Vorwort. Mit kollegialen Grüßen

Größe: px
Ab Seite anzeigen:

Download "Vorwort. Mit kollegialen Grüßen"

Transkript

1 Vorwort Die Weiterentwicklung der DNA-Sequenzanalyse ( Next Generation Sequencing oder NGS ) hat wie kaum eine andere Technologie in den vergangenen 10 Jahren den Life Science -Bereich beflügelt und neue Zusammenhänge zwischen Genotyp und Phänotyp ans Licht gebracht. Im Vergleich zu der bisher dominierenden Sanger-Methode liegt der Durchsatz der modernen Sequenziergeräte um bis zu fach höher. Wesentlich mehr Gene als bisher können mit einer sehr hohen Sequenziertiefe (Genauigkeit) untersucht werden können (s. auch Klein HG und Rost I, Bundesgesundheitsblatt 58:111, 2015). Mit einiger Verzögerung ist NGS inzwischen auch in der medizinischen Diagnostik angekommen, wodurch z.b. angeborene, genetisch bedingte Erkrankungen oder erworbene genetische Veränderungen im Tumorgewebe mit verbesserten Aufklärungsraten und höheren Sensitivitäten untersucht werden können. Die Anwendungsgebiete von NGS gehen jedoch weit über die Humangenetik und Molekularpathologie hinaus: in der Mikrobiologie ist heute der molekularbiologische Nachweis von bisher nicht anzüchtbaren Infektionserregern oder die Charakterisierung des gesamten humanen Mikrobioms möglich (enteralis - Test). In der Virologie ermöglicht NGS z.b. die frühzeitige Entdeckung von HIV-Mutationen, die zu Therapieresistenzen führen. In der Transfusionsmedizin erfolgt die HLA-Typisierung dank NGS inzwischen mit ultrahoher Auflösung und in der Laboratoriumsmedizin liefert die Analyse von zellfreier DNA im Blut wichtige und spezifische Hinweise auf organische Störungen auf subzellulärer Ebene ( Liquid Profiling ). Die Analyse zellfreier DNA im Blut spielt heute vor allem in der Molekularpathologie ( Liquid Biopsy ) und der Pränataldiagnostik (Prenatalis - Analyse zellfreier fetaler DNA aus mütterlichem Blut) eine wichtige Rolle, auch wenn die Untersuchung von zellfreier DNA mit der EBM-Reform zunächst als Regelleistung ausgeschlossen wurde (s. auch Klein HG und Holdenrieder S, J Lab Med 40:291, 2016). Wir haben uns mit diesem 3., vollständig überarbeiteten Handbuch bemüht, Ihnen die wichtigsten Indikationen für den Einsatz von NGS einfach und verständlich darzustellen. In der Humangenetik, die mit Abstand den größten Raum einnimmt, sollte auch mit der nun zur Verfügung stehenden Möglichkeit der NGS -Panel- Untersuchung weiterhin eine Stufendiagnostik zum Einsatz kommen. Wir haben daher die Begriffe ( blaue Boxen) und Erweiterte Diagnostik (grüne Boxen) eingeführt. Die Kassenärztliche Bundesvereinigung (KBV) hat allerdings kürzlich klargestellt, dass und (die genehmigungspflichtige) erweiterte Diagnostik innerhalb eines Krankheitsfalles für die gleiche Indikation nicht nebeneinander oder nacheinander abrechenbar sind. Es besteht weiterhin die Möglichkeit, für Untersuchungen, die im neuen EBM keine Berücksichtigung fanden (z.b. Exom-Analysen oder Prenatalis - nichtinvasiver Pränataltest) beim Versicherer eine Kostenübernahme mit Begründung der medizinischen Notwendigkeit für den Einzelfall zu beantragen. Detailliertere Informationen zum Thema Abrechnung finden Sie auf Seite 245 ff. Zusammenfassend enthält die 3. Auflage des Handbuchs: ü Indikationsgebiete für NGS-Analysen aus 5 Facharztbereichen ( integrierte Diagnostik ) ü Eingearbeitete Systematik des EBM für Kapitel 11 (Humangenetik) und 19 (Pathologie) ü Hintergrundinformationen zu jedem Indikationsgebiet ü Darstellung der komplexer und heterogener Krankheitsbilder in Venn-Diagrammen ü OMIM-P (klinische Subentitäten), OMIM-Gen- und ICD-10 Code in tabellarischer Form ü Abrechnungsinformationen Wir hoffen, Ihnen einen nützlichen Leitfaden für die immer komplexere Welt der molekulargenetischen Diagnostik an die Hand geben zu können und freuen uns auf Anregungen und Verbesserungsvorschläge. Bitte beachten Sie auch unser komplettes Angebot im Bereiche Biochemie und Mikrobiologie/Virologie. Mit kollegialen Grüßen Dr. med. Hanns-Georg Klein Dr. med. Imma Rost 1

2 Impressum Alle Rechte vorbehalten Zentrum für Humangenetik und Laboratoriumsdiagnostik (MVZ) Dr. Klein, Dr. Rost und Kollegen Leistungsverzeichnis und Leitfaden für die Praxis Herausgegeben von Dr. med. Hanns-Georg Klein und Dr. med. Imma Rost Redaktion: Dr. med. Hanns-Georg Klein Grafische Gestaltung: Rüdiger Schmautz (Herrsching) Verlag: Dr. Klein, München Dieses Werk ist urheberrechtlich geschützt. Alle Rechte, auch die der Übersetzung, des Nachdrucks und der Vervielfältigung des Buches oder Teilen daraus, vorbehalten. Kein Teil des Werkes darf ohne schriftliche Genehmigung des Verlages in irgendeiner Form (Fotokopie, Mikrofilm, Datenträger oder anderen Verfahren) reproduziert oder unter Verwendung elektronischer Systeme verarbeitet, vervielfältigt oder verbreitet werden. Wichtiger Hinweis: Wissenschaft unterliegt einem ständigen Fluss. Für die Richtigkeit des Inhalts der einzelnen Kapitel kann keine Garantie übernommen werden. Soweit möglich, wurden die wichtigsten Quellen für die wissenschaftlichen Laborinformationen angegeben. Der Kenntnisstand entspricht dem Zeitpunkt der Drucklegung im Mai

3 Next Generation Sequencing (NGS) in der medizinischen Diagnostik # Intro: Molekulare Diagnostik, Plattformen, analytische Ansätze, Funktionsweise, Bioinformatik 9 Humangenetik Multi-Gen-Panel-Sequenzierung (MGPS) bei Seltenen Erkrankungen (simultane Sequenzierung mehrerer Gene, die bisher nur stufenweise mit großem Aufwand untersucht werden konnten) Multi-Gen-Panels bei hereditären Tumorerkrankungen (simultane Sequenzierung von Core Genes (Haupt-Genen) und krankheitsassoziierten Risk Genes (Risiko-Genen) Neonatalis, neonatalis Diagnose, Früherkennung und Bestätigung von schwerwiegenden Erkrankungen des Neugeborenen, Säuglings und Kleinkindes Exom-Sequenzierung (Whole Exome [WES] oder Clinical Exome [CES] Sequenzierung bei klinisch und genetisch sehr heterogenen Krankheitsbildern wie z.b. schweren Entwicklungsstörungen) Ultratiefe Sequenzierung (Deep Sequencing) einzelner Gene (z.b. mit facher Abdeckung) zum Nachweis geringgradiger Keimbahnmosaike (1-5%) bei Seltenen Erkrankungen Multi-Gen-Panels bei Leukämien und Lymphomen (simultane Sequenzierung von mehreren molekularen Markern mit mindestens facher Abdeckung zur Erfassung von Mosaiken) Multi-Gen-Panel in der Reproduktionsmedizin Nicht-invasive Pränataldiagnostik, NIPT (ultratiefe Sequenzierung von zellfreier mütterlicher und fetaler DNA [cffdna] aus mütterlichem Blut zur Detektion fetaler Aneuploidien) Pathologie Targeted Cancer Panels (simultane Sequenzierung von mehreren Genen im Tumorgewebe auf klinisch relevante somatische Mutationen) Liquid Biopsy ultratiefe Sequenzierung von zellfreier Tumor-DNA [ctdna] im Blut auf somatische Mutationen in tumorassoziierten Genen - Minimal Residual Disease Monitoring) Companion Diagnostics (Erfassung von Minoritäten somatischer Mutationen therapeutisch relevanter Gene im Tumorgewebe) Transfusionsmedizin HLA-Typisierung (hochauflösend und ultrahochauflösend) simultane Sequenzierung von HLA-A, B, C, DP, DQ, DR zur Bestimmung der Gewebeverträglichkeit in der Transplantationsmedizin 239 Mikrobiologie / Virologie Mikrobiom-Analyse (simultane Sequenzierung der Gesamtheit des enteralen Bakteriengenoms zur Erfassung von bakteriellen Fehlbesiedelungen) HCV-/HIV-Genotyp (ultratiefe Sequenzierung von HCV-/HIV-RNA zur frühzeitigen Entdeckung von Therapieresistenzen) Laboratoriumsmedizin Cell-free DNA (ultratiefe Sequenzierung von zellfreien Nukleinsäuren im Blut auf somatische Mutationen in krankheitsassoziierten Genen - RNA Profiling) 243 3

4 Multi-Gen-Panel-Sequenzierung (MGPS) 1. Augenerkrankungen Bardet-Biedl-Syndrom (BBS) und Alström-Syndrom Retinitis Pigmentosa Senior-Løken-Syndrom Stickler-Syndrom (STL) Usher-Syndrom Bindegewebserkrankungen/Aortenerkrankungen Bikuspide Aortenklappe mit Risiko für Aortenstenose/-dilatation Cutis laxa (CL) Ehlers-Danlos-Syndrom (EDS) EDS, autosomal-dominante Subtypen EDS, autosomal-rezessive Subtypen EDS, seltene Formen, allelisch, Differenzialdiagnosen Kollagen 4-assoziierte intrazerebrale Blutungen Loeys-Dietz-Syndrom Marfan-Syndrom (MFS) und Typ 1 Fibrillinopathien MFS-ähnliche Erkrankungen Thorakale Aortenerkrankungen Thorakale Aortenerkrankungen, familiär, nicht-syndromal Thorakale Aortenerkrankungen mit dem Risiko der Aortendissektion Thorakale Aortenerkrankungen, selten syndromal Thorakale Aortenerkrankungen, selten syndromal, rezessiv; Cutis laxa, X-gebunden Bindegewebserkrankungen/Skeletterkrankungen Jeune-/Kurzrippen-Polydaktylie-Syndrom Kraniosynostosen Osteogenesis Imperfecta (OI) Stickler-Syndrom (STL) Blut und blutbildendes System Sphärozytose, hereditäre (HS) Entwicklungs- und Wachstumsstörungen Autismus CDG-Syndrom Coffin-Siris-Syndrom Cornelia-de-Lange-Syndrom GPI-Ankerdefekte/Hyperphosphatasie-mentale Retardierungssyndrom Großwuchssyndrome Kabuki- Syndrom Makrozephalien Mikrozephalien, primär, AR (MCPH) - Mikrozephalie-Kleinwuchs-Syndrome Rett-Syndrom und ähnliche Erkrankungen Robinow-Syndrom Rubinstein-Taybi-Syndrom (RTS) Sprachentwicklungsstörungen Tubulinopathien / Hirnfehlbildungen X-Gebundene Mentale Retardierung Fiebersyndrome Hereditäre periodische Fiebersyndrome (HPF) Herzerkrankungen Arrhythmogene Erkrankungen Arrhythmogene rechtsventrikuläre Dysplasie Brugada-Syndrom (BrS) Catecholaminerge polymorphe ventrikuläre Tachykardie (CPVT) Dilatative Kardiomyopathie (DCM) 77 4

5 7.1.5 Hypertrophe Kardiomyopathie (HCM) Long QT-Syndrom (LQTS) Non-compaction Kardiomyopathie (NCCM) Angeborene Herzfehler Alagille-Syndrom Herzfehler, Heterotaxie assoziierte Herzfehler, isolierte Herzfehler/RASopathien Herzfehler, syndromale Immundefekte (im Kindesalter), primäre Agammaglobulinämie, hereditär Neutropenie, kongenital Kombinierte T- und B-Zellimmundefekte Lungenerkrankungen Cystische Fibrose (Mukoviszidose, CF) Interstitielle Lungenerkrankungen (ILD) / diffuse parenchymatöse Lungenerkrankungen (DPLD) Pulmonale arterielle Hypertonie (PAH) Mitochondriale Erkrankungen Muskelerkrankungen Core-Myopathien Hypokaliämische periodische Paralysen (HypoPP) Muskelatrophien, spinale (SMA) Muskeldystrophien Muskeldystrophien, kongenitale Muskeldystrophien, progressive Myopathien, kongenitale Myopathien, myofibrilläre Myopathien, nicht-dystrophische und periodische Paralysen Stoffwechselmyopathien Neurogenetische Erkrankungen Alzheimer Erkrankung, familiär Ataxien Ataxie mit Okulomotorischer Apraxie (AR) Ataxie: Leukoencephalopathie mit Verlust der weißen Substanz Ataxien, episodisch Ataxien, spastisch Ataxien, Spinocerebellär, autosomal-dominante Ataxien, Spinocerebellär, autosomal-rezessive Ataxien, syndromale Formen Choreatiforme Bewegungsstörungen Hyperekplexie Hereditäre Neuropathien Epilepsien, genetisch bedingt Absence-Epilepsie Benigne familiäre Epilepsie (neonatal, infantil) Epilepsien mit erhöhter Therapierelevanz Familiäre hemiplegische Migräne Fiebergebundene Anfälle/Generalisierte Epilepsie mit Fieberkrämpfen Plus (GEFS+) Fokale Epilepsien Fruḧkindliche epileptische Enzephalopathien Generalisierte, juvenile, myoklonische Epilepsien Nierenerkrankungen Alport-Syndrom Angeborene Fehlbildungen der Nieren und ableitenden Harnwege (CAKUT) Fehlbildungen der ableitenden Harnwege Nierenagenesie/Hypoplasie Renale tubuläre Dysgenesie Nephronophthise (NPHP) Nephrotisches Syndrom (NS)/Fokal segmentale Glomerulosklerose (FSGS) Laboratoriumsmedizin Mikrobiologie/Virologie Transfusionsmedizin Pathologie Humangenetik

6 13.5 Nierenerkrankungen, polyzystische Hyperoxalurie Pankreatitis, hereditäre RASopathien Cardio-Fazio-Cutanes-Syndrom Costello-Syndrom LEOPARD-Syndrom Noonan-Syndrom Schwerhörigkeit/Taubheit Taubheit, autosomal-dominant Taubheit, autosomal-rezessiv Taubheit, syndromal Taubheit, mitochondrial Usher-Syndrom (USH) Stoffwechselerkrankungen Congenitale Defekte der Glykosylierung (CDG) Fettstoffwechselstörungen Hereditäre Hämochromatose Harnstoffzyklus-Defekte Hyperoxalurie Maligne Hyperthermie (MH) Maturity-onset-Diabetes of the Young (MODY) Mukopolysaccharidosen (MPS) Porphyrien Ziliopathien Bardet-Biedl-Syndrom (BBS) Heterotaxie Jeune-/Kurzrippen-Polydaktylie-Syndrom Joubert-Syndrom Meckel-Gruber-Syndrom Nephronophthise (NPHP) Oro-fazio-digitales Syndrom (OFS) Polyzystische Nierenerkrankungen Primäre ziliäre Dyskinesie Senior-Løken-Syndrom 204 MGPS bei hereditärer Tumorprädisposition 19. Hereditäre Tumorsyndrome Familiäres Mamma- und Ovarialkarzinom Hereditäres nicht-polypöses Kolonkarzinom (HNPCC) Gastrointestinale Polyposis-Syndrome Multiple Endokrine Neoplasien Phäochromozytom/Paragangliom 210 neonatalis bei Erkrankungen des Neugeborenen 20. Erkrankungen des Neugeborenen und Säuglings neonatalis basic [18 Gene] neonatalis extended [> 600 Gene] 211 6

7 Clinical Exome Sequencing (CES) / Whole Exome Sequencing (WES) 21. CES/WES bei kindlicher Entwicklungsverzögerung Ultradeep Sequencing einzelner Gene bei Seltenen Erkrankungen 22. Nachweis von Mosaiken am Beispiel des Tuberöse Sklerose Complex (TSC) MGPS und Ultradeep Sequencing (UDS) bei Leukämien und Lymphomen 23. Erkrankungen der myeloischen Zellreihe Akute myeloische Leukämie (AML) Myelodysplastisches Syndrom (MDS) Chronische myelomonozytäre Leukämie (CMML) Atypische chronische myeloische Leukämie (acml) Chronische myeloische Leukämie (CML) Chronische Neutrophilenleukämie (CNL) Polyzythämia Vera (PV) Primäre Myelofibrose (PMF) Essentielle Thrombozythämie (ET) Mastozytose Erkrankungen der lymphatischen Zellreihe Akute lymphatische Leukämie (ALL) Chronische lymphatische Leukämie (CLL) Haarzellleukämie (HZL) Morbus Waldenström (MW) Lymphom allgemein Großzellige granuläre Lymphozyten-Leukämie (T-LGL, NK-LGL) 221 Multi-Gen-Panels in der Reproduktionsgenetik 25.1 Hypogonadotropher Hypogonadismus, Kallmann-Syndrom Vorzeitige Ovarialinsuffizienz (POF) 224 Prenatalis - Nicht-invasiver Pränataltest (NIPT) 26. Nachweis einer Trisomie 21, 18, 13 Fehlverteilungen der Geschlechtschromosomen X und Y Targeted Cancer Panels an Tumormaterial 27. Tumoren des Gastrointestinaltraktes Gastrointestinale Stromatumoren (GIST) Kolorektales Karzinom (CRC) Pankreaskarzinom Schilddru senkarzinom Ovarialkarzinom Malignes Melanom Lungenkarzinom (NSCLC) Harnblasenkarzinom Laboratoriumsmedizin Mikrobiologie/Virologie Transfusionsmedizin Pathologie Humangenetik 7

8 33. Tumoren des Nervensystems Gliome Medulloblastom Paragangliom und Phäochromozytom 236 Liquids 34. Liquid Biopsy/Liquid Profiling zum Nachweis von zirkulierenden Tumorzellen und zirkullierenden zellfreien Tumor-Nukleinsäuren Companion Diagnostics an Tumormaterial 35. Companion Diagnostics HLA-Typisierung 36. HLA-Typisierung Hochauflösende HLA-Typisierung Ultrahochauflösende HLA-Typisierung 240 Mikrobiologie/Virologie Mikrobiom-Analyse HIV/HCV Genotypisierung und Resistenztestung Laboratoriumsmedizin 39. cf-dna-analyse Abrechnung 245 Liste der Erkrankungen/Syndrome 247 Liste der Gene 259 8

9 Next Generation Sequencing oder die Evolution der molekularen Diagnostik Die technischen Möglichkeiten, das Erbgut von Mensch, Tier und Pflanzen, aber auch das von Infektionserregern, Mikroorganismen oder Parasiten - kurz der gesamten belebten Materie - zu analysieren, haben sich seit 2007 durch Entwicklung neuer Hochdurchsatz-Methoden, die unter dem Begriff Next Generation Sequencing (NGS) zusammen gefasst werden, dramatisch weiterentwickelt. Wurde der vorläufige Abschluss des Humanen Genom-Projekts (HGP) im Jahr 2000 noch als Durchbruch in der biomedizinischen Forschung durch tausende beteiligte Wissenschaftler gefeiert, kann heute ein Humanes Genom von einem technisch versierten Mitarbeiter innerhalb von einer Woche in hoher Qualität sequenziert werden. Die Kosten für die Sequenzierung von einem kompletten menschlichen Genom haben sich in den vergangenen 15 Jahren von 100 Mio US$ auf nunmehr etwas mehr als US$ reduziert. Gleichzeitig hat sich der Durchsatz der Geräte unter der Annahme einer 100-fachen Abdeckung/Base ebenfalls um den Faktor erhöht. Zu berücksichtigen sind allerdings Leseweiten, schlecht abgedeckte Bereiche (geringe Coverage) und ca. 10% Lücken (Gaps), so dass der Einsatz der Gesamt-Genomsequenzierung für die Diagnostik derzeit noch nicht empfohlen wird [Klein HG et al, J Lab Med 38:221 (2014)]. Die gewaltigen technologischen Fortschritte in den DNA-Sequenziertechnologien übertreffen sogar die Geschwindigkeit der Weiterentwicklung von Speichermedien in der IT-Industrie (sog. Moore sches Gesetz) und ein Ende der Entwicklung ist derzeit noch nicht abzusehen [Klein HG und Rost I, Bundesgesundheitsbl 58:113, (2015)]. Auch für die Anwendungen in der Diagnostik haben die Hochleistungs-Sequenziertechnologien erhebliche Bedeutung. So wird in der Humangenetik bereits darüber diskutiert, seltene Erkrankungen anstatt der bisher üblichen Zieldiagnostik grundsätzlich einer Genomanalyse zu unterziehen. Aber wie geht man mit Zusatzbefunden um, die ein Risiko für eine spätmanifestierende neurodegenerative Erkrankung erkennen lassen? Wie kommuniziert man die zahlreichen unklaren genetischen Varianten, deren Interpretation zum heutigen Zeitpunkt noch nicht möglich ist? Wie klärt man Patienten im Sinne des Gendiagnostikgesetzes (GenDG) über Wesen, Bedeutung und Tragweite einer Genomanalyse auf? Kann ein Recht auf Nichtwissen oder Datenschutz im Zeitalter des Data Sharing und der Digitalisierung der Medizin überhaupt noch gewährleistet werden? Auch in der Pathologie tun sich bisher ungekannte Fragen auf: Inwieweit sind somatische Neumutationen, die in geringer Anzahl im Tumor nachweisbar sind, überhaupt therapierelevant? Die Liste der offenen Fragen könnte man nach Belieben verlängern. Weder die medizinischen Fachgesellschaften noch die Ärztliche Selbstverwaltung, geschweige denn der Gesetzgeber oder die Regulierungsbehörden kommen der Dynamik der Prozesse hinterher. Dies wird jedoch die Entwicklung nicht stoppen, sondern sollte Ansporn für eine aktive Mitgestaltung der Zukunft sein. 9

10 Next Generation Sequencing (NGS) - Plattformen am MVZ Martinsried Illumina HiSeq 2500 Leseweite ca. 2 x 125 bp Illumina NextSeq 500 Leseweite ca. 2 x 150 bp Illumina MiSeq Benchtop Sequencer Leseweite ca. 2 x 300 bp Ion Torrent PGA Leseweite ca. 1 x 200 bp Roche GS FLX Leseweite ca. 600 bp Roche GS FLX+ Leseweiten >1.200 bp Roche 454 Junior Leseweite ca. 600 bp Durchsatz*: Gb/Lauf (6 Tage) Durchsatz*: Gb/Lauf (48 Std.) Durchsatz*: 15 Gb/Lauf (65 Std.) Durchsatz*: 3 Gb/Lauf (24 Std.) Durchsatz*: 1 Gb/Lauf (10 Std.) Durchsatz*: 1 Gb/Lauf (10 Std.) Durchsatz*: 0,05 Gb/Lauf (8 Std.) *Durchsatz bei NGS bezieht sich auf 1-fache Abdeckung (Coverage) je Base. Für die Diagnostik wird mindestens 20-fache Coverage gefordert. Zum Vergleich das bisher leistungsfähigste Gerät, mit dem das Human Genom-Projekt (HGP) durchgeführt wurde: ABI 3730xl 96-Kapillar-Sequencer (Leseweite ca. 800 bp) Durchsatz: < 0,0001 Gb/Lauf (8 Std.) Analytische Ansätze in der Humangenetik Multi-Gen-Panel Sequenzierung (MGPS) Der Panel-Ansatz stellt im Grunde die Weiterentwicklung der bisherigen Stufendiagnostik mittels Sanger- Sequenzierung dar. In den vergangenen 15 Jahren wurden immer neue Gene in Assoziation mit seltenen Erkrankungen beschrieben, was dazu geführt hat, dass auch immer mehr Gene diagnostisch untersucht wurden. Viele der neu beschriebenen Gene sind jedoch weit seltener ursächlich als die bereits bekannten Hauptgene ( Core Genes ). Daher werden auch heute noch die einzelnen Gene beginnend mit den am häufigsten betroffenen Regionen stufenweise analysiert, um den Aufwand auf ein sinnvolles Maß zu begrenzen. Nun können aufgrund des enormen Durchsatzes der NGS-Methoden alle bekannten krankheitsassoziierten Gene in einem Panel-Ansatz parallel analysiert werden, wodurch der technische Aufwand deutlich reduziert wird. In gleichem Maße steigt allerdings der Aufwand für die Interpretation der zahlreichen Varianten, die bei der simultanen Analyse von mehreren Genen anfällt, deutlich an. Dennoch stellen die Panel-Ansätze in der Diagnostik von seltenen Erkrankungen heute die Methode der Wahl dar, eine Tatsache, die leider in Deutschland vom Gemeinsamen Bundesausschuß (G-BA) und den Spitzenverbänden über Jahre hinweg ignoriert wurde. Die Vorteile der Panel-Ansätze gegenüber Exom- oder Genom-weiten Ansätzen liegen derzeit noch 1) in der Qualität der analysierten Genabschnitte (keine Lücken, alle Bereiche sicher abgedeckt*), 2) in geringeren Kosten für die Reagenzien und 3) in der Vermeidung von unerwünschten Zusatzbefunden. * eine lückenlose Abdeckung und diagnostische Qualität kann nur erreicht werden, wenn die Panel-Gene gleichzeitig auch auf das Vorliegen von Mikrodeletionen untersucht werden (Klasse A-Analysequalität). 10

11 Clinical Exome Sequenzierung (CES) Im Vergleich zu Whole Exome Sequencing (WES), bei der alle proteincodierenden Bereiche angereichert und sequenziert werden, wird bei Clinical Exome Sequencing (CES) ein Subset des Exoms angereichert. Hierbei wird auf krankheitsassoziierte Gene fokussiert, die in der Human Gene Mutation Database (HGMD) beschrieben sind. Die angereicherte Region umfasst hierbei derzeit, je nach Anbieter, zwischen Gene (Agilent Inherited Disease) und Gene (Illumina TruSightOne) und damit bis zu Exons (weitere Informationen und vollständige Genliste siehe auf bzw. Der Vorteil der CES liegt in der Vorauswahl von krankheitsrelevanten Genen, die die Interpretation der identifizierten Varianten erleichtert und gleichzeitig das Auftreten von Varianten unklarer Signifikanz und das Vorkommen von Zusatzbefunden minimiert. CES ist flexibel einsetzbar für verschiedene Indikationen wie ursächlich ungeklärte Entwicklungsstörungen sowie Erkrankungen, die durch Mutationen in mehreren verschiedenen Genen bedingt sein können. Eine vollständige, lückenfreie Analyse ist allerdings bei CES nicht möglich, da - mit vertretbarem Aufwand - weder für alle untersuchten Gene eine MLPA durchgeführt werden, noch in allen Bereichen eine vollständige Abdeckung erreicht werden kann. Die Untersuchung mit CES ist derzeit keine Regelleistung der Krankenkassen. Vor der Untersuchung muss daher eine Kostenübernahme bei der Krankenversicherung beantragt werden. CES unterliegt den Regelungen des Gendiagnostik-Gesetzes (GenDG), d.h. es ist eine ausführliche Aufklärung und eine schriftliche Einwilligung des Patienten, sowie vor prädiktiven Analysen (d.h. Untersuchung von Gesunden) zusätzlich eine genetische Beratung erforderlich. Da der Untersuchungsansatz sehr viele krankheitsassoziierte Gene umfasst, bieten wir für bestimmte Erkrankungen (z.b. hereditäre Krebserkrankungen oder neurodegenerative Erkrankungen) im Rahmen der Aufklärung und/oder genetischen Beratung eine Wahlmöglichkeit, diese Gene in die Auswertung mit einzubeziehen oder auszublenden (Opt-in/Opt-out). Exom 50 Mb (ca Gene) Genom 3 Gb Clinical Exom 7-12 Mb ( Gene) Schematische Darstellung der großen analytischen Ansätze in der Humangenetik: Clinical Exome ( Gene, 7-12 Mb), Whole Exome (ca Gene, 50 Mb), Whole Genome (ca Gene plus nicht-codierende Genregionen, Mb). Whole Exome Sequencing (WES) Whole Exome Sequencing (WES) umfasst die Anreicherung und Sequenzierung aller proteincodierenden Bereiche (ca Gene), wohingegen bei Clinical Exome Sequencing (CES) nur ein Subset des Exoms (krankheitsassoziierte Gene) angereichert wird. WES hat sich in der jüngeren Vergangenheit als hervorragendes Mittel zur Identifikation von krankheitsverursachenden Mutationen in bisher unbekannten Genen etabliert, sowohl im Fall von autosomal-rezessiven Erkrankungen [Ng et al, Nat Genet (2009)], wie auch bei autosomal-dominanten Erkrankungen [Hoischen et al, Nat Genet (2010)]. Seitdem wird WES auch immer mehr in der Diagnostik eingesetzt, vor allem bei Indikationen, bei denen Mutationen in einer Vielzahl von Genen als krankheitsverursachend in Frage kommen. 11

12 Mehrere Studien in den letzten beiden Jahren, in denen Patienten mit schwerer Intelligenzminderung (IQ<50) mittels neuer Hochdurchsatz-Techniken wie der Exom-Sequenzierung untersucht wurden, konnten bestätigen, dass autosomal-dominante Neumutationen offenbar in erheblichem Umfang zur Ursache der schweren Intelligenzminderung beitragen [z. B. Vissers et al, Nat Genet (2010), de Lig et al, NEJM (2012) und Rauch et al, Lancet (2012)]. Während bei chromosomalen Trisomien das Risiko mit dem mütterlichen Alter steigt, nimmt die Rate an autosomal-dominanten Neumutationen mit dem väterlichen Alter zu [Veltman et al, Nat Rev Genet (2012)]. Bei den untersuchten Patienten wurden Varianten in verschiedenen Genen gefunden, wobei in der Studie von de Ligt et al bei 16% der Patienten eine kausale Mutation in einem bereits im Zusammenhang mit Entwicklungsstörungen beschriebenen Gen gefunden wurde, bei Rauch et al bei 35% der Patienten. Man geht daher nach diesen Studien davon aus, dass bis zu 50% der schweren, nicht-syndromalen Entwicklungsstörungen durch de novo-punktmutationen und kleine Indels verursacht werden, wobei eine große genetische Heterogenität zu beobachten ist. Mutationen in noch unbekannten bzw. nicht im Zusammenhang mit Entwicklungsstörungen bekannten Genen erfordern allerdings noch einen immensen Aufwand an integrierter Diagnostik (einschließlich funktioneller Tests), um den ursächlichen Zusammenhang zu beweisen, weshalb WES nur in besonderen Fällen für den Routineeinsatz geeignet ist. Zusätzlich zu der Diagnostik von Entwicklungsstörungen kann WES genutzt werden, um die bestehende Diagnostik zu erweitern. Im Bereich der Epilepsien, Ziliopathien (Joubert-Syndrom) und weiteren Indikationen ist der Einsatz von WES nach Rücksprache möglich. Whole Genome Sequencing (WGS) Im Vergleich zum Clinical Exome Sequencing (CES), bei dem ein Subset des Exoms angereichert und sequenziert wird oder Whole Exome Sequencing (WES), bei dem alle proteincodierenden Bereiche analysiert werden, handelt es sich bei Whole Genome Sequencing (WGS) um die Sequenzierung des gesamten Genoms, d.h. auch aller nicht codierenden Regionen (weitere Informationen siehe auf Der Vorteil der WGS liegt vor allem darin, dass keine Anreicherungsartefakte entstehen, da es sich um die direkte Analyse einer aus genomischer DNA hergestellten Library handelt. Hierdurch ist auch ein Nachweis von Copy Number Variations (CNVs) möglich. Aufgrund der Kosten, der Datenqualität und vor allem der zu erwartenden besonders hohen Anzahl von unklaren Varianten (VUS) hat sich der Einsatz von WGS in der Routine-Diagnostik noch nicht durchgesetzt. Eine umfassende Aufklärung nach den Vorgaben des Gendiagnostikgesetzes (GenDG) ist bei WGS kaum noch möglich. WGS wird derzeit daher vor allem in der Erforschung von seltenen Erkrankungen und in der Onkologie (Tumorgenome) eingesetzt (Klein HG et al, J Lab Med 38:221, 2014; Klein HG und Rost I, Bundesgesundheitsbl 58:113, 2015). Wie funktionieren NGS-Technologien? Bei der Illumina Sequencing-by-Synthesis (SBS)-Methode wird die fragmentierte Template DNA über spezifische Adaptoren kovalent an einen Glasobjektträger (FlowCell) gebunden, auf dem die Sequenzierreaktion stattfindet. Von dem gebundenen Startmolekül ausgehend werden durch einen PCR-ähnlichen Schritt Cluster aus identischen Molekülen gebildet (Bridge Amplification). Die Sequenzierung erfolgt zyklisch und nutzt reversible Terminatorchemie sowie fluoreszenzmarkierte Nukleotide. In jedem Zyklus wird genau ein Nukleotid komplementär zu der Template-DNA eingebaut. Ein besonderes Merkmal der SBS-Methode ist die sog. paired-end-sequenzierung. Hierbei werden die zu sequenzierenden DNA-Fragmente von jeder Seite mit einer vorher festgelegten Leseweite von bp sequenziert. Je nach Größe der DNA-Fragmente können diese Reads überlappen oder durch einen nicht-sequenzierten DNA-Teil (Insert) getrennt sein. Dieser Ansatz bietet Vorteile bei der bioinformatischen Auswertung und kann die Genauigkeit der Analysen signifikant erhöhen. Roche 454 Sequenziersysteme verwenden Emulsions-PCR (empcr) für die klonale Amplifikation der Proben, gefolgt von hoch-parallelem Pyrosequencing. Während der empcr wird die zu sequenzierende DNA an spezifische Beads gebunden und klonal amplifiziert. Die DNA tragenden Beads werden dann angereichert und in spezielle Reaktionskammern auf sog. Pico Titre Plates (PTP) befördert, welche alle für die Sequenzierung benötigten Reagenzien enthalten. Anschließend werden sequenziell Fluoreszenz-Desoxyribonucleotide (datp, dttp, dctp, dgtp) zugegeben. Bei Komplementarität zur Base des Templates erfolgt der Einbau des korrespondierenden Desoxy-Nukleotids und die Emission eines Lichtsignals. Sind in der zu sequenzierenden DNA mehrere aufeinanderfolgende, identische Nukleotide (Homopolymere) vorhanden, 12

13 werden mehrere gleiche Nukleotide nacheinander eingebaut und das korrespondierende Lichtsignal ist proportional stärker. Life Technologies Sequenziersysteme (z.b. Ion Torrent PGA oder Proton) basieren auf einer ph-vermittelten Sequenzierung und werden auch als Post-Light -Sequenzierung bezeichnet. Die Methode folgt einem Sequenzierung-durch-Synthese-Ansatz (SGS) insofern, dass ein DNA-Template durch sequentiellen Nukleotideinbau komplementiert wird. Die Methode zur Detektion der eingebauten Nukleotide unterscheidet sich allerdings substantiell von den vorher beschriebenen Methoden durch den Verzicht auf ein optisches Signal. Der Einbau eines Nukleotids involviert das Formen einer kovalenten Bindung unter Freisetzung eines Pyrophosphats und eines positiv geladenen Wasserstoffions. Der Einbau eines Nukleotids durch die DNA- Polymerase wird bei dem Ion Torrent-System durch eine Änderung des ph-wertes, ausgelöst von dem freigesetzten Wasserstoffion, detektiert. Die zu sequenzierende DNA wird in Mikroreaktionskammern auf einen Halbleiterchip gebracht. Diese Reaktionskammern enthalten die DNA-Polymerase, die verschiedenen Nuleotide werden sequentiell zugesetzt. Komplementäre Nukleotide werden von der Polymerase eingebaut und die freigesetzten Wasserstoffionen werden von einer ionensensitiven Schicht unter den Reaktionskammern detektiert. Wie bei der Roche 454 Technologie kann es zum Einbau von multiplen Nukleotiden in den Template-Strang kommen, falls eine Homopolymer-Region vorliegt. Auch hier ist das detektierte ph-signal proportional zur Anzahl der eingebauten Nukleotide. Die Sequenzierung eines Halbleiterchips dauert 2-4 Stunden, die Leseweite beträgt je nach eingesetztem Kit durchschnittlich 100, 200 oder 300 bp. Es werden verschiedene Chip-Größen angeboten, die einen flexiblen Durchsatz ermöglichen: bis 10 Mb mit dem 314 Chip, bis 100 Mb mit dem 316 Chip und bis zu 1 Gb mit dem 318 Chip. Bioinformatik - Management von Big Data Die Bioinformatik ist ein interdisziplinäres Feld der Naturwissenschaft, die Methoden für die computergestützte Analyse, Organisation und Speicherung von biologischen Daten entwickelt und implementiert. Ein wichtiges Aufgabenfeld der modernen Bioinformatik ist die Entwicklung von spezifischer Software für die Analyse und Extraktion von biologisch oder klinisch relevanten Daten aus großen Mengen an Rohdaten. Die Bioinformatik hat sich zu einem essentiellen Gebiet innerhalb der molekularen Biologie entwickelt und wird besonders in der Genetik und Genomik eingesetzt. Mithilfe von bioinformatischen Methoden und Software wird die Sequenzierung und Annotation von Genen und Genomen und die Identifikation der enthaltenen genetischen Varianten unterstützt. Auch die Auswertung von weiteren genomweiten Untersuchungen wie Array-CGH, Identifikation von Repeat-Regionen, die Suche nach speziellen Sequenzmustern (Promoterregionen, Transkriptionsfaktor- oder MikroRNA-Bindestellen) oder die Erstellung von Protein- Interaktionsnetzwerken wird mittels bioinformatischer Methoden und Algorithmen durchgeführt. Die Bioinformatik benutzt und integriert dabei Methoden aus der Informatik, Mathematik und (Bio-) Statistik. Die Auswertung und Speicherung von biologischen Daten kann Algorithmen aus den Feldern Data Mining, maschinelles Lernen, Datenbanktheorie und künstliche Intelligenz beinhalten. Häufig benutzte Programmiersprachen für die Implementierung von bioinformatischer Software sind zum Beispiel Java, Perl, Python, R, SQL oder MATLAB. Insbesondere bei der Auswertung von NGS-Daten kommt die Bioinformatik zum Einsatz. Einzelne Auswerteschritte werden hierbei zu einer Pipeline zusammengeführt, um eine Automatisierung der Datenanalyse zu erreichen. Die Rohdaten der Sequenzierung liegen im sogenannten.fastq-format vor, das alle Sequenzen und deren korrespondierende Qualitätswerte enthält. Als erstes werden die Reads den jeweiligen Patientenproben zugeordnet, die über einen eindeutigen Barcode identifiziert werden (Demultiplexing). Danach werden die Sequenzen der einzelnen Proben an das Humangenom (hg19) aligniert (Mapping). Mit diesem Mapping als Grundlage wird ein Variant Call durchgeführt, der alle Abweichungen der zu analysierenden Sequenzen von der Referenzsequenz in Form einer Tabelle ausgibt. Diese werden neben Exonnummerierung, cdna- und Aminosäureaustausch mit verschiedenen externen Ressourcen und Datenbanken wie HGMD, dbsnp, COSMIC, dbnsfp, PGX, sowie Daten aus großen, internationalen Sequenzierprojekten wie dem Exome Variant Server (EVS) und dem Exome Aggregation Consortium (ExAC), Online Mendelian Inheritance in Man (OMIM ) Informationen und experimentell verifizierten transcription factor-binding sites (TFBS) annotiert. Des Weiteren werden Bereiche, die nicht ausreichend für eine diagnostische Beurteilung abgedeckt sind detektiert (Coverage <20). Diese Bereiche können gegebenenfalls mittels Sanger- Sequenzierung nachanalysiert werden. 13

14 MIDAS (Multiple Integration of Data Annotation Study) Das MIDAS-Projekt setzt genetische Informationen strukturiert in einen Kontext zu Phänotyp-Merkmalen. Die Erfassung der Phänotypdaten erfolgt mittels der international verwendeten Human Phenotype Ontology (HPO), die Zuordnung der Genotypen über den MIDAS-Algorithmus. Zu beachten sind: - Diagnostischer Fokus (Indikationsgruppen, Gene mit Krankheitsassoziation), - Vollständigkeit der durchgeführten Analytik (Abdeckung, diagnostische Lücken), - Bewertung der detektierten genetischen Varianten (Klasse 1-5). Durch die Auswertung von Genotyp-Phänotyp-Korrelationen können Ähnlichkeiten in der Symptomatik verschiedener Krankheitsbilder erkannt und gezielt für die Auswertung und Befunderstellung verwendet werden. Das heißt neugewonnene Erkenntnisse bei der Datenerhebung und Analyse eines Patienten stehen dann auch direkt für andere Patienten zur Verfügung, die möglicherweise von der gleichen seltenen Erkrankung betroffen sind. Die Begutachtung der Analyseergebnisse großer Mengen genetischer Daten aus NGS-Analysen wird somit erleichtert, das Risiko für Fehlinterpretationen reduziert. Die MIDASDatenbank nützt Informationen von allen sequenzierten Proben in anonymisierter Form zur internen Qualitätskontrolle, der Detektion von potentiellen Artefakten der Sequenzierung und zur Bestimmung der Frequenz jeder Variante in dem hausinternen Patientenkollektiv. Die Datenbank ist über ein Webinterface abfragbar und erlaubt ein dynamisches Filtern der Daten während der Auswertung. M I D A S T U D Y Core Genes in der humangenetischen Diagnostik Core Genes oder Hauptgene beziehen sich auf ein oder mehrere klinische Kernsymptome und umfassen alle erforderlichen Gene, die obligatorisch bei der diagnostischen Abklärung einer Erkrankung oder Verdachtsdiagnose untersucht und beurteilt werden müssen. Alle Core Genes müssen zu 100% abgedeckt sein, d.h. sie dürfen keine diagnostischen Lücken (Gaps) aufweisen [s. auch Guidelines for diagnostic nextgeneration sequencing, EuroGenTest 2014, sog. Klasse A-Analysequalität, s. auch Rehm et al, Genet Med 15:733 (2013)]. Merkmale von Core Genes - Gene aus etablierter Standard-/Stufendiagnostik, für die prophylaktische oder therapeutische Konsequenzen bereits bekannt und/oder etabliert sind (z.b. Gene aus existierenden Leitlinien oder Empfehlungen von Fachgesellschaften), - Gene, die aufgrund von Literatur- und Datenbank-Recherchen als (sehr wahrscheinlich) krankheitsassoziiert eingestuft werden müssen, - Gene, deren Qualifikationskriterien regelmäßig überprüft werden. Einschlußkriterien für Core Genes - möglichst mehrfach beschrieben, auch in verschiedenen Familien, - wissenschaftlich belegte funktionelle Signifikanz im Zusammenhang mit der Erkrankung, - diagnostische Sensitivität >1% der klinisch gesicherten Fälle, - diagnostische Sensitivität 0,1-1% bei sehr seltenen Erkrankungen und bei therapeutischer Konsequenz. Ausschlußkriterien für Core Genes - isolierte Evidenz aus Assoziationsstudien, - genetische Varianten mit hoher Frequenz in der Normalbevölkerung in Abhängigkeit von der jeweiligen Erkrankung und dem Vererbungsmodus. 14

15 Variantenklassifikation Eine weitere wichtige Forderung der Fachgremien sind transparente und nachvollziehbare Regelungen, nach welchen Kriterien genetische Varianten beurteilt und eingeordnet werden. Hier hat sich in den vergangenen Jahren eine Klassifikation aus 5 Kategorien durchgesetzt, die jeder Anbieter entsprechend seines Leistungsspektrums definieren soll [Richards et al, Genet Med, 17:405 (2015) und Sukhai et al, Genet Med, 18:128 (2015)]. Klasse Bezeichnung Beschreibung 5 pathogene Mutation a) ln der Literatur bzw. in genspezifischen Mutations-Datenbanken als eindeutig pathogen beschriebene Mutationen b) nicht in der Literatur beschriebene Mutationen: - Nonsense- und Frameshift-Mutationen (Ausnahme Nonsense nahe Carboxyterminus) - Spleißmutationen in hochkonservierten Bereichen (+1+2/-1-2) - Deletionen (eines oder mehrerer Exons, außer in frame) - Sonstige als eindeutig pathogen beschriebene Varianten, deren Ursächlichkeit z.b. durch Segregations- bzw. Funktionsanalysen nachgewiesen wurde c) nicht beschriebene Missense-Varianten, deren Aminosäuresubstitution bei dieser Erkrankung ein sehr starkes Indiz für Ursächlichkeit darstellt (Glycin-Substitution im COL1A1-Gen bei Osteogenesis Imperfecta, Cystein- Substitution im FBN1-Gen...) 4 wahrscheinlich pathogene Variante 3 Variante unklarer Signifikanz 2 wahrscheinlich benigne Variante a) Spleißvarianten in mäßig konservierten Bereichen, bei denen in silico- Programme einen deutlichen Spleißdefekt vorhersagen (MaxEntScan >45% Reduktion) b) nicht beschriebene Varianten, die gemäß ACMG-Leitlinien als Klasse 4- Variante eingestuft werden können c) nicht beschriebene Missense-Varianten, die von mind. 3 in silico-programmen als pathogen bewertet werden und die mit einer Häufigkeit <0,01% (krankheitsabhängig) in der Normalbevölkerung auftreten und zusätzlich eine vergleichbare eindeutig pathogene Aminosäure-Substitution an derselben Position bekannt ist a) Varianten, die gemäß ACMG-Leitlinien als Klasse 3 eingestuft werden b) bekannte in der Literatur kontrovers diskutierte Varianten c) Varianten, die keiner anderen Klasse zugeordnet werden können a) Varianten, die gemäß ACMG-Leitlinien als Klasse 2 eingestuft werden b) Klasse 3- oder 4-Varianten, die nicht mit der Erkrankung kosegregieren c) Varianten, die gemeinsam mit einer Klasse 5-Mutation in trans auftreten (dominante Erkrankungen) 1 benigne Variante/ Polymorphismus a) Varianten, die in der Literatur oder den Datenbanken als solche(r) beschrieben sind b) Varianten mit einer im Verhältnis zur Prävalenz der Erkrankung zu hohen Frequenz in der Normalbevölkerung 15

16 Qualitätsmerkmale entsprechend EuroGenTest-Leitlinie Guidelines für den Einsatz von NGS in der Diagnostik Durch die Einführung von neuen Sequenziertechnologien werden auch neue Herausforderungen an bestehende Prozesse wie die Validierung von genetischen Untersuchungen gestellt. Bisherige Guidelines für die Test-Validierung [wie zum Beispiel Mattocks et al, (2010)] können nicht ohne Anpassungen übertragen werden. Es ist notwendig, Qualitätskriterien und Standards für diese Technologien neu zu definieren [Guidelines for diagnostic next generation sequencing, Matthijs et al, (2015), Eur J Hum Genet, accepted, Je nach angelegten Qualitätskriterien lassen sich NGS-basierte Tests in drei Gruppen einteilen: Typ A Test Diese Art von Test bietet die vollständigste Analyse die mit dem derzeitigen Stand der Technik durchführbar ist. Das bedeutet, dass alle Zielregionen entweder ausreichend mittels NGS-Reads abgedeckt sind (Coverage 20x). Ist eine Zielregion nicht ausreichend abgedeckt, werden alle Lücken mittels Sanger-Sequenzierung geschlossen. Bei einem Typ A Test werden alle Gene des Panels vollständig abgedeckt. Typ B Test Bei sehr großen MGPS-Analysen (>50 Gene) ist es oft nicht mehr möglich, für alle Gene eine lückenlose Abdeckung zu garantieren. Deswegen werden hier nur die jeweiligen Core-Gene vollständig abgedeckt. Nur für diese Gene werden eventuelle Lücken mittels Sanger-Sequenzierung geschlossen, Lücken in Nicht- Core Genen bleiben bestehen. Es handelt sich hierbei um Tests, die dafür bestimmt sind, Verdachtsdiagnosen zu bestätigen, nicht jedoch um Diagnosen ausschließen zu können. Typ C Test Typ C Tests verwenden ausschließlich NGS-Sequenzierdaten, eventuelle Lücken werden nicht mit Sanger- Sequenzierung geschlossen. Ein Beispiel hierfür wäre die Whole-Exome Sequenzierung bei Entwicklungsverzögerungen, bei der Hunderte von potenziell ursächlichen Genen bekannt sind. Aufgrund der Heterogenität dieser Erkrankungsgruppe ist es kaum möglich, Core Gene zu definieren. Die Einteilung in Typ A, B und C Tests bezieht sich ausschließlich auf Sequenziertechnologien. Je nach Erkrankung und Indikationsgruppe kann es nötig sein, einzelne oder mehrere Gene zusätzlich auf Mutationen, die mit Sequenziertechnologien nicht erkannt werden können, zu untersuchen. Hier müssen andere Analyseverfahren wie Multiplex Ligation-dependent Probe Amplification (MLPA) oder Blotting-Analysen eingesetzt werden. Zusatzbefunde Der Umgang mit Zusatzbefunden, das heißt die Identifikation von pathogenen Varianten einer nicht-angeforderten Indikation, muss klar geregelt sein. Diese Art von Zusatzbefunden tritt am häufigsten bei genomweiten Untersuchungen wie WES oder WGS auf, ist allerdings auch bei MGPS nicht vollständig ausgeschlossen. Der Umgang mit diesen Daten wird derzeit kontrovers diskutiert und reicht bis zu Empfehlungen des American College of Human Genetics, 56 Gene z.b. für Tumordispositions-Syndrome bei jedem Patienten aktiv zu begutachten [Berg et al, (2013), Christenhusz et al, (2013); McGuire et al, (2013), van El et al, (2013), ACMG, Green et al, (2013)]. Einigkeit besteht darüber, dass eine aktive und gründliche Aufklärung der Patienten erfolgen muss, und diese eine Wahlmöglichkeit besitzen müssen, ob Zusatzbefunde mitgeteilt werden sollen oder nicht. 16

