Evidence of strobilurine resistant isolates of A. solani and A. alternata in Germany
|
|
- Alexander Frank
- vor 8 Jahren
- Abrufe
Transkript
1 Technische Universität München Evidence of strobilurine resistant isolates of A. solani and A. alternata in Germany H. Hausladen, B. Adolf and J. Leiminger
2 outline introduction material and methods results Alternaria solani Alternaria alternata summary and discussion
3 EB control with strobilurines EB control by strobilurines widely used due to important benefits and excellent disease control mode of action is highly specific (single site mode of action) high risk of fungicide resistance first evidence of the F129L mutation in A. solani by Gudmestad (2000) and G143A in A. alternata by Ma et al. (2003)
4 resistance to QoI fungicides effects Alternaria solani: F129L mutation resulting in a partial resistance (Gisi, Sierotzki, 2008) reduced fungicide sensitivity, reduced disease control (see also in Pyrenophora teres) Alternaria alternata: G143A mutation resulting in a high level of resistance (Gisi, Sierotzki, 2008) complete loss of disease control by use of QoI fungicides (see also in Mycosphaerella graminicola)
5 isolate monitoring examination of leaf samples for their occurence of Alternaria species (A. solani, A. alternata) German wide monitoring period:
6 monitoring 2008
7 monitoring 2010
8 detection of the F129L mutation in A. solani Technische Universität München
9 detection of the F129L mutation in A. solani Technische Universität München site mutation at position 129 from TTC to TTA, CTC, TTG substitution from phenylalanin to leucin (Phe Leu) F 129 L F129 Phenylanalin Leucin
10 detection of two different genotypes within in A. solani Technische Universität München Alt. sol. type II - USA 207 bp AGAA... exon ATGGCTACAGCTTTCCTGGGT Intron (139 bp sequenced, 90% homology to intron bi3 of P.teres (Sierotzky et al. 2007)... A126 G131 Alt. sol. type I - Europe 214 bp exon Intron (1140 bp) exon Intron (2157 bp) exon Intron (1760 bp) AGAA... ATGGCT... ACAGCTTTCCTGGGTTATGTTCTTCCTTATGGGCAAATGTCTTTATGAGGT A126 G131 G GCTACAGTT... (Grasso et al. 2006)
11 detection of the F129L mutation in A. solani Technische Universität München site mutation at position 129 from TTC to TTA, CTC, TTG substitution from phenylalaninen to leucin (Phe Leu) sequenzing of a 207 and 214 bp fragment of the cyt b complex in A. solani F 129 L F129 Phenylanalin Leucin
12 isolate-monitoring year isolates nr of locations Strobilurin applied Locations with F129L Nr mutants Frequency % F129L 5,1 15,3 56,5 17,0 37,7 32,2
13 detection of two different genotypes within in A. solani Technische Universität München Alt. sol. type II - USA 207 bp AGAA... exon ATGGCTACAGCTTTCCTGGGT Intron (139 bp sequenced, 90% homology to intron bi3 of P.teres (Sierotzky et al. 2007)... A126 G out of 147 F129L mutants were genotype II, carrying TTA, TTG mutation Alt. sol. type I - Europe 214 bp exon Intron (1140 bp) exon Intron (2157 bp) exon Intron (1760 bp) AGAA... ATGGCT... ACAGCTTTCCTGGGTTATGTTCTTCCTTATGGGCAAATGTCTTTATGAGGT A126 G131 G GCTACAGTT... (Grasso et al. 2006) only 3 out of 147 F129L mutants, were genotype I, carrying CTC mutation first observed in 2013 (2 isolates) and 2014 (one isolate) all wildtype isolates were genotype I
14 appearance of isolates with F129L mutation Wild-type isolate F129L mutant
15 site-specific distribution of F129L and wild-type isolates Technische Universität München investigation of various isolates out of each sampled location year sampling date aug 16 th aug 16 th aug 16 th sep 11 th aug 28 th sep 18 th sep 18 th location Aschheim Aiterhofen Kirchheim Laberweinting Freising Freising Freising treatment AZ, 4 times AZ, 4 times AZ, 4 times AZ, 3 times unknown untreated AZ, 4 times number of isolates proportion of wild-type isolates proportion of F129L isolates constant site-specific composition of species
16 site-specific occurence of F129L mutants Technische Universität München A. solani location with F129L mutant wild-type wild-type and F129L mutants
17 fungicide sensitivity tests (EC 50 -value) evaluation of fungicide sensitivity of A. solani wild-type and F129L mutants EC 50, US reference F129L mutants EC 50, US reference WT strains EC 50: concentration, at which 50 % of the spores die or do not germinate
