Evidence of strobilurine resistant isolates of A. solani and A. alternata in Germany

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Evidence of strobilurine resistant isolates of A. solani and A. alternata in Germany"

Transkript

1 Technische Universität München Evidence of strobilurine resistant isolates of A. solani and A. alternata in Germany H. Hausladen, B. Adolf and J. Leiminger

2 outline introduction material and methods results Alternaria solani Alternaria alternata summary and discussion

3 EB control with strobilurines EB control by strobilurines widely used due to important benefits and excellent disease control mode of action is highly specific (single site mode of action) high risk of fungicide resistance first evidence of the F129L mutation in A. solani by Gudmestad (2000) and G143A in A. alternata by Ma et al. (2003)

4 resistance to QoI fungicides effects Alternaria solani: F129L mutation resulting in a partial resistance (Gisi, Sierotzki, 2008) reduced fungicide sensitivity, reduced disease control (see also in Pyrenophora teres) Alternaria alternata: G143A mutation resulting in a high level of resistance (Gisi, Sierotzki, 2008) complete loss of disease control by use of QoI fungicides (see also in Mycosphaerella graminicola)

5 isolate monitoring examination of leaf samples for their occurence of Alternaria species (A. solani, A. alternata) German wide monitoring period:

6 monitoring 2008

7 monitoring 2010

8 detection of the F129L mutation in A. solani Technische Universität München

9 detection of the F129L mutation in A. solani Technische Universität München site mutation at position 129 from TTC to TTA, CTC, TTG substitution from phenylalanin to leucin (Phe Leu) F 129 L F129 Phenylanalin Leucin

10 detection of two different genotypes within in A. solani Technische Universität München Alt. sol. type II - USA 207 bp AGAA... exon ATGGCTACAGCTTTCCTGGGT Intron (139 bp sequenced, 90% homology to intron bi3 of P.teres (Sierotzky et al. 2007)... A126 G131 Alt. sol. type I - Europe 214 bp exon Intron (1140 bp) exon Intron (2157 bp) exon Intron (1760 bp) AGAA... ATGGCT... ACAGCTTTCCTGGGTTATGTTCTTCCTTATGGGCAAATGTCTTTATGAGGT A126 G131 G GCTACAGTT... (Grasso et al. 2006)

11 detection of the F129L mutation in A. solani Technische Universität München site mutation at position 129 from TTC to TTA, CTC, TTG substitution from phenylalaninen to leucin (Phe Leu) sequenzing of a 207 and 214 bp fragment of the cyt b complex in A. solani F 129 L F129 Phenylanalin Leucin

12 isolate-monitoring year isolates nr of locations Strobilurin applied Locations with F129L Nr mutants Frequency % F129L 5,1 15,3 56,5 17,0 37,7 32,2

13 detection of two different genotypes within in A. solani Technische Universität München Alt. sol. type II - USA 207 bp AGAA... exon ATGGCTACAGCTTTCCTGGGT Intron (139 bp sequenced, 90% homology to intron bi3 of P.teres (Sierotzky et al. 2007)... A126 G out of 147 F129L mutants were genotype II, carrying TTA, TTG mutation Alt. sol. type I - Europe 214 bp exon Intron (1140 bp) exon Intron (2157 bp) exon Intron (1760 bp) AGAA... ATGGCT... ACAGCTTTCCTGGGTTATGTTCTTCCTTATGGGCAAATGTCTTTATGAGGT A126 G131 G GCTACAGTT... (Grasso et al. 2006) only 3 out of 147 F129L mutants, were genotype I, carrying CTC mutation first observed in 2013 (2 isolates) and 2014 (one isolate) all wildtype isolates were genotype I

14 appearance of isolates with F129L mutation Wild-type isolate F129L mutant

15 site-specific distribution of F129L and wild-type isolates Technische Universität München investigation of various isolates out of each sampled location year sampling date aug 16 th aug 16 th aug 16 th sep 11 th aug 28 th sep 18 th sep 18 th location Aschheim Aiterhofen Kirchheim Laberweinting Freising Freising Freising treatment AZ, 4 times AZ, 4 times AZ, 4 times AZ, 3 times unknown untreated AZ, 4 times number of isolates proportion of wild-type isolates proportion of F129L isolates constant site-specific composition of species

16 site-specific occurence of F129L mutants Technische Universität München A. solani location with F129L mutant wild-type wild-type and F129L mutants

17 fungicide sensitivity tests (EC 50 -value) evaluation of fungicide sensitivity of A. solani wild-type and F129L mutants EC 50, US reference F129L mutants EC 50, US reference WT strains EC 50: concentration, at which 50 % of the spores die or do not germinate

18 fungicide sensitivity tests (EC 50 -value) evaluation of fungicide sensitivity of A. solani wild-type and F129L mutants EC 50, US reference F129L mutants EC 50, US reference WT strains

19 fungicide sensitivity tests (EC 50 -value) evaluation of fungicide sensitivity of A. solani wild-type and F129L mutants 10,2 EC 50, US reference F129L mutants EC 50, US reference WT strains

20 detection of the G143A mutation in A. alternata Technische Universität München

21 detection of the G143A mutation in A. alternata Technische Universität München Point mutation within the cyt b complex, mutation site 143 GGT -> GCT (Gly Ala) G 143 A analysis of 150 single spore isolates ( ) and 58 EB infected leaf samples Sequencing of an 228 bp fragment cyt b incl. G143A mutation Primer: AF (5-ACA CTG CTT CAG CAT TTT TCT TCA TAG-3) AR (5-TTG TCC AAT TCA TGG TAT AGC ACT CA-3) (Ma et al. 2003) A.alt GATACGTCTTGCCATACGGGCAAATGTCATTATGAGCTGCAACAGTT A.alt GATACGTCTTGCCATACGGGCAAATGTCATTATGAGCTGCAACAGTT A.alt 11 - GATACGTCTTGCCATACGGGCAAATGTCATTATGAGGTGCAACAGTT A.alt 12 - GATACGTCTTGCCATACGGGCAAATGTCATTATGAGGTGCAACAGTT M M WT WT