17 Aufklärung und Genetische Beratung bei NGS (MGPS, CES, WES, WGS) Die Analyse zahlreicher oder aller Gene in einem Ansatz erfordert eine besondere bzw. erweiterte Aufklärung des Patienten im Vorfeld. Bei CES, WES und v.a. WGS ist eine umfassende Aufklärung, wie sie das GenDG vorsieht und die möglichst alle Eventualitäten einer Untersuchung erfasst, nicht mehr möglich. Umso wichtiger ist es, die im Folgenden genannten Punkte anzusprechen und eine genetische Beratung durchzuführen. Es muss auf die Möglichkeit von Zufalls- oder Zusatzbefunden aufmerksam gemacht werden und auf die Möglichkeit unklarer Befunde. Beispiel: MGPS bei der Fragestellung arrhythmogene Herzerkrankung. Es wird eine pathogene Mutation in einem Ionenkanalgen gefunden, die auch bereits im Zusammenhang mit Epilepsie beschrieben wurde. Das Resultat kann für die Beurteilung der Symptomatik (Synkope oder Krampfanfall), Diagnostik und Therapie des Patienten von Bedeutung sein. Es muss im Vorfeld besprochen werden, welcher Art solche Zusatzbefunde sein können, ob bestimmte Gene (z.b. für erbliche Tumordispositionssyndrome bei CES/WES) nicht untersucht werden (sollen), welche Zusatzbefunde mitgeteilt werden können oder sollen (s.a. Stellungnahme der GfH zu Zusatzbefunden, Newsletter/Archiv/gfh_newsletter_2013_01.htm). Unklare Befunde: bei der Analyse einer Vielzahl von Genen nimmt die Wahrscheinlichkeit, eine Vielzahl von Varianten nachzuweisen, zu. Darunter werden auch solche sein, die mit dem derzeitigen Kenntnisstand nicht eindeutig als krankheitsverursachend oder als nicht relevanter Polymorphismus einzuordnen sind. Der Patient sollte also darauf aufmerksam gemacht werden, dass die erweiterte Diagnostik nicht unbedingt gleichbedeutend mit einer sicheren Diagnose ist. CES und WES sollten außerdem im Rahmen einer genetischen Beratung und in enger Kooperation mit den betreuenden Ärzten erfolgen, um wichtige klinische Daten zu erfassen, den Untersuchungsmodus (z.b. Trioanalyse mit Erfassung von Varianten in Proben der Eltern, Erfassung des wahrscheinlichsten Vererbungsmodus) festzulegen und eine erweiterte Aufklärung (s.o.) vorzunehmen. Humangenetik 17

18 Multi-Gen-Panel-Sequenzierung (MGPS) 1. Augenerkrankungen Schematische Darstellung der phänotypischen und genetischen Heterogenität bei einigen Augenerkrankungen. 18

19 1.1 Bardet-Biedl-Syndrom (BBS) und Alström-Syndrom Dr. med. Sandra Wilson, Dipl.-Biol. Christina Sofeso Beim Bardet-Biedl-Syndrom (BBS) handelt es sich um eine Ziliopathie, bei der eine Retinitis Pigmentosa, Nierenfunktionsstörungen und eine Polydaktylie in Kombination mit Adipositas, einem Hypogonadismus und Verhaltensauffälligkeiten beobachtet werden. Es handelt sich überwiegend um autosomal-rezessiv erbliche genetische Ursachen, allerdings wurde beim Bardet-Biedl-Syndrom auch eine sogenannte triallelische Vererbung beschrieben. Es können mehr als zwei Mutationen in mehr als einem Genlokus ursächlich sein, so dass zu einer autosomal-rezessiven Vererbung zweier Mutationen in einem Gen noch eine weitere Mutation in einem anderen BBS-Gen als Modifikator zur klinischen Ausprägung der Erkrankung beitragen kann. Inzwischen wurden bereits 20 verschiedene BBS-Gene und weitere Modifikator-Gene beschrieben. In etwa 80% der klinisch diagnostizierten Fälle werden Mutationen in den bisher bekannnten BBS-Genen detektiert, wobei die Gene BBS1 und BBS10 bei Europäern am häufigsten betroffen sind (23 bzw. 20% der Fälle). Beim Alström-Syndrom handelt es sich um eine seltene Erkrankung, die phänotypische Ähnlichkeiten zum Bardet-Biedl-Syndrom zeigt und die durch autosomal-rezessive genetische Veränderungen im ALMS1-Gen verursacht wird. Zu den Symptomen des Alström-Syndroms gehören eine Retinitis Pigmentosa, eine Adipositas, Nieren- und Leberfunktionsstörungen, eine Insulin-Resistenz und Hyperinsulinämie sowie eine dilatative Kardiomyopathie. Literatur Schmidts, J Pediatr Genet 3:46 (2014) / Barker et al, Organogenesis 10:96 (2014) / Romani et al, Lancet Neurol 12:894 (2013) / Ronquillo et al, Vision Res 75:88 (2012) / Brugmann et al, Am J Med Genet A 152A:2995 (2010) Humangenetik Bardet-Biedl-Syndrom ARL6, BBIP1, BBS1, BBS10, BBS12, BBS2, BBS4, BBS5, BBS7, BBS9, IFT27, LZTFL1, MKKS, MKS1, TRIM32, TTC8 24,8 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ARL6, BBIP1, BBS1, BBS10, BBS12, BBS2, BBS4, BBS5, BBS7, BBS9, IFT27, LZTFL1, MKKS, MKS1, TRIM32, TTC8 ALMS1, CCDC28B, CEP290, IFT74, IFT172, NPHP1, SDCCAG8, TMEM67, WDPCP 80,1 kb 19

20 Erkrankungen, OMIM, ICD-10, Gene bei Bardet-Biedl-Syndrom Erkrankung OMIM-P ICD-10 Gen OMIM Gen Diag. Sensitivität Alström Syndrom Q87.8 ALMS Bardet-Biedl Syndrom Phänotyp - Q87.89 IFT Bardet-Biedl Syndrom Phänotyp - Q87.89 NPHP Bardet-Biedl Syndrom Typ Q87.89 BBS ~23,2 % Bardet-Biedl Syndrom Typ Q87.89 BBS ~8,1 % Bardet-Biedl Syndrom Typ Q87.89 ARL < 1 % Bardet-Biedl Syndrom Typ Q87.89 BBS ~2,3 % Bardet-Biedl Syndrom Typ Q87.89 BBS < 1 % Bardet-Biedl Syndrom Typ Q87.89 MKKS ~5,8 % Bardet-Biedl Syndrom Typ Q87.89 BBS ~1,5 % Bardet-Biedl Syndrom Typ Q87.89 TTC ~1,2 % Bardet-Biedl Syndrom Typ Q87.89 BBS ~6 % Bardet-Biedl Syndrom Typ Q87.89 BBS ~20 % Bardet-Biedl Syndrom Typ Q87.89 TRIM < 1 % Bardet-Biedl Syndrom Typ Q87.89 BBS ~5 % Bardet-Biedl Syndrom Typ Q87.89 MKS ~4,5 % Bardet-Biedl Syndrom Typ Q87.89 CEP < 1 % Bardet-Biedl Syndrom Typ Q87.89 WDPCP < 1 % Bardet-Biedl Syndrom Typ Q87.89 SDCCAG < 1 % Bardet-Biedl Syndrom Typ Q87.89 LZTFL < 1 % Bardet-Biedl Syndrom Typ Q87.89 BBIP < 1 % Bardet-Biedl Syndrom Typ Q87.89 IFT < 1 %?Bardet-Biedl Syndrom Typ Q87.89 IFT Bardet-Biedl Syndrom, Modifier of Q87.89 CCDC28B Bardet-Biedl Syndrom, Modifier of Q87.89 TMEM

21 1.2 Retinitis Pigmentosa Dr. rer. nat. Christoph Marschall Familiäre Retinopathien treten bei verschiedenen Erkrankungen mit überlappender Symptomatik auf wie Retinitis Pigmentosa (RP), Lebersche kongenitale Amaurose (LCA), Stargardt Erkrankung, Usher-Syndrom (USH), Bardet-Biedl-Syndrom (BBS) und Senior-Løken-Syndrom. Die Inzidenz der RP beträgt 1: , wobei die syndromalen Erkrankungen seltener sind. In den meisten Fällen ist nur die Retina klinisch betroffen. Die Symptomatik ist gekennzeichnet durch eine Nachtblindheit und ein langsam progredientes Nachlassen des zentralen Sehens ab ungefähr dem 20. Lebensjahr, das zunächst auf die Degeneration der Stäbchen-Photorezeptoren auf der Retina beschränkt ist. Später können auch noch die Zapfen betroffen sein. Es gibt allerdings auch syndromale Erkrankungen, bei denen die Dystrophie der Retina das erste Symptom ist und die sich im Frühstadium schlecht differenzieren lassen. Patienten mit Usher-Syndrom zeigen neben der RP auch noch einen Hörverlust. Sogar bei den reinen Retinopathien kann die Differenzialdiagnostik schwierig sein, da die Symptomatik oft überlappt und sich durch den meist progredienten Verlauf das volle Spektrum der Erkrankung erst nach Jahrzehnten zeigen kann. Zusätzlich ist intrafamiliäre Variabilität bekannt. Die Ursachen der RP sind sehr heterogen, da über 80 ursächliche Gene bekannt sind % der RP-Fälle werden autosomal-rezessiv, 15-25% autosomaldominant und 15% X-gekoppelt vererbt. Mutationen im USH2A-Gen verursachen 10-15% einer syndromalen Form der RP - das autosomal-rezessiv vererbte USH. Bei den autosomal-rezessiv vererbten Formen können in bis zu 85% Mutationen in den Genen RPGR inklusive ORF15 und RP2 nachgewiesen werden. Ungefähr 25% aller nicht syndromalen RP-Fälle lassen sich auf Mutationen im Rhodopsin-Gen (RHO) zurückführen, die einem autosomal-dominanten Erbgang folgen. Im NGS-Panel Augenerkrankungen können die Gene der verschiedenen Formen der RP parallel analysiert werden (Gen-Panel Diagnostik). Bei den autosomal-rezessiven Formen ist die diagnostische Sensitivität 20-30%, bei den autosomal-dominanten Formen 80-85% und bei den syndromalen Formen über 85%. Literatur Almoguera et al, PLoS One 10:e (2015) / Chiang et al, Expert Rev Mol Diagn 15:1269 (2015) / Daiger et al. Clin Genet 84:.doi /cge (2013) Humangenetik Retinitis Pigmentosa EYS, PRPF31, PRPH2, RHO, RP1, RP2, RPGR 24,0 kb Erkrankungen, OMIM, ICD-10, Gene bei Retinitis Pigmentosa Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Retinitis Pigmentosa H35.5 RP Retinitis Pigmentosa H35.5 RP Retinitis Pigmentosa H35.5 RPGR Retinitis Pigmentosa H35.5 RHO Retinitis Pigmentosa 7, digenisch H35.5 PRPH Retinitis Pigmentosa 7, digenisch H35.5 ROM Retinitis Pigmentosa H35.5 RP Retinitis Pigmentosa H35.5 IMPDH Retinitis Pigmentosa H35.5 PRPF Retinitis Pigmentosa H35.5 CRB Retinitis Pigmentosa H35.5 PRPF Retinitis Pigmentosa H35.5 TULP Retinitis Pigmentosa H35.5 CA Retinitis Pigmentosa H35.5 PRPF Retinitis Pigmentosa H35.5 ABCA

22 Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Retinitis Pigmentosa H35.5 RPE Retinitis Pigmentosa H35.5 OFD Retinitis Pigmentosa H35.5 EYS Retinitis Pigmentosa H35.5 CERKL Retinitis Pigmentosa H35.5 NRL Retinitis Pigmentosa H35.5 FAM161A Retinitis Pigmentosa H35.5 FSCN Retinitis Pigmentosa H35.5 TOPORS Retinitis Pigmentosa H35.5 SNRNP Retinitis Pigmentosa H35.5 SEMA4A Retinitis Pigmentosa H35.5 PRCD Retinitis Pigmentosa H35.5 NR2E Retinitis Pigmentosa H35.5 MERTK Retinitis Pigmentosa H35.5 USH2A Retinitis Pigmentosa H35.5 PDE6B Retinitis Pigmentosa H35.5 PROM Retinitis Pigmentosa H35.5 KLHL Retinitis Pigmentosa H35.5 PDE6A Retinitis Pigmentosa H35.5 RGR Retinitis Pigmentosa H35.5 CNGB Retinitis Pigmentosa H35.5 IDH3B Retinitis Pigmentosa H35.5 SAG Retinitis Pigmentosa H35.5 GUCA1B Retinitis Pigmentosa H35.5 CNGA Retinitis Pigmentosa H35.5 BEST Retinitis Pigmentosa H35.5 TTC Retinitis Pigmentosa H35.5 C2orf Retinitis Pigmentosa H35.5 ARL Retinitis Pigmentosa H35.5 IMPG Retinitis Pigmentosa H35.5 PDE6G Retinitis Pigmentosa H35.5 ZNF Retinitis Pigmentosa H35.5 DHDDS Retinitis Pigmentosa H35.5 PRPF Retinitis Pigmentosa H35.5 CLRN Retinitis Pigmentosa H35.5 MAK Retinitis Pigmentosa H35.5 C8orf Retinitis Pigmentosa H35.5 CDHR Retinitis Pigmentosa H35.5 RBP Retinitis Pigmentosa H35.5 NEK Retinitis Pigmentosa H35.5 SLC7A Retinitis Pigmentosa H35.5 KIZ Retinitis Pigmentosa H35.5 PRPF Retinitis Pigmentosa H35.5 IFT Retinitis Pigmentosa H35.5 ZNF Retinitis Pigmentosa, konzentrisch H35.5 BEST

23 1.3 Senior-Løken-Syndrom Dr. med. Sandra Wilson, Dipl.-Biol. Christina Sofeso Eine Nephronophthise in Kombination mit einer Retinitis Pigmentosa wird als Senior-Løken-Syndrom bezeichnet. Es handelt sich um eine autosomal-rezessiv vererbte Erkrankung. Diese Gruppe von Erkrankungen weist eine Genlocus-Heterogenität auf, es sind derzeit neun assoziierte Gene bekannt. Ähnlich der Nephronophthise wird das Senior-Løken-Syndrom zu den sogenannten Ziliopathien gezählt. Literatur Schmidts, J Pediatr Genet 3:46 (2014) / Barker et al, Organogenesis 10:96 (2014) / Romani et al, Lancet Neurol 12:894 (2013) / Ronquillo et al, Vision Res 75:88 (2012) / Brugmann et al, Am J Med Genet A 152A:2995 (2010) Senior-Løken-Syndrom CEP290, INVS, IQCB1, NPHP1, NPHP3, NPHP4, SDCCAG8 25,0 kb Erweiterte Diagnostik Humangenetik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CEP290, INVS, IQCB1, NPHP1, NPHP3, NPHP4, SDCCAG8 TRAF3IP1, WDR19 31,1 kb Erkrankungen, OMIM, ICD-10, Gene bei Senior-Løken-Syndrom Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Senior-Løken-Syndrom Typ Q61.5 NPHP1*,** Senior-Løken-Syndrom Typ 2 - Q61.5 INVS Senior-Løken-Syndrom Typ 3 - Q61.5 NPHP Senior-Løken-Syndrom Typ Q61.5 NPHP Senior-Løken-Syndrom Typ Q61.5 IQCB Senior-Løken-Syndrom Typ Q61.5 CEP Senior-Løken-Syndrom Typ Q61.5 SDCCAG Senior-Løken-Syndrom Typ Q61.5 WDR Senior-Løken-Syndrom Typ Q61.5 TRAF3IP * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 2.4 Stickler-Syndrom Dr. rer. nat. Christoph Marschall Das Stickler-Syndrom (STL) wird autosomal-dominant vererbt und zählt zu den Kollagen-Typ-II-Erkrankungen. Bisher sind über 300 Fälle beschrieben, die Inzidenz wird auf ca. 1: geschätzt. Charakteristisch für das Stickler-Syndrom sind insbesondere Mittelgesichtshypoplasie (bis zu 100% der Fälle), schwere Sehstörungen durch Myopie (>90%) z.t. bereits bei Neugeborenen, Katarakt und Netzhautablösung (60% der Fälle) bereits im ersten Lebensjahrzehnt, Gaumenspalte (41%), Pierre-Robin-Sequenz (23%) sowie Gelenkbeschwerden. Darüber hinaus besteht eine Disposition für Mitralklappenprolaps (40-50% der Fälle) und Schwerhörigkeit (10-50% der Fälle). 23

24 Die häufigste Form des Stickler-Syndroms ist der Typ 1, der auf Mutationen im COL2A1-Gen zurückzuführen ist. Durchschnittlich können in 75% der STL-Fälle Mutationen im COL2A1-Gen nachgewiesen werden. Bei Patienten mit charakteristischen membranösen Veränderungen des Glaskörpers, die in ca. 60% der Fälle mittels Spaltlampe identifiziert werden können, beträgt die Sensitivität der COL2A1-Sequenzierung ca. 94%. Deletionen in der Größe einzelner Exons bis zum gesamten Gen, sind in maximal 1% der STL1-Fälle ursächlich (Hoornaert et al 2010, Eur J Hum Genet 18:872). Wesentlich seltener sind Stickler-Syndrom Typ 2 und Typ 3, die mit Mutationen im COL11A1- bzw. COL11A2-Gen verbunden sind. Das STL2, das ungefähr 6% aller STL-Fälle ausmacht, unterscheidet sich klinisch kaum vom STL1. Allerdings zeigen sich beim STL2 perlenschnurartige Veränderungen am Glaskörper. Die Abgrenzung des STL2 vom Marshall-Syndrom, das unter anderem durch die früh beginnende Schwerhörigkeit und betontere faziale Merkmale gekennzeichnet ist und ebenfalls auf Mutationen im COL11A1-Gen beruht, ist z.t. schwierig. Beim sehr seltenen Stickler- Syndrom Typ 3 sind das Fehlen der Augensymptomatik und Mutationen im COL11A2-Gen charakteristisch. Literatur Acke et al, Mol Genet Metab 113:230 (2014) / Vijzelaar et al, BMC Med Gen 14:48 (2013) / Hoornaert et al, Eur J Hum Genet 18:872 (2010) / Richards et al, Hum Mutat 31:E1461 (2010) / Zechi-Ceide et al, Eur J Med Genet. 51:183 (2008) / Majava et al, Am J Hum Genet A 143A:258 (2007) / Richards et al, Hum Mutat 27:696 (2006) / Nishimura et al, Hum Mutat 26:36 (2005) / Stickler et al, Genet Med 3:19 (2001) / Richards et al, Br J Ophthalmol 84:364 (2000) / Freddi et al, Am J Med Genet 28:398 (2000) / Ballo et al, Am J Med Genet 80:6 (1998) / Korkko et al, Am J Hum Genet 53:55 (1993) # Stickler-Syndrom (Augenerkrankung) COL11A1, COL2A1, COL9A1, COL9A2 15,5 kb Erkrankungen, OMIM, ICD-10, Gene bei Stickler-Syndrom (Augenerkrankung) Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Stickler-Syndrom Typ Q87.8 COL2A Stickler-Syndrom Typ Q87.8 COL11A Stickler-Syndrom Typ Q87.8 COL9A Stickler-Syndrom Typ Q87.8 COL9A Core Genes sind fett gedruckt 1.5 Usher-Syndrom Dr. rer. biol. hum. S. Chahrokh-Zadeh Das Usher Syndrom (USH), eine Gruppe von klinisch und genetisch heterogenen, autosomal-rezessiven Erkrankungen mit bilateralem sensorineuralem Hörverlust, z.t. auch vestibulärer Dysfunktion und gradueller retinaler Degeneration, Retinitis Pigmentosa (RP) ist die Hauptursache (>50%) für Taub-Blindheit. Die Prävalenz wird auf 1:6.000 geschätzt. Drei Haupt-Subtypen, USH1, USH2 und USH3 werden vor allem durch Schwere und Progression der Schwerhörigkeit und Präsenz der vestibulären Mitbeteiligung unterschieden. Bisher sind 12 Gene und ein sog. Modifier-Gen (PDZD7) identifiziert. Der am häufigsten auftretende Subtyp betrifft USH2 (moderater bis schwerer Hörverlust, eher postpubertäre RP und normale vestibuläre Funktion). Die meisten Mutationen sind im USH2A-Gen (USH2A; 57%- 79%) nachweisbar. USH1 macht 30-40% aller USH-Typen aus und stellt die schwerste Form mit hochgradiger kongenitaler Schwerhörigkeit, präpubertärer Beeinträchtigung der Sehkraft (RP) und oft vestibulärer Dysfunktion dar. Bei Patienten mit Usher Syndrom Typ 1 wird oft zunächst ausschließlich die Schwerhörigkeit diagnostiziert, bis die Gesichtsfeldbeeinträchtigung (sog. Tunnelblick) und Nachtblindheit (erste Anzeichen einer RP) so weit fortgeschritten sind, dass sie ebenfalls auffallen. Eine frühe Diagnosestellung ist jedoch wichtig für eine angemessene Beschulung und Förderung im Kindesalter. Die Klassifikation der einzelnen Subtypen aufgrund klinischer Daten ist nur unzureichend, da die phänotypische Variabilität, selbst bei Vorliegen identischer Mutationen, sehr hoch sein kann. Neun Loci und sechs Gene sind bisher bekannt: MYO7A (USH1B; 53%-63% aller USH1), USH1C (USH1C; 1%-15%), CDH23 (USH1D; 7%-20%), PCDH15 (USH1F; 7%-12%), USH1G (USH1G) und CIB2 (USH1J). 24

25 Mutationen in den oben aufgeführten Genen sind auch bei Patienten mit autosomal-rezessiver nicht-syndromaler, kongenitaler oder prälingualer Schwerhörigkeit, z.b. MYO7A bei DFNB2, CDH23 bei DFNB12, PCDH15 bei DFNB23 beschrieben. Auch digenische Vererbung, mit jeweils einer Mutation in einem der betroffenen Gene, z.b. CDH23 und PCDH15, sind bekannt. Autosomal-rezessive nicht-syndromale, kongenitale oder prälinguale Schwerhörigkeit ist genetisch heterogen, mit bis dato bis zu 50 bekannten Genen und ca. 25 Loci. Literatur Erweiterte Diagnostik Krawitz Usher-Syndrom et al, Mol Genet&Genomic Typ 1 Med 2:393 (2014) / Rong et al, PLOS ONE 9: e97808 (2014) / García-García et al, Mol Vis 19:367 EBM Kap (2013) , / Kimberling GOP et al Genet und Med. 12: 512 (2010) / Ebermann et al, J Clin Invest 120:1812 (2010) CDH23, MYO7A, PCDH15, USH1G 24,0 kb Usher-Syndrom Typ 1 und Typ2 MYO7A, USH2A 22,3 kb Humangenetik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CDH23, MYO7A, PCDH15, USH1G MYO7A, USH2A TRAF3IP1, WDR19 116,1 kb Erkrankungen, OMIM, ICD-10, Gene bei Usher-Syndrom Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Usher-Syndrom Typ 1B H91.9 MYO7A* Usher-Syndrom Typ 1C H91.9 USH1C Usher-Syndrom Typ 1D (auch DFNB12. s. autosomal-rezessive H91.9 CDH23* Formen auch digenetische Vererbung mit PCDH15-Gen, s ) Usher-Syndrom Typ 1F H91.9 PCDH15*,** Usher-Syndrom Typ 1G H91.9 USH1G Usher-Syndrom Typ 2A H91.9 USH2A*,** Usher-Syndrom Typ 2C H91.9 ADGRV Usher-Syndrom Typ 2C H91.9 PDZD Usher-Syndrom Typ 2D H91.9 DFNB Usher-Syndrom Typ 3A H91.9 CLRN Usher-Syndrom Typ 3B H91.9 HARS Usher-Syndrom Typ IJ (auch DFNB48 s. autosomal-rezessive Formen) H91.9 CIB * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 25

26 2. Bindegewebs-/Aortenerkrankungen Dr. rer. nat. Karin Mayer Der gemeinsame molekularpathologische Nenner von primären Aortenerkrankungen (Aortopathien) und Bindegewebserkrankungen mit Aortenbeteiligung sind angeborene, genetisch bedingte Störungen a) der extrazellulären Matrix-Proteine, b) des TGF-beta-Signaltransduktionswegs oder c) der Strukturproteine der glatten Gefäßmuskulatur. Während Störungen unter a) und b) zu einer Schwächung der bindegewebigen Textur der Gefäßadventitia führen, sind Fehlfunktionen unter c) mit Funktionsverlusten des kontraktilen Apparats verbunden. Beides ist mit Einschränkungen der Windkesselfunktion der Aorta und einem erhöhten Risiko für Aneurysmen bzw. Aneurysma-Rupturen im arteriellen System verbunden. Gravierende, lebensbedrohliche Komplikationen reichen von Rupturen der Aorta ascendens bis hin zur Mesenterialarterien- Ruptur (z.b. in der Schwangerschaft). Seit der Identifikation der genetischen Ursache bei Marfan-Syndrom durch Identifizierung des Fibrillin 1- Gens (FBN1) wurden zahlreiche klinisch mehr oder weniger abgrenzbare Differenzialdiagnosen beschrieben und genetisch charakterisiert. Aortenerkrankungen sind ein Paradebeispiel für genetische und phänotypische Heterogenität und sind durch Pleiotropie gekennzeichnet. Schematische Darstellung der phänotypischen und genetischen Heterogenität bei Aortopathien. Core Genes (entsprechend der Clinical utility gene card für TAAD) sind fett dargestellt. 26

27 2.1 Bikuspide Aortenklappe, mit Risiko für Aortenstenose/-dilatation Biskuspide Aortenklappe, mit Risiko für Aortenstenose/-dilatation GATA5, NOTCH1, SMAD6 10,3 kb Erkrankungen, OMIM, ICD-10, Gene bei biskuspider Aortenklappe, mit Risiko für Aortenstenose/-dilatation Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Bikuspide Aortenklappe 1 (AOVD1) Q23.1 NOTCH1* Bikuspide Aortenklappe 2 (AOVD2) Q23.1 SMAD Bikuspide Aortenklappe - Q21.0 GATA * auch einzeln anforderbar Core Genes sind fett gedruckt Humangenetik 2.2 Cutis laxa (CL) Dr. rer. nat. Karin Mayer Cutis laxa ist eine seltene, genetisch heterogene, generalisierte Erkrankung des Bindegewebes, die durch lockere, faltige Haut charakterisiert ist. Im Gegensatz zur hyperelastischen Haut erscheint die Haut überschüssig und unelastisch. Zusätzlich sind Skelett- und Entwicklungsanomalien und bei einigen Fällen schwere systemische Beteiligung beschrieben. Sowohl die autosomal-dominanten, häufig mild verlaufenden Formen ADCL1, ADCL2 und ADCL3 als auch die schwer verlaufenden autosomal-rezessiven Formen ARCL1A, ARCL1B, ARCL1C, ARCL2A, ARCL2B, ARCL3A und ARCL3B sind genetisch heterogen und klinisch schwer voneinander abgrenzbar. Cutis laxa ALDH18A1, ATP6V0A2, EFEMP2, ELN, FBLN5, LTBP4, PYCR1 15,6 kb Erkrankungen, OMIM, ICD-10, Gene bei Cutis Laxa Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Cutis laxa, autosomal-dominant (ADCL1) Q82.8 ELN Cutis laxa, autosomal-dominant (ADCL2) Q82.8 FBLN Cutis laxa, autosomal-dominant (ADCL3) Q82.8 ALDH18A Cutis laxa, autosomal rezessiv, Typ 1A (ARCL1A) Q82.8 FBLN Cutis laxa, autosomal rezessiv, Typ 1B (ARCL1B) Q82.8 EFEMP2* Cutis laxa, autosomal rezessiv, Typ 1C (ARCL1C) Q82.8 LTBP Cutis laxa, autosomal rezessiv, Typ 2A (ARCL2A) Q82.8 ATP6V0A Cutis laxa, autosomal rezessiv, Typ 2B (ARCL2B)); Q82.8 PYCR Cutis laxa mit Progerie Cutis laxa, autosomal rezessiv, Typ 3A (ARCL3A); Q82.8 ALDH18A de Barsy Syndrom A Cutis laxa, autosomal rezessiv, Typ 3B (ARCL3B); Q82.8 PYCR de Barsy Syndrom B Wrinkly skin-syndrom (WSS) Q82.8 ATP6V0A * auch einzeln anforderbar 27

28 2.3 Ehlers-Danlos-Syndrom (EDS) Subtypen, allelische Erkrankungen, Differenzialdiagnosen Dr. rer. nat. Karin Mayer Unter Ehlers-Danlos-Syndrom (EDS) wird eine klinisch und genetisch heterogene Gruppe von seltenen Erkrankungen des Bindegewebes zusammengefasst, die durch Hyperelastizität der Haut, Gewebebrüchigkeit, Überstreckbarkeit der Gelenke und eine unterschiedliche Beteiligung von Skelett-, Kardiovaskular-, und Gastrointestinalsystem sowie Lunge und Augen charakterisiert sind. Auf der Grundlage von klinischen, biochemischen und molekulargenetischen Daten sowie dem Vererbungsmodus (autosomal-dominant, -rezessiv oder X-chromosomal) kann EDS in 13 Subtypen differenziert werden. Nach der vereinfachten Villefranche- Klassifikation werden diese in sechs Haupttypen unterteilt, wobei hier Mutationen in Genen für fibrilläre Kollagene oder Enzyme des Kollagenstoffwechsels vorliegen. Während der letzten Jahre wurden zusehends neue EDS-Varianten molekulargenetisch und biochemisch identifiziert und charakterisiert, was zu einem erweiterten Verständnis der Pathogenese bei EDS geführt hat, die über den Aufbau und den Stoffwechsel von Kollagenen und der extrazellulären Matrix hinausgeht. Da die klinische Abgrenzung der einzelnen EDS-Subtypen oft schwierig ist und Überlappungen mit anderen Bindegewebserkrankungen wie z.b. Cutis laxa bestehen können, kann eine genetische Diagnostik unter Einsatz von NGS die Einordnung erleichtern. Literatur Van Damme et al, Expert Opin Orphan Drugs 3:379 (2015) / Malfait and de Paepe, Adv Exp Med Biol 802:129 (2014) / Mayer in els 2012, John Wiley & Sons Ltd: Chichester (November 2012) [DOI: / a ] (2012) / de Paepe and Malfait, Clin Genet 82:1 (2012) / Beighton et al, Am J Med Genet 77:31 (1998) Schematische Darstellung der genetischen Heterogenität bei EDS. Subpanels sind farblich voneinander abgegrenzt, 28

29 EDS und Differenzialdiagnosen Individuell konfigurierbare MGPS Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ADAMTS2 (3.6 kb) * ALDH18A1 (2.4 kb) * ATP6V0A2 (2.6 kb) * ATP6V1A (1.9 kb) * ATP6V1E1 (0.7 kb) * B3GALT6 (1.0 kb) * B4GALT7 (1.0 kb) * C1R (1.9 kb) * C1S (2.1 kb) * CHST14 (1.1 kb) * COL1A1 (4.4 kb) * COL1A2 (4.1 kb) * COL3A1 (4.4 kb) * COL5A1 (5.5 kb) * COL5A2 (4.5 kb) * COL6A1 (3.1 kb) * COL6A2 (3.1 kb) * COL6A3 (9.5 kb) * DSE (2.9 kb) * EFEMP2 (1.3 kb) * ELN (2.2 kb) * EMILIN1 (3.0 kb) * FBLN5 (1.3 kb) * FKBP14 (0.6 kb) * FLNA (7.9 kb) * LTBP4 (4.9 kb) * PHYKPL (1.4 kb) * PLOD1 (2.2 kb) * PLOD3 (2.2 kb) * PRDM5 (1.9 kb) * PYCR1 (0.9 kb) * SLC2A10 (1.6 kb) * SLC39A13 (1.1 kb) * TNXB (12.7 kb) * ZNF469 (11.8 kb) Humangenetik EDS, autosomal-dominante Subtypen Ehlers-Danlos-Syndrom, vaskulärer Typ (veds) EBM Kap , GOP und Mutationssuche, Deletions-/Duplikationsdiagnostik COL3A1 Ehlers-Danlos-Syndrom, klassischer Typ (ceds) COL1A1, COL5A1, COL5A2 Kapitel ,4 kb Ehlers-Danlos-Syndrom, Arthrochalasis Typ (aeds) COL1A1, COL1A2 8,5 kb 29

30 Erkrankungen, OMIM, ICD-10, Gene bei EDS, autosomal-dominante Formen Erkrankung OMIM-P ICD-10 Gen OMIM-Gen EDS, Arthrochalasis Typ (aeds) Q79.6 COL1A1*, ** EDS, Arthrochalasis Typ (aeds) Q79.6 COL1A2*, ** EDS, klassischer Typ (ceds) Q79.6 COL1A1*, ** EDS, klassischer Typ (ceds) Q79.6 COL5A1*, ** EDS, klassischer Typ (ceds) Q79.6 COL5A2* EDS, vaskulärer Typ (veds) Q79.6 COL3A1*, ** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt EDS, autosomal-rezessive Subtypen Ehlers-Danlos-Syndrom, autosomal-rezessive Subtypen ADAMTS2, EDS, B3GALT6, autosomal-rezessive B4GALT7, CHST14, Subtypen COL1A2, DSE, FKBP14, PLOD1, SLC39A13 Ehlers-Danlos-Syndrom mit Tenascin-X-Defizienz, classic like (cleds) TNXB 17,6 kb 12,7 kb Erkrankungen, OMIM, ICD-10, Gene bei EDS, autosomal-rezessiv Erkrankung OMIM-P ICD-10 Gen OMIM-Gen EDS, kyphoskoliotischer Type (keds) Q79.6 FKBP14* EDS, kyphoskoliotischer Type (keds) Q79.6 PLOD1*, ** EDS mit Tenascin-X-Defizienz, classic like (cleds) Q79.6 TNXB*, ** EDS, Dermatosparaxis Typ (deds) Q79.6 ADAMTS2* EDS, muskulokontraktureller Typ 1 (mceds) Q79.6 CHST14* EDS, muskulokontraktureller Typ 2 (mceds) Q79.6 DSE EDS, mit Herzklappenbeteiligung (cveds) Q79.6 COL1A2*, ** EDS, Spondylodysplastische Form (speds-b3galt6) Q79.6 B3GALT6* EDS, Spondylodysplastische Form (speds-b4galt7) Q79.6 B4GALT7* EDS, Spondylodysplastische Form (speds-slc39a13) Q79.6 SLC39A * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 30

31 2.3.3 EDS, seltene Subtypen, Differenzialdiagnosen Ehlers-Danlos-Syndrom, seltene Subtypen, Differenzialdiagnosen C1R, C1S, FLNA, PRDM5, ZNF469 25,0 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. Humangenetik C1R, C1S, COL6A1, COL6A2, COL6A3, EMILIN1, FLNA, PHYKPL, PLOD3, PRDM5, SLC2A10, ZNF469 43,7 kb Erkrankungen, OMIM, ICD-10, Gene bei EDS, seltene Subtypen und Differenzialdiagnosen Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Arterial Tortuosity Syndrom (ATS) I73.8 SLC2A10* Bindegewebserkrankung (autosomal dominant) - - EMILIN Brittle Cornea Syndrom 1 (BCS 1) Q79.6 ZNF Brittle Cornea Syndrom 2 (BCS 2) Q79.6 PRDM EDS, Peridontaler Typ Q79.6 C1R EDS, Peridontaler Typ Q79.6 C1S Lysylhydroxylase-3-Defizienz; Knochenbrüchigkeit mit Arterienruptur PLOD und Taubheit Muskeldystrophie, kongenitale, Typ Ullrich (UCMD1) G71.2 COL6A Muskeldystrophie, kongenitale, Typ Ullrich (UCMD1) G71.2 COL6A Muskeldystrophie, kongenitale, Typ Ullrich (UCMD1) G71.2 COL6A Phosphohydroxylysylurie PHYKPL EDS, Variante mit periventrikulärer Heterotopie (PVNH4) Q79.6- FLNA* * auch einzeln anforderbar 2.4 Kollagen 4-assozierte intrazerebrale Blutungen Kollagen 4-assozierte intrazerebrale Blutungen COL4A1, COL4A2 10,1 kb Erkrankungen, OMIM, ICD-10, Gene bei Kollagen 4-assozierten intrazerebralen Blutungen Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Zerebrale Mikroangiopathie mit Hämorrhagie, vermehrte I67.3 COL4A1* Schlängelung der Netzhautarterien; Porenzephalie 1 Zerebrale Hämorrhagie; Porenzephalie Q04.6 COL4A * auch einzeln anforderbar 31

32 2.5 Loeys-Dietz-Syndrom (LDS) Loeys-Dietz-Syndrom EBM Kapitel , Ziffer und Mutationssuche, Deletions-/Duplikationsanalyse SMAD3, TGFB2, TGFB3, TGFBR1, TGFBR2 Kapitel Erkrankungen, OMIM, ICD-10, Gene bei Loeys-Dietz-Syndrom Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Loeys-Dietz-Syndrom Typ 1 (LDS1) Q87.4 TGFBR1 *,** Loeys-Dietz-Syndrom Typ 2 (LDS2) Q87.4 TGFBR2 *,** Loeys-Dietz-Syndrom Typ 3 (LDS3) Q87.4 SMAD3 * Loeys-Dietz-Syndrom Typ 4 (LDS4) Q87.4 TGFB2 * Loeys-Dietz-Syndrom Typ 5 (LDS5) Q87.4 TGFB * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 2.6 Marfan-Syndrom, Typ 1 Fibrillinopathien Dr. rer. nat. Karin Mayer Die häufigste Bindegewebserkrankung ist das klassische Marfan-Syndrom (MFS), das durch Mutationen in Fibrillin-1 bedingt ist. Bei den klinischen Symptomen stehen die Beteiligung von Herz- und Gefäßsystem, Skelett und die Augen (Linsenluxation) im Vordergrund. Anhand der revidierten Ghenter Nosologie von 2010 kann bei Vorliegen einer isolierten Aortenwurzeldilatation bzw. -dissektion oder einer isolierten Linsenluxation mit dem Nachweis einer Mutation im FBN1-Gen die Diagnose MFS gesichert werden, wenn diese im Zusammenhang mit einer Aortenwurzelerweiterung beschrieben ist. Dagegen führt eine Linsenluxation mit dem Nachweis einer heterozygoten FBN1-Mutation, die nicht mit Aortenwurzeldilatation assoziiert ist, zur Diagnose eines Ektopia Lentis-Syndroms (ECTOL1). FBN1-Mutationen sind bei Patienten mit klassischem Marfan-Syndrom beschrieben, aber auch bei den alternativen Diagnosen MASS-Phänotyp (Myopie, Mitralklappenprolaps, grenzwertige Aortenwurzeldilatation, Striae und Skelettbeteiligung) und Mitralklappenprolaps-Syndrom (MVPS). Andere Typ 1-Fibrillinopathien sind: - die akromikrische Dysplasie, die durch Kleinwuchs, kurze Hände und Füße, leichte faziale Dysmorphien und charakteristische Röntgenbefunde an den Händen charakterisiert ist, - die autosomal-dominante Geleophysische Dysplasie, eine seltene Skelettdysplasie gekennzeichnet durch Kleinwuchs, prominente Fehlbildungen der Hände und Füße und ein charakteristisches Gesicht, - das Stiff-Skin-Syndrom, das durch harte, dicke Haut am gesamten Körper charakterisiert ist, wodurch die Beweglichkeit der Gelenke eingeschränkt wird und Gelenkkontrakturen die Folge sind, - das autosomal-dominant vererbte Weill-Marchesani-Syndrom, gekennzeichnet durch Minderwuchs, Brachydaktylie, Gelenkversteifung und charakteristischen Augenanomalien (Mikrosphaerophakie, Linsenektopie, schwere Myopie, Glaukom). Literatur Loeys et al, J Med Genet 47:476 (2010) Marfan-Syndrom und Typ 1-Fibrillinopathien EBM Kap , GOP und Mutationssuche, Deletions-/Duplikationsdiagnostik obligat: FBN1 fakultativ: TGFBR1, TGFBR2 Kapitel

33 Erkrankungen, OMIM, ICD-10, Gene bei Marfan-Syndrom, Typ 1-Fibrillinopathien, LDS Typ 1,2 Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Akromikrische Dysplasie (ACMICD) Q77.8 FBN1 *,** Ektopia lentis, familiär, isoliert (ECTOL1) Q12.1 FBN1 *,** Geleophysische Dysplasie (GPHYSD2) Q87.4 FBN1 *,** Marfan-Syndrom (MFS) Q87.4 FBN1 *,** MASS-Syndrom (MASS) Q87.4 FBN1 *,** Stiff-Skin-Syndrom (SSKS) FBN1 *,** Weill-Marchesani-Syndrom (WMS2) Q87.4 FBN1 *,** Loeys-Dietz-Syndrom Typ 1 (LDS1) Q87.4 TGFBR1 *,** Loeys-Dietz-Syndrom Typ 2 (LDS2) Q87.4 TGFBR2 *,** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Humangenetik 2.7 Marfan-ähnliche Erkrankungen Dr. rer. nat. Karin Mayer Während heterozygote FBN1-Mutationen die Ursache des autosomal-dominant vererbten Ektopia Lentis- Syndroms (ECTOL1) sind, führen Mutationen im ADAMTS4-Gen zur autosomal-rezessiv vererbten isolierten Linsenluxation (ECTOL2). Differenzialdiagnostisch zum klassischen Marfan-Syndrom (MFS) ist aufgrund der phänotypischen Überlappungen der kraniofazialen, kardiovaskulären, Skelett- und Hautmanifestationen das Shprintzen-Goldberg-Syndrom (SGS) zu nennen, wobei mentale Retardierung und Hypotonie der Skelettmuskulatur zusätzlich vorkommen. SGS ist hauptsächlich durch Mutationen im SKI-Gen bedingt. Die kongenitale kontrakturelle Arachnodaktylie (CCA) ist durch einen marfanoiden Habitus, Spinnenfingrigkeit, Gelenkkontrakturen, Kyphoskoliose, Muskelhypotonie, Ohrmuscheldysplasien und Aortenwurzelerweiterung gekennzeichnet. CCA ist durch Mutationen im FBN2-Gen bedingt. Das Lujan-Fryns-Syndrom, das auch als X-chromosomale geistige Retardierung (XLMR) mit marfanoidem Habitus bezeichnet wird, weist mit marfanoidem Habitus, kraniofazialen Merkmalen, generalisierter Muskelhypotonie und Verhaltensproblemen sowohl Überlappungen mit MFS als auch mit SGS auf. Die Vererbung ist X-chromosomal-rezessiv mit Mutationen in den Genen MED12, UPF3B und ZDHHC9. Literatur Ahram et al, Am J Hum Genet 84:274 (2009) / Doyle et al, Nature Genet 44:1249 (2012) / Schwartz et al, J Med Genet 44: 472 (2007) Marfan-ähnliche Erkrankungen ADAMTSL4, FBN2, SKI, MEDF12, UPF3B, ZDHHC9 23,3 kb Erkrankungen, OMIM, ICD-10, Gene bei MFS-ähnlichen Erkrankungen Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Ektopia lentis, isoliert (ECTOL2) Q12.1 ADAMTSL4 * Kongenitale kontrakturelle Arachnodaktylie Q12.1 FBN2 * Lujan-Fryns-Syndrom Q87.8 MED Shprintzen-Goldberg-Kraniosynostose-Syndrom (SGS) Q87.8 SKI XLMR mit marfanoidem Habitus Q87.8 UPF3B XLMR mit marfanoidem Habitus Q87.8 ZDHHC * auch einzeln anforderbar 33

34 2.8 Thorakale Aortenerkrankungen Dr. rer. nat. Karin Mayer Thorakale Aortenaneurysmen und Dissektionen (TAAD), welche die Aorta ascendens unmittelbar hinter der Aortenklappe (Typ A-Dissektion) oder die Aorta descendens im Bereich der linken Arteria subclavia distal des Aortenbogens (Typ B-Dissektion) betreffen, können in Verbindung mit einem genetisch bedingten Syndrom oder isoliert vorkommen. Etwa 10-20% sind autosomal-dominant vererbt, mit reduzierter Penetranz und variabler Expressivität. TAAD sind sowohl klinisch als auch genetisch heterogen. Zu den syndromalen Aortenerkrankungen zählen: - Marfan-Syndrom (MFS; FBN1-Gen) - Loeys-Dietz-Syndrom Typ 1 (LDS1,TGFBR1-Gen) - Loeys-Dietz-Syndrom Typ 2 (LDS2; TGFBR2-Gen) - Loeys-Dietz-Syndrom Typ 3 (LDS3; SMAD3-Gen) - Loeys-Dietz-Syndrom Typ 4 (LDS4; TGFB2-Gen) - Loeys-Dietz-Syndrom Typ 5 (LDS5; TGFB3-Gen) - vaskuläres Ehlers-Danlos-Syndrom (veds; COL3A1-Gen) - Ehlers-Danlos-Syndrom mit periventrikulärer Heterotopie (EDS, PVNH4; FLNA-Gen) - klassisches Ehlers-Danlos-Syndrom (ceds; COL5A1-Gen, COL5A2-Gen, COL1A1-Gen) - Ehlers-Danlos-Syndrom kyphoskoliotischer Typ (keds; PLOD1-Gen) - Meester-Loeys-Syndrom (BGN-Gen) Für isolierte familiäre TAAD (siehe Kap ) wurden in Kopplungsanalysen bisher 11 Genorte lokalisiert und neun Gene identifiziert: - AAT3 auf Chromosom 3p24-25 (TGFBR2-Gen) - AAT4 auf Chromosom 16p13.13-p13.12 (MYH11-Gen) - AAT5 auf Chromosom 9q33-q34 (TGFBR1-Gen) - AAT6 auf Chromosom 10q22-24 (ACTA2-Gen) - AAT7 auf Chromosom 3q21 (MYLK-Gen) - AAT8 auf Chromosom 10q11.2-q21.1 (PRKG1-Gen) - AAT9 auf Chromosom 12p13.31 (MFAP5-Gen) - AAT10 auf Chromosom 5q23.1 (LOX-Gen) - AAT11 auf Chromosom 1p33 (FOXE3-Gen) Für AAT1 auf Chromosom 11q23-24 und AAT2 auf Chromosom 5q13-14 wurde bisher kein Gen identifiziert. Weitere Gene mit Mutationen bei TAAD sind MAT2A und SMAD2, sowie GATA5, LOX, NOTCH1 und SMAD6, wobei Veränderungen in den drei letztgenannten Ursachen für eine bikuspide Aortenklappe darstellen. Seltene Syndrome (siehe Kap ) mit Risiko für TAAD sind das Arterial Tortuosity Syndrom (ATS; SLC2A10- Gen), die autosomal-dominante Cutis laxa Typ 1 (ADCL1; ELN-Gen) und die autosomal-rezessive Cutis laxa Typ 1B (ARCL1B; EFEMP2-Gen) (siehe Kap. 2.2). Mutationen in den Genen für die α1- und α2-kette des Typ IV-Kollagens (COL4A1, COL4A2) (siehe Kap. 2.4) führen zu intrazerebralen Blutungen. Da die klinische Differenzialdiagnose bei Aortenerkrankungen oft schwierig ist, stellt die genetische Diagnostik mittels NGS eine Möglichkeit der Ursachenfindung dar. Literatur Arslan-Kirchner et al, Eur J Hum Genet 24 (2016) / Bowdin et al, Canadian J Cardiol 32:131 (2016) / Guo et al, Am J Hum Genet 93:398 (2013) / Milewicz et al, in: GeneReviews [Internet]. Seattle (WA): University of Washington, Seattle; [Updated 2012 Jan 12] / Boileau et al, Nat Genet 44: 916 (2012) / van de Laar et al, Nat Genet 43:121 (2011) / Wang et al, Am J Hum Genet 87:701 (2010) / Guo et al, Nat Genet 39 :1488 (2007) / Zhu et al, Nat Genet 38:343 (2006) / Pannu et al, Circulation 112:513 (2005) / Dietz et al, Am J Med Genet 139C:4 (2005) 34

35 Humangenetik Schematische Darstellung der phänotypischen und genetischen Heterogenität bei TAAD. Core Genes (entsprechend der Clinical utility gene card für TAAD) sind fett dargestellt Erkrankungen, OMIM, ICD-10, Gene bei thorakalen Aortenerkrankungen familiär, nicht-syndromal Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Aortenaneurysma thorakal, familiär (AAT) - I71.1;I71.2 MAT2A Aortenaneurysma thorakal, familiär (AAT) - I71.1;I71.2 SMAD Aortenaneurysma thorakal, familiär, 3 (AAT3) I71.1;I71.2 TGFBR2*, ** Aortenaneurysma thorakal, familiär, 4 (AAT4) I71.1;I71.2 MYH11* Aortenaneurysma thorakal, familiär, 5 (AAT5) I71.1;I71.2 TGFBR1*, ** Aortenaneurysma thorakal, familiär, 6 (AAT6) I71.1;I71.2 ACTA2* Aortenaneurysma thorakal, familiär, 7 (AAT7) I71.1;I71.2 MYLK* Aortenaneurysma thorakal, familiär, 8 (AAT8) I71.1;I71.2 PRKG1* Aortenaneurysma thorakal, familiär, 9 (AAT9) I71.1;I71.2 MFAP Aortenaneurysma thorakal, familiär 10 (AAT10) I71.1;I71.2 FOXE Aortenaneurysma thorakal, familiär 11 (AAT11) I71.1;I71.2 LOX Bikuspide Aortenklappe 1 (AOVD1) Q23.1 NOTCH1* Bikuspide Aortenklappe - Q21.0 GATA * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 35

