site-specific occurence of F129L mutants Technische Universität München A. solani location with F129L mutant wild-type wild-type and F129L mutants

17 fungicide sensitivity tests (EC 50 -value) evaluation of fungicide sensitivity of A. solani wild-type and F129L mutants EC 50, US reference F129L mutants EC 50, US reference WT strains EC 50: concentration, at which 50 % of the spores die or do not germinate

18 fungicide sensitivity tests (EC 50 -value) evaluation of fungicide sensitivity of A. solani wild-type and F129L mutants EC 50, US reference F129L mutants EC 50, US reference WT strains

19 fungicide sensitivity tests (EC 50 -value) evaluation of fungicide sensitivity of A. solani wild-type and F129L mutants 10,2 EC 50, US reference F129L mutants EC 50, US reference WT strains

20 detection of the G143A mutation in A. alternata Technische Universität München

21 detection of the G143A mutation in A. alternata Technische Universität München Point mutation within the cyt b complex, mutation site 143 GGT -> GCT (Gly Ala) G 143 A analysis of 150 single spore isolates ( ) and 58 EB infected leaf samples Sequencing of an 228 bp fragment cyt b incl. G143A mutation Primer: AF (5-ACA CTG CTT CAG CAT TTT TCT TCA TAG-3) AR (5-TTG TCC AAT TCA TGG TAT AGC ACT CA-3) (Ma et al. 2003) A.alt GATACGTCTTGCCATACGGGCAAATGTCATTATGAGCTGCAACAGTT A.alt GATACGTCTTGCCATACGGGCAAATGTCATTATGAGCTGCAACAGTT A.alt 11 - GATACGTCTTGCCATACGGGCAAATGTCATTATGAGGTGCAACAGTT A.alt 12 - GATACGTCTTGCCATACGGGCAAATGTCATTATGAGGTGCAACAGTT M M WT WT

22 investigated isolates in total isolates evaluated 7 43 / / wildtyp isolates 7 34 / / G143A mutants 0 9 / / investigated locations 1 29 / / locations with G143A 0 9 / /

23 Site-specific occurence of G143A mutations Technische Universität München A. alternata location with G143A mutant wild-type wild-type and G143A mutants

24 Fungicide sensitivity tests (EC 50 -value) with azoxystrobin Technische Universität München evaluation of fungicide sensitivity of A. alternata wild-type and G143A mutants wild-type isolates Germination % Germination % G143A isolates

25 Summary prevalence of the F129L and G143A mutation in Germany actually no loss in fungicide sensitivity (field) further specific field trials in 2015 (artificial inoculation) use of QoI fungicides to GAP: limitation of Strobilurin-containing products Use products/mixtures with high efficacy Full dosage Use of EB fungicides first spray: 7-8 weeks after the crop emerge further applications: according to disease development and weather condition

Cleanroom Fog Generators Volcano VP 12 + VP 18

Cleanroom Fog Generators Volcano VP 12 + VP 18 Cleanroom Fog Generators Volcano VP 12 + VP 18 Description & Functional Principle (Piezo Technology) Cleanrooms are dynamic systems. People and goods are constantly in motion. Further installations, production





A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C 3 Methoden 3.1 Extraktion der DNA aus den Paraffinschnitten 3.1.1 Extraktions-Kit Das QIAamp DNA Mini Kit- System beruht auf dem Prinzip der Auflösung der Eiweiße mit Proteinase K, DNA Bindung an eine


Extended Ordered Paired Comparison Models An Application to the Data from Bundesliga Season 2013/14

Extended Ordered Paired Comparison Models An Application to the Data from Bundesliga Season 2013/14 Etended Ordered Paired Comparison Models An Application to the Data from Bundesliga Season 2013/14 Gerhard Tutz & Gunther Schauberger Ludwig-Maimilians-Universität München Akademiestraße 1, 80799 München


Franke & Bornberg award AachenMünchener private annuity insurance schemes top grades

Franke & Bornberg award AachenMünchener private annuity insurance schemes top grades Franke & Bornberg award private annuity insurance schemes top grades Press Release, December 22, 2009 WUNSCHPOLICE STRATEGIE No. 1 gets best possible grade FFF ( Excellent ) WUNSCHPOLICE conventional annuity


Medizinische Klinik II Medizinische Klinik IV

Medizinische Klinik II Medizinische Klinik IV CAMPUS GROSSHADERN CAMPUS INNENSTADT LOREM IPSUM SETUR ALARME Medizinische Klinik II Medizinische Klinik IV Effect of Mipomersen on LDL-Cholesterol levels in Patients with Severe LDL-Hypercholesterolemia


Risk of Suicide after Bariatric Surgery

Risk of Suicide after Bariatric Surgery Overview Risk of Suicide after Bariatric Surgery Obesity and Depression Suicidality and Obesity German Obesity-Suicidality Study Birgit Wagner, PhD Department of Psychosomatic Medicine and Psychotherapy