18 fungicide sensitivity tests (EC 50 -value) evaluation of fungicide sensitivity of A. solani wild-type and F129L mutants EC 50, US reference F129L mutants EC 50, US reference WT strains
19 fungicide sensitivity tests (EC 50 -value) evaluation of fungicide sensitivity of A. solani wild-type and F129L mutants 10,2 EC 50, US reference F129L mutants EC 50, US reference WT strains
20 detection of the G143A mutation in A. alternata Technische Universität München
21 detection of the G143A mutation in A. alternata Technische Universität München Point mutation within the cyt b complex, mutation site 143 GGT -> GCT (Gly Ala) G 143 A analysis of 150 single spore isolates ( ) and 58 EB infected leaf samples Sequencing of an 228 bp fragment cyt b incl. G143A mutation Primer: AF (5-ACA CTG CTT CAG CAT TTT TCT TCA TAG-3) AR (5-TTG TCC AAT TCA TGG TAT AGC ACT CA-3) (Ma et al. 2003) A.alt GATACGTCTTGCCATACGGGCAAATGTCATTATGAGCTGCAACAGTT A.alt GATACGTCTTGCCATACGGGCAAATGTCATTATGAGCTGCAACAGTT A.alt 11 - GATACGTCTTGCCATACGGGCAAATGTCATTATGAGGTGCAACAGTT A.alt 12 - GATACGTCTTGCCATACGGGCAAATGTCATTATGAGGTGCAACAGTT M M WT WT
22 investigated isolates in total isolates evaluated 7 43 / / wildtyp isolates 7 34 / / G143A mutants 0 9 / / investigated locations 1 29 / / locations with G143A 0 9 / /
23 Site-specific occurence of G143A mutations Technische Universität München A. alternata location with G143A mutant wild-type wild-type and G143A mutants
24 Fungicide sensitivity tests (EC 50 -value) with azoxystrobin Technische Universität München evaluation of fungicide sensitivity of A. alternata wild-type and G143A mutants wild-type isolates Germination % Germination % G143A isolates
25 Summary prevalence of the F129L and G143A mutation in Germany actually no loss in fungicide sensitivity (field) further specific field trials in 2015 (artificial inoculation) use of QoI fungicides to GAP: limitation of Strobilurin-containing products Use products/mixtures with high efficacy Full dosage Use of EB fungicides first spray: 7-8 weeks after the crop emerge further applications: according to disease development and weather condition
F129L monitoring. in Germany, Austria and Poland
F129L monitoring in Germany, Austria and Poland Birgit Adolf, Jürgen Leiminger, Andrea Volz, Nicole Metz, Andrea Klaus, Anna Livic, Hans Hausladen EuroBlight Early blight subgroup meeting May 9th 2016,
MehrEfforts towards a harmonized EB detection, results of the first Alternaria ring test
Efforts towards a harmonized EB detection, results of the first Alternaria ring test Jürgen Leiminger (TUM) Jan Spoelder (HLB) Bert Evenhuis and Marieke Förch (WUR) Background Alternaria ring test EuroBlight
MehrDendrogramm der Primaten
Arbeitsblatt 1 Dargestellt ist ein Ausschnitt der DNA-Sequenz für das Enzym NAD- Polymerase, dass bei den Primatenarten Mensch(M), Schimpanse(S), Gorilla(G), Orang-Utan(O) und Gibbon(Gi) vorhanden ist.
MehrAssessment of Sensitivities to Anilinopyrimidine- and Strobilurin-fungicides in Populations of the Apple Scab Fungus Venturia inaequalis
J. Phytopathology 146, 231-238 (1998) 1998 Blackwell Wissenschafts-Verlag, Berlin ISSN 0931-1785 Universität Konstanz, Fakultät fur Biologie, Lehrstuhl für Phythopathologie, Konstanz, Germany Assessment
MehrJohannes Bachmann, Silvia Keilholz
Johannes Bachmann, Silvia Keilholz Spring mortality *common carps die with few or without any pathological signs *average body condition *no death causing organisms/ explanations *First detection of CEV
MehrCleanroom Fog Generators Volcano VP 12 + VP 18
Cleanroom Fog Generators Volcano VP 12 + VP 18 Description & Functional Principle (Piezo Technology) Cleanrooms are dynamic systems. People and goods are constantly in motion. Further installations, production
MehrFIVNAT-CH. Annual report 2002
FIVNAT-CH Schweizerische Gesellschaft für Reproduktionsmedizin Annual report 2002 Date of analysis 15.01.2004 Source: FileMaker Pro files FIVNAT_CYC.FP5 and FIVNAT_PAT.FP5 SUMMARY TABLE SUMMARY RESULTS
MehrLandesbetrieb Landwirtschaft Hessen. Integrated Varroa control strategy
Integrated Varroa control strategy Dr. Ralph Büchler Bee institute Kirchhain / Germany Bees survive in the wild! Since about 50 million years From equatorial to polar regions Cope with all pests and parasites
MehrThe transition at the end of compulsory full-time education