36 2.8.2 Thorakale Aortenerweiterung mit dem Risiko der Aortendissektion Thorakale Aortenerweiterung mit dem Risiko der Aortendissektion Mutationssuche, Deletions-/Duplikationsdiagnostik entspr. EBM Kapitel , GOP ACTA2, BGN, COL1A1, COL3A1, COL4A5, COL5A1, COL5A2, EFEMP2, ELN, EMILIN1, FOXE3, FBLN5, FBN1, FBN2, FLNA, GATA5, LOX, MAT2A, MFAP5, MYH11, MYLK, NOTCH1, PLOD1, PRKG1, SKI, SLC2A10, SMAD2, SMAD3, SMAD4, SMAD6, TGFB2, TGFB3, TGFBR1, TGFBR2 unterstrichen: die in GOP-Ziffer obligat zu untersuchenden Gene Kapitel Erkrankungen, OMIM, ICD-10, Gene bei thorakalen Aortenerweiterung mit dem Risiko der Aortendissektion Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Aortenaneurysma thorakal, familiär (AAT) - I71.1;I71.2 MAT2A Aortenaneurysma thorakal, familiär (AAT) - I71.1;I71.2 SMAD Aortenaneurysma thorakal, familiär, 3 (AAT3) I71.1;I71.2 TGFBR2*, ** Aortenaneurysma thorakal, familiär, 4 (AAT4) I71.1;I71.2 MYH11* Aortenaneurysma thorakal, familiär, 5 (AAT5) I71.1;I71.2 TGFBR1*, ** Aortenaneurysma thorakal, familiär, 6 (AAT6) I71.1;I71.2 ACTA2* Aortenaneurysma thorakal, familiär, 7 (AAT7) I71.1;I71.2 MYLK* Aortenaneurysma thorakal, familiär, 8 (AAT8) I71.1;I71.2 PRKG1* Aortenaneurysma thorakal, familiär, 9 (AAT9) I71.1;I71.2 MFAP Aortenaneurysma thorakal, familiär 10 (AAT10) I71.1;I71.2 FOXE Aortenaneurysma thorakal, familiär 11 (AAT11) I71.1;I71.2 LOX Bikuspide Aortenklappe 1 (AOVD1) Q23.1 NOTCH1* Bikuspide Aortenklappe - Q21.0 GATA Bikuspide Aortenklappe 2 (AOVD2) Q23.1 SMAD Arterial Tortuosity Syndrom (ATS) I73.8 SLC2A10 * Bindegewebserkrankung mit peripherer Neuropathie, - - EMILIN1 * Arthropathie und Hautelastizität Cutis laxa, Typ 1 dominant (ARCL1B) Q82.8 ELN Cutis laxa, Typ 1A (ARCL1A) Q82.8 FBLN EDS mit periventrikulärer Heterotopie (PVNH4) Q79.6 FLNA * EDS, klassischer Typ (EDS Typ I) Q79.6 COL1A1 *,** EDS, klassischer Typ (EDS Typ I) Q79.6 COL5A1 *,** EDS, klassischer Typ (EDS Typ I) Q79.6 COL5A2 * EDS, vaskulärer Typ (EDS Typ IV) Q79.6 COL3A1 *,** Loeys-Dietz-Syndrom Typ 1 (LDS1) Q87.4 TGFBR1 *,** Loeys-Dietz-Syndrom Typ 2 (LDS2) Q87.4 TGFBR2 *,** Loeys-Dietz-Syndrom Typ 3 (LDS3); Q87.4 SMAD3 * Aneurysmen Osteoarthritis Syndrom (AOS) Loeys-Dietz-Syndrom Typ 4 (LDS4) Q87.4 TGFB2 * Loeys-Dietz-Syndrom Typ 5 (LDS5) Q87.4 TGFB Marfan-Syndrom (MFS) Q87.4 FBN1 *,** Meester-Loeys-Syndrom BGN Hereditäre hämorrhagische Teleangiektasie SMAD4 *,**

37 Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Shprintzen-Goldberg-Kraniosynostose-Syndrom (SGS) Q87.8 SKI EDS, kyphoskoliotischer Type (keds) Q79.6 PLOD1*, ** Kongenitale kontrakturelle Arachnodaktylie Q12.1 FBN2 * Cutis laxa, autosomal rezessiv, Typ 1B (ARCL1B) Q82.8 EFEMP2* COL4A5 *,** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Erkrankungen, OMIM, ICD-10, Gene bei seltenen syndromalen thorakalen Aortenerkrankungen Erkrankung OMIM-P ICD-10 Gen OMIM-Gen EDS mit periventrikulärer Heterotopie (PVNH4) Q79.6 FLNA * EDS, klassischer Typ (ceds) Q79.6 COL1A1 *,** EDS, klassischer Typ (ceds) Q79.6 COL5A1 *,** EDS, klassischer Typ (ceds) Q79.6 COL5A2 * EDS, vaskulärer Typ (veds) Q79.6 COL3A1 *,** EDS, kyphoskoliotischer Type (keds) Q79.6 PLOD1*, ** Kongenitale kontrakturelle Arachnodaktylie Q12.1 FBN2 * Loeys-Dietz-Syndrom Typ 1 (LDS1) Q87.4 TGFBR1 *,** Loeys-Dietz-Syndrom Typ 2 (LDS2) Q87.4 TGFBR2 *,** Loeys-Dietz-Syndrom Typ 3 (LDS3) Q87.4 SMAD3 * Loeys-Dietz-Syndrom Typ 4 (LDS4) Q87.4 TGFB2 * Loeys-Dietz-Syndrom Typ 5 (LDS5) Q87.4 TGFB Marfan-Syndrom (MFS) Q87.4 FBN1 *,** Shprintzen-Goldberg-Kraniosynostose-Syndrom (SGS) Q87.8 SKI * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Humangenetik Erkrankungen, OMIM, ICD-10, Gene bei seltenen syndromalen thorakalen Aortenerkrankungen autosomal-rezessiv; Cutis laxa Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Arterial Tortuosity Syndrom (ATS) I73.8 SLC2A10* Bindegewebserkrankung mit peripherer Neuropathie, Arthropathie - - EMILIN und Hautelastizität Cutis laxa, Typ 1 autosomal-dominant (ADCL1) Q82.8 ELN Cutis laxa, Typ 1A (ARCL1A) Q82.8 FBLN Cutis laxa, autosomal rezessiv, Typ 1B (ARCL1B) Q82.8 EFEMP2* Meester-Loeys-Syndrom BGN * auch einzeln anforderbar Core Genes sind fett gedruckt 37

38 3. Bindegewebs-/Skeletterkrankungen Schematische Darstellung der phänotypischen und genetischen Heterogenität bei Bindegewebs- /Skeletterkrankungen. Die einzelnen Subpanels sind farblich voneinander abgegrenzt, "Core Genes" sind fett gedruckt. 3.1 Jeune-/Kurzrippen-Polydaktylie-Syndrom Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Beim Jeune-/Kurzrippen-Polydaktylie-Syndrom handelt es sich um eine in der Regel autosomal-rezessiv vererbte Erkrankung. Eine Nephronophthise in Kombination mit Kleinwuchs, schmalem Thorax mit kurzen Rippen, einer Polydaktylie und Retinopathie wird als Kurzrippen-Polydaktylie-Syndrom, Jeune-Syndrom oder auch als Ellis-van-Creveld-Syndrom bezeichnet. Diese Gruppe von Erkrankungen weist eine große Genlocus-Heterogenität auf; es sind derzeit ca. 20 assoziierte Gene bekannt. Ähnlich der Nephronophthise wird das Jeune-/Kurzrippen-Polydaktylie-Syndrom zu den sogenannten Ziliopathien gezählt. Literatur Schmidts, J Pediatr Genet 3:46 (2014) / Barker et al, Organogenesis 10:96 (2014) / Romani et al, Lancet Neurol 12:894 (2013) / Ronquillo et al, Vision Res 75:88 (2012) / Brugmann et al, Am J Med Genet A 152A:2995 (2010) Jeune-/ Kurzrippen-Polydaktylie-Syndrom DYNC2H1, IFT80, NEK1, TTC21B, WDR34 24,6 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. DYNC2H1, IFT80, NEK1, TTC21B, WDR34 CEP120, CSPP1, DYNC2LI1, EVC, EVC2, IFT122, IFT140, IFT172, IFT43, IFT52, KIAA0586, TCTN3, WDR19, WDR35, WDR60 72,2 kb 38

39 Erkrankungen, OMIM, ICD-10, Gene bei Jeune-/Kurzrippen-Polydaktylie-Syndrom Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Ellis-van Creveld Syndrom Typ Q77.2 EVC Ellis-van Creveld Syndrom Typ Q77.2 EVC Jeune Syndrom/OFD Typ 4 Phänotyp Q77.2 TCTN Jeune Syndrom/Joubert-Syndrom Typ 21 Phänotyp Q77.2 CSPP Kranio-Ektodermale Dysplasie Typ Q77.2 IFT Kranio-Ektodermale Dysplasie Typ Q77.2 IFT Kranio-Ektodermale Dysplasie Typ Q77.2 WDR Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 IFT Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 DYNC2H Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 TTC21B Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 WDR Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 NEK Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 WDR Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 WDR Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 IFT Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 IFT Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 WDR Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 CEP DYNC2LI IFT KIAA Humangenetik 3.2 Kraniosynostosen Dipl.-Biol. Christina Sofeso, Dr. med. Imma Rost Als Kraniosynostose wird die vorzeitige Verknöcherung von Schädelnähten bezeichnet. Daraus ergibt sich in Abhängigkeit davon, welche Schädelnähte von der Synostose betroffen sind, ein verändertes Schädelwachstum mit z.t. charakteristischen Kopfformen. Die meisten primären Kraniosynostosen sind angeboren und können isoliert oder als Teilsymptom verschiedener komplexer Syndrome auftreten. Die Gesamthäufigkeit liegt bei 1: Unter den isolierten Formen ist die Sagittalnahtsynostose mit einem Anteil von ca. 50% die häufigste. Die komplexen Formen zeigen eine oder mehrere Synostosen und z.t. weitere Symptome einer pathologischen Entwicklung knöcherner Strukturen wie z. B. Syndaktylien. Zu den klassischen Kraniosynostosesyndromen zählen: - Apert-Syndrom - Crouzon-Syndrom - Muenke-Syndrom - Pfeiffer-Syndrom - Saethre-Chotzen-Syndrom Diese Syndrome werden autosomal-dominant vererbt und beruhen mit Ausnahme des Saethre-Chotzen- Syndroms auf Mutationen in den Genen der Fibroblasten-Wachstumsfaktor-Rezeptoren (FGFR) 1, 2 und 3. Das Saethre-Chotzen-Syndrom wird meist durch Mutationen im TWIST1-Gen verursacht. Zwischen den Syndromen gibt es klinisch Überlappungen. Es gibt eine Reihe von weiteren Syndromen, bei denen ein Teisymptome die Kraniosynostose darstellt. Teilweise werden sie durch Mutationen in den gleichen Genen verursacht wie die o.g. klassischen Kraniosynostosen-Syndrome. Teilweise stehen ganz andere Leitsympome im Vordergrund wie z. B. das Aortenaneurysma bei den Loeys-Dietz-Syndromen 1 und 2. Bei wenigen Patienten mit isolierten Einzelnahtsynostosen, v.a. der Sagittal- und der Koronarnaht, wurden Mutationen im TWIST1-Gen gefunden. Es sind zahlreiche weitere seltene Syndrome beschrieben worden, die als Teilsymptom eine Kraniosynostose zeigen sowie einige nicht-syndromale Kraniosynostosen. 39

40 Literatur Beederman et al, Genes Dis 1:120 (2014) / Fitzpatrick, Nat Genet 45:231 (2013) / Foldynova-Trantirkov et al, Hum Mutat 33:29 (2012) / De Jong et al, J Plast Recon Aest Surg 63:1635 (2010) / Seto et al, Am J Med Genet 143a:678 (2007) / Kress et al, Eur J Hum Genet 14:39 (2006) / Komotar et al, Pediatr Ann 35:365 (2006) / Zöckler, Dissertation an der Med. Fakultät der FU Berlin (2006) / Cohen, Am J Med Genet 136:313 (2005) / Cohen, Am J Med Genet 115:245 (2002) / Cohen, Am J Med Genet 113:1 (2002) / Ornitz et al, Genes Dev 16:1446 (2002) / Chun et al, Am J Med Genet 110:136 (2002) / Muenke et al, in Scriver et al (eds): The Metabolic and Molecular Bases of Inherited Disease, 7th Ed, Chapter 245 (2001) / Hodach et al, Z Kinderheilkd 119:87 (1975) / Bennett, Am J Phys Anthropol 27:1 (1967) Kraniosynostosen FGFR1, FGFR2, FGFR3, TCF12, TWIST1 10,2 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. FGFR1, FGFR2, FGFR3, TCF12, TWIST1 ALX4, BMP4, CCBE1, CEP120, EFNB1, ERF, ESCO2, FREM1, GLI3, IFT122, IFT140, IFT43, IL11RA, IMPAD1, IRX5, KRAS, MEGF8, MSX2, MYH3, P4HB, POR, RAB23, RECQL4, SCARF2, SEC24D, SKI, SPECC1L, STAT3, TCF12, TGFBR1, TGFBR2, WDR19, WDR35 94,9 kb Erkrankungen, OMIM, ICD-10, Gene bei Kraniosynostosen Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Antley-Bixler-Syndrom mit Genitalanomalien und Steroidsynthesestörungen Q75.0 POR Antley-Bixler-Syndrom ohne Genitalanomalien oder Steroidsynthesestörungen Q75.0 FGFR2 * Apert-Syndrom Q75.0 FGFR2 * Baller-Gerold-Syndrom (BGS) Q75.0 RECQL Beare-Stevenson Cutis Gyrata Syndrom (BSTVS) Q75.0 FGFR2 * Bent Bone Dysplasia Q75.0 FGFR2 * Carpenter-Syndrom Typ 1 (CRPT1) Q75.0 RAB Carpenter-Syndrom Typ 2 (CRPT2) Q75.0 MEGF Chondrodysplasie mit Gelenkdislokation, Typ Grapp Q75.0 IMPAD Cole-Carpenter-Syndrom Typ 1 (CLCRP1) Q75.0 P4HB Cole-Carpenter-Syndrom Typ 2 (CLCRP2) Q75.0 SEC24D Cranioektodermale Dysplasie Typ 1 (CED1) Q75.0 IFT Cranioektodermale Dysplasie Typ 2 (CED2) Q75.0 WDR Cranioektodermale Dysplasie Typ 3 (CED3) Q75.0 IFT Cranioektodermale Dysplasie Typ 4 (CED4) Q75.0 WDR Craniofrontonasales Syndrom (CFNS) Q75.0 EFNB Crouzon-Syndrom Q75.0 FGFR2 * Crouzon-Syndrom mit Acanthosis Nigricans (CAN) Q75.0 FGFR3 * Distale Arthrogrypose Typ 8 (DA8) Q75.0 MYH

41 Greig Cephalosyndaktylie-Syndrom (GCPS) Q75.0 GLI Hamamy-Syndrom Q75.0 IRX Hartsfield-Bixler-Demyer Syndrom Q75.0 FGFR1 *,** Hennekam Lyphangieektasie-Lymphödem-Syndrom Typ 1 (HKLLS1) Q75.0 CCBE Hyper-IgE wiederholtes Infektions-Syndrom Q75.0 STAT Jackson-Weiss Syndrom Q75.0 FGFR1 *,** Jackson-Weiss Syndrom Q75.0 FGFR2 * Kraniosynostose Typ 1 (CRS1) Q75.0 TWIST1 *,** Kraniosynostose Typ 2 (CRS2) Q75.0 MSX Kraniosynostose Typ 3 (CRS3) Q75.0 TCF Kraniosynostose Typ 4 (CRS4) Q75.0 ERF Kraniosynostose Typ 5, Suszeptibilität (CRS5) Q75.0 ALX Kraniosynostose und Zahnanomalien (CRSDA) Q75.0 IL11RA Kurzrippen-Thoraxdysplasie Typ 9 mit oder ohne Polydaktylie Q75.0 IFT Kurzrippen-Thoraxdysplasie Typ 13 mit oder ohne Polydaktylie SRTD13 (13 Formen bisher) Q75.0 CEP Loeys-Dietz-Syndrom Typ 1 (LDS1) *** Q75.0 TGFBR Loeys-Dietz-Syndrom Typ 2 (LDS2) *** Q75.0 TGFBR Mikrophthalmie-Syndrom Typ 6 (MCOPS6) Q75.0 BMP Muenke Syndrom (MNKES) Q75.0 FGFR3 * Noonan-Syndrom Typ Q75.0 KRAS Opitz GBBB-Syndrom Typ II (GBBB2) Q75.0 SPECC1L Osteoglophonische Dysplasie (OGD) Q75.0 FGFR1 *,** Pfeiffer-Syndrom Q75.0 FGFR1 *,** Pfeiffer-Syndrom Q75.0 FGFR2 * Roberts-Syndrom Q75.0 ESCO Robinow-Sorauf-Syndrom Q75.0 TWIST1 *,** Saethre-Chotzen-Syndrom (SCS und SCS mit Augenlid-Anomalien) Q75.0 FGFR2 * Saethre-Chotzen-Syndrom (SCS und SCS mit Augenlid-Anomalien) Q75.0 TWIST1 *,** SC Phocomelie-Syndrom Q75.0 ESCO Shprintzen-Goldberg Kraniosynostose-Syndrom (SGS) Q75.0 SKI Steroidsynthesestörung durch Cytochrom P450-Oxidoreductase-Defekt Q75.0 POR Thanatophore Dysplasie Typ 1 (TD1) Q75.0 FGFR Trigonozephalie Typ 1 (TRIGNO1) Q75.0 FGFR1 * Trigonozephalie Typ 2 (TRIGNO2) Q75.0 FREM1 *,** Van Den Ende-Gupta-Syndrom (VDEGS) Q75.0 SCARF * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse *** Kapitel Core Genes sind fett gedruckt Humangenetik 41

42 3.3 Osteogenesis Imperfecta (OI) Dr. rer. nat. Christoph Marschall Osteogenesis Imperfecta oder Glasknochenkrankheit (Häufigkeit etwa 1:10.000) ist eine klinisch und genetisch heterogene Gruppe von Erkrankungen mit erhöhter Knochenbrüchigkeit, die, abgesehen von sehr seltenen Sonderformen, autosomal-dominant vererbt werden. Ursächliche Mutationen können in ca. 90% der Fälle in den Genen COL1A1 und COL1A2 nachgewiesen werden. Häufig führen diese zur Substitution von Glycin in der Tripel-Helix-Domäne des Typ I-Kollagens. Die Schwere der klinischen Symptomatik hängt vom betroffenen Gen sowie von Art und Lokalisation der Mutation ab (Genotyp-Phänotyp-Korrelation). Die seltenen in der Regel autosomal-rezessiv vererbten Sonderformen der OI sind meist durch spezifische klinische Merkmale charakterisiert. Die Analyse dieser Gene wird derzeit in internationalen Leitlinien nur nach gründlicher klinischer Evaluierung empfohlen. 1. Autosomal-dominant vererbte Formen (häufig) Typ I (häufigste Form, ca. 65% der Fälle) ist gekennzeichnet durch eine milde Verlaufsform mit mäßiger Knochenbrüchigkeit (10-20 Knochenbrüche bis zur Pubertät), Blauverfärbung der Skleren und postpubertärem Hörverlust bei 50% der Betroffenen. Auch Tinnitus, Aorteninsuffizienz und dünne Haut (in ca. 20% der Fälle) sind charakteristisch. Man unterscheidet Typ IA mit und Typ IB ohne Dentinogenesis Imperfecta. Typ II (ca. 20% der Fälle) ist die schwerste Verlaufsform und verläuft meist intrauterin oder in den ersten Wochen postnatal letal. Sporadische Fälle werden oft durch Keimbahnmosaike verursacht, das Wiederholungsrisiko bei Folgeschwangerschaften beträgt ca. 10%. Typ III (ca. 5% der Fälle) ist phänotypisch besonders variabel. Typisch sind extreme Kleinwüchsigkeit, Skelettdeformitäten, ca. 100 Knochenbrüche bis zur Pubertät und Hörverlust. Weiche Knochen, Skoliose und Dentinogenesis Imperfecta sind ebenfalls charakteristisch. Typ IV (ca. 10% der Fälle) ist eine milde Verlaufsform mit Kleinwüchsigkeit und mäßigen Skelettdeformitäten ohne Sklerenverfärbung, mit mäßiger Knochenbrüchigkeit. Man unterscheidet Subtyp A und B mit und ohne Dentinogenesis Imperfecta. Die Erkrankung wird durch Mutationen in den Typ I-Kollagen-Genen COL1A1 (2/3 der Fälle) und COL1A2 (1/3 der Fälle) verursacht, die zu einer verminderten Synthese von Prokollagen α1, α2 oder zu einer Strukturveränderung von Kollagen führen. Die phänotypische Heterogenität wird vermutlich durch den Einfluss modifizierender Gene und durch strukturelle Unterschiede verursacht. Insgesamt sind etwa Mutationen beschrieben, davon betreffen ca. 60% die Aminosäure Glycin. Typ V ist mit wenigen Einzelfällen mit hypertropher Kallusbildung, maschenartiger Histologie der Knochen, dichten Epiphysen, Skelettdeformitäten und variabler Knochenbrüchigkeit unbekannter Ursache beschrieben. 2. Autosomal-rezessiv vererbte Formen (selten) Typ VI ist an wenigen Einzelfällen mit mäßig schwerer Form der OI mit Skelettdeformitäten und variabler Knochenbrüchigkeit beschrieben. In der Histologie zeigen sich Fischgräten-artige Lamellen. Kürzlich konnten in wenigen Familien türkischer Abstammung Mutationen im FKBP10-Gen nachgewiesen werden, das für das Chaperon FKBP65 codiert. FKBP65 ist an der Faltung von Typ I-Kollagen beteiligt. Typ VII (2-3% der letalen OI-Fälle) ist charakterisiert durch multiple Knochenbrüche, extrem geringe Mineralisierung und Popkorn-Epiphysen. Die Ursache liegt in Mutationen im CRTAP-Gen. CRTAP codiert einen Bestandteil des Kollagen 3-Hydroxylierungs-komplexes (post-translationale Prolyl-3-Hydroxylierung von Kollagen Typ I und II). Dieser modifiziert Pro986 der α1(i)-kette, wodurch deren Faltung erleichtert und die Kette stabilisiert wird. Eine fehlende Pro986-Hydroxylierung führt zur verzögerten Faltung der Kollagen- Helix und deren Überschussmodifikation (28%-43% Zunahme der Hydroxylierung von Lysinresten). Da Typ II-Kollagen im Knorpel ebenfalls durch Prolyl-3-Hydroxylierung modifiziert wird, sind auch die Epiphysen betroffen. Typ VIII (selten, gehäuft bei irischen Auswanderern und bei Westafrikanern, bei denen 1% der Bevölkerung Anlageträger sind und Typ VIII genauso häufig ist wie OI Typ II) ist gekennzeichnet durch weiße Skleren, einen kurzen fassförmigen Thorax, lange Hände und extrem untermineralisierte Knochen. Ursächlich sind Mutationen im Prolyl-3-Hydroxylase-Gen LEPRE1, das Pro986 der α1(i)-kette modifiziert (post-translationale Prolyl-3-Hydroxylierung von Kollagen Typ I und II). Mutationen zeigen einen vergleichbaren struktu- 42

43 rellen Effekt und führen zu einer vergleichbaren klinischen Symptomatik wie OI Typ VII. Typ IX (selten) ist eine mäßig schwere Form der OI ohne Rhizomelie. Sie wird verursacht durch Mutationen im PPIB-Gen. PPIB codiert eine Peptidyl-Prolyl-cis-trans-Isomerase, die die Prolyl-Isomerisierung katalysiert und für die Faltung des Typ I-Kollagens essenziell ist. Literatur Forlino et al, Lancet 387:1657 (2016) / Valadares et al, J Pediatr 90:536 (2014) / Caparros-Martin et al, Am J Med Genet 161:1354 (2013) / van Dijk et al, EJHG 20:11 (2012) / Forlino et al, Nat Rev Endocrinol 7:540 (2011) / Alanay et al, Am J Hum Genet 86:551 (2010) / Barnes et al, NEJM 362:521 (2010) / Willaert et al, J Med Genet 46:233 (2009) / Baldridge et al, Hum Mutat 29:1435 (2008) / Marini et al, Hum Mutat 28:209 (2007) Osteogenesis Imperfecta autosomal-dominant COL1A1, COL1A2, IFITM5, WNT1 10,0 kb Humangenetik Osteogenesis Imperfecta autosomal-rezessiv BMP1, CRTAP, FKBP10, P3H1, PLOD2, PPIB, SERPINF1, SERPINH1, SP7, TMEM38B, WNT1 17,0 kb Erkrankungen, OMIM, ICD-10, Gene bei Osteogenesis Imperfecta Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Osteogenesis Imperfecta, Bruck-Syndrom Q78.0 AR PLOD Osteogenesis Imperfecta, Typ I Q78.0 AD COL1A2*, ** Osteogenesis Imperfecta, Typ I Q78.0 AD COL1A1*, ** Osteogenesis Imperfecta, Typ II Q78.0 AD COL1A2*, ** Osteogenesis Imperfecta, Typ II Q78.0 AD COL1A1*, ** Osteogenesis Imperfecta, Typ III Q78.0 AD COL1A2*, ** Osteogenesis Imperfecta, Typ III Q78.0 AD COL1A1*, ** Osteogenesis Imperfecta, Typ IV Q78.0 AD COL1A2*, ** Osteogenesis Imperfecta, Typ IV Q78.0 AD COL1A1*, ** Osteogenesis Imperfecta, Typ IX Q78.0 AR PPIB* Osteogenesis Imperfecta, Typ V Q78.0 AD IFITM Osteogenesis Imperfecta, Typ VI Q78.0 AR SERPINF Osteogenesis Imperfecta, Typ VII Q78.0 AR CRTAP* Osteogenesis Imperfecta, Typ VIII Q78.0 AR P3H1* Osteogenesis Imperfecta, Typ X Q78.0 AR SERPINH Osteogenesis Imperfecta, Typ XI Q78.0 AR FKBP Osteogenesis Imperfecta, Typ XII Q78.0 AR SP Osteogenesis Imperfecta, Typ XIII Q BMP Osteogenesis Imperfecta, Typ XIV Q TMEM38B Osteogenesis Imperfecta, Typ XV Q78.0 AD/AR WNT * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 43

44 3.4 Stickler-Syndrom (STL) Dr. rer. nat. Christoph Marschall Das Stickler-Syndrom wird autosomal-dominant vererbt und zählt zu den Kollagen-Typ-II-Erkrankungen. Bisher sind über 300 Fälle beschrieben, die Inzidenz wird auf ca. 1: geschätzt. Charakteristisch für das Stickler- Syndrom sind insbesondere Mittelgesichtshypoplasie (bis zu 100% der Fälle), schwere Sehstörungen durch Myopie (>90%) z.t. bereits bei Neugeborenen, Katarakt und Netzhautablösung (60% der Fälle) bereits im ersten Lebensjahrzehnt, Gaumenspalte (41%), Pierre-Robin-Sequenz (23%) sowie Gelenkbeschwerden. Darüber hinaus besteht eine Disposition für Mitralklappenprolaps (40-50% der Fälle) und Taubheit (10-50% der Fälle). Die häufigste Form des Stickler-Syndroms ist der Typ 1, der auf Mutationen im COL2A1-Gen zurückzuführen ist. Durchschnittlich können in 75% der STL-Fälle Mutationen im COL2A1-Gen nachgewiesen werden. Bei Patienten mit charakteristischen membranösen Veränderungen des Glaskörpers, die in ca. 60% der Fälle mittels Spaltlampe identifiziert werden können, beträgt die Sensitivität der COL2A1-Sequenzierung ca. 94%. Deletionen in der Größe einzelner Exons bis zum gesamten Gen, sind in maximal 1% der STL1-Fälle ursächlich [Hoornaert et al, Eur J Hum Genet 18:872 (2010)]. Wesentlich seltener sind Stickler-Syndrom Typ 2 und Typ 3, die mit Mutationen im COL11A1- bzw. COL11A2-Gen verbunden sind. Das STL2, das ungefähr 6% aller STL-Fälle ausmacht, unterscheidet sich klinisch kaum vom STL1. Allerdings zeigen sich beim STL2 perlenschnurartige Veränderungen am Glaskörper. Die Abgrenzung des STL2 vom Marshall-Syndrom, das unter anderem durch die früh beginnende Taubheit und betontere faziale Merkmale gekennzeichnet ist und ebenfalls auf Mutationen im COL11A1-Gen beruht, ist z.t. schwierig. Beim sehr seltenen Stickler- Syndrom Typ 3 sind das Fehlen der Augensymptomatik und Mutationen im COL11A2-Gen charakteristisch. Literatur Acke et al, Mol Genet Metab 113:230 (2014) / Vijzelaar et al, BMC Med Gen 14:48 (2013) / Hoornaert et al, Eur J Hum Genet 18:872 (2010) / Richards et al, Hum Mutat 31:E1461 (2010) / Zechi-Ceide et al, Eur J Med Genet. 51:183 (2008) / Majava et al, Am J Hum Genet A 143A:258 (2007) / Richards et al, Hum Mutat 27:696 (2006) / Nishimura et al, Hum Mutat 26:36 (2005) / Stickler et al, Genet Med 3:19 (2001) / Richards et al, Br J Ophthalmol 84:364 (2000) / Freddi et al, Am J Med Genet 28:398 (2000) / Ballo et al, Am J Med Genet 80:6 (1998) / Korkko et al, Am J Hum Genet 53:55 (1993) Stickler-Syndrom (Bindegewebserkrankung) # COL11A1, COL11A2, COL2A1, COL9A1, COL9A2 20,0 kb Erkrankungen, OMIM, ICD-10, Gene bei Stickler-Syndrom (Bindegewebserkrankung) Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Stickler-Syndrom Typ Q87.8 AD COL2A Stickler-Syndrom Typ Q87.8 AD COL11A Stickler-Syndrom Typ Q87.8 AD COL11A2* Stickler-Syndrom Typ Q87.8 AR COL9A Stickler-Syndrom Typ Q87.8 AR COL9A * auch einzeln anforderbar Core Genes sind fett gedruckt 44

45 4. Blut und blutbildendes System 4.1 Hereditäre Sphärozytose (HS) Dipl.-Biol. Birgit Busse Die hereditäre Sphärozytose ist die häufigste Ursache einer kongenitalen hämolytischen Anämie bei Kaukasiern. Die Prävalenz liegt bei ca. 1:2.000 bis 1: Die molekulare Ursache liegt in einem Defekt der Erythrozytenmembranproteine, die bei der Stabilisierung und Organisation der Plasmamembran eine zentrale Rolle spielen. Ein Defekt in diesem Netzwerk führt zu einem Formverlust der Erythrozyten (Sphärozyten, Kugelzellen) und zu einer erhöhten Membranpermeabilität, gesteigerter Glykolyse und erhöhtem ATP-Umsatz. Die Sphärozyten werden frühzeitig über die Milz wieder aus dem Blutkreislauf entfernt. Bei der hereditären Sphärozytose handelt es sich um ein klinisch, biochemisch und genetisch heterogenes Krankheitsbild. Betroffene zeigen hauptsächlich eine normozytäre hämolytische Anämie, Ikterus und Splenomegalie. Häufig finden sich auch Gallensteine. Die Klinik kann stark variieren von einer asymptomatischen Form bis hin zu einer schweren lebensbedrohlichen Anämie, die durch Transfusionen und Splenektomie behandelt werden muss. Die Vererbung kann sowohl autosomal-dominant als auch autosomal-rezessiv erfolgen, wobei ca. 2/3 aller Fälle einen dominanten Erbgang aufweisen. In Nordeuropa findet man bei bis zu 65% der Patienten Mutationen im ANK1-Gen, welches für das Protein Ankyrin-1 codiert. Frameshift- bzw. Stopp-Mutationen führen dabei in der Regel zu einem dominanten Phänotyp und Missense- und Promotormutationen zu einem rezessiven Phänotyp. Als zweithäufigste Ursache sind Mutationen im SLC4A1-Gen beschrieben, die zu einem Defekt des Protein-Band-3 führen. Die Vererbung erfolgt autosomal dominant. Des Weiteren sind in ca % Mutationen im β-spectrin beschrieben, welches durch das SPTB-Gen codiert wird. In selteneren Fällen sind das α-spectrin oder das Protein 4.2 betroffen mit einem Anteil von jeweils unter 5%. Humangenetik Literatur Barcellini et al, Blood Transfus. 9:274 (2011) / Satchwell et al, Blood Cells Mol Dis. 42:201 (2009) / Tavazzi et al, Pediatr Ann. 37:303 (2008) / An et al, Br J Haematol. 141:367 (2008) / Bennett et Healy, Trends Mol Med. 14:28 (2008) / Delaunay, Blood Rev. 21:1 (2007) / Bolton-Maggs et al, Br J Haematol 126:455 (2004) / Shah et al, Pediatr Rev. 25:168 (2004) Sphärozytose # ANK1, SPTA1, SPZTB, EPB42, SLC4A1 24,8 kb Erkrankungen, OMIM, ICD-10, Gene bei Sphärozytose Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Hereditäre Sphärozytose Typ D58.0 ANK1* Hereditäre Sphärozytose Typ D58.0 SPTB* Hereditäre Sphärozytose Typ D58.0 SPTA1* Hereditäre Sphärozytose Typ D58.0 SLC4A1* Hereditäre Sphärozytose Typ D58.0 EPB42* * auch einzeln anforderbar Weitere Erkrankungen (Hämoglobinopathien) siehe Leistungsverzeichnis oder Homepage unter Diagnostik (Erkrankungen/Syndrome). 45

46 5. Entwicklungsstörungen und Komorbiditäten, Wachstumsstörungen Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. med. Imma Rost Eine Intelligenzminderung, definiert als ein IQ von unter 70, hat eine Prävalenz von 1,5-2%. Schwerere Formen mit einem IQ von <50 haben eine Prävalenz von 0,3-0,4%. Jungen/Männer sind aufgrund X-chromosomaler Gene häufiger betroffen. Die Ursachen einer Intelligenzminderung sind vielfältig; genetische Faktoren sind aber zu mindestens 50% beteiligt. Mit den bisher möglichen Untersuchungen wie Chromosomenanalyse, Array-CGH und einer Zieldiagnostik (z.b. Fragiles X, Rett-Syndrom, Angelman- Syndrom) bleiben noch ca. 60% der Ursachen von Entwicklungsstörungen ungeklärt. Mehrere Studien der letzten Jahre, in denen Patienten mit schwerer Intelligenzminderung (IQ<50) mittels neuer Hochdurchsatz- Techniken (NGS) untersucht wurden, konnten bestätigen, dass dominante Neumutationen offenbar zu einem großen Teil zur Ursache der schweren Intelligenzminderung beitragen [z. B. Vissers L. et al, Nat Genet (2010), de Ligt, J. et al, NEJM (2012) und Rauch, A. et al, Lancet (2012)]. Man geht nach diesen Studien davon aus, dass bis zu ca. 30% der schweren, nicht-syndromalen Entwicklungsstörungen durch de novo Punktmutationen und kleine Indels verursacht werden, wobei eine große genetische Heterogenität zu beobachten ist. Darüber hinaus spielen auch autosomal-rezessive Mutationen bei den Entwicklungsstörungen eine Rolle (ca %), sowie Mutationen in X-chromosomalen Genen (5-10% der männlichen Betroffenen). Als weiterführende Diagnostik besteht die Möglichkeit der gleichzeitigen Analyse einer großen Anzahl von Genen, die mit neurologischen bzw. Entwicklungsstörungen in Zusammenhang stehen und die bereits in den Datenbanken gelistet sind, mittels Next Generation Sequencing (NGS). Bei einer Reihe von Entwicklungsstörungen stehen auch andere Symptome im Vordergrund, so z.b. Autismus-Spektrum-Störungen oder auffällige Wachstumsparameter, z.b. Makrozephalie, Mikrozephalie oder Großwuchs. Darüber hinaus gibt es syndromale Formen von Entwicklungsstörungen, bei denen differenzialdiagnostisch weitere Syndrome und damit weitere ursächliche Gene in Frage kommen (z.b. Rett- und Rett-ähnliche-Syndrome) schließlich sind hier auch einige der bekannteren, genetisch heterogenen Syndrome aufgeführt, die sinnvoll mittels NGS untersucht werden können (Cornelia-de-Lange-Syndrom, RASopathien u.a.). Alternativ ist auch noch eine erweiterte Diagnostik mittels Clinical- oder Whole-Exome-Analyse (CES/WES) möglich (siehe Kapitel 22). Literatur Vissers et al, Nat Rev Genet 17:9 (2016) / Tzschach et al, Eur J of Hum Genet 23:1513 (2015) / Tan et al, Clin Genet. doi: cge (2015) / Musante et al, Trends Genet 30:32 (2014) / Brett et al, PLoS One 9(4): e93409 (2014) / Redin et al 2014 J Med Genet 51:724 (2014) 46

47 Humangenetik Schematische Darstellung der phänotypischen und genetischen Heterogenität bei Entwicklungs/Wachstumsstörungen. Die einzelnen Subpanels sind farblich voneinander abgegrenzt. Bei Genen, die mit einem Fragezeichen gekennzeichnet sind, ist noch nicht hinreichend geklärt, in wieweit es sich um Gene handelt, deren Mutation mit dem klinischen Phänotyp einer RASopathie in Zusammenhang steht. 47

48 5.1 Autismus-Spektrum-Störungen Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. med. Imma Rost Autismus-Spektrum-Störungen (ASS) haben unter den neuropsychiatrischen Erkrankungen mit die größte Heritabilität, was sich an hohen Konkordanzraten von ca. 70% bei monozygoten Zwillingen in früheren Zwillingsstudien gezeigt hat. Dementsprechend liegt das empirische Wiederholungsrisiko für Geschwister von Kindern mit ASS zwischen 5 und 20%, also deutlich höher als bei anderen multifaktoriell bedingten Erkrankungen. ASS sind sowohl klinisch als auch genetisch heterogen; als Komorbiditäten findet man am häufigsten Entwicklungsstörungen bzw. Intelligenzminderung (ca. 70%), Sprachstörungen (ca. 30%) oder eine Epilepsie. Man geht heute davon aus, dass mit modernen genetischen Untersuchungsmethoden für etwa 20-25% der Autismus-Spektrum-Störungen eine genetische Ursache gefunden werden kann [Baker et al, (2015)]. Etwa 20% tragen de novo entstandene CNV (Copy Number Variation), die mittels Chromosomaler Micro- Arrays (CMA) gefunden werden. Bei 3-5% finden sich monogen bedingte Ursachen, meist durch Einzelgen- Mutationen bedingte Syndrome, die als Teilsymptom eine ASS zeigen. Das American College of Medical Genetics (ACMG) [Schaefer et al, (2013)] empfiehlt bei der genetischen Abklärung von Patienten mit ASS, bei denen die klinische Untersuchung keinen Verdacht auf ein spezifisches genetisches Syndrom ergibt, zunächst die Durchführung eines chromosomalen Microarrays. Falls dieser unauffällig ist, sollte bei Mädchen das MECP2-Gen (Rett-Syndrom), bei Jungen das FMR1-Gen (Fragiles-X- Syndrom) untersucht werden bzw., falls eine Makrozephalie vorliegt, das PTEN-Gen (Bannayan-Riley-Ruvalcaba-Syndrom). Man nimmt heutzutage an, dass eine Vielzahl von Genen, wahrscheinlich über 1.000, an der Entstehung von ASS beteiligt sein können, wobei noch nicht geklärt ist, in welchem Ausmaß einzelne Varianten die Ausprägung im Einzelfall beeinflussen. Trotzdem kann die erweiterte Diagnostik auch mittels NGS (Gen- Panel Diagnostik) im Einzelfall zur Diagnose und damit zu genaueren Aussagen zur Prognose und zum Wiederholungsrisiko führen. Literatur Baker et al, Pediatr Clin N Am 62:607 (2015) / Schaefer et al, Gen Med 15(5):399 (2013) Autismus CACNA1C, CDKL5, FOXP1, MECP2, PTEN, TCF4, UBE3A, ZEB2 23,6 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ALDH5A1, AP1S2, ARX, ATRX, AUTS2, BRAF, CACNA1C, CASK, CDKL5, CHD7, CHD8, CNTNAP2, DHCR7, DPP6, EHMT1, FGD1, FOXG1, FOXP1, FOXP2, GRIN2B, HPRT1, KDM5C, L1CAM, MBD5, MECP2, MED12, MEF2C, MID1, NHS, NIPBL, NLGN3, NLGN4X, NRXN1, NSD1, OPHN1, PCDH19, PHF6, PNKP, PQBP1, PTCHD1, PTEN, PTPN11, RAB39B, RAI1, SCN1A, SHANK2, SHANK3, SLC9A6, SMARCB1, SMC1A, SMC3, TCF4, TSC1, TSC2, UBE2A, UBE3A, VPS13B, ZEB2 206,7 kb 48

49 Erkrankungen, OMIM, ICD-10, Gene bei Autismus Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Alpha-Thalassämie-X-chromosomale Intelligenzminderung-Syndrom D56.0 XL ATRX Angelman-Syndrom Q93.5 AD UBE3A * Asperger-Syndrom Suszeptibilität, X-chromosomal Q84.5 XL NLGN3 *,** Autismus Suszeptibilität, X-chromosomal Q84.0 XL NLGN4X *,** Mentale Retardierung, X-chromosomal Autismus, Suszeptibilität Q84.0 AD SHANK2 *,** Autismus, Suszeptibilität, Q84.0 AD CHD Autismus, Suszeptibilität, X-chromosomal Q84.0 XL PTCHD1*,** Bannayan-Riley-Ruvalcaba-Syndrom (BRRS) Q89.- AD PTEN *,** Borjeson-Forssman-Lehmann-Syndrom Q87.8 XL PHF6 *,** CHARGE-Syndrom Q87.8 AD CHD7 *,** Coffin-Siris-Syndrom Q87.1 AD SMARCB1 *,** Cohen-Syndrom Q87.8 AR VPS13B Cornelia-de-Lange-Syndrom Q87.1 AD NIPBL Cornelia-de-Lange-Syndrom Q87.- XL SMC1A *,** Cornelia-de-Lange-Syndrom Q87.- AD SMC3 *,** Dravet-Syndrom G40.4 AD SCN1A *,** Frühkindliche epileptische Enzephalopathie G40.4 XL ARX *,** Frühkindliche epileptische Enzephalopathie G40.4 XL CDKL5 *,** Rett-Syndrom, atypisch Frühkindliche epileptische Enzephalopathie G40.4 XL PCDH19 *,** Frühkindliche epileptische Enzephalopathie G40.4 AD GRIN2B Hydrocephalus durch Aquaedukt-Stenose Q04.8 XL L1CAM Intelligenzminderung, ausgeprägte Q87.2 AD FOXP Sprachverzögerung, milde Dysmorphie-Syndrom Intelligenzminderung, X-chromosomal, Q04.3 XL CASK mit Mikrozephalie, Hirnstamm- und Kleinhirn- Hypoplasie Kardio-fazio-kutanes-Syndrom Q87.1 AD BRAF * Kleefstra-Syndrom Q87.8 AD EHMT Lesch-Nyhan-Syndrom E79.1 XL HPRT Lujan-Fryns-Syndrom Q87.8 XL MED Mentale Retardierung, autosomal dominant F79.- AD MBD Mentale Retardierung, autosomal dominant F79.- AD GRIN2B Mentale Retardierung, autosomal dominant F79.- AD AUTS Mentale Retardierung, autosomal dominant F79.- AD DPP Mentale Retardierung, Stereotypien, Epilepsie, Q93.5 AD MEF2C *,** und/oder Hirnfehlbildungen Mentale Retardierung, X-chromosomal F79.- XL RAB39B *,** Mentale Retardierung, X-chromosomal, mit zerebellärer Hypoplasie und typischem fazialen Aspekt Q04.3 XL OPHN1 *,** Humangenetik 49

50 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Mentale Retardierung, X-chromosomal, syndromal Q87.8 XL KDM5C Claes-Jensen Typ Mentale Retardierung, X-chromosomal-syndromal Q87.8 XL AP1S (Pettigrew-Syndrom) Mentale Retardierung, X-chromosomal-syndromal Q87.1 XL FGD (Aarskog-Scott-Syndrom) Mentale Retardierung, X-chromosomal-syndromal Q87.8 XL SLC9A6 *,** Christianson Typ Mentale Retardierung, X-chromosomal-syndromal Q87.8 XL UBE2A *,** Nascimento Typ Mikrozephalie, Epilepsie und Entwicklungsverzögerung G40.3 AR PNKP *,** Mowat-Wilson-Syndrom Q43.1 AD ZEB2 *,** Nance-Horan-Syndrom Q87.0 XL NHS *,** Noonan-Syndrom Typ Q87.1 AD PTPN11 * Noonan-Syndrom Typ Q87.1 AD BRAF * Opitz GBBB-Syndrom, Typ Q87.8 XL MID1 *,** Phelan-McDermid-Syndrom Q93.5 AD SHANK3 *,** Pitt-Hopkins ähnliches Syndrom F79.- AR CNTNAP Pitt-Hopkins ähnliches Syndrom F79.- AR NRXN1 *,** Pitt-Hopkins-Syndrom Q87.0 AD TCF4 *,** Renpenning-Syndrom Q87.5 XL PQBP1 *,** Rett-Syndrom Q84.2 XL MECP2 *,** Rett-Syndrom, kongenitale Variante Q84.2 AD FOXG1 *,** Smith-Lemli-Opitz-Syndrom Q87.1 AR DHCR Smith-Magenis-Syndrom Q93.5 AD RAI1 *,** Sotos-Syndrom Q87.3 AD NSD1 *,** Sprech- und Sprachstörungen Typ F80.- AD FOXP Succinat-Semialdehyd-Dehydrogenase-Mangel E72.8 AR ALDH5A1 *,** Timothy-Syndrom I45.8 AD CACNA1C * Tuberöse Sklerose Typ Q85.1 AD TSC1 *,** Tuberöse Sklerose Typ Q85.1 AD TSC2 *,** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 50

51 5.2 CDG-Syndrom - Kongenitale Defekte der Glykosylierung Dipl.-Biol. Birgit Busse Kongenitale Defekte der Glykosylierung sind erblich bedingte Defekte der Glykoproteinbiosythese und zählen zu den genetisch-bedingten Stoffwechseldefekten. Es handelt sich meist um schwere Multiorganerkrankungen mit häufig ausgeprägten neurologischen Störungen. Mittlerweile sind verschiedenste Subtypen der CDG-Syndrome bekannt, die nach der Lokalisation des jeweiligen Defektes innerhalb der Zelle und nicht nach klinischen Gesichtspunkten eingruppiert wurden. Mittels NGS-Paneldiagnostik können aktuell 43 Gene für verschiedene CDG-Typen untersucht werden. Am häufigsten ist das CDG-Syndrom Typ Ia, verursacht durch einen Phosphomanno-Mutase-Mangel durch Mutationen im PMM2-Gen. Typisch ist eine ausgeprägte Entwicklungsstörung, es können Hirnfehlbildungen, Skelett-Anomalien, invertierte Mamillen, Gerinnungsdefekte und weitere Symptome hinzukommen. Die Verdachtsdiagnose wird in der Regel zunächst durch eine Stoffwechseldiagnostik mittels Nachweis einer abnormen Glykosylierung der Glykoproteine des Serums, durch eine Serum-Transferrin-Elektrophorese, gestellt und dann mittels molekulargenetischer Untersuchung bestätigt. Ein solcher Nachweis einer auffälligen Glykosylierung der Glykoproteine des Serums liegt jedoch nicht bei allen Typen der CDG-Syndrome vor, so dass bei weiterhin bestehendem Verdacht, auch im Falle eines unauffälligen Befundes der Serum-Transferrin-Elektrophorese, eine NGS-Paneldiagnostik indiziert sein kann und so im Einzelfall zur Diagnose und damit zu genaueren Aussagen zur Prognose und zum Wiederholungsrisiko führen kann. Literatur Timal et al, Human Molecular Genetics 21 (2012) Humangenetik Individuell konfigurierbare MGPS CDG-Syndrom Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ALG1 (1.4 kb) * ALG11 (1.5 kb) * ALG12 (1.5 kb) * ALG13 (3.4 kb) * ALG2 (1.2 kb) * ALG3 (1.3 kb) * ALG6 (1.5 kb) * ALG8 (1.6 kb) * ALG9 (1.9 kb) * B4GALT1 (1.2 kb) * CAD (6.7 kb) * CCDC115 (0.5 kb) * COG1 (2.9 kb) * COG4 (2.4 kb) * COG5 (2.6 kb) * COG6 (2.0 kb) * COG7 (2.3 kb) * COG8 (1.8 kb) * DDOST (1.4 kb) * DOLK (1.6 kb) * DPAGT1 (1.2 kb) * DPM1 (0.8 kb) * DPM2 (0.3 kb) * DPM3 (0.4 kb) * MGAT2 (1.3 kb) * MOGS (2.5 kb) * MPDU1 (0.7 kb) * MPI (1.3 kb) * NGLY1 (2.0 kb) * PGM1 (1.7 kb) * PMM2 (0.7 kb) * RFT1 (1.6 kb) * SLC35A1 (1.0 kb) * SLC35A2 (1.3 kb) * SLC35C1 (1.1 kb) * SLC39A8 (1.4 kb) * SRD5A3 (1.0 kb) * SSR4 (0.6 kb) * STT3A (2.1 kb) * STT3B (2.5 kb) * TMEM165 (1.0 kb) * TMEM199 (0.6 kb) * TUSC3 (1.0 kb) 51