22 investigated isolates in total isolates evaluated 7 43 / / wildtyp isolates 7 34 / / G143A mutants 0 9 / / investigated locations 1 29 / / locations with G143A 0 9 / /

23 Site-specific occurence of G143A mutations Technische Universität München A. alternata location with G143A mutant wild-type wild-type and G143A mutants

24 Fungicide sensitivity tests (EC 50 -value) with azoxystrobin Technische Universität München evaluation of fungicide sensitivity of A. alternata wild-type and G143A mutants wild-type isolates Germination % Germination % G143A isolates

25 Summary prevalence of the F129L and G143A mutation in Germany actually no loss in fungicide sensitivity (field) further specific field trials in 2015 (artificial inoculation) use of QoI fungicides to GAP: limitation of Strobilurin-containing products Use products/mixtures with high efficacy Full dosage Use of EB fungicides first spray: 7-8 weeks after the crop emerge further applications: according to disease development and weather condition

F129L monitoring. in Germany, Austria and Poland

F129L monitoring. in Germany, Austria and Poland F129L monitoring in Germany, Austria and Poland Birgit Adolf, Jürgen Leiminger, Andrea Volz, Nicole Metz, Andrea Klaus, Anna Livic, Hans Hausladen EuroBlight Early blight subgroup meeting May 9th 2016,

Mehr

Efforts towards a harmonized EB detection, results of the first Alternaria ring test

Efforts towards a harmonized EB detection, results of the first Alternaria ring test Efforts towards a harmonized EB detection, results of the first Alternaria ring test Jürgen Leiminger (TUM) Jan Spoelder (HLB) Bert Evenhuis and Marieke Förch (WUR) Background Alternaria ring test EuroBlight

Mehr

FIVNAT-CH. Annual report 2002

FIVNAT-CH. Annual report 2002 FIVNAT-CH Schweizerische Gesellschaft für Reproduktionsmedizin Annual report 2002 Date of analysis 15.01.2004 Source: FileMaker Pro files FIVNAT_CYC.FP5 and FIVNAT_PAT.FP5 SUMMARY TABLE SUMMARY RESULTS

Mehr

Cleanroom Fog Generators Volcano VP 12 + VP 18

Cleanroom Fog Generators Volcano VP 12 + VP 18 Cleanroom Fog Generators Volcano VP 12 + VP 18 Description & Functional Principle (Piezo Technology) Cleanrooms are dynamic systems. People and goods are constantly in motion. Further installations, production

Mehr

Landesbetrieb Landwirtschaft Hessen. Integrated Varroa control strategy

Landesbetrieb Landwirtschaft Hessen. Integrated Varroa control strategy Integrated Varroa control strategy Dr. Ralph Büchler Bee institute Kirchhain / Germany Bees survive in the wild! Since about 50 million years From equatorial to polar regions Cope with all pests and parasites

Mehr

The transition at the end of compulsory full-time education

The transition at the end of compulsory full-time education The transition at the end of compulsory full-time education Marina Trebbels The transition at the end of compulsory full-time education Educational and future career aspirations of native and migrant students

Mehr

Test Report No

Test Report No TFI Charlottenburger Allee 41 52068 Aachen Germany Charlottenburger Allee 41 52068 Aachen Germany Egetaepper A/S Postfach 190 7400 Herning DÄNEMARK Fon +49.241.9679 00 Fax +49.241.9679 200 postmaster@tfi-online.de

Mehr

QTL$MAPPING$OF$IMPORTANT$AGRICULTURAL$AND$LIFE$HISTORY$TRAITS$ IN$THE$PLANT$PATHOGENIC$FUNGUS!ZYMOSEPTORIA!TRITICI$ $

QTL$MAPPING$OF$IMPORTANT$AGRICULTURAL$AND$LIFE$HISTORY$TRAITS$ IN$THE$PLANT$PATHOGENIC$FUNGUS!ZYMOSEPTORIA!TRITICI$ $ DISS.ETHNO.22827 QTLMAPPINGOFIMPORTANTAGRICULTURALANDLIFEHISTORYTRAITS INTHEPLANTPATHOGENICFUNGUS!ZYMOSEPTORIA!TRITICI Athesissubmittedtoattainthedegreeof DOCTOROFSCIENCESofETHZURICH (Dr.sc.ETHZurich)

Mehr

Medizinische Klinik II Medizinische Klinik IV

Medizinische Klinik II Medizinische Klinik IV CAMPUS GROSSHADERN CAMPUS INNENSTADT LOREM IPSUM SETUR ALARME Medizinische Klinik II Medizinische Klinik IV Effect of Mipomersen on LDL-Cholesterol levels in Patients with Severe LDL-Hypercholesterolemia

Mehr

Lukas Hydraulik GmbH Weinstraße 39 D Erlangen. Mr. Sauerbier. Lukas Hydraulik GmbH Weinstraße 39 D Erlangen

Lukas Hydraulik GmbH Weinstraße 39 D Erlangen. Mr. Sauerbier. Lukas Hydraulik GmbH Weinstraße 39 D Erlangen Technical Report No. 028-71 30 95685-350 of 22.02.2017 Client: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen Mr. Sauerbier Manufacturing location: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen

Mehr

HIV-1 NAT Blutspenderscreening Testversagen: Ursachen und mögliche Konsequenzen - Müssen zwei Zielregionen erkannt werden?