The transition at the end of compulsory full-time education Marina Trebbels The transition at the end of compulsory full-time education Educational and future career aspirations of native and migrant students
MehrTest Report No
TFI Charlottenburger Allee 41 52068 Aachen Germany Charlottenburger Allee 41 52068 Aachen Germany Egetaepper A/S Postfach 190 7400 Herning DÄNEMARK Fon +49.241.9679 00 Fax +49.241.9679 200 postmaster@tfi-online.de
MehrBezeichnung Sequenz Verwendung
8 ANHANG i 8 ANHANG I Oligonukleotide Bezeichnung Sequenz Verwendung D256 5 -ATGGCAGACGGTGAGGATATTCA-3 5 Aktin AC1 (neu) D257 5 -GCCTTTGCAATCCACATCTGTTG-3 3 Aktin AC2 (neu) D98 5 -AT CC ATG GCA ATG TCA
MehrMedizinische Klinik II Medizinische Klinik IV
CAMPUS GROSSHADERN CAMPUS INNENSTADT LOREM IPSUM SETUR ALARME Medizinische Klinik II Medizinische Klinik IV Effect of Mipomersen on LDL-Cholesterol levels in Patients with Severe LDL-Hypercholesterolemia
MehrCharacterisation of solution states of cellulose in selected direct dissolution agents
Characterisation of solution states of cellulose in selected direct dissolution agents Birgit Kosan, Katrin Schwikal, Frank Meister The 4 th Workshop on Cellulose, Regenerated Cellulose and Cellulose Derivatives,
MehrAccounting course program for master students. Institute of Accounting and Auditing http://www.wiwi.hu-berlin.de/rewe
Accounting course program for master students Institute of Accounting and Auditing http://www.wiwi.hu-berlin.de/rewe 2 Accounting requires institutional knowledge... 3...but it pays: Lehman Bros. Inc.,
MehrEfficacy of Biocides against Gram-negative Bacteria. Dr. Peter Goroncy-Bermes R & D Department
against Gram-negative Bacteria Dr. Peter Goroncy-Bermes R & D Department Three important groups of weapons can be used to fight infectious agents Antibiotics Antimycotics Biocides 30.11.2015 Titel der
MehrLukas Hydraulik GmbH Weinstraße 39 D Erlangen. Mr. Sauerbier. Lukas Hydraulik GmbH Weinstraße 39 D Erlangen
Technical Report No. 028-71 30 95685-350 of 22.02.2017 Client: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen Mr. Sauerbier Manufacturing location: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen
MehrExtended Ordered Paired Comparison Models An Application to the Data from Bundesliga Season 2013/14
Etended Ordered Paired Comparison Models An Application to the Data from Bundesliga Season 2013/14 Gerhard Tutz & Gunther Schauberger Ludwig-Maimilians-Universität München Akademiestraße 1, 80799 München
MehrHIV-1 NAT Blutspenderscreening Testversagen: Ursachen und mögliche Konsequenzen - Müssen zwei Zielregionen erkannt werden?
www.pei.de HIV-1 NAT Blutspenderscreening Testversagen: Ursachen und mögliche Konsequenzen - Müssen zwei Zielregionen erkannt werden? NAT screening and blood safety Mandatory NAT testing HCV RNA: 5 000
MehrFranke & Bornberg award AachenMünchener private annuity insurance schemes top grades
Franke & Bornberg award private annuity insurance schemes top grades Press Release, December 22, 2009 WUNSCHPOLICE STRATEGIE No. 1 gets best possible grade FFF ( Excellent ) WUNSCHPOLICE conventional annuity
MehrThe promotion of perceived physical ability via an intervention using internal teacher frame of reference in
The promotion of perceived physical ability via an intervention using internal teacher frame of reference in physical education Esther Oswald Institut für Sportwissenschaft, Universität Bern SGS-Tagung,
MehrTest Report No
TFI Charlottenburger Allee 41 52068 Aachen Germany Charlottenburger Allee 41 52068 Aachen Germany Egetaepper A/S Postafch 1 90 7400 Herning DÄNEMARK Fon +49.241.9679 00 Fax +49.241.9679 200 postmaster@tfi-online.de
MehrInvestigations on replacement of maize products in rations for dairy cows and fattening bulls
Bayerische Landesanstalt für Landwirtschaft Investigations on replacement of maize products in rations for dairy cows and fattening bulls Dr. Thomas Ettle, Sabine Weinfurtner, Mariana Steyer Feeding studies
MehrBacteriophage application in honeybees infected with Paenibacillus larvae
Bacteriophage application in honeybees infected with Paenibacillus larvae 1st German Phage Symposium 9. 10. October 2017 University of Hohenheim LAVES Inst. f. Bienenkunde Celle 1 Paenibacillus larvae
MehrMitglied der Leibniz-Gemeinschaft
Methods of research into dictionary use: online questionnaires Annette Klosa (Institut für Deutsche Sprache, Mannheim) 5. Arbeitstreffen Netzwerk Internetlexikografie, Leiden, 25./26. März 2013 Content