52 CDG-Syndrom ALG12, ALG3, ALG6, ALG8, DPM1, MOGS, MPDU1, MPI, PMM2, SLC35C1, SRD5A3, TUSC3 15,0 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ALG12, ALG3, ALG6, ALG8, DPM1, MOGS, MPDU1, MPI, PMM2, SLC35C1, SRD5A3, TUSC3 ALG1, ALG11, ALG13, ALG2, ALG9, B4GALT1, CAD, CCDC115, COG1, COG4, COG5, COG6, COG7, COG8, DDOST, DOLK, DPAGT1, DPM2, DPM3, MGAT2, NGLY1, PGM1, RFT1, SLC35A1, SLC35A2, SLC39A8, SSR4, STT3A, STT3B, TMEM165, TMEM199 68,7 kb Erkrankungen, OMIM, ICD-10, Gene bei CDG Congenital disorders of glycosylation Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen CDG Congenital disorder of deglycosylation - Typ 1v E77.8 AR NGLY CDG Congenital disorder of glycosylation - Typ 1x E77.8 AR STT3B CDG Congenital disorder of glycosylation - Typ 1a E77.8 AR PMM CDG Congenital disorder of glycosylation - Typ 1b E77.8 AR MPI CDG Congenital disorder of glycosylation - Typ 1c E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1d E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1e E77.8 AR DPM CDG Congenital disorder of glycosylation - Typ 1f E77.8 AR MPDU CDG Congenital disorder of glycosylation - Typ 1g E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1h E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1i E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1j E77.8 AR DPAGT CDG Congenital disorder of glycosylation - Typ 1k E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1l E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1m E77.8 AR DOLK CDG Congenital disorder of glycosylation - Typ 1n E77.8 AR RFT CDG Congenital disorder of glycosylation - Typ 1o E77.8 AR DPM CDG Congenital disorder of glycosylation - Typ 1p E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1q E77.8 AR SRD5A CDG Congenital disorder of glycosylation - Typ 1r E77.8 AR DDOST CDG Congenital disorder of glycosylation - Typ 1s / E77.8 XL ALG Frühkindliche epileptische Enzephalopathie 36 CDG Congenital disorder of glycosylation - Typ 1t E77.8 AR PGM CDG Congenital disorder of glycosylation - Typ 1u E77.8 AR DPM

53 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen CDG Congenital disorder of glycosylation - Typ 1w E77.8 AR STT3A CDG Congenital disorder of glycosylation - Typ 1y E77.8 AR SSR CDG Congenital disorder of glycosylation - Typ 1z E77.8 AR CAD CDG Congenital disorder of glycosylation - Typ 2a E77.8 AR MGAT CDG Congenital disorder of glycosylation - Typ 2b E77.8 AR MOGS CDG Congenital disorder of glycosylation - Typ 2c E77.8 AR SLC35C CDG Congenital disorder of glycosylation - Typ 2d E77.8 AR B4GALT CDG Congenital disorder of glycosylation - Typ 2e E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2f E77.8 AR SLC35A CDG Congenital disorder of glycosylation - Typ 2g E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2h E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2i E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2j E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2k E77.8 AR TMEM CDG Congenital disorder of glycosylation - Typ 2l E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2m E77.8 AR SLC35A CDG Congenital disorder of glycosylation - Typ 2n E77.8 AR SLC39A CDG Congenital disorder of glycosylation - Typ 2o E77.8 AR CCDC CDG Congenital disorder of glycosylation - Typ 2p E77.8 AR TMEM Mentale Retardierung, autosomal rezessiv F79.- AR TUSC Humangenetik 5.3 Coffin-Siris-Syndrom (CSS) Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. med. Imma Rost Beim Coffin-Siris-Syndrom handelt es sich um ein komplexes Syndrom, dessen Leitsymptome eine Entwicklungsstörung unterschiedlichen Ausmaßes und eine Muskelhypotonie, ein charakteristisches Aussehen mit vollen Lippen, breiter Mundspalte, breitem Nasenrücken und breiter Nasenspitze, kräftigen Augenbrauen, langen Wimpern und einer Hypertrichose des Körpers bei eher spärlichem Kopfhaar sind. Außerdem ist eine Hypoplasie/Aplasie des Endglieds des 5. Fingers bzw. des Fingernagels charakteristisch. Es kann auch an weiteren Fingern oder auch den Zehen eine Nagelhypoplasie vorliegen. Bei den meisten Kindern liegt im Säuglings- und Kleinkindalter eine Gedeihstörung vor, bei etwa der Hälfte treten Krampfanfälle auf, knapp die Hälfte haben eine Schwerhörigkeit, oft infolge gehäufter Luftwegsinfekte, etwa die Hälfte hat einen Strabismus bzw. eine Ptose. Herzfehler und Fehlbildungen der Niere und ableitenden Harnwege kommen bei ca. einem Drittel der Betroffenen vor. Ursache sind heterozygote Mutationen in derzeit sechs bekannten Genen: ARID1A, ARID1B, SMARCA4, SMARCB1, SMARCE1 und SOX11, wobei Mutationen in ARID1B mit etwa 35-40% am häufigsten sind. Bei etwa 40% der Patienten mit klinischem Verdacht auf ein Coffin-Siris-Syndrom kann in den genannten Genen keine ursächliche Variante nachgewiesen werden. Die Erkrankung wird autosomal-dominant vererbt, wobei allerdings in der Regel bei Betroffenen eine Neumutation vorliegt. Deletionen wurden bisher selten beschrieben (v.a. in ARID1B). Aufgrund der genetischen Heterogenität kann bei klinischem Verdacht auf ein Coffin-Siris-Syndrom eine Gen-Panel-Diagnostik der erwähnten Gene sinnvoll sein. Literatur Hempel A et al, J Med Genet 53:152 (2016) / Schrier SA et al, Am J Med Genet 158A:1865 (2012) / Fleck BJ et al, Am J Med Genet 99:1 (2001) 53

54 Coffin-Siris-Syndrom (CSS) ARID1A, ARID1B, SMARCA4, SMARCB1, SMARCE1, SOX11 22,4 kb Erkrankungen, OMIM, ICD-10, Gene bei Coffin-Siris-Syndrom (CSS) Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Coffin-Siris-Syndrom Q87.1 AD ARID1B Coffin-Siris-Syndrom Q87.1 AD ARID1A Coffin-Siris-Syndrom Q87.1 AD SMARCB Coffin-Siris-Syndrom Q87.1 AD SMARCA Coffin-Siris-Syndrom Q87.1 AD SMARCE Coffin-Siris-Syndrom - Q87.1 AD SOX Core Genes sind fett gedruckt 5.4 Cornelia-de-Lange-Syndrom (CdLS) Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Beim CdLS handelt es sich um ein Fehlbildungs-Retardierungs-Syndrom. Das typische CdLS präsentiert sich mit charakteristischen craniofazialen Dysmorphien, bereits pränataler Wachstumsretardierung, Hypertrichose, Synophrys, Reduktionsfehlbildungen der oberen Extremitäten und Intelligenzminderung (Durchschnittlicher IQ: 53). Zudem finden sich häufig Herzfehler, gastrointestinale Störungen, u.a. Bei milderer Ausprägung, die wahrscheinlich die überwiegende Zahl der Patienten betrifft, sind die fazialen Dysmorphien ebenfalls milder ausgeprägt als bei der klassischen Form. Die kognitive Einschränkung und Extremitätendefekte sind auch weniger schwerwiegend. Bisher sind Mutationen in fünf Genen bekannt, wobei mit 60% den größten Anteil Mutationen im NIPBL-Gen ausmachen. Literatur Dangiolo et al, Am J Med Genet A167:3161 (2015) / Kaiser et al, Hum Mol Genet 23:2888 (2014) / Minor et al, Gene 537:279 (2014) / Kline et al, Am J Med Genet C Semin Med Genet 145C:248 (2007) / Bhuiyan et al, J Med Genet 43:568 (2006) Cornelia-de-Lange-Syndrom # HDAC8, NIPBL, RAD21, SMC1A, SMC3 18,8 kb Erkrankungen, OMIM, ICD-10, Gene bei Cornelia-de-Lange-Syndrom Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Cornelia-de-Lange-Syndrom Q87.1 AD NIPBL *,** Cornelia-de-Lange-Syndrom Q87.- XL SMC1A Cornelia-de-Lange-Syndrom Q87.- AD SMC Cornelia-de-Lange-Syndrom Q87.- AD RAD Cornelia-de-Lange-Syndrom Q87. XL HDAC * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 54

55 5.5 GPI-Ankerdefekte/Hyperphosphatasie-mentale Retardierungssyndrom Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. med. Sandra Wilson Glycosylphosphatidylinositol-Anker (GPI-Anker) sind Proteinkomplexe der Plasmamembran, die Glycoproteine an der Zelloberfläche verankern. Defekte des GPI-Ankers und dadurch verursachte Störungen der GPI-verankerten Proteine stellen eine spezielle Untergruppe der Glykosylierungsstörungen (CDG-Syndrome - Congenital Disorders of Glycosylation) dar. Einige der ersten Erkrankungen, bei denen Defekte in GPI-Anker-assoziierten Genen identifiziert wurden, gehören zur Gruppe der Hyperphosphatasie mit mentaler Retardierung, so zum Beispiel die ursprünglich als Mabry-Syndrom bezeichnete Erkrankung, mit Symptomen einer schweren Entwicklungsstörung mit muskulärer Hypotonie und auch Epilepsie, fazialen Dysmorphien wie Mittelgesichtshypoplasie und Hypertelorismus, hypoplastischen distalen Phalangen der Finger und Zehen, sowie dem Leitsymptom einer persistierenden isolierten Hyperphosphatasie. Bei dieser Gruppe der GPI-Anker-Defekte führen spezifische Veränderungen des GPI-Ankers dazu, dass unter anderem die Alkalische Phosphatase (AP), die normalerweise an GPI-Ankern an der Plasmamembran verankert wird, in größeren Mengen frei im Blut vorkommt und somit zum veränderten Serumparameter einer erhöhten alkalischen Phosphatase, d.h. Hyperphosphatasie führt. Diese Hyperphosphatasie ist eines der Leitsymptome dieser Gruppe der schweren Entwicklungsstörungen. Je nach Art und Lokalisation der verschiedenen GPI-Anker-Defekte können derartige wegweisende Veränderungen von Serumparametern vorliegen, bei anderen Lokalisationen der zugrundeliegenden Störung der GPI-Anker-Synthese oder Funktion können diese Hinweiszeichen auf einen Defekt der GPI-Anker jedoch auch völlig fehlen, was die Diagnostik in diesen Fällen erschwert. Typische Symptome vieler GPI-Anker-Defekte sind schwere Entwicklungsstörungen, Epilepsien, z.t. angeborene Organfehlbildungen und faziale Dysmorphien. In den letzten Jahren wurden bereits verschiedenste Gene identifiziert, die zu einer Störung des Mechanismus der GPI-Anker-Synthese bzw. Funktion führen. Mittels Next Generation Sequencing (NGS) besteht nun die Möglichkeit, bei entsprechendem klinischen Verdacht, durch eine erweiterte Diagnostik (Gen-Panel Analyse) im Einzelfall zur Diagnose und damit zu genaueren Aussagen zur Prognose und zum Wiederholungsrisiko zu kommen. Literatur Makrythanasis et al, Am J Hum Genet 98:615 (2016) / Murakami et al. J Biol Chem 287:6318 (2012) / Krawitz et al, Nat Genet 42:827 (2010) Humangenetik GPI-Ankerdefekte/Hyperphosphatasie-mentale Retardierungssyndrom PGAP1, PGAP2, PGAP3, PIGA, PIGG, PIGL, PIGN, PIGO, PIGT, PIGV, PIGW, PIGY 20,6 kb 55

56 Erkrankungen, OMIM, ICD-10, Gene bei GPI-Ankerdefekte/Hyperphosphatasie-mentale Retardierungssyndrom Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen CHIME-Syndrom Q87.0 AR PIGL Hyperphosphatasie-mentale Retardierungs- Syndrom 1 (HPMRS1) / Mabry-Syndrom F79.- AR PIGV Hyperphosphatasie-mentale Retardierungs- Syndrom F79.- AR PIGO Hyperphosphatasie-mentale Retardierungs- Syndrom F79.- AR PGAP Hyperphosphatasie-mentale Retardierungs- Syndrom F79.- AR PGAP Hyperphosphatasie-mentale Retardierungs- Syndrom F79.- AR PIGW Hyperphosphatasie-mentale Retardierungs- Syndrom F79.- AR PIGY Mentale Retardierung, autosomal rezessiv F79.- AR PGAP Mentale Retardierung, autosomal-rezessiv Q87.0 AR PIGG Multiple kongenitale Anomalien-Hypotonie- Krampfanfälle-Syndrom Q87.8 AR PIGN Multiple kongenitale Anomalien-Hypotonie- Krampfanfälle-Syndrom Q87.8 XL PIGA Multiple kongenitale Anomalien-Hypotonie- Krampfanfälle-Syndrom Q87.8 AR PIGT Großwuchs-Syndrome Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Großwuchssyndrome umfassen eine heterogene Gruppe von Erkrankungen, denen ein überdurchschnittliches (Längen-)Wachstum im Kindesalter gemeinsam ist. Zu den pädiatrischen Großwuchssyndromen zählen u.a. Beckwith-Wiedemann-, Sotos-, Weaver-, Simpson-Golabi-Behmel-, Perlman- und das Tatton- Brown-Rahman-Syndrom. Hauptkennzeichen sind erhöhtes prä- und postnatales Längenwachstum - im Vergleich mit Gleichaltrigen -, faziale Auffälligkeiten und teilweise psychomotorische Entwicklungsverzögerung. Bei den Syndromen gibt es z.t. phänotypische Überlappungen, die eine klinische Abgrenzung erschweren, aber auch charakteristische Symptome, die eine bestimmte Verdachtsdiagnose nahelegen, wie z.b. die Kombination aus Großwuchs, Omphalozele und Makroglossie beim Beckwith-Wiedemann- Syndrom. Veränderungen in verschiedenen Genen, wie NSD1 (Sotos-Syndrom 1), NFIX (Sotos-Syndrom 2) und EZH2 (Weaver-Syndrom) bilden die molekulare Grundlage der Syndrome, deren Untersuchung zur differenzialdiagnostischen Aufklärung verhelfen kann. Das Tatton-Brown-Rahman-Syndrom oder 'DNMT3A- Großwuchssyndrom' entsteht durch Mutationen des DNMT3A-Gens. Es handelt sich um eines der Gene, die für DNA-Methyltransferase-Enzyme kodieren. Eine Sonderstellung nimmt das Beckwith-Wiedemann- Syndrom ein, das nicht nur durch Mutationen in CDKN1C, sondern (häufiger) durch epigenetische Veränderungen auf dem Kurzarm von Chromosom 11 verursacht wird. Bei einigen der Syndrome besteht ein erhöhtes Risiko für embryonale Tumoren, beim Beckwith-Wiedemann- und beim Perlman-Syndrom für einen Wilms-Tumor. Literatur: da Silva Lacerda et al Radiol Res and Pract, Article ID / /Tatton-Brown et al Nat Genet / 46:385/Tatton- Brown et al Am J Med Genet C Semin Med Genet 163C:71 Großwuchs-Syndrom CDKN1C, DIS3L2, DNMT3A, EED, EZH2, GPC3, NFIX, NSD1, OFD1 24,5 kb 56

57 Erkrankungen, OMIM, ICD-10, Gene bei Großwuchs-Syndromen Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Beckwith-Wiedemann-Syndrom Q87.3 AD CDKN1C Marshall-Smith-Syndrom Q87.3 AD NFIX Perlman-Syndrom Q87.3 AR DIS3L Simpson-Golabi-Behmel-Syndrom, Typ Q87.3 XL GPC Simpson-Golabi-Behmel-Syndrom, Typ Q87.3 XL OFD Sotos-Syndrom Q87.3 AD NSD1 *,** Sotos-Syndrom Q87.3 AD NFIX Tatton-Brown-Rahman-Syndrom Q87.3 AD DNMT3A * Weaver-Syndrom Q87.3 AD EZH2 * EED * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Humangenetik 5.7 Kabuki-Syndrom Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Beim Kabuki-Syndrom liegt eine charakteristische Kombination von kleinen äußeren Merkmalen, Fehlbildungen und einer Entwicklungsstörung, oft auch Gedeihstörung im Säuglings- und Kleinkindesalter vor. Charakteristische kraniofaziale Merkmale sind die seitlich verlängert wirkenden Lidspalten mit einer Inversion des lateralen Unterlidrandes, bogenförmige, lateral spärliche Augenbrauen, oft mit einem unbehaarten schmalen Bereich in der Mitte, eine kurze Columella und damit eine flach wirkende Nasenspitze, wenig modellierte, große Ohrmuscheln, an den Händen embryonale Fingerbeerenpolster, Brachy-Klinodaktylie V, gelegentlich Gaumen- oder Lippen-Kiefer-Gaumen-Spalten. Anfangs können Muskelhypotonie, ausgeprägte Gedeihstörung, die eine Sondenernährung erfordert, und ein Herzfehler im Vordergrund stehen, später eine mäßige Entwicklungsverzögerung, gehäufte Otitiden und Infekte sowie bei manchen Patienten Krampfanfälle. Verursacht wird das Kabuki-Syndrom zu ca. 60% durch heterozygote Mutationen im KMT2D-Gen, selten durch Mutationen in KDM6A auf dem X-Chromosom; bei einigen wurde bisher keine Ursache gefunden, so dass genetische Heterogenität vermutet wird. Literatur Micale et al, Orphanet J Rare Dis.; 6: 38 (2011) / Miyake et al, Am J Med Genet A;161A(9):2234 (2013) / Adam et al, GeneReviews Kabuki syndrome (2011) Kabuki-Syndrom # KDM6A, KMT2D 20,8 kb Erkrankung, OMIM, ICD-10, Gene bei Kabuki-Syndrom Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Kabuki-Syndrom Q87.0 AD KMT2D*, ** Kabuki-Syndrom Q87.0 XL KDM6A** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 57

58 5.8 Makrozephalien Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. med. Imma Rost Eine Makrozephalie, definiert als ein frontookzipitaler Kopfumfang oberhalb der 97. Perzentile, kann verschiedenste Ursachen haben. Abzugrenzen sind eine asymptomatische familiäre Form (sog. benigne Makrozephalie) sowie sekundäre Formen infolge eines Hydrozephalus oder anderer raumfordernder intrakranieller Prozesse wie z.b. Tumoren, Hygrome, Hämatome. Selten wird eine isolierte Verdickung der Schädelkalotte vorliegen. In den meisten anderen Fällen kann eine mehr oder weniger ausgeprägte Megalenzephalie zu Grunde liegen, die wiederum verschiedenste Ursachen haben kann. Nach Ausschluss der o.g. sekundären Ursachen kommen hier in erster Linie seltene genetisch bedingte Erkrankungen in Frage, wie z. B. lysosomale Speichererkrankungen, Leukodystrophien wie M. Alexander, Stoffwechselstörungen der organischen oder der Aminosäuren wie Glutarazidurie oder z. B. ein M. Canavan sowie weitere syndromale Erkrankungen wie z.b. Großwuchssyndrome. Falls die übliche Abklärung mittels bildgebender Verfahren und/oder Stoffwechseluntersuchungen keine Ursache aufdeckt, kann eine genetische Untersuchung mittels Next Generation Sequencing (Gen-Panel Diagnostik), v.a. bei gleichzeitigem Vorhandensein einer Entwicklungsstörung, zur Ursachenklärung beitragen. Makrozephalien EZH2, GCDH, NFIX, NSD1, PTCH1, PTEN, SHANK3 24,4 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. EZH2, GCDH, NFIX, NSD1, PTCH1, PTEN, SHANK3 AKT3, AMER1, ASPA, BRAF, BRWD3, CBL, CCDC22, CCND2, CDKN1C, CHD8, CUL4B, DIS3L2, DNMT3A, DVL1, DVL3, FOXP1, GFAP, GLI3, GPC3, GRIA3, HE- PACAM, HRAS, HUWE1, KIAA0196, KIF7, KPTN, KRAS, LZTR1, MAP2K1, MAP2K2, MED12, MLC1, MTOR, NDUFA1, NONO, NRAS, OFD1, PIGA, PIGN, PIGT, PIGV, PIK3R2, PPP1CB, PPP2R5D, PTCH2, PTPN11, RAB39B, RAF1, RASA2, RIT1, RNF135, ROR2, RRAS, SETD2, SHOC2, SOS1, SOS2, SUFU, TBC1D7, TMCO1, UPF3B, WNT5A, ZDHHC9 180,4 kb 58

59 Erkrankungen, OMIM, ICD-10, Gene bei Makrozephalien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Acrocallosales Syndrom Q04.0 AR KIF Alexander-Syndrom E75.- AD GFAP Autismus, Suszeptibilität, Q84.0 AD CHD Bannayan-Riley-Ruvalcaba-Syndrom (BRRS) Q89.- AD PTEN *,** Basalzellnävus-Syndrom Q87.8 AD PTCH1 *,** Basalzellnävus-Syndrom Q87.8 AD PTCH2 *,** Basalzellnävus-Syndrom Q87.8 AD SUFU *,** Beckwith-Wiedemann Syndrom Q87.3 AD CDKN1C Canavan-Krankheit E75.- AR ASPA Costello-Syndrom Q87.8 AD HRAS * Glutarazidurie Typ E72.3 AR GCDH * Greig-Syndrom Q87.0 AD GLI Hyperphosphatasie-mentale Retardierung-Syndrom 1 (HPMRS1) / Mabry-Syndrom F79.- AR PIGV *,** Intelligenzminderung, ausgeprägte Sprachverzögerung, milde Dysmorphie-Syndrom Q87.2 AD FOXP Kardio-fazio-kutanes Syndrom Q87.8 AD KRAS * Kardio-fazio-kutanes Syndrom Q87.8 AD MAP2K1 * Kardio-fazio-kutanes Syndrom Q87.8 AD MAP2K2 * Kardio-fazio-kutanes-Syndrom Q87.1 AD BRAF * Kraniofaziale Dysmorphien, skeletale Anomalien und mentale Retardierung Syndrom Q87.5 AR TMCO1 *,** Lujan-Fryns-Syndrom Q87.8 XL MED Luscan-Lumish Syndrom Q87.3 AD SETD2 *,** Makrozephalie, Makrosomie, faziale Dysmorphie- Syndrom Q04.5 AD RNF135 *,** Makrozephalie/Megalenzephalie-Syndrom, autosomal-rezessiv Q04.5 AR TBC1D7 *,** Marshall-Smith-Syndrom Q87.3 AD NFIX Megalenzephale Leukoenzephalopathie mit subkortikalen Zysten E75.2 AR MLC1 *,** Megalenzephale Leukoenzephalopathie mit subkortikalen Zysten 2A E75.2 AR HEPACAM Megalenzephale Leukoenzephalopathie mit subkortikalen Zysten 2B E75.2 AD HEPACAM Megalenzephalie-Polymikrogyrie-postaxiale Polydaktylie-Hydrozephalus-Syndrom Q04.8 AD PIK3R2 *,** Megalenzephalie-Polymikrogyrie-postaxiale Polydaktylie-Hydrozephalus-Syndrom Q04.8 AD AKT3 *,** Megalenzephalie-Polymikrogyrie-postaxiale Polydaktylie-Hydrozephalus-Syndrom Q04.8 AD CCND Mentale Retardierung, autosomal dominant F79.- AD PPP2R5D *,** Mentale Retardierung, autosomal rezessiv F79.- AR KPTN Mentale Retardierung, X-chromosomal F79.- XL RAB39B *,** Mentale Retardierung, X-chromosomal F79.- XL BRWD Mentale Retardierung, X-chromosomal F79.- XL GRIA Humangenetik 59

60 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Mentale Retardierung, X-chromosomal, syndromal 14 / Lujan-Fryns-Syndrom ähnlich Q87.8 XL UPF3B Mentale Retardierung, X-chromosomal, syndromal 15 (Cabezas Typ) Q87.8 XL CUL4B Mentale Retardierung, X-chromosomal, syndromal F79.- XL NONO *,** Mentale Retardierung, X-chromosomal-syndromal Raymond Typ / Lujan-Fryns-Syndrom-ähnlich Q87.8 XL ZDHHC Mentale Retardierung, X-chromosomal-syndromal Turner Typ Q87.8 XL HUWE Mitochondrialer Komplex I-Defekt G71.3 XL NDUFA1 *,** Multiple kongenitale Anomalien-Hypotonie- Krampfanfälle-Syndrom Q87.8 AR PIGN *,** Multiple kongenitale Anomalien-Hypotonie- Krampfanfälle-Syndrom Q87.8 XL PIGA *,** Multiple kongenitale Anomalien-Hypotonie- Krampfanfälle-Syndrom Q87.8 AR PIGT *,** Noonan-Syndrom - F79 AD RASA Noonan-Syndrom - Q87.1 AD RASA2 * Noonan-Syndrom Q87.1 AD KRAS * Noonan-Syndrom Q87.1 AD SOS1 * Noonan-Syndrom Q87.1 AD NRAS * Noonan-Syndrom Q87.1 AD RIT1 * Noonan-Syndrom Q87.1 AD SOS2 * Noonan-Syndrom Q87.1 AD LZTR Noonan-Syndrom Phänotyp Q87.1 AD RRAS * Noonan-Syndrom Typ Q87.1 AD PTPN11 * Noonan-Syndrom Typ Q87.1 AD RAF1 * Noonan-Syndrom Typ Q87.1 AD BRAF * Noonan-Syndrom-ähnlich mit losem Anagenhaar Q87.0 AD SHOC2 * Noonan-Syndrom-ähnlich mit und ohne juvenile myelomonozytische Leukämie Q87.0 AD CBL * Osteopathia Striata mit kranialer Sklerose Q78.8 XL AMER Pallister-Hall-Syndrom D33.0 AD GLI Perlman-Syndrom Q87.3 AR DIS3L Phelan-McDermid-Syndrom Q93.5 AD SHANK3 *,** Ritscher-Schinzel-Syndrom Q87.8 AR KIAA Ritscher-Schinzel-Syndrom Q87.8 XL CCDC Robinow-Syndrom, autosomal dominant Q87.1 AD WNT5A *,** Robinow-Syndrom, autosomal dominant Q87.1 AD DVL Robinow-Syndrom, autosomal dominant Q87.1 AD DVL Robinow-Syndrom, autosomal rezessiv Q87.1 AR ROR2 *,** Simpson-Golabi-Behmel-Syndrom, Typ Q87.3 XL GPC Simpson-Golabi-Behmel-Syndrom, Typ Q87.3 XL OFD Smith-Kingsmore Syndrom F79.- AD MTOR *,** Sotos-Syndrom Q87.3 AD NSD1 *,** Sotos-Syndrom Q87.3 AD NFIX

61 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Tatton-Brown-Rahman-Syndrom Q87.3 AD DNMT3A Weaver-Syndrom Q87.3 AD EZH * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 5.9 Mikrozephalien, primär, AR (MCPH) - Mikrozephalie-Kleinwuchs-Syndrome Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. med. Imma Rost Autosomal rezessive primäre Mikrozephalien sind sehr seltene Störungen. In der mitteleuropäischen Bevölkerung liegt die Häufigkeit bei ca. 1:1 Mio, in Pakistan bei etwa 1: Sie sind dadurch gekennzeichnet, dass der Kopfumfang bei Geburt bzw. bereits im letzten Schwangerschaftsdrittel mindestens zwei Standardabweichungen unterhalb des Medianwertes liegt. Im Alter von einem halben Jahr kann die Abweichung -3 Standardabweichungen und mehr betragen. Es handelt sich um eine heterogene Gruppe von derzeit 17 Erkrankungen, deren Gene bekannt sind. Da die einzelnen Formen der primären autosomal-rezessiven Mikrozephalien sich klinisch wenig unterscheiden, kann die molekulargenetische Diagnostik auf eine ursächliche Mutation mittels NGS (Gen-Panel Diagnostik) eine Zuordnung ermöglichen. Literatur: Zaqout et al, Neuroped 11 doi: /s (2017) / Passemard et al, Handb Clin Neurol III:129 (2013) / Hussain et al, Am J Hum Genet 90:871 (2012) / Genin et al, Hum Mol Genet 21, 24:5306 (2012) / Mahmood et al, Orphanet J Rare Dis 6:39 (2011) / Kaindl et al, Prog Neurobiol 90:363 (2010) / Kousar et al, J Child Neurol 25:715 (2010) / Willems et al, J Med Genet 47:797 (2010) / Rauch et al, Science 319:816 (2008) / Woods et al, Am J Hum Genet 76:717 (2005) / Neitzel et al, Am J Hum Genet 70:1015 (2002) Humangenetik Primäre (a-r) Mikrozephalien ASPM, CDK5RAP2, CENPJ, MCPH1, SASS6 24,6 kb Erweiterte Diagnostik Mikrozephaler Osteodysplastischer Primordialer Kleinwuchs (MOPD2) PCNT 10,0 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ASPM, CDK5RAP2, CENPJ, MCPH1, SASS6 PCNT CASC5, CDK6, CENPE, CEP135, CEP152, MFSD2A, PCNT, PHC1, STIL, WDR62, ZNF335 86,4 kb 61

62 Erkrankungen, OMIM, ICD-10, Gene bei autosomal-rezessiven primären Mikrozephalien Erkrankung OMIM-P ICD-10 Gen OMIM-Gen MCPH Q02 MCPH MCPH Q02 WDR MCPH Q02 CDK5RAP MCPH Q02 CASC MCPH Q02 ASPM * MCPH Q02 CENPJ MCPH Q02 STIL MCPH Q02 CEP MCPH F79.- CEP MCPH Q02 ZNF MCPH Q02 PHC MCPH Q02 CDK MCPH Q02 CENPE MCPH Q02 SASS MCPH Q02 MFSD2A MOPD Q87.1 PCNT Seckel-Syndrom (SKCL) Q87.1 CENPJ Seckel-Syndrom (SKCL) Q87.1 CEP * auch einzeln anforderbar Core Genes sind fett gedruckt 62

63 5.10 Rett-Syndrom/Rett-Syndrom-ähnliche Erkrankungen Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Das klassische Rett-Syndrom ist eine X-chromosomal-dominante neurodegenerative Erkrankung (Häufigkeit 1:10.000), die überwiegend beim weiblichen Geschlecht auftritt. Beim klassischen Verlauf verlieren die Kinder nach zunächst unauffälliger Entwicklung zwischen dem 6. und 18. Lebensmonat bereits erworbene Fähigkeiten, v.a. sinnvolle Handfunktionen, sprachliche Äußerungen und soziale Interaktion. Ein Leitsymptom ist die Entwicklung stereotyper Handbewegungen. Weitere Symptome sind verzögertes Wachstum, Mikrozephalie, Gangataxie, Episoden von Apnoe oder Hyperpnoe, Schlafstörungen, zunehmende Skoliose und Krampfanfälle. Die wenigen männlichen Betroffenen zeigen überwiegend eine schwere neonatale Enzephalopathie. Das klassische Rett-Syndrom wird durch Mutationen im MECP2-Gen hervorgerufen. Nicht-klassische, atypische Formen des Rett-Syndroms mit früh einsetzenden Krampfanfällen können durch Mutationen im CDKL5-Gen verursacht sein (siehe auch atypisches Rett-Syndrom, frühkindliche Epilepsie). Mutationen im FOXG1-Gen wurden sowohl bei klassischen als auch bei atypischen Formen des Rett- Syndroms beschrieben und zeigen eine sehr große klinische Heterogenität. In den letzten Jahren wurden noch einige weitere Gene entdeckt, in denen Mutationen beschrieben wurden, die zu Rett-Syndromähnlichen Krankheitsbildern bzw. Verläufen führen können. Bei Patienten mit Rett-Syndrom-ähnlichen Erkrankungen kann daher eine NGS-Paneldiagnostik indiziert sein, die im Einzelfall zur Diagnose und damit zu genaueren Aussagen zur Prognose und zum Wiederholungsrisiko führen kann. Literatur: Allou et al, Clin Genet doi: /cge (2016) / Le Meur et al, J Med Genet 47:22 (2010) / Tran Mau-Them et al, Eur J Hum Genet 22:289 (2014) / Olson et al, Am J Med Genet A 167:2017 (2015) Humangenetik Rett-Syndrom und ähnliche Erkrankungen CDKL5, FOXG1, IQSEC2, MECP2, MEF2C, NTNG1, STXBP1, TCF4, UBE3A, ZEB2 24,4 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CDKL5, FOXG1, IQSEC2, MECP2, MEF2C, NTNG1, STXBP1, TCF4, UBE3A, ZEB2 ALDH5A1, ARX, BDNF, FOXP2, KCNA2, KCNQ2, PLP1, SCN2A, SCN8A, SHANK3 52,6 kb 63

64 Erkrankungen, OMIM, ICD-10, Gene bei Rett-Syndrom/Rett-Syndrom-ähnlichen Erkrankungen Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Angelman-Syndrom Q93.5 AD UBE3A*, ** Frühkindliche epileptische Enzephalopathie G40.4 XL ARX*, ** Frühkindliche epileptische Enzephalopathie 2 / Rett-Syndrom, atypisch G40.4 XL CDKL5*, ** Frühkindliche epileptische Enzephalopathie G40.4 AD STXBP1* Frühkindliche epileptische Enzephalopathie G40.4 AD KCNQ Frühkindliche epileptische Enzephalopathie G40.3 AD SCN2A* Frühkindliche epileptische Enzephalopathie G40.4 AD SCN8A Frühkindliche epileptische Enzephalopathie G40.4 AD KCNA Mentale Retardierung, Stereotypien, Epilepsie, und/oder Hirnfehlbildungen Q93.5 AD MEF2C Mentale Retardierung, X-chromosomal 1/ F79.- XL IQSEC Mowat-Wilson-Syndrom Q43.1 AD ZEB2*, ** Pelizaeus-Merzbacher-Syndrom E75.2 XL PLP Phelan-McDermid-Syndrom Q93.5 AD SHANK3** Pitt-Hopkins-Syndrom Q87.0 AD TCF4*, ** Rett-Syndrom Q84.2 XL MECP2*, ** Rett-Syndrom ähnlich - Q BDNF Rett-Syndrom ähnlich - F NTNG Rett-Syndrom, kongenitale Variante Q84.2 AD FOXG1*, ** Sprech- und Sprachstörungen Typ F80.- AD FOXP Succinat-Semialdehyd-Dehydrogenase-Mangel E72.8 AR ALDH5A * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 5.11 Robinow-Syndrom Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. med. Imma Rost Beim Robinow-Syndrom handelt es sich um eine seltenes genetisch bedingtes Syndrom, dessen Leitsymptome charakteristische kraniofaziale Merkmale (prominente Stirn und flaches Mittelgesicht, kurze Nase mit evertierter Nasenbodenebene, weiter Augenabstand), ein Kleinwuchs mit mesomeler Verkürzung v.a. der oberen Extremität, Brachyklinodaktylie V und ein hypoplastisches Genitale v.a. im männlichen Geschlecht sind. Bei 80-90% sind die kognitiven Fähigkeiten normal. Bei 10-20% wird eine Entwicklungsstörung beschrieben. Die Erstbeschreibung durch Meinhard Robinow et al (1969) an einer Familie mit Betroffenen in sechs Generationen ließ auf eine autosomal-dominante Vererbung schließen. Betroffene Geschwister bei gesunden Eltern, v.a. bei Konsanguinität, zeigten, dass es auch eine autosomal-rezessiv vererbte Form gibt. Als Ursache dieser Form wurden Mutationen in ROR2 gefunden [Afzal et al, (2000), van Bokhoven et al (2000)], eine Tyrosin-Kinase, deren Mutationen auch eine autosomal-dominante Form der Brachydaktylie B verursachen. Als genetische Ursache der autosomal-dominant vererbten Form in der Familie aus der Erstbeschreibung wiesen Person et al (2010) Mutationen im WNT5A-Gen nach, 2015 wurden als weitere Ursache Mutationen in den Genen DVL1 und DVL3 gefunden (White et al). Damit werden genetisch derzeit drei Formen unterschieden; klinisch sind die dominanten Formen ähnlich, die rezessive Form scheint mit einem deutlicheren Minderwuchs und zusätzlichen Skelettfehlbildungen im Bereich der Rippen und Wirbelkörper verbunden zu sein. Literatur White et al, AJHG, 98,553 (2016) / White et al, AJHG 96,645 (2015) / Person et al, Dev Dyn 239,327 (2010) / van Bokhoven et al, Nat Genet 25,423 (2000) / Afzal et al, Nat Genet 25,419 (2000)/ Robinow et al, Am J Dis Child 117,645 (1969) 64

65 Robinow-Syndrom # DVL1, DVL3, ROR2, WNT5A 8,1 kb Erkrankungen, OMIM, ICD-10, Gene bei Robinow-Syndrom Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Robinow-Syndrom, autosomal dominant Q87.1 AD WNT5A Robinow-Syndrom, autosomal dominant Q87.1 AD DVL Robinow-Syndrom, autosomal dominant Q87.1 AD DVL Robinow-Syndrom, autosomal rezessiv Q87.1 AR ROR Core Genes sind fett gedruckt Humangenetik 5.12 Rubinstein-Taybi-Syndrom (RTS) Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. med. Imma Rost Das Rubinstein-Taybi-Syndrom ist gekennzeichnet durch die Leitsymptome Intelligenzminderung, postnatale Wachstumsverzögerung mit reduzierter Endgröße, Mikrozephalie und faziale Merkmale wie ein tiefer Haaransatz, breite, gebogene Augenbrauen, Lidachsenverlauf nach außen unten, im Profil Ansatz der Columella unterhalb der Nasenflügel, Retrognathie, Zahnanomalien, sowie breite, oft nach radial abgewinkelte Daumen und breite Großzehen. Beim Lachen kann es zu einem charakteristischen Gesichtsausdruck mit nahezu geschlossenen Augen kommen. Häufig treten Krampfanfälle auf. Das Rubinstein-Taybi-Syndrom tritt in aller Regel sporadisch auf. Die Prävalenz wird auf ca. 1: geschätzt. Als Ursache für das Rubinstein-Taybi-Syndrom sind bisher zum einen Mutationen im CREBBP-Gen (ca %), welches für das Cyclisches-AMP-regulierte Enhancer-Bindeprotein codiert, bekannt. Zudem wurden Mutationen im EP300- Gen (ca. 5%) beschrieben, das für das E1A-Bindeprotein p300 codiert. Diese beiden Proteine sind als transkriptionelle Co-Aktivatoren in vielen Signalwegen innerhalb der Zelle involviert (z.b. DNA-Reparatur, Wachstum, Differenzierung, Apoptose). Literatur Milani et al. (2015) Pediatr.;41:4/ Stevens et al.(2014) Gene reviews / Bartsch et al, Am J Med Genet 152A:181 (2010) / Schorry et al, Am J Med Genet 146A:2512 (2008) Rubinstein-Taybi-Syndrom Hum EBM Genet Kap 14: , (2006) GOP / Bartsch und et al, Hum Genet 117:485 (2005) / Wiley et al, Am J Med Genet 119:101 (2003) # CREBBP, EP300 14,6 kb Erkrankungen, OMIM, ICD-10, Gene bei Rubinstein-Taybi-Syndrom Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Rubinstein-Taybi Syndrom Q87.2 CREBBP *,** Rubinstein-Taybi Syndrom Q87.2 EP300 ** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 65

66 5.13 Sprachentwicklungsstörungen Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Sprachentwicklungsstörungen FOXP1, FOXP2, KANSL1, NRXN1, SETBP1 17,0 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. FOXP1, FOXP2, KANSL1, NRXN1, SETBP1 DYRK1A, MBD5, RAI1, SHANK3 38,6 kb Erkrankungen, OMIM, ICD-10, Gene bei Sprachentwicklungsstörungen Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Intelligenzminderung, ausgeprägte Sprachverzögerung, Q87.2 AD FOXP milde Dysmorphie-Syndrom Koolen-De Vries-Syndrom Q93.5 AD KANSL Mentale Retardierung, autosomal dominant F79.- AD MBD Mentale Retardierung, autosomal dominant F79.- AD DYRK1A Mentale Retardierung, autosomal dominant F79.- AD SETBP Phelan-McDermid-Syndrom Q SHANK3** Pitt-Hopkins ähnliches Syndrom F NRXN Smith-Magenis-Syndrom Q93.5 AD RAI Sprech- und Sprachstörungen Typ F80.- AD FOXP ** Deletions-/Duplikationsanalyse 5.14 Tubulinopathien Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. med. Sandra Wilson Tubulinopathien stellen ein breites, überlappendes Spektrum von angeborenen Gehirnfehlbildungen dar, welche durch Mutationen in einem von sieben Genen verursacht werden, die für die verschiedenen Isotypen des Tubulins kodieren. Gehirnfehlbildungen im Rahmen von Tubulinopathien können sich unter anderem in Form einer Lissenzephalie manifestieren, im Sinne einer klassischen Lissenzephalie, einer Lissenzephalie mit zerebellärer Hypoplasie, einer Lissenzephalie mit Agenesie des Corpus callosum, oder auch einer Lissenzephalie mit Pachygyrie. Weitere häufige Fehlbildungen sind eine Polymikrogyrie-ähnliche kortikale Dysplasie, eine rarefizierte Gyrierung, oder auch eine Mikrolissenzephalie, oft in Kombination mit dysplastischen Basalganglien, Corpus callosum-auffälligkeiten, sowie Hypoplasien oder Dysplasien des Stammhirns und Zerebellums. Klinische Symptome sind unter anderem eine globale Entwicklungsstörung, Epilepsien, oft auch eine primäre Mikrozephalie und Augenbeteiligungen verschiedenster Ausprägung. Die Diagnosestellung erfolgt in der Regel anhand der spezifischen Befunde der Gehirnfehlbildungen, eine molekulargenetische Bestätigung 66

67 der Verdachtsdiagnose kann anhand der Untersuchung der sieben bekannten Gene erfolgen, die für die verschiedenen Isotypen des Tubulins kodieren. Die meisten Tubulinopathien folgen einem autosomaldominanten Erbgang und werden meist durch spontan entstandene (de novo) Neumutationen in einem der folgenden sechs Gene verursacht: TUBA1A, TUBB2A, TUBB2B, TUBB3, TUBB und TUBG1. Selten können auch homozygote oder compound-heterozygote Mutationen im TUBA8-Gen identifiziert werden, die einem autosomal-rezessiven Erbgang folgen. Literatur Bahi-Buisson et al, GeneReview 1993 (2016) / Mirzaa et al, Am J Med Genet C Semin Med Genet 166C(2):117 (2014) / Fallet-Bianco et al, Acta Neuropathol Commun 25 (2):69 (2014) # Tubulinopathien / Hirnfehlbildungen TUBA1A, TUBA8, TUBB, TUBB2A, TUBB2B, TUBB3, TUBG1 9,4 kb Humangenetik Erkrankungen, OMIM, ICD-10, Gene bei Tubulinopathien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen α-tubulinopathie - Kortikale Dysgenese mit Q04.- AR TUBA pontozerebelläre Hypoplasie 8 α-tubulinopathie - Lissenzephalie Q04.- AD TUBA1A* β-tubulinopathie - Kortikale Dysgenese mit Q04.- AD TUBB3* pontozerebelläre Hypoplasie 1 β-tubulinopathie - Kortikale Dysgenese mit Q04.- AD TUBB2A pontozerebelläre Hypoplasie 5 β-tubulinopathie - Kortikale Dysgenese mit Q04.- AD TUBB* pontozerebelläre Hypoplasie 6 β-tubulinopathie - Kortikale Dysgenese mit Q04.- AD TUBB2B* pontozerebelläre Hypoplasie 7 ɣ-tubulinopathie - Kortikale Dysgenese mit Q04.- AD TUBG pontozerebelläre Hypoplasie 4 * auch einzeln anforderbar 67

68 5.15 X-Gebundene Mentale Retardierung Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh X-Gebundene Mentale Retardierung Individuell konfigurierbare MGPS Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ACSL4 (2.1 kb) * AGTR2 (1.1 kb) * AIFM1 (1.8 kb) * ALG13 (3.4 kb) * AMER1 (3.4 kb) * AP1S2 (0.5 kb) * ARHGEF6 (2.3 kb) * ARHGEF9 (1.5 kb) * ARX (1.7 kb) * ATP6AP2 (1.1 kb) * ATP7A (4.5 kb) * ATRX (7.5 kb) * BCOR (5.3 kb) * BRWD3 (5.4 kb) * CASK (2.8 kb) * CCDC22 (1.9 kb) * CDKL5 (3.1 kb) * CLCN4 (2.3 kb) * CLIC2 (0.7 kb) * CUL4B (2.7 kb) * DCX (1.3 kb) * DDX3X (2.0 kb) * DKC1 (1.5 kb) * DLG3 (2.5 kb) * DMD (11.1 kb) * FGD1 (2.9 kb) * FLNA (7.9 kb) * FTSJ1 (1.0 kb) * GDI1 (1.3 kb) * GK (1.7 kb) * GPC3 (1.8 kb) * GRIA3 (2.7 kb) * HCCS (0.8 kb) * HCFC1 (6.1 kb) * HDAC8 (1.1 kb) * HPRT1 (0.7 kb) * HUWE1 (13.1 kb) * IDS (1.6 kb) * IKBKG (1.5 kb) * IL1RAPL1 (2.1 kb) * IQSEC2 (4.5 kb) * KDM5C (4.7 kb) * KDM6A (4.4 kb) * KIAA2022 (4.5 kb) * L1CAM (3.8 kb) * LAMP2 (1.2 kb) * LAS1L (2.2 kb) * MAOA (1.6 kb) * MBTPS2 (1.6 kb) * MECP2 (1.5 kb) * MED12 (6.5 kb) * MID1 (2.0 kb) * NAA10 (0.7 kb) * NDP (0.4 kb) * NDUFA1 (0.2 kb) * NHS (5.0 kb) * NLGN3 (2.5 kb) * NLGN4X (2.4 kb) * NONO (1.4 kb) * NSDHL (1.1 kb) * OCRL (2.7 kb) * OFD1 (3.0 kb) * OPHN1 (2.4 kb) * OTC (1.1 kb) * PAK3 (1.7 kb) * PCDH19 (3.4 kb) * PDHA1 (1.3 kb) * PGK1 (1.3 kb) * PHF6 (1.1 kb) * PHF8 (3.2 kb) * PIGA (1.5 kb) * PLP1 (0.8 kb) * PORCN (1.4 kb) * PQBP1 (0.8 kb) * PRPS1 (1.0 kb) * PTCHD1 (2.7 kb) * RAB39B (0.6 kb) * RBM10 (3.0 kb) * RPS6KA3 (2.2 kb) * SLC16A2 (1.6 kb) * SLC6A8 (1.9 kb) * SLC9A6 (2.1 kb) * SMC1A (3.7 kb) * SMS (1.1 kb) * SYN1 (2.1 kb) * SYP (0.9 kb) * TAF1 (5.7 kb) * THOC2 (4.8 kb) * TIMM8A (0.3 kb) * TSPAN7 (0.7 kb) * UBE2A (0.5 kb) * UPF3B (1.4 kb) * USP9X (7.7 kb) * WDR45 (1.1 kb) * ZDHHC15 (1.0 kb) * ZDHHC9 (1.1 kb) * ZNF711 (2.3 kb) * ZNF81 (2.0 k) 68

69 Erkrankungen, OMIM, ICD-10, Gene bei X-gebundene Mentaler Retardierung Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Allan-Herndon-Dudley-Syndrom F79.- SLC16A Alpha-Thalassämie-X-chromosomale Intelligenzminderung D56.0 ATRX Syndrom Arts-Syndrom F79.- PRPS Asperger-Syndrom Suszeptibilität, X-chromosomal Q84.5 NLGN Autismus Suszeptibilität, X-chromosomal 2 / Mentale Retardierung, Q84.0 NLGN4X X-chromosomal Autismus, Suszeptibilität, X-chromosomal Q84.0 PTCHD Borjeson-Forssman-Lehmann-Syndrom Q87.8 PHF6* Brunner-Syndrom Q87.8 MAOA CDG Congenital disorder of glycosylation - Typ 1s / Frühkindliche E77.8 ALG epileptische Enzephalopathie 36 CK-Syndrom NSDHL Coffin-Lowry Syndrom Q87.0 RPS6KA Cornelia-de-Lange-Syndrom Q87.- SMC1A Cornelia-de-Lange-Syndrom Q87.- HDAC Cowchock-Syndrom G60.0 AIFM Danon-Krankheit / Glykogenose durch LAMP-2-Mangel E74.0 LAMP Dyskeratosis congenita, X-chromosomal (Zinsser-Cole-Engman-Syndrom) Q82.8 DKC Epilepsie, X-chromosomal, mit variablen Lernproblemen und Q87.8 SYN Verhaltensauffälligkeiten Fokale dermale Hypoplasie Q82.8 PORCN Frühkindliche epileptische Enzephalopathie G40.4 ARX*, ** Frühkindliche epileptische Enzephalopathie 2 / Rett-Syndrom, G40.4 CDKL5*, ** atypisch Frühkindliche epileptische Enzephalopathie G40.4 ARHGEF Frühkindliche epileptische Enzephalopathie G40.4 PCDH19*, ** Glycerol-Kinase Defizienz E74.8 GK Glykogenose durch Phosphoglycerat-Kinase 1-Mangel E74.0 PGK Heterotopie, periventrikulär nodulär Q04.8 FLNA* Hydrocephalus durch Aquaedukt-Stenose Q04.8 L1CAM IFAP-Syndrom mit oder ohne BRESHECK-Syndrom Q87.8 MBTPS Incontinentia pigmenti / Bloch-Sulzberger-Syndrom Q82.3 IKBKG Intelligenzminderung, X-chromosomal, mit Mikrozephalie, Q04.3 CASK Hirnstamm- und Kleinhirn-Hypoplasie Kabuki-Syndrom Q87.0 KDM6A** Kreatin-Transporter-Mangel, X-chromosomal E72.8 SLC6A Lesch-Nyhan-Syndrom E79.1 HPRT Lineare Hautdefekte mit multiplen kongenitalen Anomalien Q11.2 HCCS Lissenzephalie, X-chromosomal Q04.3 DCX Lowe-Syndrom F72.0 OCRL Lujan-Fryns-Syndrom Q87.8 MED Humangenetik 69