HIV-1 NAT Blutspenderscreening Testversagen: Ursachen und mögliche Konsequenzen - Müssen zwei Zielregionen erkannt werden? www.pei.de HIV-1 NAT Blutspenderscreening Testversagen: Ursachen und mögliche Konsequenzen - Müssen zwei Zielregionen erkannt werden? NAT screening and blood safety Mandatory NAT testing HCV RNA: 5 000

Mehr

The promotion of perceived physical ability via an intervention using internal teacher frame of reference in

The promotion of perceived physical ability via an intervention using internal teacher frame of reference in The promotion of perceived physical ability via an intervention using internal teacher frame of reference in physical education Esther Oswald Institut für Sportwissenschaft, Universität Bern SGS-Tagung,

Mehr

Franke & Bornberg award AachenMünchener private annuity insurance schemes top grades

Franke & Bornberg award AachenMünchener private annuity insurance schemes top grades Franke & Bornberg award private annuity insurance schemes top grades Press Release, December 22, 2009 WUNSCHPOLICE STRATEGIE No. 1 gets best possible grade FFF ( Excellent ) WUNSCHPOLICE conventional annuity

Mehr

Test Report No

Test Report No TFI Charlottenburger Allee 41 52068 Aachen Germany Charlottenburger Allee 41 52068 Aachen Germany Egetaepper A/S Postafch 1 90 7400 Herning DÄNEMARK Fon +49.241.9679 00 Fax +49.241.9679 200 postmaster@tfi-online.de

Mehr

Bacteriophage application in honeybees infected with Paenibacillus larvae

Bacteriophage application in honeybees infected with Paenibacillus larvae Bacteriophage application in honeybees infected with Paenibacillus larvae 1st German Phage Symposium 9. 10. October 2017 University of Hohenheim LAVES Inst. f. Bienenkunde Celle 1 Paenibacillus larvae

Mehr

Investigations on replacement of maize products in rations for dairy cows and fattening bulls

Investigations on replacement of maize products in rations for dairy cows and fattening bulls Bayerische Landesanstalt für Landwirtschaft Investigations on replacement of maize products in rations for dairy cows and fattening bulls Dr. Thomas Ettle, Sabine Weinfurtner, Mariana Steyer Feeding studies

Mehr

Dynamic Hybrid Simulation

Dynamic Hybrid Simulation Dynamic Hybrid Simulation Comparison of different approaches in HEV-modeling GT-SUITE Conference 12. September 2012, Frankfurt/Main Institut für Verbrennungsmotoren und Kraftfahrwesen Universität Stuttgart

Mehr

Extended Ordered Paired Comparison Models An Application to the Data from Bundesliga Season 2013/14

Extended Ordered Paired Comparison Models An Application to the Data from Bundesliga Season 2013/14 Etended Ordered Paired Comparison Models An Application to the Data from Bundesliga Season 2013/14 Gerhard Tutz & Gunther Schauberger Ludwig-Maimilians-Universität München Akademiestraße 1, 80799 München

Mehr

Auswirkungen von drei verschiedenen Futtermitteln auf morphologische Parameter im Dünndarm von wachsenden Kaninchen

Auswirkungen von drei verschiedenen Futtermitteln auf morphologische Parameter im Dünndarm von wachsenden Kaninchen Auswirkungen von drei verschiedenen Futtermitteln auf morphologische Parameter im Dünndarm von wachsenden Kaninchen Effect of three different feedstuffs on morphological parameters in the small intestine

Mehr

Prüfbericht Nr. / Test Report No: F (Edition 1)

Prüfbericht Nr. / Test Report No: F (Edition 1) Emission date: 22.01.2015 Page: 1 of 5 Prüfbericht Nr. / Test Report No: F4-44254-48401-01 (Edition 1) Auftraggeber Applicant Geräteart Type of equipment Typenbezeichnung Type designation Seriennummer

Mehr

Accounting course program for master students. Institute of Accounting and Auditing http://www.wiwi.hu-berlin.de/rewe

Accounting course program for master students. Institute of Accounting and Auditing http://www.wiwi.hu-berlin.de/rewe Accounting course program for master students Institute of Accounting and Auditing http://www.wiwi.hu-berlin.de/rewe 2 Accounting requires institutional knowledge... 3...but it pays: Lehman Bros. Inc.,

Mehr

Workshop on Copernicus and the CAP. A technology vision for IACS

Workshop on Copernicus and the CAP. A technology vision for IACS Workshop on Copernicus and the CAP on 17 th March 2017 A technology vision for IACS Wolfgang Ehbauer StMELF Bavaria, Germany Outline 1. Some figures about Bavaria 2. Automatic methods in use 3. Tests with

Mehr

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C

A- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C 3 Methoden 3.1 Extraktion der DNA aus den Paraffinschnitten 3.1.1 Extraktions-Kit Das QIAamp DNA Mini Kit- System beruht auf dem Prinzip der Auflösung der Eiweiße mit Proteinase K, DNA Bindung an eine

Mehr

Registration of residence at Citizens Office (Bürgerbüro)

Registration of residence at Citizens Office (Bürgerbüro) Registration of residence at Citizens Office (Bürgerbüro) Opening times in the Citizens Office (Bürgerbüro): Monday to Friday 08.30 am 12.30 pm Thursday 14.00 pm 17.00 pm or by appointment via the Citizens

Mehr

Bayesian Networks. Syntax Semantics Parametrized Distributions Inference in Bayesian Networks. Exact Inference. Approximate Inference

Bayesian Networks. Syntax Semantics Parametrized Distributions Inference in Bayesian Networks. Exact Inference. Approximate Inference Syntax Semantics Parametrized Distributions Inference in Exact Inference Approximate Inference enumeration variable elimination stochastic simulation Markov Chain Monte Carlo (MCMC) 1 Includes many slides

