The LAREU DNA Project

Transkript

1 The LAREU DNA Project LAREU has started the initiative for a world wide standard of markers for parentage testing in alpacas and llamas, in collaboration with ISAG (International Society of Animal Genetics) Conference in Amsterdam (2008), start first ring test Conference in Edinburgh (2010): results published Camelid working group within ISAG founded 2nd ring test finished in 2012 start DNA ordering within the LAREU system in Sept

2 Grundlagen zum Abstammungsnachweis Chromosomensatz in jedem Zellkern eines Organsmus (hier: Säugetiere) Chromosomen treten immer paarweise auf Geschlechts Chromosomen Katze: 38 Chromosomen, Mensch: 46, Alpaka/Lama: 74 (je ein Chromosom im Paar vom Vater, eines von der Mutter) 2

3 Erbinformation auf der Doppelhelix Nur 4 Aminosäuren bestimmen die Erbinformationen: Adenin Tymin Guanin Cytosin (A) (T) (G) (C) Die Variabilität liegt in der ABFOLGE der 4 Aminokomplexe 1 Å = 10-7 mm Bestimmte Abschnitte (Abfolgen) auf der Helix = Marker 3

4 Example (how it works) Extract single stranded DNA material (pairs chromosomes, one from the father, one from the mother), Search for start and stop characterizing each marker Repeat sequences Start ( Forward ) GCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCAAGTGTA TGTGCATACACGTGCACACACACACACACACACACAGAGGGTGTGCA CATGTGCATGCACACTCCAAGAGACAGTGCCTAGTAAAGTGTCTCAGC ACCATCTGCAGCAAACAGGTTCTGCAAAAACCAATCCCAACTGATGTT CCCACAGTGACACTGT Stop ( Reverse ) Count simple repeat sequences (here: CA base pairs, length = 11: CA11 ) Same marker is found in each of the two chromosomes of a pair 2 numbers of repeats: one from father, the other from the mother 4

5 The Official DNA Marker Panel (ISAG) for SACs 5

6 Example of Parentage Testing (I) here: 5 out of 14 markers LCA19 LCA19 LCA37 LCA37 LCA5 LCA5 LCA66 LCA66 LCA8 LCA8 Mother Father (1) Father (2) Baby Who is the father? 6

7 Zusammenarbeit mit 3 Gen Labors in Europa Deutschland: Certagen GmbH, Frankreich: Genindexe, Holland: Van Haringen Labors BV alle drei nach ISO akkreditiert Ablauf: Züchter wählt Gen Labor (auf LAREU Seite) DNA Bestellung über Tierliste > Ausdruck (mit Tupferbestellung) Auftrag ausfüllen, DNA Probe beim Tier nehmen (Tupfer > Nase) Barcode auf Tupferröhrchen kleben und mit Auftrag an das Gen Labor schicken Gen Labor schickt Rechnung, startet Analyse nach Bezahlung Gen Labor lädt DNA Resultat auf LAREU Datenbank 7

8 DNA-Typisierung bei LAREU Neues Menu 8

9 Auswahl des Gen-Labors (I) oder anderes Labor.. 9

10 Auswahl des Gen-Labors (II) Preise findet man hier 10

11 Auswahl des Gen-Labors (III) 11

12 Auswahl des Gen-Labors (IV) 12

13 Wie werden die Zellen (DNA) gewonnen? Prionics Genotube Livestock Tupferröhrchen (wird beim Labor bestellt) 13

14 Bestellung der DNA-Typisierung (I) 14

15 Bestellung der DNA-Typisierung (II) 15

16 Bestellung der DNA-Typisierung (III) Submit 16

17 Confirmation of DNA Order for Animal No. AREU Hello Dr. med. vet. Ilona Gunsser, you placed a DNA order at Certagen GmbH for your animal GKSanchez: DNA typing: yes verify mother: no verify father: no Your DNA order no. is: 509. To process you order, please take the DNA sample of your animal according to the instructions, sign the attached PDF and send it to Certagen GmbH together with the DNA Sample. The second PDF contains a barcode label. Please cut it out and attach it to the DNA sample for proper identification at Certagen GmbH. When the DNA data is uploaded by Certagen GmbH, you will be informed automatically via . Kind regards The LAREU Team 17

18 es gibt noch einen weiteren pdf im Anhang der 18

19 Beschriftung des Tupferröhrchens 19

20 DNA-Analyse fertig: Labor schickt Betreff: Results of DNA set Upload Hello Dr. med. vet. Ilona Gunsser, the DNA data for your animal GK Skadori with the number LREU have been uploaded. You can now inspect the marker set under the menu 'View'. Kind regards Certagen GmbH 20

21 DNA-Analyse fertig, Daten hochgeladen LAREU DNA Code 21

22 Darstellung der DNA-Daten (I) 22

23 Darstellung der DNA-Daten (II) 23

24 Darstellung der DNA-Daten (II) 24

25 Abstammungsüberprüfung Kind Mutter Vater Mutter und Vater sind verifiziert 25

26 LAREU-DNA-Code mit verifizierter Abstammung L MVFV LAREU Bestellnummer Vater verifiziert Jahr der Analyse kann nicht ausgeschlossen werden Labor Nr 22 = Certagen Mutter verifiziert ET Tiere (schnelle Produktion von Vollgeschwistern): Genetische Mutter beachten 26