HIR Method & Tools for Fit Gap analysis

HIR Method & Tools for Fit Gap analysis HIR Method & Tools for Fit Gap analysis Based on a Powermax APML example 1 Base for all: The Processes HIR-Method for Template Checks, Fit Gap-Analysis, Change-, Quality- & Risk- Management etc. Main processes


Sintering of PM Tool Steels supported by Computational Thermodynamics

Sintering of PM Tool Steels supported by Computational Thermodynamics Sintering of PM Tool Steels supported by Computational Thermodynamics S. Weber a,b, W. Theisen a a Ruhr-Universitaet Bochum, Werkstofftechnik D-44780 Bochum, Germany b Helmholtz-Zentrum Berlin fuer Materialien


Accounting course program for master students. Institute of Accounting and Auditing http://www.wiwi.hu-berlin.de/rewe

Accounting course program for master students. Institute of Accounting and Auditing http://www.wiwi.hu-berlin.de/rewe Accounting course program for master students Institute of Accounting and Auditing http://www.wiwi.hu-berlin.de/rewe 2 Accounting requires institutional knowledge... 3...but it pays: Lehman Bros. Inc.,


Mitglied der Leibniz-Gemeinschaft

Mitglied der Leibniz-Gemeinschaft Methods of research into dictionary use: online questionnaires Annette Klosa (Institut für Deutsche Sprache, Mannheim) 5. Arbeitstreffen Netzwerk Internetlexikografie, Leiden, 25./26. März 2013 Content


AS Path-Prepending in the Internet And Its Impact on Routing Decisions

AS Path-Prepending in the Internet And Its Impact on Routing Decisions (SEP) Its Impact on Routing Decisions Zhi Qi ytqz@mytum.de Advisor: Wolfgang Mühlbauer Lehrstuhl für Netzwerkarchitekturen Background Motivation BGP -> core routing protocol BGP relies on policy routing


Pilot Project Biogas-powered Micro-gas-turbine

Pilot Project Biogas-powered Micro-gas-turbine 1/18 Pilot Project Biogas-powered Micro-gas-turbine Supported by the Hessischen Ministerium für Wirtschaft, Verkehr und Landesentwicklung Speaker Details 2/18 Jan Müller Works at Institute of Solar Energy








eurex rundschreiben 094/10

eurex rundschreiben 094/10 eurex rundschreiben 094/10 Datum: Frankfurt, 21. Mai 2010 Empfänger: Alle Handelsteilnehmer der Eurex Deutschland und Eurex Zürich sowie Vendoren Autorisiert von: Jürg Spillmann Weitere Informationen zur


Drought Effects on Soil Solution Chemistry at Bavarian Level-II sites

Drought Effects on Soil Solution Chemistry at Bavarian Level-II sites Drought Effects on Soil Solution Chemistry at Bavarian Level-II sites Freiburg 19.11.04 Christoph Schulz, Stephan Raspe, Bernd Schultze; Bavarian State Institue of Forestry Structure 1. data base and methodical


Supplier Status Report (SSR)

Supplier Status Report (SSR) Supplier Status Report (SSR) Introduction for BOS suppliers BOS GmbH & Co. KG International Headquarters Stuttgart Ernst-Heinkel-Str. 2 D-73760 Ostfildern Management Letter 2 Supplier Status Report sheet


Symbio system requirements. Version 5.1

Symbio system requirements. Version 5.1 Symbio system requirements Version 5.1 From: January 2016 2016 Ploetz + Zeller GmbH Symbio system requirements 2 Content 1 Symbio Web... 3 1.1 Overview... 3 1.1.1 Single server installation... 3 1.1.2


Internationale Energiewirtschaftstagung TU Wien 2015

Internationale Energiewirtschaftstagung TU Wien 2015 Internationale Energiewirtschaftstagung TU Wien 2015 Techno-economic study of measures to increase the flexibility of decentralized cogeneration plants on a German chemical company Luis Plascencia, Dr.


aqpa Vereinstreffen 15. Okt. 2014, Wien

aqpa Vereinstreffen 15. Okt. 2014, Wien aqpa Vereinstreffen 15. Okt. 2014, Wien EU-GMP-Richtlinie Part II Basic Requirements for Active Substances used as Starting Materials Dr. Markus Thiel Roche Austria GmbH History ICH Richtlinie Q7 Nov.


ISO 15504 Reference Model

ISO 15504 Reference Model Process flow Remarks Role Documents, data, tools input, output Start Define purpose and scope Define process overview Define process details Define roles no Define metrics Pre-review Review yes Release


Using TerraSAR-X data for mapping of damages in forests caused by the pine sawfly (Dprion pini) Dr. Klaus MARTIN klaus.martin@slu-web.