MehrDynamic Hybrid Simulation
Dynamic Hybrid Simulation Comparison of different approaches in HEV-modeling GT-SUITE Conference 12. September 2012, Frankfurt/Main Institut für Verbrennungsmotoren und Kraftfahrwesen Universität Stuttgart
MehrPilot Project Biogas-powered Micro-gas-turbine
1/18 Pilot Project Biogas-powered Micro-gas-turbine Supported by the Hessischen Ministerium für Wirtschaft, Verkehr und Landesentwicklung Speaker Details 2/18 Jan Müller Works at Institute of Solar Energy
MehrSupplier Status Report (SSR)
Supplier Status Report (SSR) Introduction for BOS suppliers BOS GmbH & Co. KG International Headquarters Stuttgart Ernst-Heinkel-Str. 2 D-73760 Ostfildern Management Letter 2 Supplier Status Report sheet
MehrAuswirkungen von drei verschiedenen Futtermitteln auf morphologische Parameter im Dünndarm von wachsenden Kaninchen
Auswirkungen von drei verschiedenen Futtermitteln auf morphologische Parameter im Dünndarm von wachsenden Kaninchen Effect of three different feedstuffs on morphological parameters in the small intestine
MehrPrüfbericht Nr. / Test Report No: F (Edition 1)
Emission date: 22.01.2015 Page: 1 of 5 Prüfbericht Nr. / Test Report No: F4-44254-48401-01 (Edition 1) Auftraggeber Applicant Geräteart Type of equipment Typenbezeichnung Type designation Seriennummer
MehrWorkshop on Copernicus and the CAP. A technology vision for IACS
Workshop on Copernicus and the CAP on 17 th March 2017 A technology vision for IACS Wolfgang Ehbauer StMELF Bavaria, Germany Outline 1. Some figures about Bavaria 2. Automatic methods in use 3. Tests with
MehrWissen schafft Fortschritt
Wissen schafft Fortschritt» Thermal analysis of six heat-reflective exterior paints on concrete under irradiation 20130730 Dr. Julius Nickl Geschäftsführer Senior-Experte für industrielle Prozesse und
MehrReport Number of issued No. copies Pages date. MHM-EST /D Jakobi. Object under test Type designation Identification No.
TÜV Product Service GmbH Dudenstrasse 28 D-68167 Mannheim Telefon (0621) 395-342 Telefax (0621) 395-652. Accredited Laboratory (DA Tech) Reg.No. TTI-Go54/92-01 Test Report The test results relate only
MehrRegistration of residence at Citizens Office (Bürgerbüro)
Registration of residence at Citizens Office (Bürgerbüro) Opening times in the Citizens Office (Bürgerbüro): Monday to Friday 08.30 am 12.30 pm Thursday 14.00 pm 17.00 pm or by appointment via the Citizens
MehrBayesian Networks. Syntax Semantics Parametrized Distributions Inference in Bayesian Networks. Exact Inference. Approximate Inference
Syntax Semantics Parametrized Distributions Inference in Exact Inference Approximate Inference enumeration variable elimination stochastic simulation Markov Chain Monte Carlo (MCMC) 1 Includes many slides
MehrStahl-Zentrum. Koksqualität und Hochofenleistung - Theorie und Praxis. Düsseldorf, 05. Dezember Peter Schmöle
Koksqualität und Hochofenleistung - Theorie und Praxis Düsseldorf, 05. Dezember 2013 1 ThyssenKrupp Steel Europe Coke quality and blast furnace performance Introduction Roles of coke Flooding effects Effects
MehrAS Path-Prepending in the Internet And Its Impact on Routing Decisions
(SEP) Its Impact on Routing Decisions Zhi Qi ytqz@mytum.de Advisor: Wolfgang Mühlbauer Lehrstuhl für Netzwerkarchitekturen Background Motivation BGP -> core routing protocol BGP relies on policy routing
MehrQTL$MAPPING$OF$IMPORTANT$AGRICULTURAL$AND$LIFE$HISTORY$TRAITS$ IN$THE$PLANT$PATHOGENIC$FUNGUS!ZYMOSEPTORIA!TRITICI$ $
DISS.ETHNO.22827 QTLMAPPINGOFIMPORTANTAGRICULTURALANDLIFEHISTORYTRAITS INTHEPLANTPATHOGENICFUNGUS!ZYMOSEPTORIA!TRITICI Athesissubmittedtoattainthedegreeof DOCTOROFSCIENCESofETHZURICH (Dr.sc.ETHZurich)
MehrEffects of Combusting Plastics in WTE Plants on Dioxin Formation and Ash Quality
Effects of Combusting Plastics in WTE Plants on Dioxin Formation and Ash Quality Hg Cd Pb Fe boiler filter scrubbe r
MehrSintering of PM Tool Steels supported by Computational Thermodynamics
Sintering of PM Tool Steels supported by Computational Thermodynamics S. Weber a,b, W. Theisen a a Ruhr-Universitaet Bochum, Werkstofftechnik D-44780 Bochum, Germany b Helmholtz-Zentrum Berlin fuer Materialien
MehrUsing TerraSAR-X data for mapping of damages in forests caused by the pine sawfly (Dprion pini) Dr. Klaus MARTIN klaus.martin@slu-web.