70 Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Menkes-Syndrom E83.0 ATP7A Mentale Retardierung, X-chromosomal 1/ F79.- IQSEC Mentale Retardierung, X-chromosomal 3 (Methylmalon-Azidämie E71.1 HCFC und Homocysteinämie, cblx Typ) Mentale Retardierung, X-chromosomal F79.- FTSJ Mentale Retardierung, X-chromosomal 12/ F79.- THOC Mentale Retardierung, X-chromosomal F79.- RPS6KA Mentale Retardierung, X-chromosomal 21/ F79.- IL1RAPL Mentale Retardierung, X-chromosomal 30/ F79.- PAK Mentale Retardierung, X-chromosomal F79.- GDI Mentale Retardierung, X-chromosomal F79.- ZNF Mentale Retardierung, X-chromosomal F79.- ARHGEF Mentale Retardierung, X-chromosomal 49/ F79.- CLCN Mentale Retardierung, X-chromosomal F79.- TSPAN Mentale Retardierung, X-chromosomal F79.- ACSL Mentale Retardierung, X-chromosomal F79.- RAB39B Mentale Retardierung, X-chromosomal F79.- AGTR Mentale Retardierung, X-chromosomal F79.- DLG Mentale Retardierung, X-chromosomal F79.- ZDHHC Mentale Retardierung, X-chromosomal F79.- BRWD Mentale Retardierung, X-chromosomal F79.- GRIA Mentale Retardierung, X-chromosomal F79.- SYP Mentale Retardierung, X-chromosomal F79.- ZNF Mentale Retardierung, X-chromosomal F79.- KIAA Mentale Retardierung, X-chromosomal F79.- USP9X Mentale Retardierung, X-chromosomal F79.- DDX3X Mentale Retardierung, X-chromosomal mit Epilepsie (syndromal, F79.- ATP6AP Hedera Typ) Mentale Retardierung, X-chromosomal, mit zerebellärer Hypoplasie Q04.3 OPHN und typischem fazialen Aspekt Mentale Retardierung, X-chromosomal, Snyder-Robinson Typ Q87.8 SMS Mentale Retardierung, X-chromosomal, syndromal 14 / Q87.8 UPF3B Lujan-Fryns-Syndrom ähnlich Mentale Retardierung, X-chromosomal, syndromal 15 (Cabezas Q87.8 CUL4B Typ) Mentale Retardierung, X-chromosomal, syndromal F79.- CLIC Mentale Retardierung, X-chromosomal, syndromal F79.- TAF Mentale Retardierung, X-chromosomal, syndromal F79.- NONO Mentale Retardierung, X-chromosomal, Q87.8 KDM5C syndromal Claes-Jensen Typ Mentale Retardierung, X-chromosomal-syndromal Q87.8 AP1S (Pettigrew-Syndrom) Mentale Retardierung, X-chromosomal-syndromal Q87.1 FGD (Aarskog-Scott-Syndrom) Mentale Retardierung, X-chromosomal-syndromal Christianson Typ Q87.8 SLC9A

71 Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Mentale Retardierung, X-chromosomal-syndromal Nascimento Q87.8 UBE2A*, ** Typ Mentale Retardierung, X-chromosomal-syndromal Raymond Q87.8 ZDHHC Typ / Lujan-Fryns-Syndrom-ähnlich Mentale Retardierung, X-chromosomal-syndromal Turner Typ Q87.8 HUWE Mentale Retardierung-Syndrom, X-chromosomal, Siderius Typ Q87.8 PHF Mikrophthalmie Typ Lenz Q11.2 BCOR* Mitochondrialer Komplex I-Defekt G71.3 NDUFA Mohr-Tranebjaerg-Syndrom G31.8 TIMM8A Mukopolysaccharidose Typ 2 (Hunter-Syndrom) E76.1 IDS** Multiple kongenitale Anomalien-Hypotonie-Krampfanfälle Q87.8 PIGA Syndrom 2 Nance-Horan-Syndrom Q87.0 NHS Neurodegeneration mit Eisenspeicherung im Gehirn Typ G23.0 WDR Norrie-Krankheit H35.5 NDP Ogden-Syndrom F84.- NAA Opitz GBBB-Syndrom, Typ Q87.8 MID Ornithine transcarbamylase deficiency E72.4 OTC Osteopathia Striata mit kranialer Sklerose Q78.8 AMER Pelizaeus-Merzbacher-Syndrom E75.2 PLP Pyruvat-Dehydrogenase E1-alpha-Mangel E74.4 PDHA Renpenning-Syndrom Q87.5 PQBP Rett-Syndrom F84.2 MECP2*, ** Ritscher-Schinzel-Syndrom Q87.8 CCDC Simpson-Golabi-Behmel-Syndrom, Typ Q87.3 GPC Simpson-Golabi-Behmel-Syndrom, Typ Q87.3 OFD TARP-Syndrom Q87.8 RBM Wilson-Turner mentales Retardierungs-Syndrom, X-chromosomal F79.- LAS1L * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Humangenetik 71

72 6. Fiebersyndrome 6.1 Hereditäre periodische Fiebersyndrome (HPF) Dr. rer. nat. Barbara Bangol, Dr. med. Kaimo Hirv Fieber ist ein häufiges Symptom im Kindesalter, welches nicht immer auf einen gewöhnlichen Infekt zurückzuführen ist. Wurden Infektionen, autoimmune und maligne Erkrankungen ausgeschlossen, kann ein angeborenes/hereditäres periodisches Fiebersyndrom (HPF) vorliegen. HPF-Syndrome gehören zu den autoinflammatorischen Erkrankungen, die durch eine Fehlregulation der angeborenen Immunantwort verursacht werden. HPF-Syndrome zeichnen sich durch rezidivierende Fieberschübe aus, begleitet von einer systemischen Entzündungsreaktion (erhöhtes CRP, Serum-Amyloid-Protein A), die insbesondere die Haut, Schleimhäute, seröse Grenzflächen und Gelenke betrifft und bei einigen Erkrankungen zu einer sekundären Amyloidose führen kann. Da die differenzialdiagnostische Abklärung aufgrund der Ähnlichkeit und Variabilität der Symptome oft schwierig ist, stellt die genetische Diagnostik mittels NGS eine Möglichkeit der Ursachenfindung dar. Literatur Bangol et al, J Lab Med (2015) / ter Haar et al, Ann Rheum Dis 74:1636 (2015) / Federici et al, Ann Rheum Dis 74:799 (2015) / de Jesus et al, Ann Rev Immunol 33:823 (2015) / Federici et al, Best Pract Res Clin Rheumatol 28:263 (2014) / Grumbt (Bangol) et al, Kinderärztliche Praxis 82:232 (2011) / Shinar et al, Ann Rheum Dis 71:1599 (2012) Hereditäre periodische Fiebersyndrome # ELANE, IL1RN, IL36RN, LPIN2, MEFV, MVK, NLRC4, NLRP12, NLRP3, NOD2, PSMB8, PSTPIP1, TMEM173, TNFRSF1A 25,0 kb Erkrankungen, OMIM, ICD-10, Gene bei hereditären periodischen Fiebersyndromen Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Autoinflammation, Lipodystrophie und Dermatose PSMB Syndrom (ALDD) Blau-Syndrom M08.9 AD NOD CINCA-Syndrom E NLRP3* Familiäres Kälte-assoziiertes autoinflammatorisches L NLRP3* Syndrom Typ I Familiäres Kälte-assoziiertes autoinflammatorisches E NLRP Syndrom Typ II Familiäres Kälte-assoziiertes autoinflammatorisches NLRC Syndrom Typ IV Familiäres Mittelmeerfieber E MEFV* Hyper-IgD-und-periodisches-Fiebersyndrom R MVK* Infantile STING-assoziierte Vaskulopathie (SAVI) TMEM Interleukin-1-Rezeptorantagonist-Defizienz M86.9 AR IL1RN Interleukin-36-Rezeptorantagonist-Defizienz L40.1 AR IL36RN Majeed-Syndrom M LPIN Mevalonazidurie E MVK* Muckle-Wells-Syndrom E NLRP3* PAPA-Syndrom M08.9 AD PSTPIP TNF-Rezeptor-1-assoziiertes periodisches Syndrom R TNFRSF1A* Zyklische Neutropenie ELANE * auch einzeln anforderbar Core Genes sind fett gedruckt 72

73 7. Herzerkrankungen 7.1 Arrhythmogene Erkrankungen Dr. rer. nat. Christoph Marschall Zu den arrhythmogenen Erkrankungen zählen zum einen die primären Arrhythmiesyndrome, bei denen es sich um die Ionenkanalerkrankungen des Herzmuskels handelt, und zum anderen die Kardiomyopathien mit Arrhythmierisiko. Die drei häufigsten Ionenkanalerkrankungen sind das Long-QT-Syndrom (LQTS), das Brugada-Syndrom (BrS) und die catecholaminerge polymorphe ventrikuläre Tachykardie (CPVT). Bei den Kardiomyopathien sind die hypertrophe Kardiomyopathie (HCM), die dilatative Kardiomyopathie (DCM) sowie die arrhythmogene rechtsventrikuläre Kardiomyopathie (ARVD) von besonderer Bedeutung. Die meisten Formen dieser Erkrankungen folgen einem autosomal-dominanten Erbgang mit unvollständiger Penetranz und variabler Ausprägung. Die wichtigsten ursächlichen Gene sind bereits seit einigen Jahren bekannt. Eine genetische Diagnostik wird in den meisten Fällen als sinnvoll erachtet (s. Ackerman et al, Europace 13:1077, 2011). Sie dient häufig zur Diagnosesicherung, kann aber auch prognostische oder therapeutische Bedeutung haben. Nach Identifikation der ursächlichen Mutation beim Indexpatienten ist die gezielte Analyse der Blutsverwandten von besonderem Nutzen bei den Ionenkanalerkrankungen. Aufgrund der therapeutischen Konsequenzen wird die prädiktive Diagnostik auch bei Minderjährigen uneingeschränkt empfohlen. Bei den Kardiomyopathien hingegen sollte die Indikation zur prädiktiven Diagnostik insbesondere bei Minderjährigen im Rahmen der genetischen Beratung sorgfältig abgewogen werden. Einerseits kann es für die Interpretation einiger Mutationen hilfreich sein, die Segregation in der Familie zu überprüfen. Andererseits ist aufgrund der eingeschränkten Therapiemöglichkeiten (Ausnahme: DCM mit LMNA- Mutation) der Nachweis einer Mutation eher belastend. Die molekulargenetische Diagnostik aller hier verfügbaren arrhythmogenen Erkrankungen basiert auf der DNA-Sequenzierung der bekanntermaßen ursächlichen Gene (Gen-Panel Diagnostik). Die Analyse bzw. die Auswertung der Ergebnisse erfolgt indikationsbezogen und stufenweise. In den letzten Jahren hat sich die Zahl der Gene, die in ursächlichem Zusammenhang mit den arrhythmogenen Erkrankungen stehen drastisch erhöht. Dennoch finden sich bei den Ionenkanalerkrankungen (LQTS, BrS, CPVT) und der ARVD auch bei Analyse aller bekannten Gene 90-95% der Mutationen in wenigen Hauptgenen. Zur Erreichung einer möglichst hohen diagnostischen Sensitivität kann es daher wie beim LQTS sinnvoller sein, die Hauptgene KCNQ1, KCNH2 und SCN5A auch auf große Deletionen zu untersuchen, als möglichst alle bekannten Gene zu analysieren. Hinzu kommt, dass sich aus der Analyse der selten betroffenen Gene oft unklare Ergebnisse oder Zusatzbefunde ergeben. Folglich beschränken sich auch die aktuellen Empfehlungen zur Diagnostik oft auf die Hauptgene. Im Gegensatz zu den Ionenkanalerkrankungen sind die Ursachen der HCM und der DCM noch wesentlich heterogener. Hier bietet sich eine Gen-Panel Diagnostik unter Einsatz von NGS an. Diese Technologie ermöglicht die parallele Analyse von derzeit über 50 kardiologisch relevanten Genen in einem Ansatz. Hierzu zählt auch Titin (TTN), das größte menschliche Gen, das in ca. 25% der DCM-Fälle in ursächlichem Zusammenhang gesehen wird. Allerdings ist die Interpretation der NGS-Ergebnisse nach wie vor eine große Herausforderung. Beispielsweise ist derzeit eine Validierung der TTN-Mutationen durch Segregationsanalysen nötig. Daher sollte die Analyse dieses Gens eventuell auf größere Familien mit mehreren Betroffenen beschränkt bleiben. Der Einsatz von NGS ist in ausgewählten Fällen auch bei den Ionenkanalerkrankungen vorteilhaft, wenn die Differenzialdiagnose schwierig ist und primär mehrere Verdachtsdiagnosen im Raum stehen. Literatur Medeiros-Domingo et al, Europace epub ahead of print (2016) / Schulze-Bahr et al, Kardiologe DOI /s (2015) / Mogensen et al, Eur Heart J 36:1367 (2015) / Abriel et al, Gene 517:1 (2013) / Beckmann et al, pädiat prax 80:31 (2013) / Campuzano et al, J Med Genet 50:280 (2013) / Sikkema-Raddatz et al, Human Mutat 34:1035 (2013) / Kaufman et al, JACC 60:1419 (2012) / Herman et al, N Engl J Med 366:619 (2012) / Ackerman et al, Europace 13:1077 (2011) / Tester et al, Am J Cardiol 106:1124 (2010) Humangenetik 73

74 Schematische Darstellung der phänotypischen und genetischen Heterogenität bei arrhythmogenen Erkrankungen. Die einzelnen Subpanels sind farblich voneinander abgegrenzt, "Core Genes" sind fett gedruckt Arrhythmogene rechtsventrikuläre Dysplasie (ARVD) Dr. rer. nat. Christoph Marschall Die arrhythmogene rechtsventrikuläre Dysplasie (ARVD) ist eine meist autosomal-dominant vererbte Erkrankung des Herzmuskels, bei der das Myokard progredient durch Fett- und Bindegewebe ersetzt wird. Durch den bindegewebigen Umbau, von dem vorwiegend der rechte Ventrikel betroffen ist, kommt es zunächst zu einer Störung der Reizleitung mit ventrikulären Arrhythmien, Palpitationen oder Synkopen. Im EKG zeigen sich typischerweise Epsilon-Wellen und bei rechts-präkordialer Ableitung eine invertierte T- Welle mit verbreitertem QRS-Komplex. In der Regel werden die Arrhythmien, die zum plötzlichen Herztod führen können, durch körperliche Anstrengungen ausgelöst. Ungefähr 1/3 der Indexpatienten sterben plötzlich im Alter von Jahren. Dieses Alter scheint eine vulnerable Periode für fatale Arrhythmien zu sein. Die Hälfte der Anlageträger entwickelt jedoch erst im Alter von über 50 Jahren eine klinische Symptomatik und ungefähr 1/3 erkranken auch bis ins hohe Alter nicht. Die Häufigkeit der ARVD wird auf 1:5.000 geschätzt, etwa die Hälfte der Fälle zeigen eine familiäre Häufung. Inzwischen sind über zehn verschiedene Formen der ARVD beschrieben. Die häufigsten Formen werden durch Mutationen in Genen verursacht, die für Bestandteile der Desmosomen (Zell-Zell-Verbindungen) kodieren. Mit der molekulargenetischen Analyse der Gene für Desmoplakin (DSP), Plakophilin-2 (PKP2) und Desmoglein-2 (DSG2) sind in ca % der Patienten Mutationen nachweisbar. Weitere Ursachen der erblichen Form der ARVD/C können in ca. 5% der Fälle in Mutationen anderer Gene desmosomaler Proteine wie Plakoglobin (JUP) und Desmocollin-2 (DSC2) sowie sonstiger Gene wie Transmembran-Protein 43 (TMEM43) und Transforming growth factor beta-3 (TGFB3) liegen. In ca. 40% der ARVD/C-Fälle kann bislang keine genetische Ursache nachgewiesen werden. Literatur Medeiros-Domingo et al, Europace epub ahead of print (2016) / Bhonsale et al, Eur Heart J 36:847 (2015) / Campuzano et al, J Med Genet 50:280 (2013) / Kapplinger et al, J Am Coll Cardiol 57:2317 (2011) / Quarta et al, Circulation 123:2701 (2011) / Ackerman et al, Europace 13:1077 (2011) / Fressart et al, Europace 12:861 (2010) / Awad et al, Nat Clin Pract Cardiovasc Med 5:258 (2008) / Syrris et al, Eur Heart J 28:581 (2007) / van Tintelen, Circulation 113:1650 (2006) / Pilichou et al, Circulation 113:1171 (2006) 74

75 Arrhythmogene rechtsventrikuläre Dysplasie (ARVD) DSC2, DSG2, DSP, JUP, LMNA, PKP2, TGFB3, TMEM43 24,0 kb Erkrankungen, OMIM, ICD-10, Gene bei arrhythmogener rechtsventrikulärer Dysplasie (ARVD) Erkrankung OMIM-P ICD-10 Gen OMIM-Gen ARVD - I42.80 TGFB ARVD I42.80 TMEM43 *,** ARVD I42.80 DSP *,** ARVD I42.80 PKP2 *,** ARVD I42.80 DSG2 *,** ARVD I42.80 DSC2 *,** ARVD I42.80 JUP *,** I42.80 LMNA* * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Humangenetik Brugada-Syndrom (BrS) Dr. rer. nat. Christoph Marschall Das Brugada-Syndrom (BrS) ist eine der häufigsten Ursachen des plötzlichen Herztods und für ca % der Fälle mit strukturell unauffälligem Herzen verantwortlich. Es handelt sich um eine autosomal-dominant vererbte Erkrankung mit unvollständiger Penetranz. Die Häufigkeit beträgt weltweit durchschnittlich 1:2.000, wobei 90% der Betroffenen männlichen Geschlechts sind. Die Erstmanifestation kann in früher Kindheit erfolgen, typisch jedoch im Alter von Jahren. Charakteristisch für das Brugada-Syndrom ist die im EKG persistierende ST-Segment-Hebung in der rechtspräkordialen Ableitung, die in manchen Fällen nur mittels Antiarrhythmika wie Ajmalin oder Flecainid demaskiert werden kann. Beim Brugada-Syndrom besteht eine Neigung zu schnellen polymorphen ventrikulären Tachykardien und Kammerflimmern. Die Symptome treten oft nachts auf und führen häufig zum plötzlichen Herztod. Das Risiko für einen plötzlichen Herztod beträgt in Abhängigkeit von der klinischen Symptomatik 2-15%/Jahr. Die einzig sichere Therapie ist die prophylaktische Implantation eines Defibrillators. Das Brugada-Syndrom Typ 1 (genetisch) ist auf Mutationen im SCN5A-Gen zurückzuführen, das für die alpha-untereinheit des Nav1.5-Natrium-Ionenkanals codiert. In bis zu 25% der Patienten mit Brugada-Syndrom können ursächliche Mutationen im SCN5A-Gen (BrS1) nachgewiesen werden. Es sind bereits über 350 Mutationen beschrieben, die in der Regel zum funktionellen Verlust eines SCN5A-Allels führen. In 5%-10% der Fälle mit BrS Typ I-EKG liegen andere Formen des Brugada-Syndroms vor. Einige Patienten tragen Mutationen in den Calcium-Ionenkanal-Genen CACNA1C (alpha-1c-untereinheit, Ca-Kanal, Cav1.2, BrS3) und CACNB2 (ß2-Untereinheit, BrS4). Diese Mutationen führen neben der ST-Segment-Hebung zu relativ kurzen QTc von ms. Wahrscheinlich ist auch eine kürzlich identifizierte Form, die durch Mutationen des SCN10A-Gens verursacht wird, in einem Teil der Fälle ursächlich. Einige Formen sind sehr selten und daher nicht Bestandteil der Routine-Diagnostik. In ca. 70% aller Fälle des Brugada-Syndroms kann keine ursächliche Mutation nachgewiesen werden. Die Kombination von häufigen Polymorphismen scheint mit einem bis zu 20-fach erhöhten Risiko für Brugada-Syndrom assoziiert zu sein. Literatur Schulze-Bahr et al, Kardiologe DOI /s (2015) / Steinfurt et al, Dtsch Arztebl Int 112:394 (2015) / Le Scouarnec et al, Hum Mol epub 3. Feb (2015) / Behr et al, Cardiovasc Res epub 17. Feb (2015) / Hu et al, J Am Coll Cardiol 64:66 (2014) / Bezzina et al, Nat Genet 45:1044 (2013) / Nielsen et al, front physiol 4:179 (2013) / Crotti et al, J Am Coll Cardiol 60:1410 (2013) / Kaufmann et al, J Am Coll Cardiol 60:1419 (2012) / Ackerman et al, Europace 13:1077 (2011) / Kapplinger et al, Heart Rhythm 7:33 (2010) / Hedley et al, Hum Mutat 30:1256 (2009) / Antzelevitch et al, Curr Cardiol Rep 10:376 (2008) / Priori et al, Circulation 105:1342 (2002) / Brugada et al, Am Coll Cardiol 20:1391 (1992) 75

76 Brugada-Syndrom (BrS) CACNA1C, CACNB2, GPD1L, KCNE3, SCN1B, SCN5A, TRPM4 20,3 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CACNA1C, CACNB2, GPD1L, KCNE3, SCN1B, SCN5A, TRPM4 ABCC9, CACNA2D1, HCN4, KCND3, KCNE5, KCNH2, KCNJ8, RANGRF, SCN10A, SCN2B, SCN3B, SLMAP 49,2 kb Erkrankungen, OMIM, ICD-10, Gene bei Brugada-Syndrom Erkrankung OMIM-P ICD-10 Gen OMIM Gen Diag. Sensitivität Brugada I45.8 SCN5A*,** % Brugada I45.8 GPD1L* <1% Brugada I45.8 CACNA1C* % Brugada I45.8 CACNB2* % Brugada I45.8 SCN1B* <1% Brugada I45.8 KCNE3* <1% Brugada I45.8 SCN3B* <1% Brugada I45.8 HCN <1% Brugada I45.8 KCND <1% Brugada - I45.8 ABCC Brugada - I45.8 CACNA2D <1% Brugada - I45.8 KCNE <1% Brugada - I45.8 KCNH2*,** <1% Brugada - I45.8 KCNJ <1% Brugada - I45.8 RANGRF <1% Brugada - I45.8 SCN10A Brugada - I45.8 SCN2B <1% Brugada - I45.8 SLMAP <1% Brugada - I45.8 TRPM <1% * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Catecholaminerge polymorphe ventrikuläre Tachykardie (CPVT) Dr. rer. nat. Christoph Marschall CPVT ist eine autosomal-dominant vererbte Erkrankung des strukturell gesunden Herzmuskels, deren Inzidenz ca. 1: beträgt. Die Arrhythmien sind adrenerg induziert und manifestieren sich durchschnittlich im Alter von 8 Jahren. Typisch sind bi-direktionale oder polymorphe ventrikuläre Tachykardien. Unbehandelt führt die CPVT in 60% der Fälle zu Synkopen vor dem 40. Lebensjahr und in 30-50% der Fälle zu plötzlichem Herztod vor dem 30. Lebensjahr. Das Ruhe-EKG scheint normal zu sein. Je früher Synkopen 76

77 auftreten, desto schlechter ist die Prognose. Die Therapie erfolgt mittels ß-Blockern. Ca. 30% der Patienten bleiben jedoch symptomatisch und benötigen eventuell einen implantierbaren Defibrillator. In 40-70% der CPVT-Patienten können ursächliche Mutationen im Ryanodin Typ 2-Rezeptor-Gen (RYR2) identifiziert werden. Das RYR2-Gen codiert den kardialen Ryanodin-Rezeptor, den wichtigsten Ca++-freisetzenden Kanal des sarkoplasmatischen Retikulums (SR), der eine zentrale Rolle bei der Aktivierung der Kardiomyozyten spielt. Seltener sind Mutationen im Calsequestrin-Gen (CASQ2), die in ca. 3-5% der Patienten nachweisbar sind und zu einer autosomal-rezessiv vererbten Form der CPVT führen. Mutationen in beiden Genen verursachen ein Ca ++ -"leakage aus dem SR. Ähnlich wie beim RYR1-Gen, das die Ursache der malignen Hyperthermie darstellt, befinden sich die Mutationen häufiger am Carboxy-Terminus-codierenden Teil des RYR2-Gens. Im Bereich der Codons werden über 40% der Mutationen nachgewiesen. Besonders gehäuft scheinen Mutationen in Assoziation zur CPVT im stark konservierten Transmembran-Segment (Aminosäuren ) vorzukommen, so dass eine Stufendiagnostik empfohlen wird [Medeiros-Domingo et al. (2009)]. Literatur Schulze-Bahr et al, Kardiologe DOI /s (2015) / Roston et al, Circ Arrhythm Electrophysiol 8:633 (2015) / Van der Werf et al, Circ Arrhythm Electrophysiol 5:748 (2012) / Ackerman et al, Europace 13:1077 (2011) / Medeiros-Domingo et al, J Am Coll Cardiol 54:2065 (2009) / Marjamaa et al, BMC Med Genet 10:12 (2009) / Liu et al, Progr Cardiovasc Dis 51:23 (2008) / Priori et al, J Clin Invest 115:2033 (2005) / Postma et al. J Med Genet 42:863 (2005) / Priori et al, Circulation 106:69 (2002) Catecholaminerge polymorphe ventrikuläre Tachykardie (CPVT) CALM1, CASQ2, KCNJ2, RYR2 17,8 kb Humangenetik Erkrankungen, OMIM, ICD-10, Gene bei Catecholaminerger polymorpher ventrikulärer Tachykardie Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM Gen Diag. Sensitivität CPVT I45.8 AD RYR2*,** % CPVT I45.8 AR CASQ2* % I KCNJ2* <1% CPVT I45.8 AD CALM * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Dilatative Kardiomyopathie (DCM) Dr. rer. nat. Christoph Marschall Die dilatative Kardiomyopathie (DCM) ist durch die Dilatation und eingeschränkte Kontraktion des linken oder beider Ventrikel charakterisiert. Die Prävalenz liegt bei ungefähr 1: Meist geht die Erkrankung mit einer progredienten Herzinsuffizienz einher. Die DCM ist in der Regel mittels Echokardiographie darstellbar. Es besteht ein deutlich erhöhtes Risiko für Arrhythmien, Thromboembolien und plötzlichen Herztod. Obwohl die Therapie sich verbessert hat, wurden 5-Jahres-Überlebensraten von 36-80% ermittelt. Bei der terminalen Herzinsuffizienz ist oft eine Herztransplantation indiziert. Es konnte gezeigt werden, dass nur die Hälfte der DCM-Fälle mit scheinbar unklarer Ursache tatsächlich idiopathisch sind (IDCM) und nicht sekundär auf anderen Primärerkrankungen basieren. Folglich ist es wichtig, vor der Veranlassung einer genetischen Diagnostik eine sekundäre dilatative Kardiomyopathie möglichst vollständig auszuschließen. In bis zu 35% der Fälle ist die IDCM genetisch bedingt (FDCM) und meist autosomal-dominant vererbt. Die frühe Identifikation von Anlageträgern ist essentiell, um den Verlauf der Erkrankung positiv zu beeinflussen. Die genetischen Ursachen der IDCM/FDCM sind heterogen; inzwischen sind über 30 ursächliche Gene bekannt. Vor über zehn Jahren wurden bereits Mutationen im LMNA-Gen, das für Strukturproteine der inneren Zellkernmembran codiert, im Zusammenhang mit DCM identifiziert. Eine große Studie ergab, dass ca. 6-8% der IDCM/FDCM-Patienten Mutationen im LMNA-Gen tragen. Gehäuft wurden außerdem Veränderungen in verschiedenen Sarkomer-Proteinen als Ursache der IDCM/FDCM nachgewiesen. Ungefähr ein 77

78 Viertel aller Fälle tragen Mutationen in den Genen der schweren Kette des ß-Myosins (MYH7), des Myosinbindeproteins-C (MYBPC3) und des Troponins T (TNNT2). Mutationen in diesen Genen wurden zwar wesentlich häufiger im Zusammenhang mit HCM beschrieben, inzwischen sind allerdings auch über 100 verschiedene, für die dilatative Kardiomyopathie spezifische Mutationen bekannt. Mit der Analyse von vier gehäuft betroffenen Genen können in ungefähr einem Drittel aller IDCM/FDCM-Fälle ursächliche Mutationen nachgewiesen werden. In neueren Studien konnte an über 300 IDCM-Patienten gezeigt werden, dass Mutationen im größten menschlichen Gen Titin (TTN) in ca. 25% der Fälle in ursächlichem Zusammenhang stehen. Hierbei handelt es sich um schwerwiegende Mutationen, die zum funktionellen Verlust führen. Die Penetranz dieser Mutationen ist jedoch nicht vollständig, sodass die Ursächlichkeit in jeder Familie durch die gezielte Analyse mehrerer Familienmitglieder abgesichert werden sollte. Dieses Gen kann aufgrund der Größe nur mittels neuer Sequenzierverfahren analysiert werden. Dieses Verfahren bietet zudem den Vorteil, dass mindestens 20 Gene, in denen gehäuft Mutationen im Zusammenhang mit DCM nachgewiesen wurden, parallel analysiert werden können. Literatur Schafer et al, Nat Genet 49:46 (2017) / Watkins et al, Sci Transl Med 7:270 (2015) / Herman et al, N Engl J Med 366:619 (2012) / Lakdawala et al, J Card Fail 18:296 (2012) /Møller et al, Eur J Hum Genet 17:1241 (2009) / Millat et al, Clin Biochem 42:892 (2009) / Parks et al, Am Heart J 156:161 (2008) Kardiomyopathie, familiär dilatative Form (DCM) ACTN2, BAG3, DES, LMNA, MYBPC3, MYH7, PLN, RBM20, TAZ, TNNI3, TNNT2, TPM1 24,5 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ACTN2, BAG3, DES, LMNA, MYBPC3, MYH7, PLN, RBM20, TAZ, TNNI3, TNNT2, TPM1 ABCC9, ACTC1, ANKRD1, BAG3, CALR3, CASQ2, CAV3, CRYAB, CSRP3, DMD, DSP, FKTN, ILK, JPH2, LAMA4, LAMP2, LDB3, MYH6, MYL2, MYL3, MYLK2, MYOZ2, MYPN, NEBL, NEXN, PRDM16, PRKAG2, RAF1, SCN5A, SGCD, TCAP, TNNC1, TTN, VCL 215,5 kb 78

79 Erkrankungen, OMIM, ICD-10, Gene bei dilatativer Kardiomyopathie (DCM) Erkrankung OMIM-P ICD-10 Gen OMIM Gen Diag. Sensitivität DCM - I42 DSP *,** DCM - I42 ILK < 1 % DCM - I42 LAMP DCM - I42 NEBL < 1 % DCM I42 SCN5A *,** DCM - I42 TAZ DCM1A I42 LMNA * % DCM1AA I42 ACTN < 1 % DCM1C I42 LDB < 1 % DCM1CC I42 NEXN < 1 % DCM1D I42 TNNT2 * DCM1DD I42 RBM DCM1FF I42 TNNI3 * DCM1G I42 TTN > 20 % DCM1HH I42 BAG < 1 % DCM1I I42 DES > 1 % DCM1II/HCM I42 CRYAB DCM1JJ I42 LAMA < 1 % DCM1L I42.0 SGCD DCM1LL I42 PRDM DCM1N I42 TCAP < 1 % DCM1NN/HCM I42.0 RAF1 * DCM1O I42 ABCC DCM1P I42 PLN < 1 % DCM1S I42 MYH7 *,** % DCM1W I42 VCL < 1 % DCM1X I42 FKTN DCM1Y I42 TPM1 * < 1 % DCM2A I42 TNNI3 * DCM3B I42.0 DMD *,** HCM - I42 ANKRD < 1 % DCM1MM I42 MYBPC3 * % DCM1EE I42 MYH < 1 % DCM1KK I42 MYPN < 1 % DCM1Z I42 TNNC I42 PRKAG I42 MYOZ I42 MYLK2 * I42 MYL3 * I42 MYL2 * I42 JPH I42 CSRP Humangenetik 79

80 Erkrankung OMIM-P ICD-10 Gen OMIM Gen Diag. Sensitivität CAV3 * CASQ2 * CALR ACTC1 * * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Hypertrophe Kardiomyopathie (HCM) Dr. rer. nat. Christoph Marschall Bei der hypertrophen Kardiomyopathie (HCM) handelt es sich um eine autosomal-dominant vererbte, strukturelle Erkrankung des Herzmuskels, die mit einer Prävalenz von ca. 1:500 in der kaukasischen Bevölkerung auftritt. In der Regel ist die hypertrophe Kardiomyopathie mit einer asymmetrisch erhöhten Muskelmasse des linken Ventrikels unter Beteiligung des interventrikulären Septums assoziiert, wodurch es zu charakteristischen Veränderungen im EKG kommt (Q-Welle, ST-Strecke und P-Welle). Die phänotypische Ausprägung der hypertrophen Kardiomyopathie variiert von benignen, unvollständig penetranten bis zu malignen Formen mit einem hohen Risiko für plötzlichen Herztod bereits im Kindesalter. Die durchschnittliche Lebenserwartung der Betroffenen liegt bei 66 Jahren, wobei die Prognose abhängig von der zugrunde liegenden molekularen Ursache ist. Bislang wurden im Zusammenhang mit HCM ca. 650 ursächliche Mutationen in 15 verschiedenen Genen identifiziert, die bis auf zwei Gene ausschließlich für kardiale Proteine der Sarkomere codieren. Über 85% der bisher beschriebenen Mutationen befinden sich in den Genen für die schwere Kette des ß-Myosins (MYH7), das Myosinbindeprotein-C (MYBPC3), Troponin T (TNNT2) und Troponin I (TNNI3). Ca. 50% der Mutationen können in der ersten Stufe der Diagnostik, welche eine Mutationssuche in 16 Exons einschließt, detektiert werden. Insgesamt können derzeit im Rahmen der Routinediagnostik Mutationen in ca. 60% aller HCM-Fälle nachgewiesen werden. Deletionen einzelner Exons oder gesamter Gene sind sehr selten (<1% aller Fälle) und werden daher nicht untersucht. Literatur Ho et al, Cardiovasc Res 105:397 (2015) / Haas et al, Eur Heart J 35:2733 (2014) / Lopes et al, J Med Genet 50:228 (2013) / Maron et al, J Am Coll Cardiol 60:705 (2012) / Chanavat et al, Eur J Hum Genet 55:163 (2012) / Ackerman et al, Europace 13:1077 (2011) / Millat et al, Eur J Med Genet 53:261 (2010) / Soor et al, J Clin Pathol (2009) / Morita et al, N Engl J Med 358:1899 (2008) / Morita et al, Circulation 113:2697 (2006) / Ingles et al, J Med Genet 42:e59 (2005) Hypertrophe Kardiomyopathie (HCM) ACTC1, ACTN2, ANKRD1, CSRP3, JPH2, MYBPC3, MYH7, MYL2, MYL3, PLN, PRKAG2, TCAP, TNNC1, TNNI3, TNNT2, TPM1 22,4 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ACTC1, ACTN2, ANKRD1, CSRP3, JPH2, MYBPC3, MYH7, MYL2, MYL3, PLN, PRKAG2, TCAP, TNNC1, TNNI3, TNNT2, TPM1 CALR3, CASQ2, CAV3, CRYAB, DES, LDB3, MYH6, MYLK2, MYOZ2, MYPN, NEXN, VCL 48,1 kb 80

81 Erkrankungen, OMIM, ICD-10, Gene bei hypertropher Kardiomyopathie (HCM) Erkrankung OMIM-P ICD-10 Gen OMIM Gen Diag. Sensitivität HCM - I42 DES > 1 % HCM - I42 ANKRD < 1 % HCM I42 MYLK2* < 1 % HCM I42 MYH7*, ** % HCM I42 TPM1* < 1 % HCM I42 TNNT2* % HCM I42 PRKAG < 1 % HCM6 - I42 PRKAG <1% HCM I42 TNNI3* % HCM I42 MYL3* > 1 % HCM I42 MYL2* > 1 % HCM I42 ACTC1* > 1 % HCM I42 CSRP < 1 % HCM I42 TNNC < 1 % HCM I42 MYH < 1 % HCM I42 VCL < 1 % HCM I42 MYOZ < 1 % HCM I42 JPH < 1 % HCM I42 JPH HCM I42 PLN < 1 % HCM I42 CALR < 1 % HCM I42 NEXN < 1 % HCM I42 MYPN < 1 % HCM I42 ACTN < 1 % HCM I42 TCAP < 1 % - - I42 CASQ2* I42 CAV3* I42 CRYAB I42 LDB I42 MYBPC3* % Humangenetik * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Long QT-Syndrom (LQTS) Dr. rer. nat. Christoph Marschall Das Long QT-Syndrom (LQTS) ist eine klinisch und genetisch heterogene Herzerkrankung, die durch eine verlängerte ventrikuläre Repolarisation charakterisiert ist. Im Langzeit-EKG lässt sich eine verlängerte Frequenz-korrigierte QT-Zeit (QTc) von 440 bis >500 ms nachweisen. In Abhängigkeit von der QTc kommt es zu Arrhythmien, die zu Bewusstlosigkeit und plötzlichem Herztod führen können. Die 10-Jahres-Mortalität beträgt unbehandelt 50%. Man unterscheidet die häufige autosomal-dominante Romano-Ward- (RW) und die sehr seltene autosomal-rezessive Jervell-Lange-Nielsen-Form (JLN). Die Prävalenz des Long QT-Syndroms in der kaukasischen Bevölkerung ist mindestens 1: In ca. 75% der klinisch gesicherten Fälle können Mutationen in einem von fünf myokardialen Ionenkanal- Genen nachgewiesen werden. Diese codieren für repolarisierende Kalium-Kanäle (KCNQ1, KCNH2, KCNE1, KCNE2) sowie einen Natrium-Kanal (SCN5A). Die molekulare Klassifikation und Nomenklatur (LQTS Typ 1-81

82 12) orientiert sich hierbei an den betroffenen Genen: - KCNQ1 (LQTS Typ 1; 48 % der Mutationen, eigene Daten) codiert einen spannungsabhängigen kardialen Kalium-Kanal. Mutationen mit dominanter oder rezessiver Ausprägung (RW- und JLN-Form) sind beschrieben. Individuen mit Mutationen im KCNQ1-Gen zeigen meist frühzeitig einen deutlich ausgeprägten Phänotyp mit einem hohen Risiko für kardiale Ereignisse. - KCNH2 (LQTS Typ 2; 31 % der Mutationen, eigene Daten) codiert einen weiteren K + -Kanal. Es besteht ein hohes Risiko für kardiale Ereignisse. Es handelt es sich um RW-Formen. - SCN5A (LQTS Typ 3; 18 % der Mutationen, eigene Daten) codiert einen kardialen Natrium-Kanal. Im Gegensatz zu Typ 1 sind kardiale Ereignisse im Zusammenhang mit SCN5A-Mutationen seltener, die Letalität ist jedoch fünffach höher. Klinisch tritt LQTS Typ 3 als RW-Form auf. - KCNE1 (LQTS Typ 5; 3 % der Mutationen, eigene Daten) codiert die regulatorische ß-Untereinheit des KCNQ1-Kanals. Mutationen können zur Romano-Ward oder JLN-Form führen. - KCNE2 (LQTS Typ 6, 1% der Mutationen, eigene Daten) codiert für MIRP1, eine Untereinheit des HERG- Kanals. Die Identifikation von Anlageträgern ursächlicher Mutationen ermöglicht eine rechtzeitige, ggfs. präsymptomatische Therapie. Das Risiko für kardiale Ereignisse wird dadurch beim LQTS Typ 1 um 62-95% und beim LQTS Typ 2 um 74% reduziert. Alle Anlageträger sollten Instruktionen zur Anpassung ihres Lebensstils erhalten. Darüber hinaus wurden bei seltenen Sonderformen des Long QT-Syndroms, die durch spezielle z.t. komplexe Phänotypen gekennzeichnet sind, Mutationen in weiteren Genen identifiziert, deren Analyse in einzelnen Familien sinnvoll sein kann: ANK2 (LQTS Typ 4), KCNJ2 (LQTS Typ 7), CAV3 (LQTS Typ 9), SCN4B (LQTS Typ 10), KCNE3, SNTA1 (LQTS Typ 12). Des Weiteren können Arzneistoffe verschiedenster Klassen eine Verlängerung der QT-Zeit hervorrufen. Ein verzögerter Metabolismus von Medikamenten, der durch Varianten im CYP2D6-, CYP2C9- oder CYP2C19- Gen bedingt sein kann, kann diesen Effekt verstärken. Beim Medikamenten-induzierten Long QT-Syndrom kann die ergänzende Diagnostik der Cytochrom P450-Gene sinnvoll sein. Literatur Lieve et al, Genet Test Mol Biomarkers 17:553 (2013) / Ackerman et al, Europace 13:1077 (2011) / Hofman et al, J Am Coll Cardiol 55:2570 (2010) / Tester et al, Am J Cardiol 106:1124 (2010) / Hedley et al, Hum Mutat 30:1486 (2009) / Kapplinger et al, Heart Rhythm 6:1297 (2009) / Morita et al, Lancet 372:750 (2008) / Hofman et al, Eur Heart J 28:575 (2007) / Millat et al, Clin Genet 70:214 (2006) / Priori et al, N Eng J 348:19 (2003) / Splawski et al, Circulation 102:1178 (2000) Long-QT-Syndrom CACNA1C, CALM1, CAV3, KCNE1, KCNE2, KCNE3, KCNH2, KCNJ2, KCNJ5, KCNQ1, SCN4B, SCN5A, SNTA1 24,9 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CACNA1C, CALM1, CAV3, KCNE1, KCNE2, KCNE3, KCNH2, KCNJ2, KCNJ5, KCNQ1, SCN4B, SCN5A, SNTA1 AKAP9, ANK2, CACNA1C, CALM1, CALM2, CAV3, KCNE1, KCNE2, KCNE3, KCNH2, KCNJ2, KCNJ5, KCNQ1, SCN4B, SCN5A, SNTA1, TECRL 74,9 kb 82

83 Erkrankungen, OMIM, ICD-10, Gene bei Long QT-Syndrom Erkrankung OMIM-P ICD-10 Gen OMIM Gen Diag. Sensitivität LQT - I45.8 KCNE3* < 1 % LQT - I45.8 TECRL <1% LQT I45.8 KCNQ1*, ** % LQT I45.8 KCNH2*, ** % LQT I45.8 SCN5A*, ** % LQT I45.8 ANK2* < 1 % LQT I45.8 KCNE1*, ** > 1 % LQT I45.8 KCNE2*, ** < 1 % LQT7 Anderson-Syndrom I45.8 KCNJ2* < 1 % LQT8, Timothy Syndrom I45.8 CACNA1C* < 1 % LQT I45.8 CAV3* < 1 % LQT I45.8 SCN4B* < 1 % LQT I45.8 AKAP < 1 % LQT I45.8 SNTA1* < 1 % LQT I45.8 KCNJ < 1 % LQT I45.8 CALM < 1 % LQT I45.8 CALM <1% * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Non-compaction Kardiomyopathie (NCCM) Dr. rer. nat. Christoph Marschall Die Non-Compaction-Kardiomyopathie (NCCM) ist eine myokardiale Erkrankung, gekennzeichnet durch prominente ventrikuläre Trabekel und tiefe Einbuchtungen der subendokardialen Oberfläche des linken und zum Teil auch des rechten Ventrikels, die mit oder ohne linksventrikuläre Dysfunktion aus dem ventrikulären Hohlraum bis an die Grenze des Epikards reichen. Die NCCM kann eine morphologische Manifestation von mehreren verschiedenen Kardiomyopathien sein. In den pädiatrischen Patientenkollektiven beträgt die Prävalenz der NCCM bis zu 9% aller primären Kardiomyopathien und ist somit die dritthäufigste Kardiomyopathie nach der DCM und der HCM. Die Pathogenese der NCCM beruht wahrscheinlich auf einem Stillstand der trabekulären Verdichtung des Myokards in der Embryogenese. In den Genen MYH7, TPM1, TAZ, ACTC1, PRDM16, HCN4, LDB3, MYBPC3, CASQ2 und TNNT2 wurden in ungefähr 30% der Fälle ursächliche Mutationen beschrieben, wobei MYH7 und TPM1 am häufigsten betroffen sind. Auch mit einer erweiterten Diagnostik kann in schätzungsweise 70% der Fälle keine Mutation nachgewiesen werden. Literatur Shariati et al, Herz 40:583 (2015) / Millat et al, Eur J Med Genet 58:439 (2015) / Schaefer et al, Eur J Med Genet 57:129 (2014) / Probst et al, Circ Cardiovasc Genet 4:367 (2011) Humangenetik Non-compaction Kardiomyopathie (NCCM) Mutationssuche bis 25 kb ACTC1, CASQ2, HCN4, LDB3, MYBPC3, MYH7, PRDM16, TAZ, TNNT2, TPM1 24,2 kb 83

84 Erkrankungen, OMIM, ICD-10, Gene bei Non-compaction Kardiomyopathie (NCCM) Erkrankung OMIM-P ICD-10 Gen OMIM Gen Diag. Sensitivität NCCM I42 TAZ > 2 % NCCM I42 LDB > 2 % NCCM I42 ACTC1 * > 2 % NCCM I42 MYH7 *,** > 5 % NCCM I42 TNNT2 * > 2 % NCCM I42 PRDM > 2 % NCCM I42 TPM1 * > 2 % NCCM I42 MYBPC3 * > 2 % HCN CASQ2 * * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 7.2 Angeborene Herzfehler Dr. med. Sandra Wilson, Dr. rer. nat. Christoph Marschall Kongenitale Herzfehler werden bei ca. 8 von Lebendgeburten beobachtet. Die Ursachen angeborener Herzfehler sind vielfältig und häufig multifaktoriell. In den letzten Jahren wurden durch moderne zytogenetische und molekulargenetische Methoden immer mehr genetische Ursachen für angeborene Herzfehler identifiziert. Inzwischen geht man davon aus, dass ein signifikanter Anteil angeborener kardialer Malformationen genetisch bedingt ist, wohingegen vermutete exogene Faktoren noch weitestgehend ungeklärt sind. Angeborene Herzfehler können familiär gehäuft auftreten, sowohl isoliert, als auch in syndromaler Form. Mit Herzfehlern assoziierte Gene codieren für Transkriptionsfaktoren, Chromatin-Regulatoren, Wachstums- Faktoren und Signaltransduktionswege, die eine entscheidende Rolle bei der normalen Herz- Entwicklung spielen. Insgesamt sind mehr als 80 Gene bekannt, die mit isolierten und häufigeren syndromalen Formen von angeborenen Herzfehlern assoziiert sind. Mittels neuer Sequenziertechnologien (NGS) ist es in familiären Fällen oder bei Verdacht auf ein übergeordnetes Syndrom möglich, genetische Ursachen für angeborene Herzfehler wie z.b. ASD, VSD, TOF, TGA, HLHS, AS, PS, konotrunkale Defekte, Ebstein-Anomalie und Heterotaxien sowie RASopathien und andere syndromale Formen zu untersuchen. Abkürzungen: AS - Aortenstenose, ASD - Atrium Septum Defekt, HLHS - Hypoplastisches Linksherz Syndrom, PS - Pulmonalstenose, TGA - Transposition der großen Arterien, TOF - Fallot Tetralogie, VSD - Ventrikel Septum Defekt Literatur Muntean et al, Biochem Genet 55(2):105 (2017) / Digilio et al, Front Pediatr. 1;4:120 (2016) / Lindinger et al, Klin Padiatr 222(5):321 (2010) 84

85 Individuell konfigurierbare MGPS Angeborene Herzfehler Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ACTC1 (1.1 kb) * ACVR2B (1.5 kb) * ADAMTS10 (3.3 kb) * ARHGAP31 (4.3 kb) * BMPR2 (3.1 kb) * BRAF (2.3 kb) * CBL (2.7 kb) * CFAP53 (1.5 kb) * CFC1 (0.7 kb) * CHD7 (9.0 kb) * CITED2 (0.8 kb) * CREBBP (7.3 kb) * CRELD1 (1.3 kb) * DNAH11 (13.5 kb) * DNAH5 (13.9 kb) * DNAI1 (2.1 kb) * DOCK6 (6.1 kb) * DTNA (2.2 kb) * EHMT1 (3.9 kb) * ELN (2.4 kb) * EOGT (1.6 kb) * EP300 (7.2 kb) * EVC (3.0 kb) * EVC2 (3.9 kb) * FBN2 (8.7 kb) * FLNA (7.9 kb) * FOXC1 (1.7 kb) * FOXH1 (1.1 kb) * FOXP1 (2.1 kb) * GATA4 (1.3 kb) * GATA5 (1.2 kb) * GATA6 (1.8 kb) * GDF1 (1.1 kb) * GJA1 (1.1 kb) * GPC3 (1.8 kb) * HRAS (0.6 kb) * JAG1 (3.7 kb) * KDM6A (4.4 kb) * KMT2D (16.6 kb) * KRAS (0.6 kb) * LEFTY2 (1.1 kb) * LZTR1 (2.5 kb) * MAP2K1 (1.2 kb) * MAP2K2 (1.2 kb) * MED12 (6.5 kb) * MED13L (6.6 kb) * MGP (0.4 kb) * MMP21 (1.7 kb) * MYH11 (5.9 kb) * MYH6 (5.8 kb) * NF1 (8.5 kb) * NIPBL (8.4 kb) * NKX2-5 (1.0 kb) * NKX2-6 (0.9 kb) * NODAL (1.0 kb) * NOTCH1 (7.7 kb) * NOTCH2 (7.4 kb) * NPHP4 (4.3 kb) * NR2F2 (1.2 kb) * NRAS (0.6 kb) * NSD1 (8.1 kb) * PITX2 (1.0 kb) * PKD1L1 (8.5 kb) * PPP1CB (1.0 kb) * PTPN11 (1.8 kb) * RAF1 (1.9 kb) * RASA2 (2.6 kb) * RBM10 (3.0 kb) * RBPJ (1.5 kb) * RIT1 (0.7 kb) * RRAS (0.7 kb) * SALL1 (4.0 kb) * SALL4 (3.2 kb) * SEMA3E (2.3 kb) * SHOC2 (1.7 kb) * SMAD6 (1.5 kb) * SOS1 (4.0 kb) * SOS2 (4.0 kb) * SPRED1 (1.3 kb) * TAB2 (2.1 kb) * TBX1 (1.5 kb) * TBX20 (1.3 kb) * TBX3 (2.2 kb) * TBX5 (1.6 kb) * TFAP2B (1.4 kb) * TGFBR1 (1.5 kb) * TGFBR2 (1.8 kb) * TLL1 (3.0 kb) * ZEB2 (3.6 kb) * ZFPM2 (3.5 kb) * ZIC3 (1.4 kb) Humangenetik Alagille-Syndrom Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. med. Imma Rost Das klinisch sehr variable Alagille-Syndrom zeigt Symptome in mehreren Organsystemen, vor allem aufgrund der intrahepatischen Gallengangshypoplasie und dadurch bedingter Cholestase in der Leber, weiterhin angeborene Herzfehler, vor allem Stenosen der pulmonalarteriellen Gefäße, Wirbelanomalien in Form von Schmetterlingswirbeln, und am Auge ein hinteres Embryotoxon. Es werden charakteristische Gesichtszüge beschrieben. Morbidität und Mortalität werden vor allem durch die kardiologischen und hepatischen Symptome bestimmt. Die (Verdachts-) Diagnose wird in erster Linie klinisch anhand einer typischen Merkmalskombination gestellt; sie kann molekulargenetisch bestätigt werden durch Nachweis von Mutationen in den Genen JAG1 oder NOTCH2, wobei die überwiegende Mehrzahl der Patienten pathogene Varianten in JAG1 trägt, davon 5-10% Mikrodeletionen des gesamten oder von Teilen des Gens in 20p12. Nur ca. 1-2% der Patienten tragen Mutationen in NOTCH2. Familiäres Vorkommen wird in 30-50% der Betroffenen beobachtet; die Vererbung erfolgt autosomal-dominant, die Häufigkeit wird auf 1: geschätzt. Literatur Saleh et al, The Applicationof Clinical Genetics 9:75 (2016), Spinner et al, Gene Reviews (2013) Alagille-Syndrom JAG1, NOTCH2 11,1 kb Erkrankungen, OMIM, ICD-10, Gene bei Alagille-Syndrom Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM Gen Alagille-Syndrom AD JAG1** Alagille-Syndrom AD NOTCH ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 85