Using TerraSAR-X data for mapping of damages in forests caused by the pine sawfly (Dprion pini) Dr. Klaus MARTIN klaus.martin@slu-web. Using TerraSAR-X data for mapping of damages in forests caused by the pine sawfly (Dprion pini) Dr. Klaus MARTIN klaus.martin@slu-web.de Damages caused by Diprion pini Endangered Pine Regions in Germany


Shock pulse measurement principle

Shock pulse measurement principle Shock pulse measurement principle a [m/s²] 4.0 3.5 3.0 Roller bearing signals in 36 khz range Natural sensor frequency = 36 khz 2.5 2.0 1.5 1.0 0.5 0.0-0.5-1.0-1.5-2.0-2.5-3.0-3.5-4.0 350 360 370 380 390


Asynchronous Generators

Asynchronous Generators Asynchronous Generators Source: ABB 1/21 2. Asynchronous Generators 1. Induction generator with squirrel cage rotor 2. Induction generator with woed rotor Source: electricaleasy.com 2/21 2.1. Induction


Environmental management in German institutions of higher education: Lessons learnt and steps toward sustainable management

Environmental management in German institutions of higher education: Lessons learnt and steps toward sustainable management Environmental management in German institutions of higher education: Lessons learnt and steps toward sustainable management Lüneburg, Juni 23/24, 2005 Joachim Müller Sustainable Management of Higher Education


Lufft UMB Sensor Overview

Lufft UMB Sensor Overview Lufft Sensor Overview Wind Radiance (solar radiation) Titan Ventus WS310 Platinum WS301/303 Gold V200A WS300 WS400 WS304 Professional WS200 WS401 WS302 Radiance (solar radiation) Radiation 2 Channel EPANDER


Level of service estimation at traffic signals based on innovative traffic data services and collection techniques

Level of service estimation at traffic signals based on innovative traffic data services and collection techniques Level of service estimation at traffic signals based on innovative traffic data services and collection techniques Authors: Steffen Axer, Jannis Rohde, Bernhard Friedrich Network-wide LOS estimation at


KTI Project: LIDT and Degradation Testing for Industrial Applications

KTI Project: LIDT and Degradation Testing for Industrial Applications KTI Project: LIDT and Degradation Testing for Industrial Applications Total Investment: Industry: Personel Misc./Equipment Research: Personel 1.713 MCHF 989 kchf 330 kchf 649 kchf 734 kchf CSEM EMPA University


City West between Modern Age and History: How Does the Balancing Act. between Traditional Retail Structures and International

City West between Modern Age and History: How Does the Balancing Act. between Traditional Retail Structures and International City West between Modern Age and History: How Does the Balancing Act between Traditional Retail Structures and International Competition Work? Agenda 1. Basic Data about City West 2. Kurfürstendamm 3.


Application materials checklists for the study program BSBA/Digital Enterprise Management

Application materials checklists for the study program BSBA/Digital Enterprise Management s for the study program BSBA/Digital Enterprise Management Checkliste Bewerbungsunterlagen für den Studiengang BSBA/Digital Enterprise Management Bewerber/innen mit deutscher Hochschulzugangsberechtigung,


Welcome. Thoughts on Brands Strategy & Activities

Welcome. Thoughts on Brands Strategy & Activities Welcome Thoughts on Brands Strategy & Activities Why brands? Precondicions: - consistant unique look and branding - consistant product quality - standardized processes or product qualities - consistant


Proseminar - Organisation und Personal Seminar Organisational Theory and Human Resource Management

Proseminar - Organisation und Personal Seminar Organisational Theory and Human Resource Management 1 Proseminar - Organisation und Personal Seminar Organisational Theory and Human Resource Management Veranstaltungsnummer / 82-021-PS08-S-PS-0507.20151.001 Abschluss des Studiengangs / Bachelor Semester


Quality Management is Ongoing Social Innovation Hans-Werner Franz

Quality Management is Ongoing Social Innovation Hans-Werner Franz Quality Management is Ongoing Social Innovation Hans-Werner Franz ICICI Conference, Prague 1-2 October 2009 What I am going to tell you social innovation the EFQM Excellence model the development of quality


Einkommensaufbau mit FFI:

Einkommensaufbau mit FFI: For English Explanation, go to page 4. Einkommensaufbau mit FFI: 1) Binäre Cycle: Eine Position ist wie ein Business-Center. Ihr Business-Center hat zwei Teams. Jedes mal, wenn eines der Teams 300 Punkte


FIVNAT-CH Schweizerische Gesellschaft für Fertilität, Sterilität und Familienplanung Société Suisse de Fertilité, Stérilité et de Planning Familial

FIVNAT-CH Schweizerische Gesellschaft für Fertilität, Sterilität und Familienplanung Société Suisse de Fertilité, Stérilité et de Planning Familial Schweizerische Gesellschaft für Fertilität, Sterilität und Familienplanung FIVNAT-CH Schweizerische Gesellschaft für Fertilität, Sterilität und Familienplanung Annual report 2001 Date of analysis 30.10.2002