Using TerraSAR-X data for mapping of damages in forests caused by the pine sawfly (Dprion pini) Dr. Klaus MARTIN klaus.martin@slu-web.de Damages caused by Diprion pini Endangered Pine Regions in Germany
MehrThe label can give (imaginary) wings:the Placebo Effect of Energy Drinks
Economy Katja Meyer The label can give (imaginary) wings:the Placebo Effect of Energy Drinks Diploma Thesis Bibliographic information published by the German National Library: The German National Library
MehrHIR Method & Tools for Fit Gap analysis
HIR Method & Tools for Fit Gap analysis Based on a Powermax APML example 1 Base for all: The Processes HIR-Method for Template Checks, Fit Gap-Analysis, Change-, Quality- & Risk- Management etc. Main processes
MehrA- Zugabe von 180µl Pufferlösung und Proteinase K, Inkubation bei 56 C. B- Zugabe von 200µl einer zweiten Pufferlösung, Inkubation bei 70 C
3 Methoden 3.1 Extraktion der DNA aus den Paraffinschnitten 3.1.1 Extraktions-Kit Das QIAamp DNA Mini Kit- System beruht auf dem Prinzip der Auflösung der Eiweiße mit Proteinase K, DNA Bindung an eine
MehrRisk of Suicide after Bariatric Surgery
Overview Risk of Suicide after Bariatric Surgery Obesity and Depression Suicidality and Obesity German Obesity-Suicidality Study Birgit Wagner, PhD Department of Psychosomatic Medicine and Psychotherapy
MehrEinkommensaufbau mit FFI:
For English Explanation, go to page 4. Einkommensaufbau mit FFI: 1) Binäre Cycle: Eine Position ist wie ein Business-Center. Ihr Business-Center hat zwei Teams. Jedes mal, wenn eines der Teams 300 Punkte
MehrISEA RWTH Aachen Electric Bus Simulation
ISEA RWTH Aachen Electric Bus Simulation Finding the Optimal Technical Configuration 05.04.2017 Fabian Meishner Lehrstuhl für Elektrochemische Energiewandlung und 1 Speichersystemtechnik Electric Bus Simulation
MehrGenannotation bei Prokaryoten
Genannotation bei Prokaryoten Maike Tech Abt. Bioinformatik Institut für Mikrobiologie und Genetik (IMG) Universität Göttingen 28. November 2005 Genetik von Pro- und Eukaryoten Eukaryoten Prokaryoten Zellkern
MehrDeutsch. DGAP Stimmrechtsmitteilung: Leoni AG Veröffentlichung gemäß 26 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung
Seite 1 von 5 Deutsch DGAP Stimmrechtsmitteilung: Veröffentlichung gemäß 26 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung Veröffentlichung einer Stimmrechtsmitteilung übermittelt durch DGAP - ein
MehrPhotometric Report 25 Lens Kit
Photometric Report 25 Lens Kit R-G-B US Distribution Elation Professional Los Angeles, Ca. 800-333-0644 web: www.elationlighting.com info: sale@elationlighting.com support: support@elationlighting.com
MehrCall Centers and Low Wage Employment in International Comparison
Wissenschaftszentrum Nordrhein-Westfalen Kulturwissenschaftliches Institut Wuppertal Institut für Klima, Umwelt, Energie Institut Arbeit und Technik Call Centers and Low Wage Employment in International
MehrHLA-READY GENE A Low SSP HLA-A low resolution
IN VITRO DIAGNOSTICUM LOT G950085 Arbeitsprotokoll / PCR Protocol 2006-12 0123 Test-Durchführung / -Performance Datum / Date Unterschrift / Signature Bemerkungen / Comments Probe / Sample 1 5 9 13 17 2
MehrDrought Effects on Soil Solution Chemistry at Bavarian Level-II sites
Drought Effects on Soil Solution Chemistry at Bavarian Level-II sites Freiburg 19.11.04 Christoph Schulz, Stephan Raspe, Bernd Schultze; Bavarian State Institue of Forestry Structure 1. data base and methodical
MehrGLEICHSTELLUNGSPOLITIK IN ZEITEN WACHSENDER UNGLEICHHEIT
GLEICHSTELLUNGSPOLITIK IN ZEITEN WACHSENDER UNGLEICHHEIT 4. Gender Studies Tagung, DIW/FES Berlin 27 September 2018 Monika Queisser Senior Counsellor OECD Centre of Opportunity and Equality Beschäftigung
MehrAsynchronous Generators
Asynchronous Generators Source: ABB 1/21 2. Asynchronous Generators 1. Induction generator with squirrel cage rotor 2. Induction generator with woed rotor Source: electricaleasy.com 2/21 2.1. Induction