Mehr

Stahl-Zentrum. Koksqualität und Hochofenleistung - Theorie und Praxis. Düsseldorf, 05. Dezember Peter Schmöle

Stahl-Zentrum. Koksqualität und Hochofenleistung - Theorie und Praxis. Düsseldorf, 05. Dezember Peter Schmöle Koksqualität und Hochofenleistung - Theorie und Praxis Düsseldorf, 05. Dezember 2013 1 ThyssenKrupp Steel Europe Coke quality and blast furnace performance Introduction Roles of coke Flooding effects Effects

Mehr

Mitglied der Leibniz-Gemeinschaft

Mitglied der Leibniz-Gemeinschaft Methods of research into dictionary use: online questionnaires Annette Klosa (Institut für Deutsche Sprache, Mannheim) 5. Arbeitstreffen Netzwerk Internetlexikografie, Leiden, 25./26. März 2013 Content

Mehr

Effects of Combusting Plastics in WTE Plants on Dioxin Formation and Ash Quality

Effects of Combusting Plastics in WTE Plants on Dioxin Formation and Ash Quality Effects of Combusting Plastics in WTE Plants on Dioxin Formation and Ash Quality Hg Cd Pb Fe boiler filter scrubbe r

Mehr

Risk of Suicide after Bariatric Surgery

Risk of Suicide after Bariatric Surgery Overview Risk of Suicide after Bariatric Surgery Obesity and Depression Suicidality and Obesity German Obesity-Suicidality Study Birgit Wagner, PhD Department of Psychosomatic Medicine and Psychotherapy

Mehr

Pilot Project Biogas-powered Micro-gas-turbine

Pilot Project Biogas-powered Micro-gas-turbine 1/18 Pilot Project Biogas-powered Micro-gas-turbine Supported by the Hessischen Ministerium für Wirtschaft, Verkehr und Landesentwicklung Speaker Details 2/18 Jan Müller Works at Institute of Solar Energy

Mehr

The label can give (imaginary) wings:the Placebo Effect of Energy Drinks

The label can give (imaginary) wings:the Placebo Effect of Energy Drinks Economy Katja Meyer The label can give (imaginary) wings:the Placebo Effect of Energy Drinks Diploma Thesis Bibliographic information published by the German National Library: The German National Library

Mehr

Genannotation bei Prokaryoten

Genannotation bei Prokaryoten Genannotation bei Prokaryoten Maike Tech Abt. Bioinformatik Institut für Mikrobiologie und Genetik (IMG) Universität Göttingen 28. November 2005 Genetik von Pro- und Eukaryoten Eukaryoten Prokaryoten Zellkern

Mehr

ISEA RWTH Aachen Electric Bus Simulation

ISEA RWTH Aachen Electric Bus Simulation ISEA RWTH Aachen Electric Bus Simulation Finding the Optimal Technical Configuration 05.04.2017 Fabian Meishner Lehrstuhl für Elektrochemische Energiewandlung und 1 Speichersystemtechnik Electric Bus Simulation

Mehr

Call Centers and Low Wage Employment in International Comparison

Call Centers and Low Wage Employment in International Comparison Wissenschaftszentrum Nordrhein-Westfalen Kulturwissenschaftliches Institut Wuppertal Institut für Klima, Umwelt, Energie Institut Arbeit und Technik Call Centers and Low Wage Employment in International

Mehr

AS Path-Prepending in the Internet And Its Impact on Routing Decisions

AS Path-Prepending in the Internet And Its Impact on Routing Decisions (SEP) Its Impact on Routing Decisions Zhi Qi ytqz@mytum.de Advisor: Wolfgang Mühlbauer Lehrstuhl für Netzwerkarchitekturen Background Motivation BGP -> core routing protocol BGP relies on policy routing

Mehr

Sintering of PM Tool Steels supported by Computational Thermodynamics

Sintering of PM Tool Steels supported by Computational Thermodynamics Sintering of PM Tool Steels supported by Computational Thermodynamics S. Weber a,b, W. Theisen a a Ruhr-Universitaet Bochum, Werkstofftechnik D-44780 Bochum, Germany b Helmholtz-Zentrum Berlin fuer Materialien

Mehr

Level 1 German, 2014

Level 1 German, 2014 90886 908860 1SUPERVISOR S Level 1 German, 2014 90886 Demonstrate understanding of a variety of German texts on areas of most immediate relevance 9.30 am Wednesday 26 November 2014 Credits: Five Achievement

Mehr

COMPARISON of SMART HBA1C Analyser against Central Laboratory Analysis November 2008 K.Danzmayer

COMPARISON of SMART HBA1C Analyser against Central Laboratory Analysis November 2008 K.Danzmayer COMPARISON of SMART HBA1C Analyser against Central Laboratory Analysis 12-14. November 2008 K.Danzmayer Estermannstraße 17 A-4020 Linz Tel.+43/732/77 10 77 Fax.+43/732/77 10 77-391 mail:diagnostika@diateam.at

Mehr

eurex rundschreiben 094/10

eurex rundschreiben 094/10 eurex rundschreiben 094/10 Datum: Frankfurt, 21. Mai 2010 Empfänger: Alle Handelsteilnehmer der Eurex Deutschland und Eurex Zürich sowie Vendoren Autorisiert von: Jürg Spillmann Weitere Informationen zur

Mehr

Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit Pool water quality the German philosophy

Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit Pool water quality the German philosophy Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit Pool water quality the German philosophy Christiane Höller Bavarian Health and Food Safety Authority Legal regulations 1979 Federal Law on

Mehr

Evaluation of an Augmented-Realitybased 3D User Interface to Enhance the 3D-Understanding of Molecular Chemistry