European IAIDO Summer Seminar 2015 Germany 15th 17th August

European IAIDO Summer Seminar 2015 Germany 15th 17th August European IAIDO Summer Seminar 2015 Germany 15th 17th August We are proud to present a European IAIDO Summer Seminar with Morita Sensei and Oshita Sensei in Augsburg, Germany. We invite all Iaidoka regardless


Nitrogen Oxides. O = Lachgas =Stickoxydul =Distickstoffoxid = Nitrous Oxide N 2. Nitrogen oxides

Nitrogen Oxides. O = Lachgas =Stickoxydul =Distickstoffoxid = Nitrous Oxide N 2. Nitrogen oxides Nitrogen Oxides N 2 O = Lachgas =Stickoxydul =Distickstoffoxid = Nitrous Oxide Structure of this lecture Introduction Ecology of the nitrogen cycle Processes of nitrification, denitrification, NH 3 emission


A closer look at the M/G/R PS model for TCP traffic

A closer look at the M/G/R PS model for TCP traffic A closer look at the M/G/R PS model for TCP traffic July 23, 2001 Institute of Communication etworks Munich University of Technology 1 Outline Simulation Scenario Sojourn Time Formulas Investigated Scenarios


Power-Efficient Server Utilization in Compute Clouds

Power-Efficient Server Utilization in Compute Clouds Power-Efficient Server Utilization in Compute Clouds 1/14 Overview 1. Motivation 2. SPECpower benchmark 3. Load distribution strategies 4. Cloud configuration 5. Results 6. Conclusion 2/14 1. Motivation


Exercise (Part XI) Anastasia Mochalova, Lehrstuhl für ABWL und Wirtschaftsinformatik, Kath. Universität Eichstätt-Ingolstadt 1

Exercise (Part XI) Anastasia Mochalova, Lehrstuhl für ABWL und Wirtschaftsinformatik, Kath. Universität Eichstätt-Ingolstadt 1 Exercise (Part XI) Notes: The exercise is based on Microsoft Dynamics CRM Online. For all screenshots: Copyright Microsoft Corporation. The sign ## is you personal number to be used in all exercises. All


Influence of dust layer thickness. on specific dust resistivity

Influence of dust layer thickness. on specific dust resistivity on specific dust resistivity D. Pieloth, M. Majid, H. Wiggers, P. Walzel Chair of Mechanical Process Engineering, TU Dortmund, Dortmund/Germany Outline 2 Motivation Measurement of specific dust resistivity



Informationsextraktion Informationsextraktion Bestimmte Anwendungen bei der semantischen Verarbeitung erfordern keine tiefe linguistische Analyse mit exakter Disambiguierung (= eine einzige und korrekte Lesart). Hierzu gehört


Applying Pléiades in the ASAP project HighSens

Applying Pléiades in the ASAP project HighSens Applying Pléiades in the ASAP project HighSens Highly versatile, new satellite Sensor applications for the Austrian market and International Development (Contract number: 833435) Dr. Eva Haas, GeoVille


Context-adaptation based on Ontologies and Spreading Activation

Context-adaptation based on Ontologies and Spreading Activation -1- Context-adaptation based on Ontologies and Spreading Activation ABIS 2007, Halle, 24.09.07 {hussein,westheide,ziegler}@interactivesystems.info -2- Context Adaptation in Spreadr Pubs near my location



p^db=`oj===pìééçêíáåñçêã~íáçå= p^db=`oj===pìééçêíáåñçêã~íáçå= Error: "Could not connect to the SQL Server Instance" or "Failed to open a connection to the database." When you attempt to launch ACT! by Sage or ACT by Sage Premium for


============================================================================= Bezeichnung Artikelnummer Schirmdurchmesser Verpackungseinheit in mm

============================================================================= Bezeichnung Artikelnummer Schirmdurchmesser Verpackungseinheit in mm Deutsch Im Maschinen-, Anlagen- und Schaltschrankbau werden die Steuerungs- und Leitungskomponenten immer komplexer. Dadurch gewinnt ein gutes EMV-Konzept immer mehr an Bedeutung. Die Produkte von Murrplastik


Extract of the Annotations used for Econ 5080 at the University of Utah, with study questions, akmk.pdf.

Extract of the Annotations used for Econ 5080 at the University of Utah, with study questions, akmk.pdf. 1 The zip archives available at http://www.econ.utah.edu/ ~ ehrbar/l2co.zip or http: //marx.econ.utah.edu/das-kapital/ec5080.zip compiled August 26, 2010 have the following content. (they differ in their


Modelling CO 2 and trace gas exchange between landsurface

Modelling CO 2 and trace gas exchange between landsurface Modelling CO 2 and trace gas exchange between landsurface and atmosphere Rüdiger Grote (Ruediger.Grote@kit.edu) Institut für Meteorologie und Klimaforschung, Atmosphärische Umweltforschung, Garmisch-Partenkirchen,


VDE Prüf- und Zertifizierungsinstitut Zeichengenehmigung

VDE Prüf- und Zertifizierungsinstitut Zeichengenehmigung usweis-nr. / Blatt / Page 2 ktenzeichen / File ref. Dieses Blatt gilt nur in Verbindung mit Blatt 1 des sausweises Nr.. This supplement is only valid in conjunction with page 1 of the. Terrestrische Photovoltaik-Module


The process runs automatically and the user is guided through it. Data acquisition and the evaluation are done automatically.