86 7.2.2 Herzfehler, Heterotaxie-assoziierte Herzfehler, Heterotaxie-assoziierte ACVR2B, CFAP53, CRELD1, DNAI1, GDF1, LEFTY2, NODAL, MMP21, PKD1L1, ZIC3 15,4 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ACVR2B, CFAP53, CRELD1, DNAI1, GDF1, LEFTY2, NODAL, MMP21, PKD1L1, ZIC3 DNAH11, DNAH5, MMP21,NPHP4, PKD1L1 52,1 kb Erkrankungen, OMIM, ICD-10, Gene bei Heterotaxie-assoziierten Herzfehlern Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Double-outlet right ventricle Q89.3 AD/AR GDF Heterotaxie Q89.3 AD/AR GDF Heterotaxie / Atrioventrikulärer Septum Defekt, Q89.3 AD CRELD Suszeptibilität Typ 2 Heterotaxie Phänotyp Q89.3 AD LEFTY Heterotaxie Phänotyp - Q89.3 AD NPHP Heterotaxie, viszeral Typ Q89.3 X-linked ZIC Heterotaxie, viszeral Typ Q89.3 AD CFC Heterotaxie, viszeral Typ Q89.3 AD ACVR2B Heterotaxie, viszeral Typ Q89.3 AD NODAL Heterotaxie, viszeral Typ Q89.3 AR CFAP Heterotaxie, viszeral Typ 7, autosomal Q89.3 AR MMP Heterotaxie, viszeral Typ 8, autosomal Q89.3 AR PKD1L Primäre ziliäre Dyskinesie Typ 1 / Q89.3 AR DNAI Kartagener Syndrom Primäre ziliäre Dyskinesie Typ 3 / Q89.3 AR DNAH Kartagener Syndrom Primäre ziliäre Dyskinesie Typ 7 / Q89.3 AR DNAH Kartagener Syndrom Transposition der großen Gefäße Typ Q89.3 AD/AR GDF Core Genes sind fett gedruckt 86

87 7.2.3 Herzfehler, isolierte Isolierte Herzfehler ACTC1, CITED2, ELN, FOXH1, GATA4, GATA5, GATA6, MYH6, NKX2-5, TBX1, TBX20 19,3 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ACTC1, CITED2, ELN, FOXH1, GATA4, GATA5, GATA6, MYH6, NKX2-5, TBX1, TBX20 BMPR2, DTNA, FOXP1, GJA1, MED13L, NKX2-6, NR2F2, SMAD6, TAB2, TLL1, ZFPM2 46,7 kb Humangenetik Erkrankungen, OMIM, ICD-10, Gene bei isolierten Herzfehlern Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen angeborene Herzfehler, multiple - Q24.9 AD FOXH angeborene Herzfehler, multiple - Q24.9 AD GATA Atrioventrikulärer Septum Defekt, Suszeptibilität Typ Q24.9 AD GATA Atrioventrikulärer Septum Defekt, Suszeptibilität Typ Q24.9 AD GATA Atrium Septum Defekt Typ Q24.9 AD GATA Atrium Septum Defekt Typ 3 / Hypoplastisches Q24.9 AD/AR MYH Linksherz Atrium Septum Defekt Typ Q21.1 AD TBX Atrium Septum Defekt Typ Q21.1 AD ACTC1* Atrium Septum Defekt Typ Q24.9 AD NKX Atrium Septum Defekt Typ Q24.9 AD CITED Atrium Septum Defekt Typ Q24.9 AD GATA DiGeorge Syndrom Q24.9 AD/AR TBX Fallot Tetralogie Q24.9 AD GATA Fallot Tetralogie Q24.9 AD GATA Fallot Tetralogie Q24.9 AD NKX Fallot Tetralogie Q24.9 AD/AR TBX Hypoplastisches Linksherz Syndrom Typ Q24.9 AD NKX Konotrunkale Malformationen Q24.9 AD NKX Konotrunkale Malformationen Q24.9 AD/AR TBX Pankreasagenesie und kongenitale Herzfehler Q24.9 AD GATA Persistierender Ductus arteriosus Q24.9 AD GATA Supravalvuläre Aortenstenose Q25.3 AD ELN Velokardiofaziales Syndrom Q24.9 AD/AR TBX Ventrikulärer Septum Defekt Typ Q24.9 AD GATA Ventrikulärer Septum Defekt Typ Q24.9 AD CITED Ventrikulärer Septum Defekt Typ Q24.9 AD NKX * auch einzeln anforderbar Core Genes sind fett gedruckt 87

88 7.2.4 Herzfehler/RASopathien RASopathien mit Herzfehlern BRAF, HRAS, KRAS, MAP2K1, MAP2K2, PTPN11, RAF1, RIT1, SOS1 14,2 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. BRAF, HRAS, KRAS, MAP2K1, MAP2K2, PTPN11, RAF1, RIT1, SOS1 CBL, NRAS, PPP1CB, RASA2, SOS2 25,0 kb Erkrankungen, OMIM, ICD-10, Gene bei RASopathien mit Herzfehlern Erkrankung OMIM-P ICD-10 Gen OMIM Gen Diag. Sensitivität Cardio-Fazio-Cutanes-Syndrom (CFC) Typ Q87 BRAF* % Cardio-Fazio-Cutanes-Syndrom (CFC) Typ Q87 KRAS* < 2-3 % Cardio-Fazio-Cutanes-Syndrom (CFC) Typ Q87 MAP2K1* % Cardio-Fazio-Cutanes-Syndrom (CFC) Typ Q87 MAP2K2* % Costello-Syndrom L81.9 HRAS* % - 90% Costello-Syndrom L81.9 KRAS* LEOPARD-Syndrom Typ L81.9 PTPN11* % LEOPARD-Syndrom Typ L81.9 RAF1* < 1 % LEOPARD-Syndrom Typ L81.9 BRAF* < 1 % Neurofibromatose-Noonan-Syndrom (NFNS) L81.9 PTPN11* Noonan-Syndrom - Q87 CBL* selten Noonan-Syndrom - Q87.1 RASA2* Noonan-Syndrom - Q87.2 SOS2* Noonan-Syndrom - Q87.1 PPP1CB* Noonan-Syndrom Typ Q87.1 PTPN11* % Noonan-Syndrom Typ Q87.1 KRAS* < 5 % Noonan-Syndrom Typ Q87.1 SOS1* Noonan-Syndrom Typ Q87.1 RAF1* % Noonan-Syndrom Typ Q87.1 NRAS* < 1 % Noonan-Syndrom Typ Q87.1 BRAF* < 2 % Noonan-Syndrom Typ Q87.1 RIT1* % * auch einzeln anforderbar Core Genes sind fett gedruckt 88

89 7.2.5 Herzfehler, syndromale Syndromale Herzfehler EVC, EVC2, JAG1, NOTCH2, SALL4, TBX3, TBX5 24,9 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. Humangenetik EVC, EVC2, JAG1, NOTCH2, SALL4, TBX3, TBX5 ADAMTS10, ARHGAP31, CHD7, CREBBP, DOCK6, EHMT1, EOGT, EP300, FBN1, FBN2, FLNA, FOXC1, GPC3, KDM6A, KMT2D, MED12, MGP, MYH11, NIPBL, NOTCH1, NSD1, PITX2, RBM10, RBPJ, SALL1, SEMA3E, TFAP2B, TGFBR1, TGFBR2, ZEB2 174,5 kb Erkrankungen, OMIM, ICD-10, Gene bei syndromalen Herzfehlern Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Adams-Oliver Syndrom Typ Q24.25 AD ARHGAP Adams-Oliver Syndrom Typ Q24.26 AR DOCK Adams-Oliver Syndrom Typ Q24.27 AD RBPJ Adams-Oliver Syndrom Typ Q24.28 AR EOGT Adams-Oliver Syndrom Typ Q24.29 AD NOTCH1* Alagille-Syndrom Typ 1 / Fallot Tetralogie Q24.30 AD JAG1** Alagille-Syndrom Typ 2 / Hajdu-Cheney Syndrom Q24.31 AD NOTCH Axenfeld-Rieger Syndrom Typ 3, mit und ohne Q24.41 AD FOXC1*, ** Herzfehler Char-Syndrom Q24.38 AD TFAP2B CHARGE-Syndrom Q24.32 AD CHD7*, ** ?CHARGE-Syndrom Q24.33 AD SEMA3E Cornelia-de-Lange-Syndrom Typ Q24.17 AD NIPBL*, ** Ellis-van-Creveld-Syndrom Typ Q24.23 AR EVC Ellis-van-Creveld-Syndrom Typ Q24.24 AR EVC Erkrankung der Aortenklappe Typ Q24.29 AD NOTCH1* Holt-Oram-Syndrom Q24.34 AD TBX Kabuki-Syndrom Typ Q24.13 AD KMT2D*, ** Kabuki-Syndrom Typ Q24.14 XL KDM6A** Kardiale Septumdefekte / Axenfeld-Rieger-Syndrom, Q24.42 AD PITX Typ 1 Kardiale valvuläre Dysplasie, X-linked Q24.40 XL FLNA* Keutel-Syndrom Q24.22 AR MGP Kleefstra-Syndrom Q24.21 AD EHMT Kongenitale Kontrakturelle Arachnodaktylie Q24.9 AD FBN2*

90 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Loeys-Dietz-Syndrom Typ 1 *** Q24.9 AD TGFBR1*, ** Loeys-Dietz-Syndrom Typ 2 *** Q24.9 AD TGFBR2*, ** Lujan-Fryns-Syndrom Q24.10 AD MED Melnick-Needles Syndrom Q24.40 XL FLNA* Mowat-Wilson Syndrom Q24.18 AD ZEB2*, ** Okihiro Syndrom - Duane Radial Ray Syndrom Q24.35 AD SALL periventrikuläre Heterotopie Q24.40 XL FLNA* Rubinstein-Taybi-Syndrom Typ Q24.15 AD CREBBP*, ** Rubinstein-Taybi-Syndrom Typ Q24.16 AD EP300** Simpson-Golabi-Behmel-Syndrom Q24.20 XL GPC Sotos-Syndrom Q24.19 AD NSD1*, ** TAAD Typ Q24.9 AD MYH11* TARP Syndrom Q24.39 AD RBM Townes-Brocks-Syndrom Q24.36 AD SALL Ulnar-mammary-Syndrom Q24.37 AD TBX Weill-Marchesani-Syndrom Typ Q24.11 AR ADAMTS Weill-Marchesani-Syndrom Typ Q24.12 AD FBN1*, ** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse *** Kapitel Core Genes sind fett gedruckt 90

91 8. Immundefekte, primäre Humangenetik Schematische Darstellung der phänotypischen und genetischen Heterogenität bei Immundefekten. 8.1 Agammaglobulinämie, hereditäre Dr. rer. nat. Barbara Bangol, Dr. med. Kaimo Hirv Die hereditäre Agammaglobulinämie ist eine primäre Immundefekterkrankung, charakterisiert durch stark erniedrigte oder fehlende Serumantikörper und massiv erniedrigte oder fehlende zirkulierende B-Zellen, hervorgerufen durch eine frühe Reifungsstörung der B-Zellen. Betroffene entwickeln schwere, rekurrierende bakterielle Infektionen in den ersten Lebensjahren. Die häufigste Form der Agammaglobulinämie ist die X-chromosomale Agammaglobulinämie (Typ Bruton), die durch Mutationen im BTK-Gen verursacht wird und bei etwa 85-95% der männlichen Patienten vorliegt. Die seltenen autosomal vererbten Agammaglobulinämien sind anhand klinischer Symptome kaum von der X-chromosomalen Form zu unterscheiden und tragen für bis zu 15% der Patienten mit Agammaglobulinämie bei. Aufgrund ihrer genetischen Heterogenität kann eine Analyse mittels NGS sinnvoll sein. Literatur Al-Herz et al, Front Immunol 5:162 (2014) / Bousfiha et al, J Clin Immunol 33:1078 (2013) / Conley, Curr Opin Immunol 21:466 (2009) / Conley et al, Immunol Rev 203:216 (2005) / Conley et al, J Clin Immunol 12:139 (1992) Agammaglobulinämie, hereditäre BLNK, BTK, CD79A, CD79B, IGHM, IGLL1, LRRC8A, PIK3R1 11,4 kb24 91

92 Erkrankungen, OMIM, ICD-10, Gene bei syndromaler, hereditärer Agammaglobulinämie Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Agammaglobulinämie, autosomal-rezessiv, AGM D80.0 IGHM Agammaglobulinämie, autosomal-rezessiv, AGM D80.0 IGLL Agammaglobulinämie, autosomal-rezessiv, AGM D80.0 CD79A Agammaglobulinämie, autosomal-rezessiv, AGM D80.0 BLNK Agammaglobulinämie, autosomal-dominant, AGM D80.9 LRRC8A Agammaglobulinämie, autosomal-rezessiv, AGM D80.0 CD79B Agammaglobulinämie, autosomal-rezessiv, AGM D80.0 PIK3R Agammaglobulinämie Typ Bruton D80.0 BTK*,** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 8.2 Neutropenie, kongenitale Dr. rer. nat. Barbara Bangol, Dr. med. Kaimo Hirv Die schweren kongenitalen Neutropenien (SCN) sind eine heterogene Gruppe von Erkrankungen der Myelopoese und charakterisiert durch absolute Neutrophilenzahlen <200/µl Blut, bei normaler Anzahl der Lymphozyten. Im Knochenmark besteht ein isolierter Block in der Ausreifung der myeloischen Reihe auf der Stufe der Promyelozyten. Bei Patienten mit einer SCN fällt als erstes ein verzögerter Abfall der Nabelschnur auf, ebenso treten rezidivierende Fieberepisoden auf und bakterielle Infekte, vor allem der Ohren (Mittelohrentzündung), Lunge (Lungenentzündung), Haut (Hautabszesse) und Schleimhäute (Zahnfleischentzündungen, Aphthen). Charakteristisch ist, dass sich meist keine oder wenig Eiterbildung zeigt. Etwa 10-30% der Patienten mit schwerer kongenitaler Neutropenie entwickeln im Laufe ihres Lebens ein Myelodysplastisches Syndrom (MDS) oder eine Akute Myeloische Leukämie (AML). Neutropenie ist zudem ein häufiges Merkmal verschiedener genetischer Syndrome, die mit extrahämatopoetischen Manifestationen assoziiert sind, wie dem Barth-Syndrom, dem Cohen-Syndrom, der Glykogenose durch Glukose-6-Phosphatase-Mangel Typ b, dem Hermansky-Pudlak-Syndrom Typ 2, der Poikilodermie mit Neutropenie oder dem Shwachman-Diamond-Syndrom. Häufigste genetische Ursache einer kongenitalen Neutropenie sind Mutationen im ELANE-Gen. Sie werden bei etwa 40-55% der Patienten mit permanent schwerer Neutropenie oder zyklischer Neutropenie gefunden. In selteneren Fällen liegen Mutationen in anderen SCN-assoziierten Genen vor. In bis zu 40% der SCN-Fälle ist die genetische Ursache weiterhin unbekannt. Literatur Al-Herz et al, Front Immunol 5:162 (2014) / Bousfiha et al, J Clin Immunol 33:1078 (2013) / Boztug und Klein, Hematol Oncol Clin North Am 27:43 (2013) / Hauck und Klein, Curr Opin Allergy Clin Immunol 13:596 (2013) / Donadieu et al, Orphanet J Rare Dis 6:26 (2011) / Xia et al, Br J Haematol 147:535 (2009) 92

93 Neutropenie, kongenitale AP3B1, CLPB, CSF3R, CXCR4, ELANE, G6PC3, GATA1, GATA2, GFI1, HAX1, JAGN1, LAMTOR2, RAB27A, SBDS, SLC37A4, TAZ, USB1, VPS45, WAS 24,1 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. Humangenetik AP3B1, CLPB, CSF3R, CXCR4, ELANE, G6PC3, GATA1, GATA2, GFI1, HAX1, JAGN1, LAMTOR2, RAB27A, SBDS, SLC37A4, TAZ, USB1, VPS45, WAS LYST, VPS13B 47,6 kb Erkrankungen, OMIM, ICD-10, Gene bei kongenitaler Neutropenie Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Barth-Syndrom E71.1 TAZ Chediak-Higashi-Syndrom (CHS) E70.3 LYST Cohen-Syndrom Q87.8 VPS13B Dyserythropoetische Anämie mit abnormen Blutplättchen und D64.4 GATA Neutropenie, X-chromosomale GATA2-Defizienz D70.7 GATA Glykogenose durch Glukose-6-Phosphatase-Mangel Typ b E74.0 SLC37A Griscelli-Syndrom Typ E70.3 RAB27A Hermansky-Pudlak-Syndrom Typ 2 (HPS 2) E70.3 AP3B Immundefekt durch MAPBPIP-Defizienz D82.8 LAMTOR MEGCANN D70.7 CLPB Poikilodermie mit Neutropenie D82.8 USB Schwere kongenitale Neutropenie (SCN2) D70.0 GFI Schwere kongenitale Neutropenie (SCN7) D70.7 CSF3R schwere kongenitale Neutropenie (SCN 1) D70.0 ELANE schwere kongenitale Neutropenie (SCN 3), Kostmann-Syndrom D70.0 HAX schwere kongenitale Neutropenie (SCN 4) D70.0 G6PC schwere kongenitale Neutropenie (SCN 5) D70.0 VPS schwere kongenitale Neutropenie (SCN 6) D70.0 JAGN Schwere kongenitale Neutropenie, X-chromosomale (SCN X) D70.0 WAS Shwachman-Bodian-Diamond-Syndrom (SBDS) D61.0 SBDS WHIM-Syndrom D81.8 CXCR Zyklische Neutropenie D70.0 ELANE

94 8.3 Kombinierte T- und B-Zellimmundefekte Dr. rer. nat. Barbara Bangol, Dr. med. Kaimo Hirv Kombinierte Immundefekte (CID), einschließlich der schweren kombinierten Immundefekte (SCID), sind eine heterogene Gruppe genetischer Erkrankungen, die durch einen Mangel und/oder eine Fehlfunktion der T-Zellen charakterisiert sind. Bei den SCID unterscheidet man Erkrankungen mit zusätzlich erniedrigter Anzahl zirkulierender B-Zellen (T-B-SCID, bei etwa 35% der SCID-Patienten) von SCID-Formen, bei denen B-Zellen vorhanden sind, wobei die B-Zell-Funktion selbst bei normaler Entwicklung dieser Zellen aufgrund der fehlenden T-Zell-Hilfe für die Antikörperantwort immer beeinträchtigt ist (T-B+SCID, bei etwa 65% der SCID-Patienten). Zudem kann die Anzahl der NK-Zellen vermindert sein. Während beim CID Restfunktionen der Abwehr erhalten bleiben und CID-Patienten verhältnismäßig gesund sein können, verläuft ein SCID ohne Blutstammzelltransplantation vor dem zweiten Lebensjahr letal. Klinische Manifestationen eines SCID treten in der Regel innerhalb der ersten 6 Lebensmonate auf. Es sind meist protrahiert verlaufende Infektionen des Magen-Darm-Trakts und der Atemwege, schwere Varizellen, komplizierte Infektionen mit EBV, CMV oder Adenovirus oder ein hartnäckiger Soorbefall. In manchen Fällen kann die Persistenz maternaler T-Zellen, die bei SCID-Patienten nicht abgestoßen werden und proliferieren können, zu Symptomen einer Graft-versus-Host-Erkrankung (GvHD) führen. Bei der SCID-Erkrankung sind im wesentlichen Gene betroffen, deren Produkte an der Reifung von Lymphozyten beteiligt sind. Hierzu gehören Zytokin-Rezeptoren, und deren Signal-transduzierende Moleküle, die für die frühe Differenzierung und Reifung von Lymphozyten essentiell sind, sowie Proteine, die für die Ausbildung und Funktion von B- und/oder T-Zell-Rezeptoren notwendig sind. Die häufigste SCID-Form wird durch Mutationen im IL2RG-Gen auf dem X-Chromosom verursacht und macht etwa 80% der SCID-Fälle bei männlichen Patienten aus. Weitere häufiger betroffene Gene (autosomal-rezessiv) sind RAG1/RAG2, DCLRE1C (Artemis), ADA und JAK3 (insgesamt bis zu 40% aller SCID-Fälle). Hypomorphe Mutationen in SCID-typischen Genen, die noch eine Restfunktion des betroffenen Proteins zulassen, können zu atypischem SCID führen, bei dem der klinische Phänotyp bisher nicht eindeutig definiert ist. Der Krankheitsverlauf ist nicht so schwer wie bei einem typischen SCID und die Diagnose sollte auch bei älteren Kindern und selbst bei erwachsenen Patienten berücksichtigt werden. Hypomorphe Mutationen in einigen SCID-assoziierten Genen können zum Omenn-Syndrom (OS) führen, einer entzündlichen Erkrankung ähnlich einer GvHD. Neben typischen SCID-Symptomen zeigen OS-Patienten zusätzlich entzündliche Symptome wie Lymphadenopathie, Hepatosplenomegalie, generalisierte Erythrodermie und Alopezie. Der Einsatz von NGS zur simultanen Analyse CID/SCID-relevanter Gene kann hilfreich sein, um eine frühzeitige genetische Diagnose stellen zu können. Literatur Al-Herz et al, Front Immunol 5:162 (2014) / Routes et al, J Clin Immunol 34:398 (2014) / Bousfiha et al, J Clin Immunol 33:1078 (2013) / Felgengreff et al, Clin Immunol 141:73 (2011) / Fischer et al, Immunol Rev 203:98 (2005) / Buckley et al, Annu Rev Immunol 22:625 (2004) / Muller et al, Blood 98:1847 (2001) 94

95 Kombinierte T- und B-Zellimmundefekte ADA, CD247, CD3D, CD3E, CD3G, CD40, CD40LG, CD8A, CORO1A, DCLRE1C, IL2RG, IL7R, JAK3, LIG4, PNP, RAG1, RAG2, ZAP70 25,1 kb Erweiterte Diagnostik Omenn-Syndrom (OS) ADA, AK2, DCLRE1C, IL2RG, IL7R, JAK3, LIG4, RAG1, RAG2 17,2 kb Schwere kombinierte Immundefekte (T-B-) ADA, AK2, DCLRE1C, LIG4, NHEJ1, PRKDC, RAG1, RAG2 24,6 kb Humangenetik Schwere kombinierte Immundefekte (T-B+) CD247, CD3D, CD3E, CORO1A, FOXN1, IL2RG, IL7R, JAK3, PTPRC 14,7 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ADA, AK2, CD247, CD3D, CD3E, CD3G, CD40, CD40LG, CD8A, CIITA, CORO1A, DCLRE1C, DOCK8, FOXN1, IKZF1, IL2RG, IL7R, ITK, JAK3, LCK, LIG4, MAGT1, NHEJ1, ORAI1, PNP, PRKDC, PTPRC, RAG1, RAG2, RFX5, RFXANK, RFXAP, RHOH, RMRP, STAT5B, STIM1, STK4, TAP1, TAP2, TAPBP, TRAC, UNC119, ZAP70 79,0 kb Erkrankungen, OMIM, ICD-10, Gene bei kombinierten T- und B-Zellimmundefekten Erkrankung OMIM-P ICD-10 Gen OMIM-Gen alymphoide zystische Thymus-Dysgenesie, kongenitale Alopezie D82.8 FOXN und Nageldystrophie anauxetische Dysplasie Q77.7 RMRP familiärer CD8-Mangel D84.8 CD8A Hyper-IgE-Syndrom infolge DOCK8-Mangel, autosomal rezessiv D81.1 DOCK Hyper-IgM-Syndrom Typ I (HIGM1), X-chromosomal D80.5 CD40LG Hyper-IgM-Syndrom Typ III (HIGM3) D80.5 CD Immundefekt mit Magnesium-Defekt, Epstein-Barr-Virus-Infektion D81.8 MAGT und Neoplasie, X-chromosomal Immundefizienz 7 (IMD7) D84.8 TRAC Immundefizienz D81.2 CORO1A Immundefizienz 9 (IMD9) D81.8 ORAI

96 Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Immundefizienz 10 (IMD10) D81.8 STIM Immundefizienz 13 (IMD13) D81.8 UNC Immundefizienz 17 (IMD17) D81.2 CD3G Immundefizienz D81.2 CD3E Immundefizienz D81.2 CD3D Immundefizienz 22 (IMD22) D81.1 LCK Immundefizienz D81.2 CD Immundefizienz 26 (IMD26) D81.1 PRKDC Knorpel-Haar-Hypoplasie (CHH) Q78.8 RMRP kombinierter Immundefekt infolge Ikaros-Mangel D81.8 IKZF kombinierter Immundefekt infolge STK4-Mangel D81.8 STK kombinierter Immundefekt infolge ZAP70-Mangel D81.8 ZAP kombinierter zellulärer und humoraler Immundefekt mit Hautgranulomen D81.8 RAG (CCHIDG) Laron-Syndrom mit Immundefekt D82.8 STAT5B LIG4-Syndrom D81.1 LIG Lymphoproliferatives Syndrom I (LPFS1) D72.8 ITK MHC-Klasse-I-Defekt D81.6 TAP MHC-Klasse-I-Defekt D81.6 TAP MHC-Klasse-I-Defekt D81.6 TAPBP MHC-Klasse-II-Defekt D81.7 CIITA MHC-Klasse-II-Defekt D81.7 RFX MHC-Klasse-II-Defekt D81.7 RFXANK MHC-Klasse-II-Defekt D81.7 RFXAP Omenn-Syndrom D81.8 ADA Omenn-Syndrom D81.8 AK Omenn-Syndrom D81.8 DCLRE1C Omenn-Syndrom D81.8 LIG Omenn-Syndrom D81.8 RAG Omenn-Syndrom D81.8 RAG Omenn-Syndrom D81.8 RMRP Purin-Nukleosid-Phosphorylase-Mangel D81.5 PNP Retikuläre Dysgenesie D81.0 AK schwerer kombinierter Immundefekt infolge ADA-Mangel, D81.3 ADA autosomal rezessiv, T- B- NKschwerer kombinierter Immundefekt infolge CD45-Mangel, D81.2 PTPRC autosomal rezessiv, T- B+ NK+ schwerer kombinierter Immundefekt infolge CD45-Mangel, D81.2 PTPRC autosomal rezessiv, T- B+ NK+ schwerer kombinierter Immundefekt infolge DCLRE1C-Mangel D81.1 DCLRE1C mit Strahlungs-Sensitivität schwerer kombinierter Immundefekt infolge IL7Rα-Mangel, D81.2 IL7R autosomal rezessiv, T- B+ NK+ schwerer kombinierter Immundefekt infolge JAK3-Mangel, D81.2 JAK autosomal rezessiv, T- B+ NK+ schwerer kombinierter Immundefekt infolge RAG1-Mangel, autosomal rezessiv, T- B- NK D81.1 RAG

97 Erkrankung OMIM-P ICD-10 Gen OMIM-Gen schwerer kombinierter Immundefekt infolge RAG2-Mangel, D81.1 RAG autosomal rezessiv, T- B- NK+ schwerer kombinierter Immundefekt mit Mikrozephalie, D81.1 NHEJ Wachstumsverzögerung und Strahlungs-Sensitivität schwerer kombinierter Immundefekt, X-chromosomal, T- B+ NK D81.2 IL2RG T-Zell-Defizienz mit Epidermodysplasia verruciformis - D84.8 RHOH Humangenetik 97

98 9. Lungenerkrankungen 9.1 Cystische Fibrose (Mukoviszidose, CF) Dipl.-Biol. Christina Sofeso, Dr. rer. biol. hum. S. Chahrokh-Zadeh Cystische Fibrose (CF) ist die häufigste autosomal-rezessiv vererbte Erkrankung in der kaukasischen Bevölkerung (Häufigkeit ca. 1:2.500, Heterozygotenfrequenz ca. 1:25). Mutationen im CFTR (Cystic Fibrosis Transmembrane Conductance Regulator)-Gen führen zu Funktionsstörungen eines Chloridkanals in der apikalen Membran von Drüsenepithelzellen und dadurch zur Änderung des Salzgehaltes des Schweißes und anderer Körpersekrete. Hierdurch kommt es zur Bildung des charakteristischen, zähflüssigen Schleims. Die Erkrankung betrifft vor allem das Bronchialsystem, ist mit häufigen Infektionen assoziiert und fortschreitend. Auch der Magen-Darm-Trakt kann durch Sekretionsstörungen des Pankreas betroffen sein. Bei etwa 85% der Patienten tritt eine Pankreasinsuffizienz auf. Die durchschnittliche Lebenserwartung Betroffener liegt bei ca Jahren. Jedes 25. Individuum in den westlichen Industrienationen ist asymptomatischer Träger (Konduktor) einer CFTR-Mutation. Gemeinsame Nachkommen zweier Konduktoren haben ein Risiko von 25%, an manifester CF zu erkranken. Die in vielen Bevölkerungsgruppen am häufigsten nachweisbare Mutation ist F508del. Je nach Art und Schweregrad der CFTR-Mutationen kann es zu unterschiedlicher Ausprägung der Erkrankung kommen. Neben der klassischen CF gibt es noch atypische Formen (CFTR-RD (CFTRrelated disease)), wie z.b. disseminierte Bronchieektasien, atypische chronische Rhinosinusitis, chronische Pankreatitis (s. auch Pankreatitis), und CBAVD (congenitale bilaterale Aplasie des Vas deferens). Literatur O'Sullivan et al, Lancet 373:1891 (2009) / Castellani et al, J Cyst Fibros 7:179 (2008) / Ogino et al, J Med Genet 41:e70 (2004) / Steiner et al, Hum Mutat 24:120 (2004) / Bobadilla et al, Hum Mutat 19:575 (2002) / Welsh et al in Scriver CR et al (eds): The Metabolic and Molecular Bases of Inherited Disease, 8th Ed, Chapter 201 (2001) / Claustres et al, Hum Mutat 16:143 (2000) / Bombieri et al, Hum Genet 103:718 (1998) / Brinson et al, Genet Test, Vol.1, No. 1 (1997) # Cystische Fibrose (CF) EBM Kapitel GOP und Mutationssuche, Deletions-/Duplikationsdiagnostik CFTR Kapitel Erkrankungen, OMIM, ICD-10, Gene bei Cystische Fibrose Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Cystische Fibrose (Mukoviszidose, CF) E84.9 CFTR*,** *auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 98

99 9.2 Interstitielle Lungenerkrankungen im Kindesalter (ILD)/diffuse parenchymatöse Lungenerkrankungen (DPLD) Dipl.-Biol. Christina Sofeso Die angeborenen Störungen des Surfactant-Metabolismus sind genetisch heterogen, manifestieren sich meist ab dem Neugeborenenalter, oft als klassische Alveolarproteinose, aber auch mit anderen klinischen Symptomen einer diffusen Lungenerkrankung mit mehr oder weniger schwerer respiratorischer Insuffizienz. Genetisch bedingte Surfactant-Dysfunktionen werden z.b. durch Mutationen in Genen verursacht, die für Protein-Komponenten des Surfactant kodieren (SFTPB, SFTPC), für den Lipidtransport (ABCA3), bzw. für die Signaltransduktion im Surfactant-Metabolismus der pulmonalen Macrophagen (CSF2RA, CSF2RB) von Bedeutung sind. Die Erkrankungen folgen verschiedenen Erbgängen: autosomal-rezessiv (SFTPB, ABCA3, CSF2RB), autosomal-dominant bzw. sporadisch durch dominante Neumutation (SFTPC) bzw. X-gebunden (CSF2RA). Mutationen in FLNA verursachen mehrere Erkrankungen, die im männlichen Geschlecht als Letalfaktor gelten und daher nur weibliche Betroffene zeigen. Dazu gehören Fehlbildungssyndrome aus dem Formenkreis der Otopalatodigitalen Syndrome (OPD 1 und 2), das Melnick-Needles-Syndrom und die frontometaphysäre Dysplasie; alle gehen mit Fehlbildungen einher, die das Skelett, die Kraniofazies, das Gehirn, Abdominalorgane und den Urogenitaltrakt betreffen. Ähnlich wird die X-gebunden-dominante periventrikuläre Heterotopie vererbt. Andere FLNA-assoziierte Syndrome gehen mit einer Symptomatik einher, die sich ausschließlich im männlichen Geschlecht zeigt, weibliche Mutationsträger sind symptomfrei. Im Jahr 2010 wurde erstmals ein sechsjähriger Patient mit einer X-gebundenen periventrikulären nodulären Heterotopie und zusätzlich einer schweren chronischen Lungenerkrankung beschrieben, der eine Mutation im FLNA-Gen in Mosaikform trägt wurde über eine weitere Patientin mit periventrikulärer nodulärer Heterotopie in Kombination mit einer schweren Lungenerkrankung und einer Mutation in FLNA berichtet. Das Filamin A-Gen codiert für Filamin A, ein Actin-bindendes Protein, das für den Erhalt des zellulären Actin-Zytoskeletts wichtig ist. Bei der kongenitalen alveolar-kapillären Dysplasie handelt es sich um ein seltenes schweres, kurz nach Geburt manifestes Krankheitsbild mit früher Letalität. Klinisch zeigt sich ein Atemnotsyndrom bei persistierender pulmonaler Hypertonie. Etwa 80% der Betroffenen haben zusätzliche Fehlbildungen, v.a. kardiovaskulär, gastrointestinal und urogenital, davon etwa 1/3 ein Verlust der normalen Rechts-Links-Asymmetrie der thorakalen und intraabdominalen Organe. Histologisch zeigt sich eine Fehlentwicklung der alveolären Kapillaren und Venen mit fehlendem Kontakt zwischen Kapillaren und Epithel, verdickter Muscularis der Arteriolen und der Alveolenwand und einem abnormen Verlauf der Lungenvenen gemeinsam mit den Arteriolen. Ursächlich sind Mutationen und Deletionen in FOXF1, einem Gen, das offenbar einem paternalen Imprinting unterliegt, da bei den bisher untersuchten Patienten immer das mütterliche Allel betroffen war. Das Gen liegt in einer komplex aufgebauten Region mit regulierenden Elementen in 16q24.1. Die meisten Fälle sind sporadisch aufgetreten; die wenigen familiären Fälle zeigten eine Vererbung über die Mutter, was ebenfalls mit einem paternalen Imprinting des Gens vereinbar ist. Die drei Leitsymptome des seltenen autosomal-dominant vererbten Hirn-Lunge-Schilddrüsen-Syndroms sind die benigne hereditäre Chorea, die Lungenerkrankung, beim Neugeborenen ein Atemnotsyndrom oder später eine chronische interstitielle Pneumonie oder rezidivierende Infektionen der Lunge, und die kongenitale Hypothyreose, Athyreose oder partielle Agenesie. Ursächlich sind Mutationen im NKX2-1-Gen, das für einen Transkriptionsfaktor codiert, der während der frühen Embryonalentwicklung v.a. in der Schilddrüse, Lunge, Basalganglien und Hypothalamus exprimiert wird. Humangenetik Literatur Eltahir et al, J Med Case Rep 10:97 (2016) / Paolini et al, Int J Mol Sci 16: ( 2015) / Wambach et al, Am J Respir Crit Care Med 189:1538 (2014) / Hildebrandt et al, Orphanet J Rare Dis 9:171 (2014) / Lord et al, Respir Care 59:e171 (2014) / Turcu et al, Arch Dis Child 98:490 (2013) / Hamvas et al, Chest 144:794 (2013) / Gillett et al, J Perinatol 33:157 (2013) / Sen et al, Hum Mutat 34:801 (2013) / Wambach et al, Pediatrics 130:e1575 (2012) / Agrawal et al, Pediatr Res 71:633 (2012) / Somaschini et al, Acta Biomed 83 Suppl 1:10 (2012) / Masurel-Paulet A et al, Eur J Med Genet, 54(1):25 (2011) / de Wit MC et al, Eur J Med Genet, 54(3):299 (2011) / Gower et al, Paediatr Respir Rev 12:223 (2011) / Gower et al, Paediatr Respir Rev 12:223 (2011) / Kleinlein et al, Arch Dis Child Fetal Neonatal Ed 96:F453 (2011) / Carey et al, Clin Immunol 135:223 (2011) / Maquet et al, J Clin Endocrinol Metab 94:197 (2009) / Faro et al, Neo Reviews 9:e468 (2008) / Bullard et al, Pediatr Res 62:176 (2007) / Somaschini et al, J Pediatr 150:649 (2007) / Cameron et al, J Pediatr 146:370 (2005) / Brasch et al, Am J Respir Crit Care Med 174:571 (2006) / Whitsett et al, N Engl J Med 347:2141 (2002) / Nogee at al, N Engl J Med 344:573 (2001) / Dunbar et al, Pediatr Res 48:275 (2000) / Klein et al, J Pediatr 132:244 (1998) / Ballard et al, Pediatrics 96:1046 (1995) / Nogee et al, N Engl J Med 328:406 (1993) 99

100 # Interstitielle - / diffuse parenchymatöse Lungenerkrankungen ABCA3, CSF2RA, CSF2RB, FLNA, FOXF1, NKX2-1, SFTPB, SFTPC 21,1 kb Erkrankungen, OMIM, ICD-10, Gene bei Interstitiellen - / diffusen parenchymatösen Lungenerkrankungen Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen FLNA-assoziierte Lungenerkrankung - J84.- XL FLNA* Hirn-Lunge-Schilddrüse-Syndrom J84.- AD NKX2-1*,** Kongenitale alveolar-kapilläre Dysplasie J84.- AD FOXF1*,** (ACDMPV) Surfactant-Dysfunktion Typ J84.0 AR SFTPB* Surfactant-Dysfunktion Typ J84.0 AD SFTPC* Surfactant-Dysfunktion Typ J84.0 AR ABCA3* Surfactant-Dysfunktion Typ J84.0 XL CSF2RA*,** Surfactant-Dysfunktion Typ J84.0 AR CSF2RB* * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 9.3 Pulmonale arterielle Hypertonie (PAH) Dipl.-Biol. Christina Sofeso Unter der pulmonalen arteriellen Hypertonie (PAH) werden verschiedene Formen von Lungenhochdruckerkrankungen zusammengefasst. Die PAH kann sporadisch ohne bekannte Ursache (idiopathische pulmonale arterielle Hypertonie, IPAH) oder familiär auftreten (hereditäre pulmonale arterielle Hypertonie, HPAH). Des Weiteren kann eine PAH im Zusammenhang mit anderen Erkrankungen, wie z.b. Bindegewebserkrankungen, HIV-Infektionen oder Lebererkrankungen vorkommen oder auch durch bestimmte Medikamente induziert sein. Die PAH ist gekennzeichnet durch einen mittleren pulmonal-arteriellen Druck (PAP) von >25mmHg im Ruhezustand bei normalem pulmonalkapillären Verschlussdruck (Wedge-Druck) 15mmHg und durch einen erhöhten Gefäßwiderstand (PVR). Durch typische Veränderungen der Lungengefäße kommt es zunehmend zu einer Gefäßverengung und somit zur Überlastung des rechten Herzens, welche letztendlich zu einem Rechtsherzversagen führen kann. Bei der hereditären pulmonalen arteriellen Hypertonie (HPAH) handelt es sich um eine autosomal-dominant vererbte Erkrankung mit unvollständiger Penetranz. Heterozygote Mutationen im BMPR2-Gen (Bone Morphogenetic Receptor 2; Mitglied der transforming growth factor beta (TGF-ß) family) konnten bisher bei etwa 75% der Patienten mit HPAH und bei ca % der Patienten mit IPAH identifiziert werden. Im Durchschnitt entwickeln etwa 27% der BMPR2-Mutationsträger eine PAH, wobei die Penetranz bei Frauen mit 42% deutlich höher liegt, als bei Männern (ca. 14%). In selteneren Fällen (ca. 1-3%) können auch Mutationen in anderen Genen, die z.t. ebenfalls in den TGF-ß Signalweg involviert sind, vorliegen (z.b. ACVRL1, ENG, SMAD9, CAV1, KCNK3, TBX4). Literatur Chung et al, Can J Cardiol 31:544 (2015) / Ma et al, Hum Genet 133:471 (2014) / Austin et al, Circ Res 115:189 (2014) / Kwapiszewska et al, Dtsch Med Wochenschr 139: S111 (2014) / Kerstjens-Frederikse et al, Med Genet 50:500 (2013) / Pabst et al, Pharm Unserer Zeit 36:448 (2010) / Hoeper et al, Pneumologie, 64:401 (2010) / Girerd et al, Am J Respir Crit Med 181:851 (2010) / Machado et al, J Am Coll Cardiol 54:S32 (2009) / Simmonneau et al, J Am Coll Cardiol 54:S43 (2009) / Montani et al, Eur Respir Rev 18:272 (2009) / Müller et al, Med Genet 4:318 (2006) 100

101 Pulmonale arterielle Hypertonie (PAH) ACVRL1 (ALK1), BMPR1B, BMPR2, CAV1, EIF2AK4, ENG, GDF2 (BMP9), KCNA5, KCNK3, SMAD1, SMAD4, SMAD9, TBX4 23,9 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. Humangenetik ACVRL1 (ALK1), BMPR1B, BMPR2, CAV1, EIF2AK4, ENG, GDF2 (BMP9), KCNA5, KCNK3, SMAD1, SMAD4, SMAD9, TBX4 NOTCH3 30,8 kb Erkrankungen, OMIM, ICD-10, Gene bei pulmonaler arterieller Hypertonie (PAH) Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Pulmonale arterielle Hypertonie (PAH) I27.0 BMPR2 *,** Pulmonale arterielle Hypertonie (PAH) I27.0 ACVRL1 ** Pulmonale arterielle Hypertonie (PAH) - I27.0 ENG ** Pulmonale arterielle Hypertonie (PAH) I27.0 KCNK Pulmonale arterielle Hypertonie (PAH) I27.0 CAV Pulmonale arterielle Hypertonie (PAH) I27.0 SMAD Pulmonale arterielle Hypertonie (PAH) - I27.0 BMPR1B Pulmonale arterielle Hypertonie (PAH) - I27.0 TBX Pulmonale arterielle Hypertonie (PAH) I27.0 EIF2AK Pulmonale arterielle Hypertonie (PAH) - I27.0 SMAD Pulmonale arterielle Hypertonie (PAH) - I27.0 KCNA Pulmonale arterielle Hypertonie (PAH) - I27.0 SMAD Pulmonale arterielle Hypertonie (PAH) - I27.0 GDF2 (BMP9) Pulmonale arterielle Hypertonie (PAH) - I27.0 NOTCH * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 101

102 10. Mitochondriale Erkrankungen (mitochondriales Genom) Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Mitochondriale Erkrankungen werden durch Störungen der mitochondrialen Atmungskette und damit der OXPHOS und darüber hinaus durch Störungen anderer biochemischer Mechanismen, wie z.b. ß-Oxidation, mitochondrialer Fusion und Teilung u.v.a. hervorgerufen. Sie entstehen sowohl durch Mutationen mitochondrial kodierter als auch kernkodierter (über 1.000) Gene. Symptome nahezu aller Organe sind beschrieben. Mutationen der (mitochondrialen) mtdna können in homo- oder heteroplasmischer Form vorliegen, wobei das Ausmaß der Heteroplasmie erst ab einem bestimmten Schwellenwert von pathologischer Bedeutung sein kann. Schematische Darstellung des humanen mitochondrialen Genoms mit allen codierenden Genen und den häufigsten Mutationen bei LHON, MELAS und MERRF Bei mitochondrialen Erkrankungen, die durch Mutationen von mitochondrial kodierten Genen verursacht werden, liegt immer eine mütterliche Vererbung zugrunde. Zu den Erkrankungen, bei denen mtdna-mutationen eine Rolle spielen, zählen: - LHON (Leber sche hereditäre Optikusneuropathie), charakterisiert durch bilateralen, schmerzfreien, subakuten Visusverlust im Laufe des Erwachsenenlebens durch selektive Degeneration der retinalen Ganglion Zellschicht und des Nervus opticus. Bei ca. 90% der Patienten kann eine der drei mtdna- Mutationen nachgewiesen werden: m.3460g>a, m.11778g>a oder m.14484t>c. - MELAS (Mitochondriale Encephalomyopathie, Laktatazidose und Schlaganfall-ähnliche Episoden), eine Multisystemerkrankung mit Beginn im Kindesalter. Die häufigste Mutation betrifft m.3243a>g des MT- TL1-Gens, es sind jedoch auch Mutationen in weiteren mtdna-genen beschrieben; - MERRF (Myoklonische Epilepsie mit ragged red fibers ), eine Multisystemerkrankung mit primär myoklonischer, später generalisierter Epilepsie, Ataxie, Schwäche und Demenz. Die häufigste Mutation m.8344a>g betrifft das MT-TK-Gen, auch hier sind weitere mtdna-mutationen bekannt. Vorteil der NGS-Methode ist die simultane Erfassung des Heteroplasmiegrades. Literatur Wang et al, Chin Med J 128:1820 (2015) /Farrar et al, Trends Genet 29:488 (2013) Mitochondriales Genom (37 Gene; 16,6 kb) bei V.a. LHON, MELAS, MERFF oder mitochondriale Taubheit Tabelle mit den Genen des mitochondrialen Genomes und OMIM-G siehe Taubheit S

103 11. Muskelerkrankungen Humangenetik Schematische Darstellung der phänotypischen und genetischen Heterogenität bei Muskelerkrankungen. Die einzelnen Sub-Panels sind farblich voneinander abgegrenzt, Core Genes sind fett gedruckt. nicht NGS-basierte Diagnostik der jeweils häufigsten Erkrankung aus der Indikationsgruppe 103

104 11.1 Core-Myopathien Dr. rer. biol. hum. S. Chahrokh-Zadeh, Dr. med. Imma Rost Kongenitale Myopathien sind eine Gruppe seltener, klinisch heterogener Erkrankungen, die durch Strukturauffälligkeiten in der Muskelhistologie bzw. Elektronenmikroskopie gekennzeichnet sind. Die häufigsten kongenitalen Strukturmyopathien sind die Nemaline Myopathie, die Central-Core-Myopathie und die Zentronukleäre Myopathie. Wegen der vielfältigen Differenzialdiagnosen muss eine breite diagnostische Abklärung erfolgen. Die genetische Paneldiagnostik kann zur definitiven Zuordnung beitragen. Die kongenitalen Muskeldystrophien sind ebenfalls selten, klinisch und genetisch heterogen mit unterschiedlichen, z.t. schweren Begleitsymptomen wie Fehlbildungen des Zentralen Nervensystems oder der Augen und damit sehr variablen Verläufen. Literatur North KN et al, Neuromuscul Disord 24:97 (2014) / Nigro V et al, Acta Myol XXXI:196 (2012) Erweiterte Diagnostik Core-Myopathien Stufe I RYR1 15,1kb Core-Myopathien Stufe II ACTA1, BIN1, DNM2, MTM1, SEPN1, TPM3 10,0 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. RYR1 ACTA1, BIN1, DNM2, MTM1, SEPN1, TPM3 TPM2, TTN 133,9 kb Erkrankungen, OMIM, ICD-10, Gene bei Core-Myopathien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Central-Core-Myopathie G RYR1* Myopathie, frühmanifestierend G TTN mit Kardiomyopathie Myopathie, kongenital mit Cores, G ACTA auch Nemaline Myopathie Typ 3 Myopathie, kongenital G SEPN mit Fasertypendisproportion CFTD Myopathie, kongenital G TPM mit Fasertypendisproportion CFTD Myopathie, zentronukleär CNM G71.2 AD DNM Myopathie, zentronukleär, CNM G71.- AR BIN Myopathie, zentronukleär CNMX G71.- XR MTM Nemaline Myopathie Typ G TPM Nemaline Myopathie Typ G TPM * auch einzeln anforderbar Core Genes sind fett gedruckt 104