Evaluation of an Augmented-Realitybased 3D User Interface to Enhance the 3D-Understanding of Molecular Chemistry Evaluation of an Augmented-Realitybased 3D User Interface to Enhance the 3D-Understanding of Molecular Chemistry Patrick Maier, Gudrun Klinker Fachgebiet Augmented Reality (FAR),, Fakultät für Informatik,

Mehr

Supplier Status Report (SSR)

Supplier Status Report (SSR) Supplier Status Report (SSR) Introduction for BOS suppliers BOS GmbH & Co. KG International Headquarters Stuttgart Ernst-Heinkel-Str. 2 D-73760 Ostfildern Management Letter 2 Supplier Status Report sheet

Mehr

LOC Pharma. Anlage. Lieferantenfragebogen Supplier Questionnaire. 9. Is the warehouse temperature controlled or air-conditioned?

LOC Pharma. Anlage. Lieferantenfragebogen Supplier Questionnaire. 9. Is the warehouse temperature controlled or air-conditioned? Please complete this questionnaire and return to: z.h. Leiter Qualitätsmanagement info@loc-pharma.de Name and position of person completing the questionnaire Signature Date 1. Name of Company 2. Address

Mehr

HIR Method & Tools for Fit Gap analysis

HIR Method & Tools for Fit Gap analysis HIR Method & Tools for Fit Gap analysis Based on a Powermax APML example 1 Base for all: The Processes HIR-Method for Template Checks, Fit Gap-Analysis, Change-, Quality- & Risk- Management etc. Main processes

Mehr

Bosch Rexroth - The Drive & Control Company

Bosch Rexroth - The Drive & Control Company Bosch Rexroth - The Drive & Control Company Alle Rechte bei Bosch Rexroth AG, auch für den Fall von Schutzrechtsanmeldungen. Jede Verfügungsbefugnis, wie Kopier- und Weitergaberecht, bei uns. 1 Case study

Mehr

Finite Difference Method (FDM)

Finite Difference Method (FDM) Finite Difference Method (FDM) home/lehre/vl-mhs-1-e/folien/vorlesung/2a_fdm/cover_sheet.tex page 1 of 15. p.1/15 Table of contents 1. Problem 2. Governing Equation 3. Finite Difference-Approximation 4.

Mehr

Level 2 German, 2015

Level 2 German, 2015 91126 911260 2SUPERVISOR S Level 2 German, 2015 91126 Demonstrate understanding of a variety of written and / or visual German text(s) on familiar matters 2.00 p.m. Friday 4 December 2015 Credits: Five

Mehr

PRO SCAN WASSERANALYSE PER SMARTPHONE WATER ANALYSIS BY SMARTPHONE ANALYSE DE L EAU PAR SMARTPHONE

PRO SCAN WASSERANALYSE PER SMARTPHONE WATER ANALYSIS BY SMARTPHONE ANALYSE DE L EAU PAR SMARTPHONE N02 WASSERANALYSE PER SMARTPHONE WATER ANALYSIS BY SMARTPHONE ANALYSE DE L EAU PAR SMARTPHONE NO 2 NO 3 ph Cl 2 CO 2 ANALYSE DIAGNOSE LÖSUNG ANALYSIS DIAGNOSIS SOLUTION THE NEW GENERATION ph KH GH N03

Mehr

Produktänderung EPCOS DeltaCap Kondensatoren für die Blindleistungskompensation

Produktänderung EPCOS DeltaCap Kondensatoren für die Blindleistungskompensation 06.03.2015 Produktänderung EPCOS DeltaCap Kondensatoren für die Blindleistungskompensation Bei einigen EPCOS DeltaCap TM Leistungskondensatoren der Baureihen B32300A* und B32303A* für die Blindleistungskompensation

Mehr

Test Report. Test of resitance to inertia effects of Zirkona Backwall. Sled Test (Frontal Impact) 20 g / 30 ms

Test Report. Test of resitance to inertia effects of Zirkona Backwall. Sled Test (Frontal Impact) 20 g / 30 ms Test Report Test of resitance to inertia effects of Zirkona Backwall Sled Test (Frontal Impact) 20 g / 30 ms This report serves solely as a documentation of test results. 93XS0002-00_TdC.doc Page 1 1.

Mehr

s 120; s 311; s 312; s 330; s 510; s 511; s 530; s 700

s 120; s 311; s 312; s 330; s 510; s 511; s 530; s 700 Technical Report No. 028-7130 95685-250 of 02.12.2016 Client: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen Mr. Sauerbier Manufacturing location: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen

Mehr

Symbio system requirements. Version 5.1

Symbio system requirements. Version 5.1 Symbio system requirements Version 5.1 From: January 2016 2016 Ploetz + Zeller GmbH Symbio system requirements 2 Content 1 Symbio Web... 3 1.1 Overview... 3 1.1.1 Single server installation... 3 1.1.2

Mehr

Joining weed survey datasets for analyses on a European scale a proposal

Joining weed survey datasets for analyses on a European scale a proposal Joining weed survey datasets for analyses on a European scale a proposal Jana Bürger Bärbel Gerowitt Crop Health, University Rostock, Germany European Weed Research Society WG Meeting Weeds and Biodiversity

Mehr

Strategies and possibilities to diagnose and control bee diseases in traditional and local beehives

Strategies and possibilities to diagnose and control bee diseases in traditional and local beehives Strategies and possibilities to diagnose and control bee diseases in traditional and local beehives Wolfgang Ritter CVUA Freiburg/Animal Health Head of International OIE Reference Laboratory President