The process runs automatically and the user is guided through it. Data acquisition and the evaluation are done automatically. Q-App: UserCal Advanced Benutzerdefinierte Kalibrierroutine mit Auswertung über HTML (Q-Web) User defined calibration routine with evaluation over HTML (Q-Web) Beschreibung Der Workflow hat 2 Ebenen eine


MindestanforderungenanDokumentationvon Lieferanten

MindestanforderungenanDokumentationvon Lieferanten andokumentationvon Lieferanten X.0010 3.02de_en/2014-11-07 Erstellt:J.Wesseloh/EN-M6 Standardvorgabe TK SY Standort Bremen Standard requirements TK SY Location Bremen 07.11.14 DieInformationenindieserUnterlagewurdenmitgrößterSorgfalterarbeitet.DennochkönnenFehlernichtimmervollständig


2013 Annual Conference of the Institute of Refrigeration LEC Leakage & Energy Control system. Agenda

2013 Annual Conference of the Institute of Refrigeration LEC Leakage & Energy Control system. Agenda 2013 Annual Conference of the Institute of Refrigeration LEC Leakage & Energy Control system General information Agenda Overview about the LEC system Interaction of the LEC versions Data's input Survey


SARA 1. Project Meeting

SARA 1. Project Meeting SARA 1. Project Meeting Energy Concepts, BMS and Monitoring Integration of Simulation Assisted Control Systems for Innovative Energy Devices Prof. Dr. Ursula Eicker Dr. Jürgen Schumacher Dirk Pietruschka,



ANLAGENANALYSE PLANT ANALYSIS ANLAGENANALYSE PLANT ANALYSIS ANLAGENANALYSE PLANT ANALYSIS Ein Anlagenstillstand ist meistens mit einem enormen Kostenund Zeitaufwand verbunden. Bis die Fehlerquelle gefunden und das Austauschgerät organisiert


Milenia Hybridetect. Detection of DNA and Protein

Milenia Hybridetect. Detection of DNA and Protein Milenia Hybridetect Detection of DNA and Protein Firmenprofil und Produkte Milenia Biotec GmbH ist im Jahr 2000 gegründet worden. Die Firma entwickelt, produziert, vermarktet und verkauft diagnostische


Essen, 16. Dezember 2005. Stellungnahme zum Projekt. Qualifizierung der quantitativen Schallemissionsanalyse

Essen, 16. Dezember 2005. Stellungnahme zum Projekt. Qualifizierung der quantitativen Schallemissionsanalyse Essen, 16. Dezember 2005 Stellungnahme zum Projekt Qualifizierung der quantitativen Schallemissionsanalyse In dem Projekt Qualifizierung der quantitativen Schallemissionsanalyse wurden die Ergebnisse der


Employment and Salary Verification in the Internet (PA-PA-US)

Employment and Salary Verification in the Internet (PA-PA-US) Employment and Salary Verification in the Internet (PA-PA-US) HELP.PYUS Release 4.6C Employment and Salary Verification in the Internet (PA-PA-US SAP AG Copyright Copyright 2001 SAP AG. Alle Rechte vorbehalten.


Lehrstuhl für Allgemeine BWL Strategisches und Internationales Management Prof. Dr. Mike Geppert Carl-Zeiß-Str. 3 07743 Jena

Lehrstuhl für Allgemeine BWL Strategisches und Internationales Management Prof. Dr. Mike Geppert Carl-Zeiß-Str. 3 07743 Jena Lehrstuhl für Allgemeine BWL Strategisches und Internationales Management Prof. Dr. Mike Geppert Carl-Zeiß-Str. 3 07743 Jena http://www.im.uni-jena.de Contents I. Learning Objectives II. III. IV. Recap


Fluid-Particle Multiphase Flow Simulations for the Study of Sand Infiltration into Immobile Gravel-Beds

Fluid-Particle Multiphase Flow Simulations for the Study of Sand Infiltration into Immobile Gravel-Beds 3rd JUQUEEN Porting and Tuning Workshop Jülich, 2-4 February 2015 Fluid-Particle Multiphase Flow Simulations for the Study of Sand Infiltration into Immobile Gravel-Beds Tobias Schruff, Roy M. Frings,


VDE Prüf- und Zertifizierungsinstitut Gutachten mit Fertigungsüberwachung

VDE Prüf- und Zertifizierungsinstitut Gutachten mit Fertigungsüberwachung Blatt / Page 2 Dieses Blatt gilt nur in Verbindung mit Blatt 1 des Gutachtens mit Fertigungsüberwachung Nr.. This supplement is only valid in conjunction with page 1 of the Certificate of Conformity with