105 11.2 Hypokaliämische periodische Paralysen (HypoPP) Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, M.Sc. Anna Munzig Die autosomal-dominant vererbten primären periodischen Paralysen sind charakterisiert durch reversible episodische Muskelschwäche und intermittierende Myotonie. Anfallsartige Lähmungen bilden sich innerhalb von wenigen Stunden bis einigen Tagen zurück, wobei die Atemmuskulatur weniger betroffen und Bewusstsein und Sprache immer ungestört sind. Verantwortlich sind Fehlfunktionen in muskulären Ionenkanälen (Natrium-, Calcium-, Kalium-Kanäle), welche die Aktivität der Myozyten steuern. Die Muskelschwäche kann mit Veränderungen des Serum-Kaliumspiegels einhergehen und in eine hyper- bzw. hypokaliämische periodische Paralyse differenziert werden. Eine klinische Unterscheidung anhand des Serum-Kalium, welches während des Auftretens der Symptome bestimmt werden muss, ist jedoch nicht immer möglich. Die häufigste Form ist die HypoPP (Prävalenz: 1: ). Die eine Stunde bis Tage andauernde Lähmung aller Extremitäten wird von einem Abfall des Serum-Kaliumspiegels unter 3mmol/L (Referenzwert: 3,5-5mmol/L) begleitet. Die Ausprägung der Lähmung kann - von einer leichten Schwäche bis zu einer kompletten Lähmung der Extremitäten - sehr variabel sein. Die ersten Symptome treten meist vor dem 20. Lebensjahr auf, wobei die Anfallshäufigkeit zwischen dem 15. und 35. Lebensjahr ein Maximum erreicht. Auslöser für die Anfälle sind unter anderem kohlenhydratreiche Mahlzeiten, Stress, Alkoholkonsum oder körperliche Anstrengung. In sehr schweren Fällen kann sich im späteren Verlauf der Erkrankung eine anhaltende Schwäche der Gliedergürtelmuskulatur entwickeln. Bei ca. 60% der Patienten mit HypoPP können Mutationen im CACNA1S-Gen nachgewiesen werden. Dieses Gen codiert für die alpha-1-untereinheit des muskulären, spannungsgesteuerten Calcium-Kanals CaV1.1, der überwiegend im Skelettmuskel und der Retina exprimiert wird. Mutationen in diesem Gen sind ebenfalls mit einer Prädisposition für maligne Hyperthermie (siehe Eintrag unter Pharmakogenetik) assoziiert. In ca. 10% der HypoPP-Fälle findet man Mutationen im SCN4A-Gen und ca. 3% der Patienten zeigen Mutationen im KCNJ18- Gen. Humangenetik Literatur Statland et al, Continuum (Minneap Minn) 19 (6 Muscle Disease):1598 (2013) /Matthews et al, J Physiol 588:1879 (2010) / Striessnig et al, Pflugers Arch 460:361 (2010) / Rayan et al, Curr Op in Neur 23:466 (2010) Hypokaliämische Periodische Paralyse CACNA1S, KCNJ18, SCN4A 12,4 kb Erkrankungen, OMIM, ICD-10, Gene bei hypokaliämischer periodischer Paralyse Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Hypokaliämische Periodische Paralyse G72.3 AD KCNJ18* Hypokaliämische Periodische Paralyse Typ G CACNA1S* Hypokaliämische Periodische Paralyse Typ G SCN4A * auch einzeln anforderbar Core Genes sind fett gedruckt 105

106 11.3 Muskelatrophien, spinale (SMA) Dr. rer. biol. hum. S. Chahrokh-Zadeh, Dr. med. Imma Rost Genetisch bedingte spinale Muskelatrophien werden verursacht durch den Untergang von Vorderhornzellen im Rückenmark. Die häufigste Form ist die SMA infolge von Deletionen (seltener Punktmutationen) des SMN1- Gens (z.b. SMA1 Typ Werdning-Hoffmann). Bei V. a. SMA wird eine konventionelle Deletionssuche durchgeführt (MLPA SMN1-Gen), im Einzelfall auch eine Mutationssuche. Weitere seltene Formen wurden v.a. durch Next Generation Sequencing identifiziert (s. unten stehende Tabelle). Bei SMA handelt sich eine klinisch sehr heterogene Gruppe von Erkrankungen, bei denen teilweise auch andere Leitsymptome im Vordergrund stehen (z.b. Pontocerebelläre Hypoplasien). Spinale Muskelatrophie Typ 1-4 EBM Kap GOP SMN1 Spinale Muskelatrophien (neonatal/frühmanifestierend) und Pontocerebelläre Hypolasie ASAH1, ATP7A, EXOSC3, EXOSC8, IGHMBP2, PLEKHG5, TRPV4, UBA1, VRK1 20,6 kb Kapitel Erweiterte Diagnostik Spinale Muskelatrophien (spätmanifestierend) ATP7A, BICD2, BSCL2, CHCHD10, DNAJB2, FBXO38, GARS, HSPB8, REEP1, SLC5A7, TFG, TRPV4, VAPB 22,8 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ASAH1, ATP7A, EXOSC3, EXOSC8, IGHMBP2, PLEKHG5, TRPV4, UBA1, VRK1 ATP7A, BICD2, BSCL2, CHCHD10, DNAJB2, FBXO38, GARS, HSPB8, REEP1, SLC5A7, TFG, TRPV4, VAPB ASAH1, ATP7A, BICD2, BSCL2, CHCHD10, DNAJB2, DYNC1H1, EXOSC3, EXOSC8, FBXO38, GARS, HSPB8, IGHMBP2, PLEKHG5, REEP1, SLC5A7, TFG, TRPV4, UBA1, VAPB, VRK1 50,0 kb 106

107 Erkrankungen, OMIM, ICD-10, Gene bei spinalen Muskelatrophien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Amyotrophe Lateralsklerose Typ 8 (ALS8) G VAPB Charcot-Marie-Tooth-Syndrom, rezessiver intermediärer G60.0 AR PLEKHG Typ (CMTRIC) Distale SMA VA (HMN5A) G12.9 AD BSCL Distale SMA VA (HMN5A) G12.9 AD GARS Distale SMA, autosomal rezessiv, 4 (DSMA4) G12.9 AR PLEKHG Distale SMA, autosomal rezessiv, 5 (DSMA5) G12.9 AR DNAJB Distale spinale Muskelatrophie, X-chromosomal G12.9 XR ATP7A (SMAX3) Hereditäre motorisch-sensorische Neuropathie G60.0 AD TRPV Typ 2C (HMSN2C) Hereditäre motorisch-sensorische Neuropathie, G60.9 AD TFG Typ Okinawa (HMSNO) Hereditäre motorische Neuropathie 2A G60.9 AD HSPB (HMN2A) Hereditäre motorische Neuropathie 7A G60.9 AD SLC5A (HMN7A) Hereditäre motorische Neuropathie VB G60.9 AD REEP (HMN5B) Kongenitale, nicht progressive distale SMA G12.9 AD TRPV Neonatale SMA mit Arthrogrypose, X-chromosomal G12.9 XR UBA (SMAX2) Pontocerebelläre Hypoplasie Typ 1A (PCH1A) Q04.3 AR VRK Pontocerebelläre Hypoplasie Typ 1B (PCH1B) Q04.3 AR EXOSC Pontocerebelläre Hypoplasie Typ 1C (PCH1C) Q04.3 AR EXOSC Skapuloperoneale SMA G12.9 AD TRPV SMA mit progressiver Myoklonus-Epilepsie G12.9 AR ASAH (SMAPME) SMA Typ Jokela (SMAJ) G12.9 AD CHCHD SMA with Respiratory Distress (SMARD) G12.9 AR IGHMBP SMA, lower extremity-predominant, autosomal G12.9 AD DYNC1H dominant (SMA-LED1) SMA, spätmanifestierend, Typ Finkel G12.9 AD VAPB SMA-LED G12.9 AD BICD Spinale Muskelatrophie, distal - G60.9 AD FBXO Core Genes sind fett gedruckt Humangenetik 11.4 Muskeldystrophien Dr. rer. biol. hum. S. Chahrokh-Zadeh, Dr. med. Imma Rost Die Muskeldystrophien stellen eine Erkrankungsgruppe, die progressive Muskelschwäche- und Degeneration verursachen. Die zugrundeliegenden Defekte betreffen Gene, die für eine normale Muskelfunktion erforderlich sind und die klinischen Manifestationen sind teilweise überlappend. Mit Hilfe von Immunhistochemischen- oder Immunfluoreszenz-Färbungen gelingt die Differenzierung nur einiger Untertypen, wie Dysferlinopathie, Dystrophinopathie oder Sarcoglykanopathien. Viele weitere, an der Erkrankung beteiligte, defekte Proteine sind nicht ohne weiteres bestimmbar. Die häufigsten Muskeldystrophien betreffen die Muskeldystrophie Duchenne, die Myotonen Dystrophien und die Fazioscapulohumerale Dystrophie. Andere, weniger häufige Muskeldystrophien 107

108 betreffen die Gliedergürtel-, die Emery-Dreifuss- und die kongenitalen Muskeldystrophien. Mutationen in vielen Genen führen zu dieser Erkrankungsgruppe und ihre Differenzierung stellt oft eine große Herausforderung dar. Die kongenitalen Muskeldystrophien sind selten, klinisch und genetisch heterogen mit unterschiedlichen, z.t. schweren Begleitsymptomen wie Fehlbildungen des Zentralen Nervensystems oder der Augen und damit sehr variablen Verläufen. Ihre Prävalenz ist noch größtenteils unbekannt, wobei die Frequenz bestimmter Untertypen innerhalb verschiedener Bevölkerungsgruppen variieren soll. Literatur Dai et al, Neuromusc Dis 25:617 (2015) / Chae et al, J Med Genet 52:208 (2015) / Sparks et al, Genereviews (2012) Muskeldystrophien (Dystroglycanopathien Typ A+B) B3GALNT2, B4GAT1, DAG1, FKRP, FKTN, GMPPB, ISPD, LARGE, POMGNT1, POMGNT2, POMK, POMT1, POMT2, TMEM kb Erweiterte Diagnostik Muskeldystrophien (Kollagen-assoziierte und sonstige) CHKB, COL6A1, COL6A2, COL6A3, FHL1, ITGA7, SEPN1 23,0 kb Dystroglycanopathien Typ A (mit Gehirn- und Augenanomalien) B3GALNT2, B3GNT1, DAG1, FKRP, FKTN, GMPPB, ISPD, LARGE, POMGNT1, POMGNT2, POMK, POMT1, POMT2, TMEM kb Dystroglycanopathien Typ B (Kongenital, mit mentaler Retardierung) und Typ C DAG1, FKRP, FKTN, GMPPB, ISPD, LARGE, POMGNT1, POMK, POMT1, POMT2 17,9 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. B3GALNT2, B4GAT1, DAG1, FKRP, FKTN, GMPPB, ISPD, LARGE, POMGNT1, POMGNT2, POMK, POMT1, POMT2, TMEM5 CHKB, COL6A1, COL6A2, COL6A3, FHL1, ITGA7, SEPN1 B3GALNT2, B3GNT1, DAG1, FKRP, FKTN, GMPPB, ISPD, LARGE, POMGNT1, POMGNT2, POMK, POMT1, POMT2, TMEM5 DAG1, FKRP, FKTN, GMPPB, ISPD, LARGE, POMGNT1, POMK, POMT1, POMT2 56,3 kb 108

109 Erkrankungen, OMIM, ICD-10, Gene bei Muskeldystrophien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Bethlem kongenitale Muskeldystrophie G71.- AD, AR COL6A Bethlem kongenitale Muskeldystrophie G71.- AD, AR COL6A Bethlem kongenitale Muskeldystrophie G71.- AD, AR COL6A Kongenitale Muskeldystrophie mit Integrindefekt G71.- AR ITGA Kongenitale Muskeldystrophie mit Merosindefizienz G71.- AR LAMA (MDCA1) MDDGA G71.- AR POMT MDDGA G71.- AR POMT MDDGA3, congenital G71.- AR POMGNT MDDGA4, congenital G71.- AR FKTN MDDGA G71.- AR FKRP MDDGA6, congenital G71.- AR LARGE MDDGA7, congenital G71.- AR ISPD MDDGA7, congenital G71.- AR ISPD MDDGA G71.- AR POMGNT MDDGA G71.- AR DAG MDDGA G71.- AR DAG MDDGA G71.0 AR DAG MDDGA G71.- AR TMEM MDDGA G71.- AR B3GALNT MDDGA G71.- AR POMK MDDGA G71.- AR B4GAT MDDGA G71.- AR B3GNT MDDGA G71.- AR GMPPB MDDGB G71.- AR POMT MDDGB G71.- AR POMT MDDGB G71.- AR POMGNT MDDGB4, congenital G71.- AR FKTN MDDGB G71.- AR FKRP MDDGB G71.- AR LARGE MDDGB G71.- AR GMPPB MDDGC G71.0 AR POMGNT Muskeldystrophie mit rigider Wirbelsäule G71.- XL FHL Muskeldystrophie mit rigider Wirbelsäule G71.- AR SEPN Myopathie mit reduzierenden Einschlusskörpern G71.- XL FHL (RBM) Ullrich kongenitale Muskeldystrophie G71.- AD, AR COL6A Ullrich kongenitale Muskeldystrophie G71.- AD, AR COL6A Ullrich kongenitale Muskeldystrophie G71.- AD, AR COL6A kongenitale Muskeldystrophie, megakonialer Typ G71.- AR CHKB Humangenetik 109

110 11.5 Muskeldystrophien, kongenitale Erkrankungen, OMIM, ICD-10, Gene bei kongenitalen Muskeldystrophien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Bethlem kongenitale Muskeldystrophie G71.- AD/AR COL6A Bethlem kongenitale Muskeldystrophie G71.- AD/AR COL6A Bethlem kongenitale Muskeldystrophie G71.- AD/AR COL6A Kongenitale Muskeldystrophie mit abnormen G71.- AR CHKB mitochondrialen Strukturen (MDCMC) Kongenitale Muskeldystrophie mit Integrindefekt G71.- AR ITGA Kongenitale Muskeldystrophie mit Merosindefizienz G71.- AR LAMA (MDCA1) MDDGA G71.- AR POMT MDDGA G71.- AR POMT MDDGA3, congenital G71.- AR POMGNT MDDGA4, congenital G71.- AR FKTN MDDGA G71.- AR FKRP MDDGA6, congenital G71.- AR LARGE MDDGA7, congenital G71.- AR ISPD MDDGA G71.- AR POMGNT MDDGA G71.0 AR DAG MDDGA G71.- AR TMEM MDDGA G71.- AR B3GALNT MDDGA G71.- AR POMK MDDGA G71.- AR B4GAT MDDGA G71.- AR GMPPB MDDGB G71.- AR POMT MDDGB G71.- AR POMT MDDGB G71.- AR POMGNT MDDGB4, congenital G71.- AR FKTN MDDGB G71.- AR FKRP MDDGB G71.- AR LARGE MDDGB G71.- AR GMPPB Muskeldystrophie mit rigider Wirbelsäule G71.- XL FHL Muskeldystrophie mit rigider Wirbelsäule G71.- AR SEPN Myopathie mit reduzierenden Einschlusskörpern G71.- XL FHL (RBM) Ullrich kongenitale Muskeldystrophie G71.- AD/AR COL6A Ullrich kongenitale Muskeldystrophie G71.- AD/AR COL6A Ullrich kongenitale Muskeldystrophie G71.- AD/AR COL6A

111 11.6 Muskeldystrophien, progressive Dr. rer. biol. hum. S. Chahrokh-Zadeh, Dr. med. Imma Rost Zu den progressiven Muskeldystrophien können die Muskeldystrophie Duchenne/Becker-Kiener, die heterogene Gruppe der Gliedergürtelmuskeldystrophien, teilweise die Dystroglycanopathien und die Emery-Dreifuß-Muskeldystrophie gerechnet werden. Es handelt sich also um eine heterogene Gruppe von Erkrankungen, die unterschiedliche Manifestationsalter, Schweregrade, Verläufe und Begleitsymptome zeigen. Insgesamt machen die progressiven Muskeldystrophien einen Anteil von rund einem Drittel aller Muskelerkrankungen in verschiedenen Populationen aus. Da es teilweise erhebliche klinische Überlappungen gibt, kann unter Berücksichtigung der Häufigkeiten und nach sorgfältiger Vordiagnostik eine Paneldiagnostik bei der genauen Zuordnung hilfreich sein. Literatur North KN et al, Neuromuscul Disord 24:97 (2014) / Nigro V et al, Acta Myol XXXI:196 (2012) Humangenetik Progressive Muskeldystrophien (Typ Duchenne/Typ Becker) EBM Kap GOP DMD Progressive Muskeldystrophien (Gliedergürtelmuskeldystrophien AD + AR) ANO5, CAPN3, CAV3, DYSF, FKRP, FKTN, LMNA, MYOT, SGCA, SGCB, SGCD, SGCG, TCAP, TRIM32 24,7 kb Kapitel Erweiterte Diagnostik Emery-Dreifuß Muskeldystrophie EMD, FHL1, LMNA, SYNE2 24,4 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ANO5, CAPN3, CAV3, DYSF, FKRP, FKTN, LMNA, MYOT, SGCA, SGCB, SGCD, SGCG, TCAP, TRIM32 EMD, FHL1, LMNA, SYNE2 DAG1, DES, DNAJB6, GAA, GMPPB, HNRNPDL, ISPD, LIMS2, PLEC, POMGNT1, POMK, POMT1, POMT2, SYNE1, TMEM43, TNPO3, TRAPPC11, TTN 234,6 kb Erkrankungen, OMIM, ICD-10, Gene bei progressiven Muskeldystrophien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen?LGMD2R G71.0 AR DES EDMD G71.- XR EMD EDMD G71.- AD LMNA*

112 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen EDMD G71.- AR LMNA* EDMD G71.- AD SYNE EDMD G71.- AD SYNE EDMD G71.- XR FHL EDMD G71.- AD TMEM43*, ** LGMD1A G71.0 AD MYOT LGMD1B G71.0 AD LMNA* LGMD1C G71.0 AD CAV3* LGMD1E G71.0 AD DNAJB LGMD1F G71.0 AD TNPO LGMD1G G71.0 AD HNRNPDL LGMD2A G71.0 AR CAPN LGMD2B G71.0 AR DYSF LGMD2C G71.0 AR SGCG LGMD2D G71.0 AR SGCA LGMD2E G71.0 AR SGCB LGMD2F G71.0 AR SGCD LGMD2G G71.0 AR TCAP LGMD2H G71.0 AR TRIM LGMD2I - G71.0 AR FKRP LGMD2J G71.0 AR TTN LGMD2K - G71.0 AR POMT LGMD2L G71.0 AR ANO LGMD2M - G71.0 AR FKTN LGMD2N - G71.0 AR POMT LGMD2O - G71.0 AR POMGNT LGMD2P - G71.0 AR DAG LGMD2Q G71.0 AR PLEC LGMD2S G71.0 AR TRAPPC LGMD2T - G71.0 AR GMPPB LGMD2U - G71.0 AR ISPD LGMD2V (M. Pompe) G71.0 AR GAA LGMD2W - G71.0 AR LIMS MDDGC G71.0 AR POMT MDDGC G71.0 AR POMT MDDGC G71.0 AR POMGNT MDDGC G71.0 AR FKTN MDDGC G71.0 AR FKRP MDDGC G71.0 AR ISPD MDDGC G71.0 AR DAG MDDGC G71.0 AR POMK MDDGC G71.0 AR GMPPB Muskeldystrophie Becker *** G71.0 XR DMD*, ** Muskeldystrophie Duchenne *** G71.0 XR DMD*, ** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse *** Abrechnung Kap Core Genes sind fett gedruckt 112

113 11.7 Myopathien, kongenitale Dr. rer. biol. hum. S. Chahrokh-Zadeh, Dr. med. Imma Rost Kongenitale Myopathien sind eine Gruppe seltener, klinisch heterogener Erkrankungen, die durch Strukturauffälligkeiten in der Muskelhistologie bzw. Elektronenmikroskopie gekennzeichnet sind. Die häufigsten kongenitalen Strukturmyopathien sind die Nemaline Myopathie, die Central-Core-Myopathie und die Zentronukleäre Myopathie. Wegen der vielfältigen Differenzialdiagnosen muss eine breite diagnostische Abklärung erfolgen. Die genetische Paneldiagnostik kann zur definitiven Zuordnung beitragen. Literatur North KN et al, Neuromuscul Disord 24:97 (2014) / Nigro V et al, Acta Myol XXXI:196 (2012) Kongenitale Myopathien ACTA1, MYH7, RYR1, TPM3 22,9 kb Erweiterte Diagnostik Humangenetik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ACTA1, MYH7, RYR1, TPM3 BIN1, CCDC78, CFL2, CNTN1, DNM2, KBTBD13, KLHL40, KLHL41, LMOD3, MTM1, MTMR14, MYF6, NEB, SEPN1, SPEG, TNNT1, TPM2, TTN 190,3 kb 113

114 Erkrankungen, OMIM, ICD-10, Gene bei kongenitalen Myopathien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen CAP-Myopathie 1; NEM G71.- AD/AR TPM CAP-Myopathie G71.- AD TPM Central Core Myopathie G71.- AD/AR RYR1* CFTD (Myopathie, kongenital m. Fasertypendisproportion) G71.- AD ACTA CFTD (Myopathie, kongenital m. Fasertypendisproportion) G71.- AR SEPN CFTD (Myopathie, kongenital m. Fasertypendisproportion) G71.- AD TPM CNM G71.- AD DNM CNM G71.- AD MYF CNM G71.- AD CCDC CNM G71.- AR SPEG CNMX G71.- XR MTM Kongenitale letale Myopathie Compton-North G71.- AR CNTN Kongenitale Myopathie m. fataler Kardiomyopathie G71.- AR TTN Minicore-Myopathie mit externer Ophthalmoplegie G71.- AR RYR1* Modifier für CNM G71.- AD MTMR Myopathie, zentronukleär, CNM G71.- AR BIN Myosinspeichermyopathie G71.- AD MYH7*, ** NEM G71.- AR NEB NEM G71.- AD/AR TPM NEM G71.- AR TNNT NEM G71.- AD KBTBD NEM G71.- AD CFL NEM G71.- AR KLHL NEM G71.- AR KLHL NEM G71.- AR LMOD * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 114

115 11.8 Myopathien, myofibrilläre Dr. rer. biol. hum. S. Chahrokh-Zadeh, Dr. med. Imma Rost Kongenitale Myopathien sind eine Gruppe seltener, klinisch heterogener Erkrankungen, die durch Strukturauffälligkeiten in der Muskelhistologie bzw. Elektronenmikroskopie gekennzeichnet sind. Die häufigsten kongenitalen Strukturmyopathien sind die Nemaline Myopathie, die Central-Core-Myopathie und die Zentronukleäre Myopathie. Wegen der vielfältigen Differenzialdiagnosen muss eine breite diagnostische Abklärung erfolgen. Die genetische Paneldiagnostik kann zur definitiven Zuordnung beitragen. Die kongenitalen Muskeldystrophien sind ebenfalls selten, klinisch und genetisch heterogen mit unterschiedlichen, z.t. schweren Begleitsymptomen wie Fehlbildungen des Zentralen Nervensystems oder der Augen und damit sehr variablen Verläufen. Literatur North KN et al, Neuromuscul Disord 24:97 (2014) / Nigro V et al, Acta Myol XXXI:196 (2012) Humangenetik Myofibrilläre Myopathien BAG3, CRYAB, DES, DNAJB6, FHL1, FLNC, LDB3, MYOT 17,3 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. BAG3, CRYAB, DES, DNAJB6, FHL1, FLNC, LDB3, MYOT PLEC 31,1 kb Erkrankungen, OMIM, ICD-10, Gene bei myofibrillären Myopathien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen MFM G71.- AD/AR DES MFM G71.- AR CRYAB MFM G71.- AD MYOT MFM G71.- AD LDB MFM G71.- AD FLNC MFM G71.- AD BAG MFM, Fatale infantile Hypertrophie, G71.- AR CRYAB ?-B-Crystallin-abhängig Sphäroidkörper-Myopathie G71.- AD MYOT

116 11.9 Myopathien, nicht-dystrophische/periodische Paralysen Dr. rer. biol. hum. S. Chahrokh-Zadeh, Dr. med. Imma Rost Als Myotonie wird eine unwillkürliche vorübergehende Anspannung eines Skelettmuskels bezeichnet. Die nichtdystrophischen Myotonien Thomsen und Becker sowie die differenzialdiagnostisch wichtigsten Formen der periodischen Paralysen werden durch Mutationen in verschiedenen Ionenkanalgenen verursacht. Es handelt sich im Gegensatz zur häufigsten Myotonen Dystrophie (Curschmann-Steinert) um seltene, nicht zur Muskeldystrophie führende Erkrankungen. Die Krankheiten beginnen im Kindesalter bzw. bei Geburt (Paramyotonia Congenita). Da es unterschiedliche auslösende Faktoren und Prophylaxe- bzw. Therapieansätze gibt, ist eine eindeutige Diagnose anzustreben, wobei die Paneldiagnostik hilfreich sein kann. Literatur Trivedi JR et al, Exp Neurol, 253:28 (2014) Nicht-dystrophische Myotonie/periodische Paralysen CLCN1, HSPG2, SCN4A 12,6 kb Erweiterte Diagnostik Periodische Paralysen CACNA1S, SCN4A, KCNJ18, KCNJ2 13,7 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CLCN1, HSPG2, SCN4A CACNA1S, SCN4A, KCNJ18, KCNJ2 29,8 kb Erkrankungen, OMIM, ICD-10, Gene bei nicht-dystrophischen Myopathien und periodischen Paralysen Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Andersen-Tawil-Syndrom G72.- AD KCNJ2* Atypische Myotonia Congenita G72.- AD SCN4A Hyperkaliämische periodische Paralyse Typ G72.- AD SCN4A (HYPP) Hypokaliämische Periodische Paralyse G72.3 AD KCNJ18* Hypokaliämische periodische Paralyse Typ G72.- AD CACNA1S* (HOKPP1) Hypokaliämische periodische Paralyse Typ G72.- AD SCN4A (HOKPP2) Myotonia congenita Becker G71.- AR CLCN Myotonia congenita Thomsen G71.- AD CLCN Paramyotonia Congenita G72.- AD SCN4A Schwartz-Jampel-Syndrom Typ Q78.- AR HSPG * auch einzeln anforderbar Core Genes sind fett gedruckt 116

117 11.10 Stoffwechselmyopathien Dr. rer. biol. hum. S. Chahrokh-Zadeh, Dr. med. Imma Rost Metabolische Myopathien betreffen den Stoffwechsel von Kohlehydraten, v.a. Glucose, und Fetten, den beiden Hauptenergielieferanten des Skelettmuskels. Es handelt sich damit u.a. um Störungen der Glycolyse und des Glycogen-Abbaus, der ß-Oxidation von Fettsäuren sowie Atmungskettendefekte. Die klinische Symptomatik dieser heterogenen Krankheitsgruppe ist variabel und umfasst unter anderem Muskelhypotonie, Muskelschwäche, -steifheit und/oder -krämpfe oder akute Rhabdomyolyse. Sowohl auslösende Faktoren als auch das Manifestationsalter sind unterschiedlich. Als Differenzialdiagnosen kommen sowohl andere genetisch bedingte als auch erworbene Erkrankungen infrage, dementsprechend ist ein breiter diagnostischer Ansatz erforderlich. Die genetische Paneldiagnostik kann zur genauen Einordnung beitragen. Literatur Angelini, Biochim Biophys Acta 1852:615 (2015) / Olpin, J Clin Pathol 68:410 (2015) Erweiterte Diagnostik Stoffwechselmyopathien (Glycogenosen mit muskulärer Symptomatik und Carnitinstoffwechselstörungen) ALDOA, CPT2, GAA, LDHA, PFKM, PGAM2, PHKA1, PHKB, PYGM, SLC25A20 20,9 kb Humangenetik Stoffwechselmyopathien (Defekte der mitochondrialen ß-Oxidation und Mitochondriale Deletionssyndrome (MTDPS) und Mypathie) ACADVL, AGK, C10orf2, DGUOK, ETFA, ETFB, ETFDH, HADHA, HADHB, POLG, RRM2B, SUCLA2, SUCLG1, TK2, TYMP 23,5 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ALDOA, CPT2, GAA, LDHA, PFKM, PGAM2, PHKA1, PHKB, PYGM, SLC25A20 ACADVL, AGK, C10orf2, DGUOK, ETFA, ETFB, ETFDH, HADHA, HADHB, POLG, RRM2B, SUCLA2, SUCLG1, TK2, TYMP ACADVL, AGK, C10orf2, DGUOK, ETFA, ETFB, ETFDH, FBXL4, HADHA, HADHB, LAMA2, LPIN1, MGME1, MPV17, POLG, RRM2B, SLC25A4, SUCLA2, SUCLG1, TK2, TYMP 51,5 kb Erkrankungen, OMIM, ICD-10, Gene bei Stoffwechselmyopathien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Carnitin-Acylcarnitin-Translocase-Mangel E71.- AR SLC25A (CACTD) CPTII-Mangel, Infantil E71.3 AR CPT2* CPTII-Mangel, letal neonatal E71.3 AR CPT2* Glykogenspeichererkrankung GSD IXb E74.- AR PHKB Glykogenspeichererkrankung GSD IXd E74.- XR PHKA Glykogenspeichererkrankung GSD X E74.- AR PGAM

118 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Glykogenspeichererkrankung GSD XI E74.- AR LDHA Glykogenspeichererkrankung GSD XII E74.- AR ALDOA Kongenitale Muskeldystrophie mit Merosindefizienz E71.3 AR LAMA (MDCA1) LGMD2V (M. Pompe) G71.0 AR GAA Lipin-1-Mangel (=akute rekurrierende Myoglobinurie) R82.1 AR LPIN M. McArdle (GSD V) E74.- AR PYGM M. Tarui (GSD VII) E74.- AR PFKM Mangel an mitochondrialem trifunktionalen E71.3 AR HADHA* Protein (MTP-Mangel) Mangel an mitochondrialem trifunktionalen E71.3 AR HADHB Protein (MTP-Mangel) MTDPS G72.8 AR TYMP MTDPS2 (myopathischer Typ) G72.8 AR TK MTDPS3 (hepatozerebraler Typ) G72.8 AR DGUOK MTDPS4 A (Alpers-Typ) G72.8 AR POLG MTDPS4 B (MNGIE-Typ) G72.8 AR POLG MTDPS5 (enzephalomyopathischer Typ AR SUCLA mit/ohne Methylmalonazidurie) MTDPS6 (hepatozerebraler Typ) G72.8 AR MPV MTDPS7 (hepatozerebraler Typ) G72.8 AR C10orf MTDPS8 A (enzephalomyopathischer Typ mit G72.8 AR RRM2B Tubulopathie) MTDPS8 B (MNGIE-Typ) G72.8 AR RRM2B MTDPS9 (enzephalomyopathisch mit Methylmalonazidurie) G72.8 AR SUCLG MTDPS10 (Sengers-Syndrom) G72.8 AR AGK MTDPS G72.8 AR MGME MTDPS12 (kardiomyopathischer Typ) G72.8 AR SLC25A MTDPS13 (enzephalomyopathischer Typ, G72.8 AR FBXL schwer) Multipler Acyl-CoA-Dehydrogenase-Mangel E71.3 AR ETFA (MAD-Mangel) Multipler Acyl-CoA-Dehydrogenase-Mangel E71.3 AR ETFB (MAD-Mangel) Multipler Acyl-CoA-Dehydrogenase-Mangel E71.3 AR ETFDH (MAD-Mangel) Myopathie durch CPTII-Mangel E71.3 AR CPT2* Very long chain Acyl-CoA-Dehydrogenase-Mangel (VLCAD-Mangel) E71.3 AR ACADVL*, ** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 118

119 12. Neurogenetische Erkrankungen Humangenetik Schematische Darstellung der phänotypischen und genetischen Heterogenität bei neurogenetischen Erkrankungen. Die einzelnen Sub-Panels sind farblich voneinander abgegrenzt. 119

120 12.1 Alzheimer Erkrankung, familiär Dr. rer. nat. Christoph Marschall Die Alzheimer Erkrankung ist mit einer Prävalenz von 1:5 bei über 80-jährigen die häufigste Form der Altersdemenz. Für alle Formen der Alzheimer Erkrankung ist eine Beteiligung genetischer Faktoren bekannt. Mutationen im Präsenilin 1- (PSEN1) und im Amyloid-Vorläufer-Protein-Gen (APP) sind mit der autosomaldominant vererbten hereditären Frühform von Morbus Alzheimer assoziiert (Beginn der Erkrankung vor dem 60. Lebensjahr). Etwa 65% der Fälle sind auf Mutationen im PSEN1-Gen und ca. 15% auf Mutationen im APP-Gen zurückzuführen. Eine weitere Ursache für die Erkrankung sind in <5% der Fälle Mutationen im PSEN2-Gen. Für die verbleibenden ca. 15% gibt es zum Teil Hinweise auf Assoziation zu noch nicht näher charakterisierten Genen. PSEN1 und PSEN2 codieren für zwei der vier Proteine, die Bestandteil des Gamma- Sekretase-Proteinkomplexes sind. Dieser Komplex ist an der Prozessierung des Beta-Amyloid-Vorläufer- Proteins zu Beta-Amyloid beteiligt. APP codiert für das Beta-Amyloid-Vorläufer-Protein, ein ubiquitär exprimiertes, transmembranöses Protein. Mutationen im PSEN1- oder APP-Gen führen zu einer Zunahme von Beta-Amyloid 42 (Aβ42) zu Lasten von Aβ40. Beide Proteine sind ein wesentlicher Bestandteil der neuritischen Plaques. Allerdings aggregiert das stärker hydrophobe Aβ42 rascher zu den toxischen Fibrillen. Literatur Ringman et al, Curr Neurol Neurosci Rep 14:499 (2014) / Wallon et al, J Alzheimers Dis 30:847 (2012) / Nelson et al, J Clin Invest 117:1230 (2007) / Raux et al, J Med Genet 42:793 (2005) / Tanzi et al, Cell 120:545 (2005) / Kowalska et al, Pol J Pharmacol 56:171 (2004) / Casserly et al, Lancet 363:1139 (2004) / Mertens, Dt Ärzteblatt Heft 36 (2002) / Esler et al, Science 293:1449 (2001) / Bertram et al, Curr Neurol Neurosci Rep 1:442 (2001) / Li et al, Nature 405:689 (2000) # Alzheimer Erkrankung, familiär Mutationssuche bis 25 kb APP, PSEN1, PSEN2 5,1kb Erkrankungen, OMIM, ICD-10, Gene bei Alzheimer Erkrankung, familiär Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Diag. Sensivität Alzheimer Erkrankung Typ F00.0 AD APP ,2% Alzheimer Erkrankung Typ F00.0 AD PSEN % Alzheimer Erkrankung Typ F00.0 AD PSEN % 120

121 12.2 Ataxien Dr. rer. hum. biol. S. Chahrokh-Zadeh Bei den hereditären Ataxien handelt es sich um eine klinisch und genetisch sehr heterogene Gruppe von Erkrankungen, die mit allen bekannten Vererbungsmodi einhergehen. Neben den häufiger vorkommenden, in der Regel spät-beginnenden, autosomal-dominanten Spinocerebellären Ataxien (SCAs), die durch CAG-Triplett- Repeat-Expansionen verursacht werden, findet sich eine große Anzahl von Genen, deren Mutationen zu einem sehr variablen Erscheinungsbild führen: langsam progressive ataktische Gangstörungen, oft einhergehend mit eingeschränkter Koordination der Hände, der Sprache und der Augenbewegung, meist aufgrund von Kleinhirnatrophie und Degeneration der spinocerebellären bzw. der Hinterstrang-Bahnen. Auch eine Degeneration weiterer Anteile des zentralen und peripheren Nervensystems (Pyramidenbahnen, Basalganglien) kann vorhanden sein, was sich mit nichtzerebellären Symptomen wie Polyneuropathie, Spastik u.a. äußert. Viele Subtypen überlappen hinsichtlich ihres klinischen Erscheinungsbildes. Vorab erfolgt die Analyse der häufigsten Ataxie-Gene ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP (nach Rücksprache: FXN und FMR1) im Hinblick auf Triplett-Repeat-Expansionen. Humangenetik Literatur Fogel et al, Jama Neur 71:1237 (2014) / Jayadev et al, Genet in med 15:673 (2013) / Nemeth et al, Brain 136:3106 (2013) Individuell konfigurierbare MGPS Ataxien Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ABCB7 (2.3 kb) * ABHD12 (1.2 kb) * ADCK3 (1.9 kb) * ADGRG1 (2.1 kb) * AFG3L2 (2.4 kb) * AHI1 (3.6 kb) * ANO10 (2.0 kb) * APTX (1.1 kb) * ARL13B (1.3 kb) * ATM (9.2 kb) * ATP8A2 (3.6 kb) * ATXN10 (1.4 kb) * C5orf42 (9.6 kb) * CA8 (0.9 kb) * CACNA1A (7.5 kb) * CACNA1G (7.1 kb) * CACNB4 (1.6 kb) * CC2D2A (4.9 kb) * CCDC88C (6.1 kb) * CEP290 (7.4 kb) * CEP41 (1.1 kb) * CLCN2 (2.7 kb) * CLN5 (1.2 kb) * CLN6 (0.9 kb) * CSPP1 (3.7 kb) * DARS2 (1.9 kb) * DNAJC5 (0.6 kb) * DNMT1 (4.9 kb) * EEF2 (2.6 kb) * EIF2B1 (0.9 kb) * EIF2B2 (1.1 kb) * EIF2B3 (1.4 kb) * EIF2B4 (1.6 kb) * EIF2B5 (2.2 kb) * ELOVL4 (0.9 kb) * ELOVL5 (1.0 kb) * FGF14 (0.8 kb) * FLVCR1 (1.7 kb) * GBA2 (2.8 kb) * GJB1 (0.8 kb) * GLRB (1.5 kb) * GOSR2 (0.8 kb) * GRID2 (3.0 kb) * GRM1 (3.6 kb) * INPP5E (1.9 kb) * ITPR1 (8.2 kb) * KCNA1 (1.5 kb) * KCNC3 (2.3 kb) * KCND3 (2.0 kb) * KIAA0586 (4.9 kb) * KIF1C (3.3 kb) * KIF7 (4.0 kb) * MARS2 (1.8 kb) * MRE11A (2.1 kb) * MTPAP (1.7 kb) * NPC1 (3.8 kb) * NPC2 (0.5 kb) * NPHP1 (2.2 kb) * OFD1 (3.0 kb) * OPA1 (3.0 kb) * PDE6D (0.5 kb) * PDYN (0.8 kb) * PEX10 (1.0 kb) * PEX2 (0.9 kb) * PIK3R5 (2.6 kb) * PLA2G6 (2.4 kb) * PNKP (1.6 kb) * PNPLA6 (4.1 kb) * POC1B (1.4 kb) * POLG (3.7 kb) * PRKCG (2.1 kb) * PRNP (0.8 kb) * RPGRIP1L3.9 kb) * SACS (13.7 kb) * SCN2A (6.0 kb) * SETX (8.0 kb) * SIL1 (1.4 kb) * SLC1A3 (1.6 kb) * SNX14 (2.8 kb) * SPG7 (2.4 kb) * SPTBN2 (7.2 kb) * STUB1 (0.9 kb) * SYNE1 (26.4 kb) * SYT14 (1.9 kb) * TCTN1 (1.8 kb) * TCTN2 (2.1 kb) * TCTN3 (1.8 kb) * TDP1 (1.8 kb) * TGM6 (2.1 kb) * TMEM138 (0.5 kb) * TMEM216 (0.4 kb) * TMEM231 (1.1 kb) * TMEM237 (1.2 kb) * TMEM240 (0.5 kb) * TMEM67 (3.0 kb) * TRPC3 (2.8 kb) * TTBK2 (3.7 kb) * TTC21B (3.9 kb) * VAMP1 (0.4 kb) * VLDLR (2.6 kb) * WWOX (1.2 kb) * ZNF423 (3.9 kb) 121

122 Ataxien mit Okulomotorischer Apraxie (AR) Ataxien mit Okulomotorischer Apraxie (AR) # APTX, SETX, PIK3R5, PNKP 13,3 KB Erkrankungen, OMIM, ICD-10, Gene bei Ataxien mit Okulomotorischer Apraxie Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Ataxie-Okuläre-Apraxie Typ G11.9 AR APTX Ataxie-Okuläre-Apraxie Typ G11.9 AR SETX Ataxie-Okuläre-Apraxie Typ G11.9 AR PIK3R Ataxie-Okuläre-Apraxie Typ G11.9 AR PNKP Core Genes sind fett gedruckt Ataxien: Leukoencephalopathie mit Verlust der weißen Substanz Leukoencephalopathie mit Verlust der weißen Substanz # EIF2B1, EIF2B2, EIF2B3, EIF2B4, EIF2B5 7,10 KB Erkrankungen, OMIM, ICD-10, Gene bei Leukoencephalopathie mit Verlust der weißen Substanz Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Leukoencephalopathie mit Verlust der weißen Substanz G11.9 AR EIF2B Leukoencephalopathie mit Verlust der weißen Substanz G11.9 AR EIF2B Leukoencephalopathie mit Verlust der weißen Substanz G11.9 AR EIF2B Leukoencephalopathie mit Verlust der weißen Substanz G11.9 AR EIF2B Leukoencephalopathie mit Verlust der weißen Substanz G11.9 AR EIF2B Core Genes sind fett gedruckt Ataxien, episodisch Episodische Ataxien # CACNA1A, CACNB4, KCNA1, SCN2A, SLC1A3 18,2 kb Erkrankungen, OMIM, ICD-10, Gene bei episodischen Ataxien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Episodische Ataxie, Typ G11.9 AD KCNA Episodische Ataxie, Typ G11.9 AD CACNA1A*,** Episodische Ataxie, Typ G11.9 AD CACNB Episodische Ataxie, Typ G11.9 AD SLC1A Episodische Ataxie mit neonataler Epilepsie - G11.9 AD SCN2A* *auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 122

123 Ataxien, spastisch Spastische Ataxien AFG3L2, KIF1C, MTPAP, SACS, SPG7, VAMP1 25,5 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. Humangenetik 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. AFG3L2, KIF1C, MTPAP, SACS, SPG7, VAMP1 GBA2, MARS2 28,5 kb Erkrankungen, OMIM, ICD-10, Gene bei spastischen Ataxien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Spastische Ataxie Typ G11.9 AD VAMP Spastische Ataxie Typ G11.9 AR KIF1C Spastische Ataxie Typ G11.9 AR MARS Spastische Ataxie Typ G11.9 AR MTPAP Spastische Ataxie Typ G11.9 AR AFG3L Spastische Ataxie - G11.9 AR SPG Spastische Ataxie, Charlevoix-Saguenay Typ G11.9 AR SACS Cerebelläre Ataxie mit Spastik - - AR GBA Cerebelläre Ataxie-Mentale Retardierungs-Syndrom G11.9 AR GBA Core Genes sind fett gedruckt Ataxien, Spinocerebellär, autosomal-dominante Individuell konfigurierbare MGPS EDS und Differenzialdiagnosen Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik., * AFG3L2 (2.4 kb) * CACNA1A (7.5 kb) * CACNA1G (7.1 kb) * CACNB4 (1.6 kb) * CCDC88C (6.1 kb) * DNAJC5 (0.6 kb) * DNMT1 (4.9 kb) * EEF2 (2.6 kb) * ELOVL4 (0.9 kb) * ELOVL5 (1.0 kb) * FGF14 (0.8 kb) * ITPR1 (8.2 kb) * KCNA1 (1.5 kb) * KCNC3 (2.3 kb) * KCND3 (2.0 kb) * PDYN (0.8 kb) * PRKCG (2.1 kb) * SCN2A (6.0 kb) * SLC1A3 (1.6 kb) * SPTBN2 (7.2 kb) * TGM6 (2.1 kb) * TMEM240 (0.5 kb) * TRPC3 (2.8 kb) * TTBK2 (3.7 kb) * VAMP1 (0.4 kb) 123

124 Erkrankungen, OMIM, ICD-10, Gene bei spinocerebellären Ataxien, autosomal-dominant Erkrankung OMIM-P ICD-10 Gen OMIM Gen?Spinocerebelläre Ataxie G11.9 EEF ?Spinocerebelläre Ataxie G11.9 ELOVL ?Spinocerebelläre Ataxie G11.9 CCDC88C ?Spinocerebelläre Ataxie G11.9 TRPC Cerebelläre Ataxie, Taubheit und Narkolepsie, autosomaldominant G11.9 DNMT Cerebelläre Ataxie-Mentale Retardierungs-Syndrom G11.9 DNAJC Episodische Ataxie mit neonataler Epilepsie - G11.9 SCN2A* Episodische Ataxie, Typ G11.9 KCNA Episodische Ataxie, Typ G11.9 CACNA1A*, ** Episodische Ataxie, Typ G11.9 CACNB Episodische Ataxie, Typ G11.9 SLC1A Spastische Ataxie Typ G11.9 VAMP Spinocerebelläre Ataxie G11.9 SPTBN Spinocerebelläre Ataxie G11.9 TTBK Spinocerebelläre Ataxie G11.9 KCNC Spinocerebelläre Ataxie G11.9 PRKCG Spinocerebelläre Ataxie G11.9 ITPR Spinocerebelläre Ataxie G11.9 KCND Spinocerebelläre Ataxie G11.9 TMEM Spinocerebelläre Ataxie G11.9 PDYN Spinocerebelläre Ataxie G11.9 FGF Spinocerebelläre Ataxie G11.9 AFG3L Spinocerebelläre Ataxie 29, kongenital, nicht progressiv G11.9 ITPR Spinocerebelläre Ataxie G11.9 TGM Spinocerebelläre Ataxie G11.9 ELOVL Spinocerebelläre Ataxie G11.9 CACNA1G * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 124

125 Ataxien, Spinocerebelläre, autosomal-rezessive Autosomal-rezessive Spinocerebelläre Ataxien Individuell konfigurierbare MGPS Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ATP8A2 (3.6 kb) * ATXN10 (1.4 kb) * C5orf42 (9.6 kb) * CA8 (0.9 kb) * CC2D2A (4.9 kb) * CEP290 (7.4 kb) * CEP41 (1.1 kb) * CLCN2 (2.7 kb) * CLN5 (1.2 kb) * CSPP1 (3.7 kb) * DARS2 (1.9 kb) * EIF2B1 (0.9 kb) * EIF2B2 (1.1 kb) * EIF2B3 (1.4 kb) * EIF2B4 (1.6 kb) * EIF2B5 (2.2 kb) * FLVCR1 (1.7 kb) * GBA2 (2.6 kb) * GOSR2 (0.8 kb) * GRID2 (3.0 kb) * GRM1 (3.6 kb) * INPP5E (1.9 kb) * KIAA0586 (4.9 kb) * KIF1C (3.3 kb) * KIF7 (4.0 kb) * MARS2 (1.8 kb) * MRE11A (2.1 kb) * MTPAP (1.7 kb) * NPC2 (0.5 kb) * NPHP1 (2.2 kb) * OPA1 (3.0 kb) * PDE6D (0.5 kb) * PIK3R5 (2.6 kb) * PNKP (1.6 kb) * PNPLA6 (4.1 kb) * POC1B (1.4 kb) * POLG (3.7 kb) * RPGRIP1L (3.9 kb) * SACS (13.7 kb) * SETX (8.0 kb) * SIL1 (1.4 kb) * SNX14 (2.8 kb) * SPG7 (2.4 kb) * SPTBN2 (7.2 kb) * STUB1 (0.9 kb) * SYNE1 (26.4 kb) * SYT14 (1.9 kb) * TCTN1 (1.8 kb) * TCTN2 (2.1 kb) * TCTN3 (1.8 kb) * TDP1 (1.8 kb) * TMEM138 (0.5 kb) * TMEM216 (0.4 kb) * TMEM231 (1.1 kb) * TMEM237 (1.2 kb) * TMEM67 (3.0 kb) * TTC21B (3.9 kb) * WWOX (1.2 kb) * ZNF423 (3.9 kb) Humangenetik Erkrankungen, OMIM, ICD-10, Gene bei spinocerebelläre Ataxien, autosomal-rezessiv Erkrankung OMIM-P ICD-10 Gen OMIM-Gen?Cerebelläre Ataxie, mentale Retardierung, und Dysequilibrium G11.9 ATP8A Syndrom 4 Anämie, sideroblastisch, mit Ataxie (X-gebunden) G11.9 ABCB Ataxie, Hinterstrang mit Retinitis Pigmentosa G11.9 FLVCR Ataxia-telangiectasia-ähnliche Erkrankung G11.9 MRE11A Ataxie-Okuläre-Apraxie Typ G11.9 APTX Ataxie-Okuläre-Apraxie Typ G11.9 SETX Ataxie-Okuläre-Apraxie Typ G11.9 PIK3R Ataxie-Okuläre-Apraxie Typ G11.9 PNKP Boucher-Neuhauser-Syndrom G11.9 PNPLA Cerebelläre Ataxie und mentale Retardierung G11.9 CA Ceroid Lipofuszinose, neuronal, G11.9 CLN Epilepsie, progressive, myoklonische G11.9 GOSR Joubert-Syndrom Phänotyp - Q04.3 POC1B Joubert-Syndrom Typ Q04.3 INPP5E Joubert-Syndrom Typ Q04.3 TMEM Joubert-Syndrom Typ Q04.3 AHI Joubert-Syndrom Typ Q04.3 NPHP1*, ** Joubert-Syndrom Typ Q04.3 CEP Joubert-Syndrom Typ Q04.3 TMEM Joubert-Syndrom Typ Q04.3 RPGRIP1L Joubert-Syndrom Typ Q04.3 ARL13B Joubert-Syndrom Typ Q04.3 CC2D2A Joubert-Syndrom Typ 11 - Q04.3 TTC21B