Mehr

Drought Effects on Soil Solution Chemistry at Bavarian Level-II sites

Drought Effects on Soil Solution Chemistry at Bavarian Level-II sites Drought Effects on Soil Solution Chemistry at Bavarian Level-II sites Freiburg 19.11.04 Christoph Schulz, Stephan Raspe, Bernd Schultze; Bavarian State Institue of Forestry Structure 1. data base and methodical

Mehr

Big Data Analytics. Fifth Munich Data Protection Day, March 23, Dr. Stefan Krätschmer, Data Privacy Officer, Europe, IBM

Big Data Analytics. Fifth Munich Data Protection Day, March 23, Dr. Stefan Krätschmer, Data Privacy Officer, Europe, IBM Big Data Analytics Fifth Munich Data Protection Day, March 23, 2017 C Dr. Stefan Krätschmer, Data Privacy Officer, Europe, IBM Big Data Use Cases Customer focused - Targeted advertising / banners - Analysis

Mehr

Technische Information

Technische Information Technische Information Technical Information 01/2017 991 GT3 Cup Führungsstange Waagebalken austauschen Change master cylinder pushrod Fahrzeug / Vehicle: Bauteil / Part: 991 GT3 Cup Waagebalkenbremse

Mehr

Level 2 German, 2016

Level 2 German, 2016 91126 911260 2SUPERVISOR S Level 2 German, 2016 91126 Demonstrate understanding of a variety of written and / or visual German texts on familiar matters 2.00 p.m. Tuesday 29 November 2016 Credits: Five

Mehr

Einkommensaufbau mit FFI:

Einkommensaufbau mit FFI: For English Explanation, go to page 4. Einkommensaufbau mit FFI: 1) Binäre Cycle: Eine Position ist wie ein Business-Center. Ihr Business-Center hat zwei Teams. Jedes mal, wenn eines der Teams 300 Punkte

Mehr

Geostatistics for modeling of soil spatial variability in Adapazari, Turkey

Geostatistics for modeling of soil spatial variability in Adapazari, Turkey 1 Geostatistics for modeling of soil spatial variability in Adapazari, Turkey Jack W. Baker Michael H. Faber (IBK) ETH - Zürich 2 Practical evaluation of liquefaction occurrence Obtained from empirical

Mehr

Grade 12: Qualifikationsphase. My Abitur

Grade 12: Qualifikationsphase. My Abitur Grade 12: Qualifikationsphase My Abitur Qualifikationsphase Note 1 Punkte Prozente Note 1 15 14 13 85 % 100 % Note 2 12 11 10 70 % 84 % Note 3 9 8 7 55 % 69 % Note 4 6 5 4 40 % 54 % Note 5 3 2 1 20 % 39

Mehr

Technical Terms Technische Daten: Operating voltage Betriebsspannungsbereich Rated Voltage Nennspannung

Technical Terms Technische Daten: Operating voltage Betriebsspannungsbereich Rated Voltage Nennspannung Technical Terms Technische Daten: Operating voltage Betriebsspannungsbereich Rated Voltage Nennspannung 4...7 V 5 V *) Rated Current Nennstrom < 50 ma Sound Output [SPL]at 10 cm Lautstärke[Schalldruckpegel]

Mehr

Using TerraSAR-X data for mapping of damages in forests caused by the pine sawfly (Dprion pini) Dr. Klaus MARTIN klaus.martin@slu-web.

Using TerraSAR-X data for mapping of damages in forests caused by the pine sawfly (Dprion pini) Dr. Klaus MARTIN klaus.martin@slu-web. Using TerraSAR-X data for mapping of damages in forests caused by the pine sawfly (Dprion pini) Dr. Klaus MARTIN klaus.martin@slu-web.de Damages caused by Diprion pini Endangered Pine Regions in Germany

Mehr

Hausaufgabe 1-4. Name: If homework late, explanation: Last class homework is being accepted: If correction late, explanation: Student Self-Grading

Hausaufgabe 1-4. Name: If homework late, explanation: Last class homework is being accepted: If correction late, explanation: Student Self-Grading Hausaufgabe 1-4 To Be Filled Out By Instructor Inspected Self-Grade Accepted Lateness of Homework Accepted Instructor s Grade: Name: To Be Filled Out By Student (White Fields Only) Class # due: 1-4 Turned

Mehr

Lukas Hydraulik GmbH Weinstraße 39 D Erlangen. Mr. Sauerbier. Lukas Hydraulik GmbH Weinstraße 39 D Erlangen. edraulic rescue equipment

Lukas Hydraulik GmbH Weinstraße 39 D Erlangen. Mr. Sauerbier. Lukas Hydraulik GmbH Weinstraße 39 D Erlangen. edraulic rescue equipment Technical Report No. 028-7130 95685-050 of 22.02.2017 Client: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen Mr. Sauerbier Manufacturing location: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen

Mehr

Shock pulse measurement principle

Shock pulse measurement principle Shock pulse measurement principle a [m/s²] 4.0 3.5 3.0 Roller bearing signals in 36 khz range Natural sensor frequency = 36 khz 2.5 2.0 1.5 1.0 0.5 0.0-0.5-1.0-1.5-2.0-2.5-3.0-3.5-4.0 350 360 370 380 390

Mehr

Level 2 German, 2013

Level 2 German, 2013 91126 911260 2SUPERVISOR S Level 2 German, 2013 91126 Demonstrate understanding of a variety of written and / or visual German text(s) on familiar matters 9.30 am Monday 11 November 2013 Credits: Five

Mehr

Mock Exam Behavioral Finance

Mock Exam Behavioral Finance Mock Exam Behavioral Finance For the following 4 questions you have 60 minutes. You may receive up to 60 points, i.e. on average you should spend about 1 minute per point. Please note: You may use a pocket

Mehr

City West between Modern Age and History: How Does the Balancing Act. between Traditional Retail Structures and International

City West between Modern Age and History: How Does the Balancing Act. between Traditional Retail Structures and International City West between Modern Age and History: How Does the Balancing Act between Traditional Retail Structures and International Competition Work? Agenda 1. Basic Data about City West 2. Kurfürstendamm 3.