MehrEnvironmental management in German institutions of higher education: Lessons learnt and steps toward sustainable management
Environmental management in German institutions of higher education: Lessons learnt and steps toward sustainable management Lüneburg, Juni 23/24, 2005 Joachim Müller Sustainable Management of Higher Education
MehrNumber of Maximal Partial Clones
Number of Maximal Partial Clones KARSTEN SCHÖLZEL Universität Rostoc, Institut für Mathemati 26th May 2010 c 2010 UNIVERSITÄT ROSTOCK MATHEMATISCH-NATURWISSENSCHAFTLICHE FAKULTÄT, INSTITUT FÜR MATHEMATIK
MehrWissenschaftliche Dienste. Sachstand. Payment of value added tax (VAT) (EZPWD-Anfrage ) 2016 Deutscher Bundestag WD /16
Payment of value added tax (VAT) (EZPWD-Anfrage ) 2016 Deutscher Bundestag Seite 2 Payment of value added tax (VAT) (EZPWD-Anfrage ) Aktenzeichen: Abschluss der Arbeit: 07.04.2016 Fachbereich: WD 4: Haushalt
MehrShock pulse measurement principle
Shock pulse measurement principle a [m/s²] 4.0 3.5 3.0 Roller bearing signals in 36 khz range Natural sensor frequency = 36 khz 2.5 2.0 1.5 1.0 0.5 0.0-0.5-1.0-1.5-2.0-2.5-3.0-3.5-4.0 350 360 370 380 390
MehrLevel 1 German, 2014
90886 908860 1SUPERVISOR S Level 1 German, 2014 90886 Demonstrate understanding of a variety of German texts on areas of most immediate relevance 9.30 am Wednesday 26 November 2014 Credits: Five Achievement
MehrCOMPARISON of SMART HBA1C Analyser against Central Laboratory Analysis November 2008 K.Danzmayer
COMPARISON of SMART HBA1C Analyser against Central Laboratory Analysis 12-14. November 2008 K.Danzmayer Estermannstraße 17 A-4020 Linz Tel.+43/732/77 10 77 Fax.+43/732/77 10 77-391 mail:diagnostika@diateam.at
MehrBayerisches Landesamt für Gesundheit und Lebensmittelsicherheit Pool water quality the German philosophy
Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit Pool water quality the German philosophy Christiane Höller Bavarian Health and Food Safety Authority Legal regulations 1979 Federal Law on
MehrEvaluation of an Augmented-Realitybased 3D User Interface to Enhance the 3D-Understanding of Molecular Chemistry
Evaluation of an Augmented-Realitybased 3D User Interface to Enhance the 3D-Understanding of Molecular Chemistry Patrick Maier, Gudrun Klinker Fachgebiet Augmented Reality (FAR),, Fakultät für Informatik,
MehrLOC Pharma. Anlage. Lieferantenfragebogen Supplier Questionnaire. 9. Is the warehouse temperature controlled or air-conditioned?
Please complete this questionnaire and return to: z.h. Leiter Qualitätsmanagement info@loc-pharma.de Name and position of person completing the questionnaire Signature Date 1. Name of Company 2. Address
Mehreurex rundschreiben 094/10
eurex rundschreiben 094/10 Datum: Frankfurt, 21. Mai 2010 Empfänger: Alle Handelsteilnehmer der Eurex Deutschland und Eurex Zürich sowie Vendoren Autorisiert von: Jürg Spillmann Weitere Informationen zur
MehrBosch Rexroth - The Drive & Control Company
Bosch Rexroth - The Drive & Control Company Alle Rechte bei Bosch Rexroth AG, auch für den Fall von Schutzrechtsanmeldungen. Jede Verfügungsbefugnis, wie Kopier- und Weitergaberecht, bei uns. 1 Case study
MehrLevel 2 German, 2015
91126 911260 2SUPERVISOR S Level 2 German, 2015 91126 Demonstrate understanding of a variety of written and / or visual German text(s) on familiar matters 2.00 p.m. Friday 4 December 2015 Credits: Five
MehrFinite Difference Method (FDM)
Finite Difference Method (FDM) home/lehre/vl-mhs-1-e/folien/vorlesung/2a_fdm/cover_sheet.tex page 1 of 15. p.1/15 Table of contents 1. Problem 2. Governing Equation 3. Finite Difference-Approximation 4.
MehrTest Report. Test of resitance to inertia effects of Zirkona Backwall. Sled Test (Frontal Impact) 20 g / 30 ms
Test Report Test of resitance to inertia effects of Zirkona Backwall Sled Test (Frontal Impact) 20 g / 30 ms This report serves solely as a documentation of test results. 93XS0002-00_TdC.doc Page 1 1.