GRIPS - GIS basiertes Risikoanalyse-, Informations- und Planungssystem

GRIPS - GIS basiertes Risikoanalyse-, Informations- und Planungssystem GRIPS - GIS basiertes Risikoanalyse-, Informations- und Planungssystem GIS based risk assessment and incident preparation system Gregor Lämmel TU Berlin GRIPS joined research project TraffGo HT GmbH Rupprecht


Lieferkettenmanagement unter. Biodiversitätsaspekten

Lieferkettenmanagement unter. Biodiversitätsaspekten Lieferkettenmanagement unter Berücksichtigung von Biodiversitätsaspekten 2. Dialogforum: Biodiversität und Unternehmen Judith Winterstein, GIZ Berlin, judith.winterstein@giz.de 20.10.2011 Deutsche Gesellschaft


Distributed testing. Demo Video

Distributed testing. Demo Video distributed testing Das intunify Team An der Entwicklung der Testsystem-Software arbeiten wir als Team von Software-Spezialisten und Designern der soft2tec GmbH in Kooperation mit der Universität Osnabrück.


Labour law and Consumer protection principles usage in non-state pension system

Labour law and Consumer protection principles usage in non-state pension system Labour law and Consumer protection principles usage in non-state pension system by Prof. Dr. Heinz-Dietrich Steinmeyer General Remarks In private non state pensions systems usually three actors Employer


Transparenz 2.0. Passive Nachverfolgung und Filterung von WebApps auf dem Prüfstand

Transparenz 2.0. Passive Nachverfolgung und Filterung von WebApps auf dem Prüfstand Matthias Seul IBM Research & Development GmbH BSI-Sicherheitskongress 2013 Transparenz 2.0 Passive Nachverfolgung und Filterung von WebApps auf dem Prüfstand R1 Rechtliche Hinweise IBM Corporation 2013.


VDE Prüf- und Zertifizierungsinstitut Zeichengenehmigung

VDE Prüf- und Zertifizierungsinstitut Zeichengenehmigung usweis-nr. / Blatt / Page 2 ktenzeichen / File ref. letzte Änderung / updated Datum / Date Dieses Blatt gilt nur in Verbindung mit Blatt 1 des sausweises Nr.. This supplement is only valid in conjunction


glass made for the sun

glass made for the sun glass made for the sun AR-coated 2 mm thin solar glass for Glass-Glass-PV-Modules structure Share Products 51% 50,01% 49,99% company facts Start float glass production in Sept. 2009 Capacity float line


Die Datenmanipulationssprache SQL

Die Datenmanipulationssprache SQL Die Datenmanipulationssprache SQL Daten eingeben Daten ändern Datenbank-Inhalte aus Dateien laden Seite 1 Data Manipulation Language A DML statement is executed when you Add new rows to a table Modify


Wartezeit in Deutschland auf eine Nierentransplantation: Aktuelle Aspekte oder Das Blutgruppe 0-Problem

Wartezeit in Deutschland auf eine Nierentransplantation: Aktuelle Aspekte oder Das Blutgruppe 0-Problem Wartezeit in Deutschland auf eine Nierentransplantation: Aktuelle Aspekte oder Das Blutgruppe 0-Problem Wartezeit und Ergebnisse nach NTX USA Waiting time on dialysis as the strongest modifiable risk factor



HOCHGERNER І PULTANLAGEN. HOCHGERNER І PULTANLAGEN. 2 Die Vision. Mit unserer Arbeit setzen wir raumgestalterische Akzente. Diese sind so vielfältig wie die Materialien, die wir verarbeiten. Und doch versuchen wir bei jedem Projekt,



p^db=`oj===pìééçêíáåñçêã~íáçå= p^db=`oj===pìééçêíáåñçêã~íáçå= How to Disable User Account Control (UAC) in Windows Vista You are attempting to install or uninstall ACT! when Windows does not allow you access to needed files or folders.


Effects of Specimen Compaction on Performance Characteristics: Results of Triaxial tests on AC

Effects of Specimen Compaction on Performance Characteristics: Results of Triaxial tests on AC Effects of Specimen Compaction on Performance Characteristics: Results of Triaxial tests on AC Update of progress at ISBS Konrad Mollenhauer Compaction methods at ISBS Gyratory Roller Sector Marshall Compaction


Beschwerdemanagement / Complaint Management

Beschwerdemanagement / Complaint Management Beschwerdemanagement / Complaint Management Structure: 1. Basics 2. Requirements for the implementation 3. Strategic possibilities 4. Direct Complaint Management processes 5. Indirect Complaint Management


Zugangsvoraussetzungen für Airworthiness Review Staff gem. Part-M.A.707

Zugangsvoraussetzungen für Airworthiness Review Staff gem. Part-M.A.707 1) Zusammenfassung der relevanten Part-M Paragraphen und AMC M.A.707 Airworthiness review staff (a) To be approved to carry out reviews, an approved continuing management organisation shall have appropriate