Mehr

Level 1 German, 2016

Level 1 German, 2016 90886 908860 1SUPERVISOR S Level 1 German, 2016 90886 Demonstrate understanding of a variety of German texts on areas of most immediate relevance 2.00 p.m. Wednesday 23 November 2016 Credits: Five Achievement

Mehr

Newest Generation of the BS2 Corrosion/Warning and Measurement System

Newest Generation of the BS2 Corrosion/Warning and Measurement System Newest Generation of the BS2 Corrosion/Warning and Measurement System BS2 System Description: BS2 CorroDec 2G is a cable and energyless system module range for detecting corrosion, humidity and prevailing

Mehr

auf differentiellen Leitungen

auf differentiellen Leitungen Eingebettete Taktübertragung auf differentiellen Leitungen Johannes Reichart Kleinheubacher Tagung Miltenberg, 28.09.2009 Institut für Prof. Elektrische Dr.-Ing. und Optische Manfred Nachrichtentechnik

Mehr

Walter Buchmayr Ges.m.b.H.

Walter Buchmayr Ges.m.b.H. Seite 1/10 Chapter Description Page 1 Advantages 3 2 Performance description 4 3 Settings 5 4 Options 6 5 Technical data 7 6 Pictures 8 http://members.aon.at/buchmayrgmbh e-mail: walter.buchmayr.gmbh@aon.at

Mehr

SAMPLE EXAMINATION BOOKLET

SAMPLE EXAMINATION BOOKLET S SAMPLE EXAMINATION BOOKLET New Zealand Scholarship German Time allowed: Three hours Total marks: 24 EXAMINATION BOOKLET Question ONE TWO Mark There are three questions. You should answer Question One

Mehr

Asynchronous Generators

Asynchronous Generators Asynchronous Generators Source: ABB 1/21 2. Asynchronous Generators 1. Induction generator with squirrel cage rotor 2. Induction generator with woed rotor Source: electricaleasy.com 2/21 2.1. Induction

Mehr

Numerical Analysis of a Radiant Syngas Cooler

Numerical Analysis of a Radiant Syngas Cooler Numerical Analysis of a Radiant Syngas Cooler Folie 2, Dr.-Ing. Gerd Oeljeklaus, Universität Duisburg-Essen Universität Duisburg-Essen Prof. Dr.-Ing., Universität Duisburg-Essen - Ulrich Günther Siemens

Mehr

Wartezeit in Deutschland auf eine Nierentransplantation: Aktuelle Aspekte oder Das Blutgruppe 0-Problem

Wartezeit in Deutschland auf eine Nierentransplantation: Aktuelle Aspekte oder Das Blutgruppe 0-Problem Wartezeit in Deutschland auf eine Nierentransplantation: Aktuelle Aspekte oder Das Blutgruppe 0-Problem Wartezeit und Ergebnisse nach NTX USA Waiting time on dialysis as the strongest modifiable risk factor

Mehr

Strategies to introduce resistance in cassava against viruses causing brown streak disease using sirna

Strategies to introduce resistance in cassava against viruses causing brown streak disease using sirna Strategies to introduce resistance in cassava against viruses causing brown streak disease using sirna Beena M Ravindran and Stephan Winter WCRTC Nanning, Guangxi, China, 18-22 January 2016 Most Important

Mehr

Moving from Niche to Mass Market Non-GMO labelling experience in Germany

Moving from Niche to Mass Market Non-GMO labelling experience in Germany Moving from Niche to Mass Market Non-GMO labelling experience in Germany Alexander Hissting Verband Lebensmittel ohne Gentechnik e.v. (VLOG) Association Food without Genetic Engineering Overview VLOG VLOG

Mehr

Deutsch. DGAP Stimmrechtsmitteilung: Epigenomics AG Veröffentlichung gemäß 26 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung

Deutsch. DGAP Stimmrechtsmitteilung: Epigenomics AG Veröffentlichung gemäß 26 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung Deutsch DGAP Stimmrechtsmitteilung: Epigenomics AG Veröffentlichung gemäß 26 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung 31.05.2017 / 11:57 Veröffentlichung einer Stimmrechtsmitteilung übermittelt

Mehr

Internationale Energiewirtschaftstagung TU Wien 2015

Internationale Energiewirtschaftstagung TU Wien 2015 Internationale Energiewirtschaftstagung TU Wien 2015 Techno-economic study of measures to increase the flexibility of decentralized cogeneration plants on a German chemical company Luis Plascencia, Dr.

Mehr

Statistics, Data Analysis, and Simulation SS 2015

Statistics, Data Analysis, and Simulation SS 2015 Mainz, June 11, 2015 Statistics, Data Analysis, and Simulation SS 2015 08.128.730 Statistik, Datenanalyse und Simulation Dr. Michael O. Distler Dr. Michael O. Distler

Mehr

Environmental management in German institutions of higher education: Lessons learnt and steps toward sustainable management

Environmental management in German institutions of higher education: Lessons learnt and steps toward sustainable management Environmental management in German institutions of higher education: Lessons learnt and steps toward sustainable management Lüneburg, Juni 23/24, 2005 Joachim Müller Sustainable Management of Higher Education

Mehr

Lufft UMB Sensor Overview

Lufft UMB Sensor Overview Lufft Sensor Overview Wind Radiance (solar radiation) Titan Ventus WS310 Platinum WS301/303 Gold V200A WS300 WS400 WS304 Professional WS200 WS401 WS302 Radiance (solar radiation) Radiation 2 Channel EPANDER