MehrProduktänderung EPCOS DeltaCap Kondensatoren für die Blindleistungskompensation
06.03.2015 Produktänderung EPCOS DeltaCap Kondensatoren für die Blindleistungskompensation Bei einigen EPCOS DeltaCap TM Leistungskondensatoren der Baureihen B32300A* und B32303A* für die Blindleistungskompensation
Mehrs 120; s 311; s 312; s 330; s 510; s 511; s 530; s 700
Technical Report No. 028-7130 95685-250 of 02.12.2016 Client: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen Mr. Sauerbier Manufacturing location: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen
MehrCity West between Modern Age and History: How Does the Balancing Act. between Traditional Retail Structures and International
City West between Modern Age and History: How Does the Balancing Act between Traditional Retail Structures and International Competition Work? Agenda 1. Basic Data about City West 2. Kurfürstendamm 3.
MehrJoining weed survey datasets for analyses on a European scale a proposal
Joining weed survey datasets for analyses on a European scale a proposal Jana Bürger Bärbel Gerowitt Crop Health, University Rostock, Germany European Weed Research Society WG Meeting Weeds and Biodiversity
MehrStrategies and possibilities to diagnose and control bee diseases in traditional and local beehives
Strategies and possibilities to diagnose and control bee diseases in traditional and local beehives Wolfgang Ritter CVUA Freiburg/Animal Health Head of International OIE Reference Laboratory President
MehrBig Data Analytics. Fifth Munich Data Protection Day, March 23, Dr. Stefan Krätschmer, Data Privacy Officer, Europe, IBM
Big Data Analytics Fifth Munich Data Protection Day, March 23, 2017 C Dr. Stefan Krätschmer, Data Privacy Officer, Europe, IBM Big Data Use Cases Customer focused - Targeted advertising / banners - Analysis
MehrKTI Project: LIDT and Degradation Testing for Industrial Applications
KTI Project: LIDT and Degradation Testing for Industrial Applications Total Investment: Industry: Personel Misc./Equipment Research: Personel 1.713 MCHF 989 kchf 330 kchf 649 kchf 734 kchf CSEM EMPA University
MehrTechnische Information
Technische Information Technical Information 01/2017 991 GT3 Cup Führungsstange Waagebalken austauschen Change master cylinder pushrod Fahrzeug / Vehicle: Bauteil / Part: 991 GT3 Cup Waagebalkenbremse
MehrTechnical Terms Technische Daten: Operating voltage Betriebsspannungsbereich Rated Voltage Nennspannung
Technical Terms Technische Daten: Operating voltage Betriebsspannungsbereich Rated Voltage Nennspannung 4...7 V 5 V *) Rated Current Nennstrom < 50 ma Sound Output [SPL]at 10 cm Lautstärke[Schalldruckpegel]
MehrGrade 12: Qualifikationsphase. My Abitur
Grade 12: Qualifikationsphase My Abitur Qualifikationsphase Note 1 Punkte Prozente Note 1 15 14 13 85 % 100 % Note 2 12 11 10 70 % 84 % Note 3 9 8 7 55 % 69 % Note 4 6 5 4 40 % 54 % Note 5 3 2 1 20 % 39
MehrPRO SCAN WASSERANALYSE PER SMARTPHONE WATER ANALYSIS BY SMARTPHONE ANALYSE DE L EAU PAR SMARTPHONE
N02 WASSERANALYSE PER SMARTPHONE WATER ANALYSIS BY SMARTPHONE ANALYSE DE L EAU PAR SMARTPHONE NO 2 NO 3 ph Cl 2 CO 2 ANALYSE DIAGNOSE LÖSUNG ANALYSIS DIAGNOSIS SOLUTION THE NEW GENERATION ph KH GH N03
MehrNitrogen Oxides. O = Lachgas =Stickoxydul =Distickstoffoxid = Nitrous Oxide N 2. Nitrogen oxides
Nitrogen Oxides N 2 O = Lachgas =Stickoxydul =Distickstoffoxid = Nitrous Oxide Structure of this lecture Introduction Ecology of the nitrogen cycle Processes of nitrification, denitrification, NH 3 emission
MehrLevel 2 German, 2016
91126 911260 2SUPERVISOR S Level 2 German, 2016 91126 Demonstrate understanding of a variety of written and / or visual German texts on familiar matters 2.00 p.m. Tuesday 29 November 2016 Credits: Five
MehrGeostatistics for modeling of soil spatial variability in Adapazari, Turkey
1 Geostatistics for modeling of soil spatial variability in Adapazari, Turkey Jack W. Baker Michael H. Faber (IBK) ETH - Zürich 2 Practical evaluation of liquefaction occurrence Obtained from empirical
Mehrrot red braun brown rot red RS-8 rot red braun brown R S V~
Kleiner Ring 9 /Germany Phone: 0049 4122 / 977 381 Fax: 0049 4122 / 977 382 Sample connections: Feedback module with integrated detection of occupied tracks for the RS-feedback bus (Lenz Digital plus)
MehrHausaufgabe 1-4. Name: If homework late, explanation: Last class homework is being accepted: If correction late, explanation: Student Self-Grading
Hausaufgabe 1-4 To Be Filled Out By Instructor Inspected Self-Grade Accepted Lateness of Homework Accepted Instructor s Grade: Name: To Be Filled Out By Student (White Fields Only) Class # due: 1-4 Turned