Ausgleichshalter / Compensation Holder

Ausgleichshalter / Compensation Holder usgleichshalter / Compensation Holder usgleichshalter Produkt-Eigenschaften: usgleichshalter für HSK und SK Für Werkzeuge mit Weldon Spanfläche Produkt-Vorteile: Korrektur von Rundlauffehler und chsfehler


VDE Prüf- und Zertifizierungsinstitut Zeichengenehmigung

VDE Prüf- und Zertifizierungsinstitut Zeichengenehmigung Blatt / Page 2 Dieses Blatt gilt nur in Verbindung mit Blatt 1 des sausweises Nr.. This supplement is only valid in conjunction with page 1 of the. Terrestrische Photovoltaik-Module mit Silizium-Solarzellen


Energieeffizienz und Erneuerbare Energien Programme der EZ -- ein Zwischenstand

Energieeffizienz und Erneuerbare Energien Programme der EZ -- ein Zwischenstand Energieeffizienz und Erneuerbare Energien Programme der EZ -- ein Zwischenstand Climate Policy Capacity Building Seminar Kiew 07.10.04 Klaus Gihr Senior Project Manager Europe Department Was sind unsere


Lehrstuhl für Allgemeine BWL Strategisches und Internationales Management Prof. Dr. Mike Geppert Carl-Zeiß-Str. 3 07743 Jena

Lehrstuhl für Allgemeine BWL Strategisches und Internationales Management Prof. Dr. Mike Geppert Carl-Zeiß-Str. 3 07743 Jena Lehrstuhl für Allgemeine BWL Strategisches und Internationales Management Prof. Dr. Mike Geppert Carl-Zeiß-Str. 3 07743 Jena http://www.im.uni-jena.de Contents I. Learning Objectives II. III. IV. Recap


XONTRO Newsletter. Financial Institutes. No. 70

XONTRO Newsletter. Financial Institutes. No. 70 XONTRO Newsletter Financial Institutes No. 70 Page 1 This XONTRO Newsletter for Financial Institutes contains information covering the following topics: BCIN BV processing control handling ( Bearbeitung


Simulation of a Battery Electric Vehicle

Simulation of a Battery Electric Vehicle Simulation of a Battery Electric Vehicle M. Auer, T. Kuthada, N. Widdecke, J. Wiedemann IVK/FKFS University of Stuttgart 1 2.1.214 Markus Auer Agenda Motivation Thermal Management for BEV Simulation Model


ISO 15504 Reference Model

ISO 15504 Reference Model Prozess Dimension von SPICE/ISO 15504 Process flow Remarks Role Documents, data, tools input, output Start Define purpose and scope Define process overview Define process details Define roles no Define


Funktionelle Genomik. praktische Anwendungen

Funktionelle Genomik. praktische Anwendungen Funktionelle Genomik praktische Anwendungen Schmelzpunkt der DNA Einzelsträngige DNA absorbiert UV-Licht effektiver SYBR Green fluoresziert nur wenn es an doppelsträngiger DNA bindet Fluoreszenz erhöht


CABLE TESTER. Manual DN-14003

CABLE TESTER. Manual DN-14003 CABLE TESTER Manual DN-14003 Note: Please read and learn safety instructions before use or maintain the equipment This cable tester can t test any electrified product. 9V reduplicated battery is used in


EtherNet/IP Topology and Engineering MPx06/07/08VRS

EtherNet/IP Topology and Engineering MPx06/07/08VRS EtherNet/IP Topology and Engineering MPx06/07/08VRS 3 1. Engineering via free EtherNet/IPTM-Port of a device on Bus from MPx07V10 2. Engineering via optional Industrial-Ethernet-Switch 3. Engineering via


C-TEC Systemtechnik und Serviceleistung für die Werkstoffprüfung GmbH

C-TEC Systemtechnik und Serviceleistung für die Werkstoffprüfung GmbH C-TEC Systemtechnik und Serviceleistung C-TEC Systemtechnik und Serviceleistung The Origin of the company C-TEC: Foundation in 1994 Commercial basis: development of Pipeline Crawlers In 1995 the first


presents GALLUP Impact-Test for 21st May 2013

presents GALLUP Impact-Test for 21st May 2013 presents GALLUP Impact-Test for 21st May 2013 History The Gallup - Impact-Test is based on a method developed by Gallup & Robinson in the 30s. Since many years this test has been used to check print advertising


The Mrs.Sporty Story Founders and History

The Mrs.Sporty Story Founders and History Welcome to The Mrs.Sporty Story Founders and History 2003: vision of Mrs. Sporty is formulated 2004: pilot club opened in Berlin 2005: launch of Mrs.Sporty franchise concept with Stefanie Graf Stefanie


Inspection of industrial installations

Inspection of industrial installations Inspection of industrial installations Elements of a systematic approach 1 Who speaks? Bernd Serr Regional Government of Freiburg, DE Permits, inspections IED forum and committee BREF-author 2 Content