Mehr

Level of service estimation at traffic signals based on innovative traffic data services and collection techniques

Level of service estimation at traffic signals based on innovative traffic data services and collection techniques Level of service estimation at traffic signals based on innovative traffic data services and collection techniques Authors: Steffen Axer, Jannis Rohde, Bernhard Friedrich Network-wide LOS estimation at

Mehr

KTI Project: LIDT and Degradation Testing for Industrial Applications

KTI Project: LIDT and Degradation Testing for Industrial Applications KTI Project: LIDT and Degradation Testing for Industrial Applications Total Investment: Industry: Personel Misc./Equipment Research: Personel 1.713 MCHF 989 kchf 330 kchf 649 kchf 734 kchf CSEM EMPA University

Mehr

Vaccines: A success story with failures. Aims of vaccination

Vaccines: A success story with failures. Aims of vaccination Vaccines: A success story with failures Ursula Wiedermann Institute of Specific Prophylaxis and Tropical Medicine, Medical University Vienna www.meduniwien.ac.at/tropenmedizin Aims of vaccination Individual

Mehr

FEM Isoparametric Concept

FEM Isoparametric Concept FEM Isoparametric Concept home/lehre/vl-mhs--e/cover_sheet.tex. p./26 Table of contents. Interpolation Functions for the Finite Elements 2. Finite Element Types 3. Geometry 4. Interpolation Approach Function

Mehr

MgCl2/TiCl4-TMEDA/Al(i-Bu)3

MgCl2/TiCl4-TMEDA/Al(i-Bu)3 Diss. ETH Nr. 7590 POLYMERISATION UND COPOLYMERISATION VON PROPYLEN UND ETHYLEN MIT ZIEGLERNATTA TRÄGERKATALYSATOREN AUF MAGNESIUMCHLORIDBASIS DER ARTEN MgCl2/TiCl4/Al(iBu)3, MgCl2/TiCl4/Al(iBu)3/LEWISBASE

Mehr

Classification of water supply and wastewater disposal data in river basin districts for Germany

Classification of water supply and wastewater disposal data in river basin districts for Germany Classification of water supply and wastewater disposal data in river basin districts for Germany Diana Weißenberger Statistisches Landesamt Baden-Württemberg 19.03.2014 Contents 1) Survey of water supply

Mehr

Data Mining and Data Analysis using the Example of cross-border Traffic Management during Extreme Weather Events

Data Mining and Data Analysis using the Example of cross-border Traffic Management during Extreme Weather Events Data Mining and Data Analysis using the Example of cross-border Traffic Management during Extreme Weather Events Dipl.-Ing. Marc Hohloch Extreme Weather Events and the Impact for Mobility of Rescue Forces

Mehr

Non users after Cochlear Implantation in Single Sided Deafness

Non users after Cochlear Implantation in Single Sided Deafness Non users after Cochlear Implantation in Single Sided Deafness W. Pethe*, J. Langer*, S. Lissel**, K. Begall* *HNO-Klinik, AMEOS Klinikum Halberstadt **Cochlear Implant Rehabilitationszentrum Sachsen-Anhalt

Mehr

European IAIDO Summer Seminar 2015 Germany 15th 17th August

European IAIDO Summer Seminar 2015 Germany 15th 17th August European IAIDO Summer Seminar 2015 Germany 15th 17th August We are proud to present a European IAIDO Summer Seminar with Morita Sensei and Oshita Sensei in Augsburg, Germany. We invite all Iaidoka regardless

Mehr

Deutsch. DGAP Stimmrechtsmitteilung: Epigenomics AG Veröffentlichung gemäß 26 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung

Deutsch. DGAP Stimmrechtsmitteilung: Epigenomics AG Veröffentlichung gemäß 26 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung Deutsch DGAP Stimmrechtsmitteilung: Epigenomics AG Veröffentlichung gemäß 26 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung 16.10.2017 / 10:28 Veröffentlichung einer Stimmrechtsmitteilung übermittelt

Mehr

Level 1 German, 2011

Level 1 German, 2011 90886 908860 1SUPERVISOR S Level 1 German, 2011 90886 Demonstrate understanding of a variety of German texts on areas of most immediate relevance 9.30 am uesday Tuesday 1 November 2011 Credits: Five Achievement

Mehr

FIVNAT-CH Schweizerische Gesellschaft für Fertilität, Sterilität und Familienplanung Société Suisse de Fertilité, Stérilité et de Planning Familial

FIVNAT-CH Schweizerische Gesellschaft für Fertilität, Sterilität und Familienplanung Société Suisse de Fertilité, Stérilité et de Planning Familial Schweizerische Gesellschaft für Fertilität, Sterilität und Familienplanung FIVNAT-CH Schweizerische Gesellschaft für Fertilität, Sterilität und Familienplanung Annual report 2001 Date of analysis 30.10.2002

Mehr

Summary Details for Performance, Duration and Acoustic Measurements for the. Aircon 10S Wind Turbine. UK MCS Certification Summary

Summary Details for Performance, Duration and Acoustic Measurements for the. Aircon 10S Wind Turbine. UK MCS Certification Summary Summary Details for Performance, Duration and Acoustic Measurements for the Aircon 10S Wind Turbine UK MCS Certification Summary Certificate Number MCS TUV0007 Small Wind Turbine Certification Summary

Mehr

Supplementary material for Who never tells a lie? The following material is provided below, in the following order:

Supplementary material for Who never tells a lie? The following material is provided below, in the following order: Supplementary material for Who never tells a lie? The following material is provided below, in the following order: Instructions and questionnaire used in the replication study (German, 2 pages) Instructions

Mehr