MehrDeutsch. DGAP Stimmrechtsmitteilung: Leoni AG Veröffentlichung gemäß 26 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung
Seite 1 von 5 Deutsch DGAP Stimmrechtsmitteilung: Veröffentlichung gemäß 26 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung 16.01.2017 Veröffentlichung einer Stimmrechtsmitteilung übermittelt durch
MehrLukas Hydraulik GmbH Weinstraße 39 D Erlangen. Mr. Sauerbier. Lukas Hydraulik GmbH Weinstraße 39 D Erlangen. edraulic rescue equipment
Technical Report No. 028-7130 95685-050 of 22.02.2017 Client: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen Mr. Sauerbier Manufacturing location: Lukas Hydraulik GmbH Weinstraße 39 D-91058 Erlangen
MehrLevel of service estimation at traffic signals based on innovative traffic data services and collection techniques
Level of service estimation at traffic signals based on innovative traffic data services and collection techniques Authors: Steffen Axer, Jannis Rohde, Bernhard Friedrich Network-wide LOS estimation at
MehrLevel 2 German, 2013
91126 911260 2SUPERVISOR S Level 2 German, 2013 91126 Demonstrate understanding of a variety of written and / or visual German text(s) on familiar matters 9.30 am Monday 11 November 2013 Credits: Five
MehrPage 1 of 5 Deutsch DGAP Stimmrechtsmitteilung: Korrektur einer Stimmrechtsmitteilung vom gemäß 40 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung Veröffentlichung einer Stimmrechtsmitteilung übermittelt
MehrElectrical tests on Bosch unit injectors
Valid for Bosch unit injectors with order numbers 0 414 700 / 0 414 701 / 0 414 702 Parts Kit Magnet*: - F00H.N37.925 - F00H.N37.933 - F00H.N37.934 * For allocation to the 10-place Bosch order number,
MehrExercise (Part XI) Anastasia Mochalova, Lehrstuhl für ABWL und Wirtschaftsinformatik, Kath. Universität Eichstätt-Ingolstadt 1
Exercise (Part XI) Notes: The exercise is based on Microsoft Dynamics CRM Online. For all screenshots: Copyright Microsoft Corporation. The sign ## is you personal number to be used in all exercises. All
MehrKAP AG: Veröffentlichung gemäß 40 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung
1 von 5 KAP AG: Veröffentlichung gemäß 40 Abs. 1 WpHG mit dem Ziel der europaweiten Verbreitung 14.09.2018 / 14:52 Veröffentlichung einer Stimmrechtsmitteilung übermittelt durch DGAP - ein Service der
MehrMock Exam Behavioral Finance
Mock Exam Behavioral Finance For the following 4 questions you have 60 minutes. You may receive up to 60 points, i.e. on average you should spend about 1 minute per point. Please note: You may use a pocket
MehrLufft UMB Sensor Overview
Lufft Sensor Overview Wind Radiance (solar radiation) Titan Ventus WS310 Platinum WS301/303 Gold V200A WS300 WS400 WS304 Professional WS200 WS401 WS302 Radiance (solar radiation) Radiation 2 Channel EPANDER
MehrNewest Generation of the BS2 Corrosion/Warning and Measurement System
Newest Generation of the BS2 Corrosion/Warning and Measurement System BS2 System Description: BS2 CorroDec 2G is a cable and energyless system module range for detecting corrosion, humidity and prevailing
MehrKuhnke Technical Data. Contact Details
Kuhnke Technical Data The following page(s) are extracted from multi-page Kuhnke product catalogues or CDROMs and any page number shown is relevant to the original document. The PDF sheets here may have
MehrLevel 1 German, 2016
90886 908860 1SUPERVISOR S Level 1 German, 2016 90886 Demonstrate understanding of a variety of German texts on areas of most immediate relevance 2.00 p.m. Wednesday 23 November 2016 Credits: Five Achievement
MehrInspection and Reporting: Mr. Eric Uhle, Element Materials Hamburg GmbH, Laboratory Mülheim Operations Manager Laboratory Mülheim M.Sc.
info.muelheim@ Lahnstr. 26 Exquip Germany GmbH Mr. Kroll Auf dem Knuf 12 59073 Hamm Date 2017-11-02 Report No. 1709145S Part 4 / 1710342MH Order No. Inspection of Protector Testing acc. to API 5CT Ed.
MehrEuropean IAIDO Summer Seminar 2015 Germany 15th 17th August
European IAIDO Summer Seminar 2015 Germany 15th 17th August We are proud to present a European IAIDO Summer Seminar with Morita Sensei and Oshita Sensei in Augsburg, Germany. We invite all Iaidoka regardless
MehrQuality Management is Ongoing Social Innovation Hans-Werner Franz
Quality Management is Ongoing Social Innovation Hans-Werner Franz ICICI Conference, Prague 1-2 October 2009 What I am going to tell you social innovation the EFQM Excellence model the development of quality
Mehr