Login data for HAW Mailer, Emil und Helios

Login data for HAW Mailer, Emil und Helios Login data for HAW Mailer, Emil und Helios Es gibt an der HAW Hamburg seit einiger Zeit sehr gute Online Systeme für die Studenten. Jeder Student erhält zu Beginn des Studiums einen Account für alle Online


1.9 Dynamic loading: τ ty : torsion yield stress (torsion) τ sy : shear yield stress (shear) In the last lectures only static loadings are considered

1.9 Dynamic loading: τ ty : torsion yield stress (torsion) τ sy : shear yield stress (shear) In the last lectures only static loadings are considered 1.9 Dynaic loading: In the last lectures only static loadings are considered A static loading is: or the load does not change the load change per tie N Unit is 10 /sec 2 Load case Ι: static load (case


Assessment of disgn-flows in water management, Classical methods, nonstationary and multidimensional extensions of Extreme Value Modeling (EVM)

Assessment of disgn-flows in water management, Classical methods, nonstationary and multidimensional extensions of Extreme Value Modeling (EVM) Assessment of disgn-flows in water management, Classical methods, nonstationary and multidimensional extensions of Extreme Value Modeling (EVM) Dr. Winfried Willems, IAWG Outline Classical Approach, short


Cooperation Project Sao Paulo - Bavaria. Licensing of Waste to Energy Plants (WEP/URE)

Cooperation Project Sao Paulo - Bavaria. Licensing of Waste to Energy Plants (WEP/URE) Cooperation Project Sao Paulo - Bavaria Licensing of Waste to Energy Plants (WEP/URE) SMA 15.10.2007 W. Scholz Legal framework Bayerisches Staatsministerium für European Directive on Waste incineration



ELBA2 ILIAS TOOLS AS SINGLE APPLICATIONS ELBA2 ILIAS TOOLS AS SINGLE APPLICATIONS An AAA/Switch cooperative project run by LET, ETH Zurich, and ilub, University of Bern Martin Studer, ilub, University of Bern Julia Kehl, LET, ETH Zurich 1 Contents


VDE Prüf- und Zertifizierungsinstitut Zeichengenehmigung

VDE Prüf- und Zertifizierungsinstitut Zeichengenehmigung Canadian Solar Inc., 545 Speedvale venue West, GUELPH ON N1K 1E6, CND usweis-nr. / Blatt / Page 2 ktenzeichen / File ref. letzte Änderung / updated Datum / Date Dieses Blatt gilt nur in Verbindung mit


Studienkomitee A2 Transformers. Martin A. Stössl Siemens AG Österreich Transformers Weiz

Studienkomitee A2 Transformers. Martin A. Stössl Siemens AG Österreich Transformers Weiz Studienkomitee A2 Transformers Martin A. Stössl Siemens AG Österreich Transformers Weiz A2 Working Groups - Themenschwerpunkte 1. Zuverlässigkeit A2.37 Tx reliability survey A2.40 Copper sulphide long-term


Important information. New SIMATIC HMI Panels. Migration made easy start now. SIMATIC HMI Panels. siemens.com/simatic-panels

Important information. New SIMATIC HMI Panels. Migration made easy start now. SIMATIC HMI Panels. siemens.com/simatic-panels Important information New SIMATIC HMI Panels Migration made easy start now SIMATIC HMI Panels siemens.com/simatic-panels Das Totally Integrated Automation Portal (TIA Portal) ist das wegweisende, durchgängige


VDE Prüf- und Zertifizierungsinstitut Zeichengenehmigung

VDE Prüf- und Zertifizierungsinstitut Zeichengenehmigung Blatt / page 2 Dieses Blatt gilt nur in Verbindung mit Blatt 1 des sausweises Nr. This supplement is only valid in conjunction with page 1 of the. Blankwiderstands-Durchflußerwärmer, geschlossen Bare Element


ZERTIFIKAT. IFS Food (Version 6, April 2014) DQS CFS GmbH. Brigitte Flachmeyer. DQS CFS GmbH. Hiermit bestätigt die Zertifizierungsstelle

ZERTIFIKAT. IFS Food (Version 6, April 2014) DQS CFS GmbH. Brigitte Flachmeyer. DQS CFS GmbH. Hiermit bestätigt die Zertifizierungsstelle ZERTIFIKAT Hiermit bestätigt die Zertifizierungsstelle (akkreditiert nach der ISO/IEC Guide 65 (ISO/IEC 17065 Norm) für Zertifizierungen nach dem IFS sowie einen Vertrag mit den IFS-Standardeignern geschlossen


Yield characteristics and analytical results of berries of the new German Seabuckthorn variety 'Habego' (Orange Energy )

Yield characteristics and analytical results of berries of the new German Seabuckthorn variety 'Habego' (Orange Energy ) Yield characteristics and analytical results of berries of the new German Seabuckthorn variety 'Habego' (Orange Energy ) Dr. Friedrich Höhne, Landesforschungsanstalt MV, Gülzow Axel Wähling, NIG GmbH,