126 Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Joubert-Syndrom Typ Q04.3 KIF Joubert-Syndrom Typ Q04.3 TCTN Joubert-Syndrom Typ Q04.3 TMEM Joubert-Syndrom Typ Q04.3 CEP Joubert-Syndrom Typ Q04.3 TMEM Joubert-Syndrom Typ Q04.3 C5orf Joubert-Syndrom Typ Q04.3 TCTN Joubert-Syndrom Typ Q04.3 ZNF Joubert-Syndrom Typ Q04.3 TMEM Joubert-Syndrom Typ Q04.3 CSPP Joubert-Syndrom Typ Q04.3 PDE6D Joubert-Syndrom Typ Q04.3 KIAA Joubert/Meckel Syndrom Phänotyp Q04.3 TCTN Joubert/Nephronophthise Phänotyp - Q04.3 ATXN Leukoencephalopathie mit Ataxie G11.9 CLCN Leukoencephalopathie mit Verlust der weißen Substanz G11.9 EIF2B Leukoencephalopathie mit Hirnstamm- und Wirbelsäulen G11.9 DARS Beteiligung und Laktaterhöhung Leukoencephalopathie mit Verlust der weißen Substanz G11.9 EIF2B Leukoencephalopathie mit Verlust der weißen Substanz G11.9 EIF2B Leukoencephalopathie mit Verlust der weißen Substanz G11.9 EIF2B Leukoencephalopathie mit Verlust der weißen Substanz G11.9 EIF2B Mitochondrial rezessives Ataxie Syndrom G11.9 POLG Niemann-Pick-Erkrankung, Typ C G11.9 NPC Primäre Coenzym Q10 Defizienz Typ G11.9 ADCK Spastische Ataxie - G11.9 SPG Spastische Ataxie Typ G11.9 KIF1C Spastische Ataxie Typ G11.9 MARS Spastische Ataxie Typ G11.9 MTPAP Spastische Ataxie Typ G11.9 AFG3L Spastische Ataxie, Charlevoix-Saguena-Typ G11.9 SACS Spinocerebelläre Ataxie, autosomal- rezessiv G11.9 SYT Spinocerebelläre Ataxie, autosomal-rezessiv G11.9 SETX Spinocerebelläre Ataxie, autosomal-rezessiv G11.9 SYNE Spinocerebelläre Ataxie, autosomal-rezessiv G11.9 ANO Spinocerebelläre Ataxie, autosomal-rezessiv G11.9 GRM Spinocerebelläre Ataxie, autosomal-rezessiv G11.9 SPTBN Spinocerebelläre Ataxie, autosomal-rezessiv G11.9 STUB Spinocerebelläre Ataxie, autosomal-rezessiv G11.9 GRID Spinocerebelläre Ataxie, mit axonaler Neuropathie G11.9 TDP Spinocerebelläre Ataxie, autosomal-rezessiv G11.9 WWOX Spinocerebelläre Ataxie, autosomal-rezessiv G11.9 SNX G11.9 SIL G11.9 OPA * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 126

127 Ataxien, syndromale Formen Ataxien, syndromale Formen Individuell konfigurierbare MGPS Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ABCB7 (2.3 kb) * ABHD1 (1.2 kb) * ADCK3 (1.9 kb) * ADGRG1 (2.1 kb) * AHI1 (3.6 kb) * ARL13B (1.3 kb) * ATM (9.2 kb) * ATP8A2 (3.6 kb) * ATXN10 (1.4 kb) * C5orf42 (9.6 kb) * CA8 (0.9 kb) * CC2D2A (4.9 kb) * CEP290 (7.4 kb) * CEP41 (1.1 kb) * CLN5 (1.2 kb) * CLN6 (0.9 kb) * CSPP1 (3.7 kb) * DARS2 (1.9 kb) * DNMT1 (4.9 kb) * FLVCR1 (1.7 kb) * GJB1 (0.8 kb) * GOSR2 (0.6 kb) * INPP5E (1.9 kb) * KIAA0586 (4.9 kb) * KIF7 (4.0 kb) * MRE11A (2.1 kb) * NPC1 (3.8 kb) * NPC2 (0.5 kb) * NPHP1 (2.2 kb) * OFD1 (3.0 kb) * OPA1 (3.0 kb) * PDE6D (0.5 kb) * PEX10 (1.0 kb) * PEX2 (0.9 kb) * PLA2G6 (2.4 kb) * PNPLA6 (4.1 kb) * POC1B (1.4 kb) * POLG (3.7 kb) * RPGRIP1L (3.9 kb) * SACS (13.7 kb) * SIL1 (1.4 kb) * TCTN1 (1.8 kb) * TCTN2 (2.1 kb) * TCTN3 (1.8 kb) * TMEM138 (0.5 kb) * TMEM216 (0.4 kb) * TMEM231 (1.1 kb) * TMEM237 (1.2 kb) * TMEM67 (3.0 kb) * TTC21B (3.9 kb) * VLDLR (2.6 kb) * ZNF423 (3.9 kb) Humangenetik Erkrankungen, OMIM, ICD-10, Gene bei Ataxien, syndromale Formen Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen?Cerebelläre Ataxie, mentale Retardierung, und G11.9 AR ATP8A Dysequilibrium Syndrom 4 Anämie, sideroblastisch, mit Ataxie (X-gebunden) G11.9 AR ABCB Ataxie, Hinterstang, mit Retinitis Pigmentosa G11.9 AR FLVCR Ataxia-telangiectasia-ähnliche Erkrankung G11.9 AR MRE11A Ataxie-Telangiektasie G11.9 AR ATM Boucher-Neuhauser-Syndrom G11.9 AR PNPLA Cerebelläre Ataxie und mentale Retardierung G11.9 AR CA Cerebelläre Ataxie, Taubheit und Narkolepsie, G11.9 AD DNMT autosomal-dominant Cerebelläre Ataxie-Mentale Retardierungs G11.9 AR ADGRG Syndrom Cerebelläre Ataxie-Mentale Retardierungs G11.9 AR CLN Syndrom Cerebelläre Ataxie-Mentale Retardierungs G11.9 AR PEX Syndrom Cerebelläre Ataxie-Mentale Retardierungs G11.9 AR PEX Syndrom Cerebelläre Ataxie-Mentale Retardierungs G11.9 AR VLDLR Syndrom Ceroid lipofuszinose-neuropathie, neuronal, G11.9 AR CLN Charcot-Marie-Tooth Neuropathie, X-dominant, G11.9 XD GJB1* Epilepsie, progressive, myoklonische G11.9 AR GOSR Leukoencephalopathie mit Hirnstamm- und G11.9 AR DARS Wirbelsäulen-Beteiligung und Laktaterhöhung 127

128 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Mitochondrial rezessives Ataxie Syndrom G11.9 AR POLG Niemann-Pick-Erkrankung, Typ C G11.9 AR NPC Niemann-Pick-Erkrankung, Typ C G11.9 AR NPC Primäre Coenzym Q10 Defizienz Typ G11.9 AR ADCK Spastische Ataxie, Charlevoix-Saguena-Typ G11.9 AR SACS Spinocerebelläre Ataxie, autosomal-rezessiv G11.9 AR SYNE G11.9 AR SIL G PLA2G G11.9 AR OPA G11.9 AR ABHD * auch einzeln anforderbar* auch einzeln anforderbar 12.3 Choreatiforme Bewegungsstörungen Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Bei 90% der Patienten mit choreatiformer Bewegungsstörung genetischer Ursache kann eine pathogene CAG-Triplett-Repeat-Expansion im HTT-Gen nachgewiesen werden. Für die verbleibenden 10% ohne HTT- Mutationsnachweis können differenzialdiagnostisch Chorea-Huntington-ähnliche Erkrankungen, die klinisch nur schwer oder gar nicht abgrenzbar sind, über eine Multi-Gen-Panel-Untersuchung abgeklärt werden. Bei einigen der aufgeführten Gene, erfolgt die Abklärung über das Vorliegen einer Repeat-Expansion über PCR und anschließende Kapillarelektrophorese (Fragmentlängenanalyse). Literatur Hensman Moss et al, Neurology 82:292 (2014) / Nguyen, MedGen 25:223 (2013) Choreatiforme Bewegungsstörungen Stufe I Bestimmung der Triplett-Repeat-Anzahl der Gene: ATXN1, ATXN2, ATXN3, ATXN7, TBP, ATN1 Choreatiforme Bewegungsstörungen Stufe II ADCY5, ARSA, FRRS1L, GM2A, GNAO1, KCNA1, NKX2-1, PRNP, RNF216, VPS13A, XK 25,0 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ATXN1, ATXN2, ATXN3, ATXN7, TBP, ATN1 ADCY5, ARSA, FRRS1L, GM2A, GNAO1, KCNA1, NKX2-1, PRNP, RNF216, VPS13A, XK ATM, FTL, PDE10A, SETX 60,3 kb 128

129 Erkrankungen, OMIM, ICD-10, Gene bei choreatiformen Bewegungsstörungen Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Dyskinesie, familiär mit Gesichts-Myokymie AD ADCY Neurodegeneration mit Ferritin-Akkumulation AD FTL im Gehirn 3 Chorea, hereditäre benigne AD NKX Huntington-ähnliche Erkrankung AD PRNP Episodische Ataxie, Myokymie-Syndrom AD KCNA Choreoakanthocytose AR VPS13A McLeod-Syndrom XL XK Spinocerebelläre Ataxie Typ AD ATXN Spinocerebelläre Ataxie Typ AD ATXN Spinocerebelläre Ataxie Typ AD ATXN Spinocerebelläre Ataxie Typ AD ATXN Frontotemporale Demenz und/oder Amyotrope AD C9orf Lateralsklerose Typ 1 Spinocerebelläre Ataxie Typ AD TBP Dentatorubrale Pallidoluysische Atrophie AD ATN Humangenetik 12.4 Hyperekplexie Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. med. Imma Rost Bei der hereditären Hyperekplexie handelt es sich um eine Erkrankung, die bereits im Neugeborenenalter, manchmal bereits bei Geburt, mit einer anfallsartigen massiven generalisierten Erhöhung des Muskeltonus einhergeht. Als Auslöser reicht ein Beklopfen der Glabella. Klinisch erinnern die Zustände an Krampfanfälle; das EEG ist aber unauffällig. Die Symptomatik schwächt sich in der Säuglingszeit meist ab. Erhalten bleibt häufig eine ausgeprägte Schreckhaftigkeit mit Tonusverlust, was die Gefahr von Verletzungen durch Stürze birgt. Als diagnostischer Test kann ein Tippen auf die Nasenspitze (sog. nose-tapping Test) dienen, der bei Kindern mit Hyperekplexie zu einer starken Überstreckung im Nacken führt, während gesunde Neugeborene keine wesentliche Reaktion zeigen. Als Therapie kommt eine Behandlung mit Benzodiazepinen infrage. Verursacht wird die Erkrankung durch Mutationen in Genen für Glycinrezeptoren, u.a. GLRA1, GLRB und SLC6A5. Die Proteine, die durch diese Gene codiert werden, sind in die glycinabhängige Neurotransmission involviert. Die Gene GLRA1 und GLRB codieren für die Untereinheiten a1 bzw. ß eines postsynaptischen Glycinrezeptors, das SLC6A5-Gen codiert für den präsynaptischen Glycin-Transporter Typ 2. Mutationen in einem dieser Gene können zur Beeinträchtigung inhibitorischer Neurotransmissionswege oder zur Stimulation exzitatorischer Signalwege in den Nervenzellen führen. Literatur Lee et al, J Mov Disord.;10(1):53 (2017) / Mine et al, Dev Med Child Neurol.;57(4):372 (2015) / Dreissen et al, Epilepsia.;53 Suppl 7:3 (2012) Hyperekplexie # GLRA1, GLRB, SLC6A5 5,3 kb 129

130 Erkrankungen, OMIM, ICD-10, Gene bei Hyperekplexie Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Hyperekplexie, Typ G25.8 GLRA Hyperekplexie, Typ G25.10 GLRB Hyperekplexie, Typ G25.9 SLC6A

131 12.5 Hereditäre Neuropathien Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Bei den erblichen peripheren Neuropathien mit einer geschätzten Prävalenz von 1:2.500 in der Allgemeinbevölkerung handelt es sich um eine Gruppe der häufigsten hereditären neurologischen Erkrankungen, die klinisch und genetisch heterogen ist. Über 90 Gene und Loci sind beteiligt. Das Manifestationsalter betrifft in der Regel die erste oder zweite Dekade, jedoch sind auch spätmanifestierende Formen bekannt. Die Klassifikation basiert auf dem klinischen Phänotyp, dem Vererbungsmodus, dem Manifestationsalter, elektrophysiologischen Untersuchungen und der zugrundeliegenden Mutation. Die Haupt-Subtypen betreffen die hereditäre motorische und sensible Neuropathie (HMSN) oder Charcot-Marie-Tooth-Erkrankung (CMT), die hereditäre sensible und autonome Neuropathie (HSAN oder HSN), die hereditäre motorische Neuropathie (HMN oder dhmn) und die hereditäre Neuropathie mit Neigung zu Druckparesen (HNPP). Humangenetik Charcot-Marie-Tooth-Neuropathien Typ 1 u. 2 Stufe I EBM Kap , GOP Ausschluß der CMT1A-typischen 1,5 Mb Duplikation, die u.a. das PMP22-Gen einschließt. Charcot-Marie-Tooth-Neuropathien Typ 1 u. 2 Stufe II ATL1, DNM2, EGR2, GARS, GDAP1, HSPB1, IGHMBP2, KIF1B, LITAF, MFN2, MPZ, NEFL, NGF, PMP22, RAB7A 24,9 kb Erweiterte Diagnostik Hereditäre sensorische (autonome) Neuropathie 1 u. 2 ATL1, ATL3, DNMT1, FAM134B, KIF1A, SPTLC1, SPTLC2 17,9 kb CMT Typ II, axonal, autosomal-dominant AARS, DYNC1H1, GDAP1, HSPB1, HSPB8, LRSAM1, MFN2, MPZ 24,3 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ATL1, DNM2, EGR2, GARS, GDAP1, HSPB1, IGHMBP2, KIF1B, LITAF, MFN2, MPZ, NEFL, NGF, PMP22, RAB7A ATL1, FAM134B, SPTLC1 AARS, DYNC1H1, GDAP1, HSPB1, HSPB8, LRSAM1, MFN2, MPZ AARS, ARHGEF10, ATP7A, BAG3, BSCL2, CCT5, CTDP1, DCTN1, DYNC1H1, FAM134B, FGD4, FIG4, GAN, GJB1, HOXD10, HSPB3, HSPB8, IKBKAP, KARS, LMNA, LRSAM1, MED25, MTMR2, NDRG1, NTRK1, PLEKHG5, PRPS1, PRX, REEP1, SBF2, SCN9A, SEPT9, SH3TC2, SLC12A6, SOX10, SPTLC1, SPTLC2, TDP1, TRPV4, WNK1, YARS 196,0 kb 131

132 Erkrankungen, OMIM, ICD-10, Gene bei hereditärer Neuropathie Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen CMT 2N G60.0 AD AARS Verlangsamte Nevenleitungsgeschwindigkeit G60.0 AD ARHGEF HSN 1D G60.0 AD ATL Spinale Muskelatrophie, distal, X-gebunden G60.0 XL ATP7A (SMAX3) Myofibrilläre Myopathie Typ G60.0 AD BAG HMN G60.0 AD BSCL HSN mit Spastischer Paraplegie G60.0 AR CCT Neuropathie, kongenitaler Katarrhakte, faziale G60.0 AR CTDP Dysmorphien HMN 7B G60.0 AD DCTN CMT axonal Typ 2M, CMT dominant intermediär G60.0 AD DNM B CMT axonal Typ G60.0 AD DYNC1H CMT 1D G60.0 AD/AR EGR CMT 4E G60.0 AD/AR EGR Dejerine-Sottas Erkrankung G60.0 AD/AR EGR HSAN 2B G60.0 AR FAM134B CMT 4H G60.0 AR FGD CMT 4J G60.0 AR FIG Giant Axon Neuropathie (GAN) G60.0 AR GAN CMT 2D G60.0 AD GARS HMN G60.0 AD GARS CMT axonal, Type 2K, CMT axonal, mit Stimmbandparesen, G60.0 AD/AR GDAP CMT rezessiv, intermediär Typ A, CMT 4A CMT axonal, mit Stimmbandparesen, CMT G60.0 AD/AR GDAP rezessiv CMT rezessiv, intermediär Typ A G60.0 AD/AR GDAP CMT Typ 4A, CMT4A G60.0 AD/AR GDAP CMT X G60.0 XL GJB1* HMSN mit kongenitalem vertikalem Talus G60.0 AD HOXD CMT 2F G60.0 AD HSPB HMN 2B G60.0 AD HSPB HMN G60.0 AD HSPB CMT 2L G60.0 AD HSPB HMN 2A G60.0 AD HSPB HMN G60.0 AR IGHMBP HSAN G60.0 AR IKBKAP CMT rezessiv intermediär Typ B G60.0 AR KARS CMT 2A G60.0 AD KIF1B CMT 1C G60.0 AD LITAF CMT 2B G60.0 AR LMNA* CMT 2P G60.0 AD/AR LRSAM CMT 2B G60.0 AR MED

133 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen CMT 2A G60.0 AD MFN HMSN G60.0 AD MFN CMT 1B G60.0 AD/AR MPZ CMT 2J G60.0 AD/AR MPZ CMT 2I G60.0 AD/AR MPZ CMT dominant intermediär Typ D G60.0 AD/AR MPZ Neuropathie, kongenital hypomyelinisierend G60.0 AD/AR MPZ Dejerine-Sottas Erkrankung G60.0 AD/AR MPZ CMT 4B G60.0 AR MTMR CMT 4D G60.0 AR NDRG CMT 1F G60.0 AD NEFL CMT 2E G60.0 AD NEFL HSAN G60.0 AR NGF HSAN G60.0 AR NTRK CMT, rezessiv intermediär, Typ C G60.0 AR PLEKHG CMT 1E G60.0 AD/AR PMP Dejerine-Sottas Erkrankung G60.0 AD/AR PMP CMT 1A G60.0 AD/AR PMP HNPP G60.0 AD/AR PMP CMT X G60.0 XL PRPS CMT 4F G60.0 AD/AR PRX Dejerine-Sottas Erkrankung G60.0 AD/AR PRX CMT 2B G60.0 AD RAB7A HMN5B G60.0 AD REEP CMT 4B G60.0 AR SBF HSAN Typ 2D G60.0 AR SCN9A Hereditäre neuralgische Amyotrophie G60.0 AD Periphere Neuropathie mit Corpus Callosum G60.0 AR SH3TC Agenesie Periphere demyelinisierende Neuropathie G60.0 AR SLC12A (PCWH-Syndrom) HSAN G60.0 AD SOX HSAN 1C G60.0 AD SPTLC Spinocerebelläre Ataxie mit axonaler Neuropathie G60.0 AD SPTLC Spinocerebelläre Ataxie, autosomal-rezessiv G60.0 AR TDP mit axonaler Neuropathie HSAN 2A G60.0 AD TRPV CMT, dominant intermediär Typ C G60.0 AR WNK CMT, dominant intermediär Typ C G60.0 AD YARS CMT axonal, Type 2K G60.0 AD/AR GDAP * auch einzeln anforderbar Humangenetik 133

134 12.6 Epilepsien, genetisch bedingt Dr. rer. nat. Karin Mayer, M.Sc Anna Munzig, Dr. med. Imma Rost Epilepsien treten mit einer Häufigkeit von 0,5 bis 1% auf und knapp die Hälfte beginnt bereits im Kindesalter. In der heterogenen Gruppe der Epilepsien sind mindestens 50% genetisch (mit-)bedingt, wobei die Ursache in den meisten Fällen multifaktoriell bzw. polygen ist. Nur 1 bis 2% der sog. idiopathischen Epilepsien folgt einem monogenen Erbgang. Zu diesen gehören unter anderem die epileptischen Enzephalopathien des Kindesalters (EIEE), die früh beginnen, einen schweren Verlauf zeigen, oft therapieschwierig sind und neben der fast immer vorhandenen Störung der kognitiven Entwicklung weitere Komorbiditäten zeigen. Bei den idiopathischen generalisierten Epilepsien erlaubt der Nachweis einer Mutation (in einem der aufgeführten Gene) allerdings häufig nur den Schluss auf ein erhöhtes Risiko, eine Epilepsie zu entwickeln (Suszeptibilitätsfaktoren). Ein Großteil der genetischen Epilepsien ist durch Mutationen in Untereinheiten neuronaler spannungsabhängiger Na +, K +, Ca 2+, Cl -Ionenkanäle und Untereinheiten ligandenabhängiger Rezeptoren wie dem GABA- Rezeptor und dem Nikotin-Acetylcholin-Rezeptor bedingt. Den genetischen Epilepsien können die symptomatischen Epilepsien gegenüber gestellt werden, die z.b. sekundär als Folge einer angeborenen Gehirnfehlbildung (z.b. Migrationsstörung), im Rahmen eines übergeordneten genetischen Syndroms (z.b. Angelman-Syndrom, Rett-Syndrom, Tuberöse Sklerose) oder bei chromosomalen Imbalancen z.b. (idic15) oder r(20) bei Frontallappenepilepsie auftreten. Die klinische Differenzialdiagnose kann oft schwierig sein, weshalb die genetische Diagnostik auch mittels NGS zunehmend eine Möglichkeit der Ursachenklärung darstellt. Der Nachweis einer Mutation kann eine Verdachtsdiagnose bestätigen, was bei einigen Formen eine gezielte Therapie ermöglicht (z.b. beim Glucose-Transporter-Defekt). Zudem kann weitere Diagnostik eingespart, eine prognostische Einschätzung und Aussagen zu einem eventuellen Wiederholungsrisiko gegeben werden. Literatur Lesca et al, Rev Neurol (Paris), 6-7:539 (2015) / Poduri et al, Nat Rev Neurol, 10(5):293 (2014) / Scheffer, Neuropediatrics, 45(2):70 (2014) / Thomas et al, Nat Rev Neurol, 10(5):283 (2014 )/ Thomas et al, Nat Rev Neurol, 10(5):283 (2014) / Hoppman-Chaney et al, Clin Genet, 83:345 (2012) / Tavyev et al, Eur J Med Genet 55:299 (2012) / Striano P et al, Arch Neurol 69(3):322 (2012) / Noh GL et al, Eur J Med Genet 55: 281 (2012) / Jiang Y et al, Hum Genet 131:1217 (2012) / Weber et al, Z Epileptol 24: 100 (2011) / von Spiczak S et al, Z Epileptol 24:108 (2011) / Nicita F et al, Seizure 21:3 (2011) / Muhle H et al, Epilepsia 52(12):e194 (2011) / Mefford HC et al, Ann Neurol 70(6):974 (2011) / Kortüm F et al, J Med Genet 48:396 (2011) / Fountain-Capal JK et al, Ped Neurol 45: 319 (2011) / Depienne C et al, Hum Mut 32:E1959 (2010) / Berg AT et al, Akt Neurol 37:120 (2010) 134

135 Humangenetik Schematische Darstellung der phänotypischen und genetischen Heterogenität bei Epilepsien. Die einzelnen Subpanels sind farblich voneinander abgegrenzt, "Core Genes" sind fett gedruckt. Abkürzungen: EIEE: Early Infantile Epileptic Encephalopathy (frühkindliche epileptische Enzephalopathien) GEFS+: Generalized Epilepsy with Febrile Seizures Plus FHM: Familial Hemiplegic Migraine (familiäre hemiplegische Migräne) 135

136 Epilepsie Individuell konfigurierbare MGPS Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * AARS (2.9 kb) * ADGRV1 (18.9 kb) * ALDH7A1 (1.6 kb) * ALG13 (3.4 kb) * AP3B2 (3.2 kb) * ARHGEF15 (2.5 kb) * ARHGEF9 (1.5 kb) * ARV1 (0.8 kb) * ARX (1.7 kb) * ATP1A2 (3.1 kb) * BRAT1 (2.5 kb) * CACNA1A (6.8 kb) * CACNA1H (7.1 kb) * CACNB4 (1.6 kb) * CAD (6.7 kb) * CASR (3.3 kb) * CDKL5 (3.1 kb) * CERS1 (1.1 kb) * CHD2 (5.5 kb) * CHRNA2 (1.6 kb) * CHRNA4 (1.9 kb) * CHRNB2 (1.5 kb) * CLCN2 (2.7 kb) * CLCN4 (2.3 kb) * CPA6 (1.3 kb) * CSTB (0.3 kb) * DCX (1.3 kb) * DENND5A (3.9 kb) * DEPDC5 (4.8 kb) * DNM1 (2.6 kb) * DOCK7 (6.4 kb) * DYRK1A (2.3 kb) * EEF1A2 (1.4 kb) * EFHC1 (1.9 kb) * ELP4 (1.6 kb) * EPM2A (1.0 kb) * FASN (7.5 kb) * FGF12 (0.7 kb) * FOXG1 (1.5 kb) * FRRS1L (1.0 kb) * GABBR2 (2.8 kb) * GABRA1 (1.4 kb) * GABRB1 (1.4 kb) * GABRB3 (1.4 kb) * GABRD (1.4 kb) * GABRG2 (1.4 kb) * GAL (0.4 kb) * GLUL (1.1 kb) * GNAO1 (1.1 kb) * GOSR2 (0.6 kb) * GPHN (2.3 kb) * GRIN2A (4.4 kb) * GRIN2B (4.5 kb) * GRIN2D (4.0 kb) * GUF1 (2.0 kb) * HCN1 (2.7 kb) * HDAC4 (3.3 kb) * IQSEC2 (4.5 kb) * ITPA (0.6 kb) * KCNA1 (1.5 kb) * KCNA2 (1.5 kb) * KCNB1 (2.6 kb) * KCNC1 (1.8 kb) * KCNH5 (3.0 kb) * KCNMA1 (3.7 kb) * KCNQ2 (2.6 kb) * KCNQ3 (2.6 kb) * KCNT1 (3.7 kb) * KCTD7 (0.9 kb) * LGI1 (1.7 kb) * LMNB2 (1.9 kb) * MBD5 (4.5 kb) * MECP2 (1.5 kb) * MEF2C (1.4 kb) * NECAP1 (0.8 kb) * NHLRC1 (1.2 kb) * NIPA2 (1.1 kb) * NPRL2 (1.1 kb) * NPRL3 (1.7 kb) * PCDH19 (3.4 kb) * PIGA (1.5 kb) * PIK3AP1 (2.4 kb) * PLCB1 (3.6 kb) * PNKP (1.6 kb) * PNPO (0.8 kb) * POLG (3.7 kb) * PRDM8 (2.1 kb) * PRICKLE1 (2.5 kb) * PRICKLE2 (2.5 kb) * PRRT2 (1.0 kb) * RANBP2 (9.7 kb) * RANGAP1 (1.8 kb) * RELN (10.4 kb) * ROGDI (0.9 kb) * RYR3 (14.6 kb) * SCARB2 (1.4 kb) * SCN1A (6.0 kb) * SCN1B (0.7 kb) * SCN2A (6.0 kb) * SCN8A (5.9 kb) * SCN9A (5.9 kb) * SIK1 (2.3 kb) * SLC12A5 (3.4 kb) * SLC13A5 (1.7 kb) * SLC1A2 (1.7 kb) * SLC25A12 (2.0 kb) * SLC25A22 (1.0 kb) * SLC2A1 (1.5 kb) * SLC35A2 (1.3 kb) * SLC6A1 (1.8 kb) * SPTAN1 (7.4 kb) * SRPX2 (1.4 kb) * ST3GAL3 (1.3 kb) * STX1B (0.9 kb) * STXBP1 (1.8 kb) * SYN1 (2.1 kb) * SYNGAP1 (4.0 kb) * SZT2 (10.1 kb) * TBC1D24 (1.7 kb) * TNK2 (3.3 kb) * UBA5 (1.2 kb) * WWOX (1.2 kb) 136

137 Absence-Epilepsie Absence-Epilepsie CACNA1H, CLCN2, EFHC1, GABRA1, GABRB3, GABRG2, NIPA2, SLC2A1 15,9 kb Erkrankungen, OMIM, ICD-10, Gene bei Absence-Epilepsie Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Idiopathische, generalisierte Epilepsie mit Absencen G40.3 AD SLC2A1*, ** Juvenile Absence-Epilepsie G40.3 AD EFHC Juvenile Absence-Epilespie Typ AD CLCN Kindliche Absence-Epilepsie - G NIPA Kindliche Absence-Epilepsie 2 (ECA2) G40.3 AD GABRG2* Kindliche Absence-Epilepsie Typ 4 (ECA4) G GABRA Kindliche Absence-Epilepsie Typ 5 (ECA5) G40.3 AD GABRB Kindliche Absence-Epilepsie Typ 6 (ECA6) G40.3 AD CACNA1H * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Humangenetik Benigne familiäre Epilepsie (neonatal, infantil) Benigne familiäre Epilepsie (neonatal, infantil) CHRNA2, KCNQ2, KCNQ3, PRRT2, SCN2A, SCN8A 19,8 kb Erkrankungen, OMIM, ICD-10, Gene bei benigner familärer Epilepsie Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Benigne, familiäre, infantile Krampfanfälle - - AD CHRNA Benigne, familiäre, neonatale Krampfanfälle G40.3 AD KCNQ (BFNS1) Benigne, familiäre, neonatale Krampfanfälle G40.3 AD KCNQ (BFNS2) Benigne, familiäre, infantile Krampfanfälle (BFIS2) G40.3 AD PRRT Benigne, familiäre, infantile Krampfanfälle (BFIS3) G40.3 AD SCN2A* Benigne, familiäre, infantile Krampfanfälle (BFIS5) AD SCN8A * auch einzeln anforderbar Core Genes sind fett gedruckt Epilepsien mit erhöhter Therapierelevanz Epilepsien mit erhöhter Therapierelevanz ALDH7A1, ALG13, KCNQ2, PNPO, PRRT2, SCN1A, SLC2A1 16,9 kb 137

138 Erkrankungen, OMIM, ICD-10, Gene bei Epilepsien mit erhöhter Therapierelevanz Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Dravet-Syndrom G40.4 AD SCN1A*, ** Frühinfantile epileptische Enzephalopathie G40.3 AD KCNQ Glucose-Transporter-Defekt Typ G93.4 AD SLC2A1*, ** Infantile Konvulsionen und Choreoathetose G40.3 AD PRRT Kohlenhydrat-defizientes Glykoprotein-Syndrom E77.8 XL ALG Typ 1s (CDG1s) Pyridoxial-Phosphat-abhängige Epilepsie G40.8 AR PNPO Pyridoxin-abhängige Epilepsie G40.8 AR ALDH7A1* * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Familiäre hemiplegische Migräne (FHM) Familiäre hemiplegische Migräne ATP1A2, CACNA1A, SCN1A 15,9 kb Erkrankungen, OMIM, ICD-10, Gene bei familiärer hemiplegischer Migräne Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen FHM Familiäre hemiplegische Migräne Typ 1 Familiäre hemiplegische Migräne Typ 2 Familiäre hemiplegische Migräne Typ * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt G43.1 AD AD AD CACNA1A*,** ATP1A2*,** SCN1A*,** Fiebergebundene Anfälle/Generalisierte Epilepsie mit Fieberkrämpfen Plus (GEFS+) Fiebergebundene Anfälle/ Generalisierte Epilepsie mit Fieberkrämpfen Plus CPA6, GABRD, GABRG2, SCN1A, SCN1B, SCN9A, STX1B 17,6kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CPA6, GABRD, GABRG2, SCN1A, SCN1B, SCN9A, STX1B ADGRV1 36,5 kb 138

139 Erkrankungen, OMIM, ICD-10, Gene bei fiebergebundenen Anfällen/generalisierter Epilepsie mit Fieberkrämpfen Plus Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Familiäre fiebergebundene Anfälle Typ 4 (FEB4) G40.3 AD ADGRV Familiäre, fiebergebundene Anfälle Typ G40.3 AR CPA GEFS+ - Generalisierte Epilepsie mit G40.3 AD SCN1B* Fieberkrämpfen plus Typ 1 (GEFSP1) GEFS+ - Generalisierte Epilepsie mit G40.3 AD SCN1A*, ** Fieberkrämpfen plus Typ 2 (GEFSP2) GEFS+ - Generalisierte Epilepsie mit G40.3 AD GABRG2* Fieberkrämpfen plus Typ 3 (GEFSP3) GEFS+ - Generalisierte Epilepsie mit G40.3 AD GABRD Fieberkrämpfen plus Typ 5 (GEFSP5) GEFS+ - Generalisierte Epilepsie mit G40.3 AD SCN9A Fieberkrämpfen plus Typ 7 (GEFSP7) GEFS+ - Generalisierte Epilepsie mit G STX1B Fieberkrämpfen plus Typ 9 (GEFSP9) * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Fokale Epilepsien Fokale Epilepsien CHRNA2, CHRNA4, CHRNB2, DEPDC5, ELP4, GRIN2A, KCNA1, KCNT1, LGI1 Temporallappenepilepsie und Frontallappenepilepsie CHRNA2, CHRNA4, CHRNB2, CPA6, GAL, KCNT1, LGI1, RELN 22,6 kb 22,4 kb Humangenetik Erkrankungen, OMIM, ICD-10, Gene bei fokalen Epilepsien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Benigne infantile Epilepsie mit temporalen Spikes G40.0 AD ELP (BECTS) Episodische Ataxie Typ 1 (EA1) G11.8 AD KCNA Familiäre Temporallappenepilepsie Typ G40.8 AD LGI Familiäre Temporallappenepilepsie Typ G40.09 AD CPA Familiäre Temporallappenepilepsie Typ AD GAL Familiäre Temporallappenepilepsie Typ AD RELN Familiäre, fokale Epilepsie Typ G40.8 AD DEPDC Familiäre, fokale Epilepsie Typ AD NPRL Familiäre, fokale Epilepsie Typ AD NPRL Fokale Epilepsie und Sprachstörung (FESD) E72.1 AD GRIN2A Nächtliche Frontallappenepilepsie Typ G40.8 AD CHRNA Nächtliche Frontallappenepilepsie Typ G40.8 AD CHRNB Nächtliche Frontallappenepilepsie Typ G40.8 AD CHRNA Nächtliche Frontallappenepilepsie Typ G40.8 AD KCNT Core Genes sind fett gedruckt 139

140 Frühkindliche epileptische Enzephalopathien Frühkindliche epileptische Enzephalopathie (EIEE) (1) ARX, CDKL5, KCNQ2, PCDH19, SCN1A, SCN2A, STXBP1 24,7 kb Erweiterte Diagnostik Frühkindliche epileptische Enzephalopathie (EIEE) (2) DNM1, GABRA1, GABRB3, GNAO1, KCNA2, KCNT1, SCN8A, SLC12A5, SLC13A5, UBA5, WWOX 25,0 kb Frühkindliche epileptische Enzephalopathie (EIEE) (3) GRIN2B, HCN1, KCNB1, PIGA, PLCB1, PNKP, SLC35A2, SPTAN1 25,0 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. AARS, ALG13, AP3B2, ARHGEF9, ARV1, ARX, CACNA1A, CAD, CDKL5, CHD2, DCX, DENND5A, DNM1, DOCK7, EEF1A2, FASN, FGF12, FOXG1, FRRS1L, GABBR2, GABRA1, GABRB1, GABRB3, GNAO1, GPHN, GRIN2B, GRIN2D, GUF1, HCN1, ITPA, KCNA2, KCNB1, KCNQ2, KCNT1, MECP2, NECAP1, PCDH19, PIGA, PLCB1, PNKP, POLG, RANGAP1, RYR3, SCN1A, SCN2A, SCN8A, SIK1, SLC12A5, SLC13A5, SLC1A2, SLC25A12, SLC25A22, SLC35A2, SPTAN1, ST3GAL3, STXBP1, SYNGAP1, SZT2, TBC1D24, UBA5, WWOX 189,2 kb 140

141 Erkrankungen, OMIM, ICD-10, Gene bei frühkindlichen epileptischen Enzephalopathien (EIEE) Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Atypisches, kongenitales Rett-Syndrom F84.2 AD FOXG1*, ** Autosomal dominante, nicht-syndromale Intelligenzminderung G40.8 AD SYNGAP EIEE1 - Frühinfantile epileptische Enzephalopathie, G40.8 XL ARX*, ** Ohtahara-Syndrom EIEE1 - Partington-Syndrom G40.8 XL ARX*, ** EIEE1 - Proud-Syndrom Q87.8 XL ARX*, ** EIEE2 - Atypisches Rett-Syndrom F84.2 XL CDKL5*, ** EIEE3 - Frühinfantile epileptische Enzephalopathie G40.3 AR SLC25A EIEE4 - Frühinfantile epileptische Enzephalopathie, G40.3 AD STXBP1* Ohtahara-Syndrom EIEE5 - West-Syndrom G40.4 AD SPTAN EIEE6 - Dravet-Syndrom, SMEI G40.4 AD SCN1A*, ** EIEE6 - Panayiotopoulos-Syndrom - G40.8 AD SCN1A*, ** EIEE7 - Frühinfantile epileptische Enzephalopathie, G40.3 AD KCNQ Ohtahara-Syndrom EIEE8 - Hyperekplexie - Epilepsie G25.8 XL ARHGEF EIEE9 - Epilepsie mit mentaler Retardierung bei G40.8 XL PCDH19*, ** Mädchen (Juberg-Hellmann-Syndrom) EIEE10 - Mikrozephalie-Krampfanfälle-/ G40.8 AR PNKP Entwicklungsverzögerung-Syndrom (MCSZ) EIEE11 - Frühinfantile epileptische Enzephalopathie, G40.3 AD SCN2A* Ohtahara-Syndrom EIEE12 - infantile maligne migrierende Partialepilepsie G40.8 AR PLCB (MMPSE) EIEE13 - Frühinfantile epileptische Enzephalopathie G40.3 AD SCN8A EIEE14 - Infantile maligne migrierende Partialepilepsie G40.3 AD KCNT (MMPSI) EIEE15 - Frühinfantile epileptische Enzephalopathie G40.3 AR ST3GAL EIEE16 - Infantile maligne migrierende Partialepilepsie G40.8 AR TBC1D EIEE17 - Frühinfantile epileptische Enzephalopathie G40.3 AD GNAO EIEE18 - Frühinfantile epileptische Enzephalopathie G40.8 AR SZT ohne Burst-Suppression EIEE19 - Frühinfantile epileptische Enzephalopathie G40.3 AD GABRA EIEE20 - Multiple kongenitale Anomalien-Hypotonie-Krampfanfälle-Syndrom Q87.8 XL PIGA Typ 2 (MCAHS2) EIEE21 - Frühinfantile epileptische Enzephalopathie G40.3 AR NECAP EIEE22 - Kongenitaler Defekt der Glycoproteinbiosynthese E77.8 XL SLC35A Typ 2m (CDG2M) EIEE23 - Frühinfantile epileptische Enzephalopathie G40.8 AR DOCK EIEE24 - Frühinfantile epileptische Enzephalopathie G40.3 AD HCN EIEE25 - Frühinfantile epileptische Enzephalopathie G SLC13A EIEE26 - Frühinfantile epileptische Enzephalopathie G40.3 AD KCNB EIEE27 - Frühinfantile epileptische Enzephalopathie G40.3 AD GRIN2B EIEE28 - Frühinfantile epileptische Enzephalopathie G40.3 AR WWOX Humangenetik 141

142 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen EIEE29 - Frühinfantile epileptische Enzephalopathie G40.3 AR AARS EIEE30 - Frühinfantile epileptische Enzephalopathie G40.3 AD SIK EIEE31 - Frühinfantile epileptische Enzephalopathie G40.3 AD DNM EIEE32 - Frühinfantile epileptische Enzephalopathie G40.3 AD KCNA EIEE33 - Frühinfantile epileptische Enzephalopathie G40.3 AD EEF1A EIEE34 - Frühinfantile epileptische Enzephalopathie G25.8 AR SLC12A EIEE35 - Frühinfantile epileptische Enzephalopathie G40.4 AR ITPA EIEE36 - Frühinfantile epileptische Enzephalopathie G40.3 XL ALG EIEE37 - Frühinfantile epileptische Enzephalopathie AR FRRS1L EIEE38 - Frühinfantile epileptische Enzephalopathie AR ARV EIEE39 - Früninfantile epileptische Enzephalopathie AR SLC25A EIEE40 - Frühinfantile epileptische Enzephalopathie AR GUF EIEE41 - Frühinfantile epileptische Enzephalopathie AD SLC1A EIEE42 - Frühinfantile epileptische Enzephalopathie AD CACNA1A*, ** EIEE43 - Frühinfantile epileptische Enzephalopathie G40.3 AD GABRB EIEE44 - Frühinfantile epileptische Enzephalopathie AR UBA EIEE45 - Frühinfantile epileptische Enzephalopathie G40.3 AD GABRB EIEE46 - Frühinfantile epileptische Enzephalopathie G40.3 AD GRIN2D EIEE47 - Frühinfantile epileptische Enzephalopathie G40.3 AD FGF EIEE48 - Frühinfantile epileptische Enzephalopathie G40.3 AR AP3B EIEE49 - Frühinfantile epileptische Enzephalopathie G DENND5A EIEE50 - Frühinfantile epileptische Enzephalopathie G40.3 AR CAD Epileptische Enzephalopathie G40.3 AD CHD Epileptische Enzephalopathie - G FASN Epileptische Enzephalopathie - G GABBR Epileptische Enzephalopathie - - AD RANGAP Epileptische Enzephalopathie - G RYR Schwere frühe therapieresistente Epilepsie G GPHN Lissenzephalie, X-chromosomal Q04.3 XL DCX Mitochondriales DNA-Depletions-Syndrom 4A G31.88 AR POLG (Alpers-Typ) Rett-Syndrom F84.2 XL MECP2*, ** *auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 142

143 Generalisierte juvenile myoklonische Epilepsien Juvenile myoklonische Epilepsien CACNB4, CASR, CLCN2, EFHC1, GABRA1, GABRD, KCNMA1, SLC6A1, TBC1D24 19,3 kb Progressive myoklonische Epilepsien CERS1, CSTB, EPM2A, GOSR2, KCNC1, KCTD7, LMNB2, NHLRC1, PRDM8, PRICKLE1, PRICKLE2, SCARB2 17,2 kb Humangenetik Erkrankungen, OMIM, ICD-10, Gene bei generalisierter juveniler myoklonischer Epilepsie Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Epilepsie mit myoklonisch-atonischen Anfällen (MAE) G40.4 AD SLC6A Familiäre infantile myoklonische Epilepsie (FIME) G40.8 AR TBC1D Generalisierte Epilepsie mit paroxysmaler Dyskinesie G40.3 AD KCNMA (GEPD) Idiopathische, generalisierte Epilepsie Typ G40.3 AD CASR Juvenile myoklonische Epilepsie Typ 1 (EJM1) G40.3 AD EFHC Juvenile myoklonische Epilepsie Typ 5 (EJM5) G40.3 AD GABRA Juvenile myoklonische Epilepsie Typ 6 (EJM6) G40.3 AD CACNB Juvenile myoklonische Epilepsie Typ 7 (EJM7) G40.3 AD GABRD Juvenile myoklonische Epilepsie Typ 8 (EJM8) G40.3 AD CLCN Progressive myoklonische Epilepsie Typ 1A G40.3 AR CSTB (PME1A) (Unverricht and Lundborg) Progressive myoklonische Epilepsie Typ 1B G40.3 AR PRICKLE (PME1B) (Unverricht und Lundborg) Progressive myoklonische Epilepsie Typ 2A G40.3 AR EPM2A (PME2A; Lafora) Progressive myoklonische Epilepsie Typ 2B (PME2B; G40.3 AR NHLRC Lafora) Progressive myoklonische Epilepsie Typ 3 mit oder G40.3 AR KCTD ohne intrazelluläre Einschlüsse (PME3) Progressive myoklonische Epilepsie Typ 4 mit oder G40.3 AR SCARB ohne Nierenversagen (PME4) Progressive myoklonische Epilepsie Typ 5 (PME5) G40.3 AD PRICKLE Progressive myoklonische Epilepsie Typ 6 (PME6) G40.3 AR GOSR Progressive myoklonische Epilepsie Typ 7 (PME7) G40.3 AD KCNC Progressive myoklonische Epilepsie Typ 8 (PME8) G40.3 AR CERS Progressive myoklonische Epilepsie Typ 9 (PME9) G40.3 AR LMNB Progressive myoklonische Epilepsie Typ 10 (PME10) G40.3 AR PRDM Core Genes sind fett gedruckt 143

144 13. Nierenerkrankungen Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Genetische Ursachen angeborener Nierenerkrankungen sind vielfältig, mit verschiedensten Krankheitsbildern mit sehr großer klinischer und auch genetischer Heterogenität. Die molekulargenetische Diagnostik zur Diagnosefindung oder Bestätigung ist oft entscheidend für die Beratung betroffener Familien und zum Teil auch für die Therapie der Patienten. Mittels Next Generation Sequencing (NGS) können viele mit angeborenen Nierenerkrankungen assoziierte Gene auf einmal untersucht werden (Gen-Panel Diagnostik). Dies ist besonders bei klinisch schwer abzugrenzenden Phänotypen, aber auch bei großer intrafamiliärer Variabilität der Ausprägung von Fehlbildungen von großem Vorteil. Je nach Phänotyp und familiärer Vorgeschichte, ist bei klinischem Verdacht auf angeborene Fehlbildungen der Nieren und ableitenden Harnwege (congenital anomalies of the kidney and urinary tract, CAKUT) eventuell eine Eingrenzung auf isolierte Fehlbildungen der ableitenden Harnwege oder auf isolierte Nierenagenesie oder Hypoplasie möglich. Mit diesen Phänotypen sind jeweils ca. 20 Gene assoziiert. Eine weitere klinisch abgrenzbare Untergruppe von CAKUT ist die Renale tubuläre Dysgenesie, bei der es sich um eine schwere seltene fetale Störung mit fehlenden oder ungenügend entwickelten proximalen Nierentubuli handelt, mit der aktuell 4 Gene assoziiert werden. Bei größerer intrafamiliärer Variabilität der Ausprägung der Symptomatik kann in vielen Fällen allerdings keine eindeutige phänotypische Zuordnung getroffen werden, und es kommen dann die bereits mehr als 50 Gene in Frage, die mit zum Teil sehr variablen CAKUT-Phänotypen assoziiert sind. Bei den Polyzystischen Nierenerkrankungen unterscheidet man die oft mildere autosomal-dominant erbliche polyzystische Nierenerkrankung, die meist erst im Erwachsenenalter symptomatisch wird, von der oft sehr schweren, meist bereits vorgeburtlich manifestierenden autosomalrezessiven polyzystischen Nierenerkrankung. Phänotypische Überlappungen sind jedoch beschrieben, ebenso existieren Hinweise auf eine oligogene Vererbung. Bei der Gruppe der Nephronophthisen (NPHP) handelt es sich um autosomal-rezessiv vererbte zystische Nierenerkrankungen, die für 6-10% des terminalen Nierenversagens bei Kindern verantwortlich gemacht werden. Die NPHP weist eine große Genlocus- Heterogenität auf. Bisher konnten Mutationen in mehr als 20 Genen bei NPHP identifiziert werden. Beim Nephrotischen Syndrom (NS) kommt es durch eine Dysfunktion des glomerulären Filters zu einem exzessiven Verlust von Plasmaproteinen (Proteinurie) sowie einer Hypalbuminämie. Eine der häufigsten Ursachen des NS ist die fokal segmentale Glomerulosklerose (FSGS). 58% der Patienten mit einem steroid-resistenten NS (SRNS) zeigen einen raschen Verlust der Nierenfunktion bis hin zum Nierenversagen. Retrospektive Studien an Patienten mit genetisch und nicht-genetisch bedingtem steroid-resistenten NS (SRNS) konnten belegen, dass Betroffene mit genetisch bedingter Erkrankung nicht durch eine intensivierte Immunsuppression in (Voll-) Remission zu bringen sind, d.h. die molekulargenetische Untersuchung ist wichtig für die Therapie-Planung der Patienten. Bisher sind bereits mehr als 20 verschiedene Gene bekannt, die mit NS bzw. FSGS assoziiert sind. Beim Alport-Syndrom handelt es sich um eine progressive hereditäre Nephropathie. Klinische Zeichen sind zunächst Proteinurie und Hämaturie, im weiteren Verlauf entwickeln die Patienten ein terminales Nierenversagen (end stage renal disease, ESRD). Zusätzlich werden extrarenale Manifestationen wie Innenohr- Schwerhörigkeit und Augenveränderungen (Lenticonus anterior) beobachtet. Abhängig vom ursächlichen Gen werden ein X-chromosomaler, ein autosomal-rezessiver und ein autosomal-dominanter Erbgang unterschieden. Bei der Hyperoxalurie handelt es sich um eine autosomal-rezessiv vererbte Stoffwechselkrankheit, die bereits im Säuglings- oder Kleinkindalter durch Oxalatablagerung zu einer chronischen Niereninsuffizienz und/oder zu Urolithiasis begleitet von Fieber, Hämaturie und Nierenkoliken und, bei vollständigem Verschluss der Harnwege, zu akutem Nierenversagen führt. Als ursächlich sind Mutationen in drei verschiedenen Genen beschrieben. Aufgrund der großen klinischen und auch genetischen Heterogenität erblicher Nierenerkrankungen kann eine molekulargenetische Abklärung mittels NGS die exakte Zuordnung erleichtern, zur Identifikation modifizierender genetischer Faktoren beitragen und die Therapie und damit die Prognose der betroffenen Patienten verbessern. Literatur Wolf, Curr Opin Pediatr 27:201 (2015) / Hwang et al, Kidney Int 85:1429 (2014) / Humbert et al, Am J Hum Genet Feb 94:288 (2014) / Rodriguez, Fetal Pediatr Pathol 33:293 (2014) / Vivante et al, Pediatr Nephrol 29:695 (2014) / Bergmann et al, J AM Soc Nephrol 22:2047 (2011) / Saisawat et al, Kidney Int 81:196 (2011) 144

145 Humangenetik Schematische Darstellung der phänotypischen und genetischen Heterogenität bei Nierenerkrankungen. Die einzelnen Subpanels sind farblich voneinander abgegrenzt, "Core Genes" sind fett gedruckt. 145

146 Genliste Nierenerkrankungen Individuell konfigurierbare MGPS Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ACE (3,9 kb) * ACTA2 (1,1 kb) * ACTN4 (2,7 kb) * ADCK4 (1,6 kb) * ACTG2 (1,1 kb) * AGT(1,4 kb) * AGTR1 (1,2 kb) * AGXT (1,2 kb) * AHI1 (3,6 kb) * ANKS6 (2,6 kb) * ANLN (3,4 kb) * ANOS1 (2,0 kb) * APOL1 (1,2 kb) * ARHGAP24 (2,2 kb) * ARHGDIA (0,6 kb) * BICC1 (2,9 kb) * BMP4 (1,2 kb) * BMP7 (1,3 kb) * CC2D2A (4,9 kb) * CD2AP (1,9 kb) * CDC5L (2,4 kb) * CEP164 (4,4 kb) * CEP290 (7,4 kb) * CEP83 (2,1 kb) * CFH (3,7 kb) * CHD1L (2,7 kb) * CHRM3 (1,8 kb) * COL4A3 (5,0 kb) * COL4A4 (5,0 kb) * COL4A5 (6,6 kb) * COQ2 (1,3 kb) * COQ6 (1,4 kb) * CRB2 (3,9 kb) * CUBN (10,9 kb) * DACH1 (2,1 kb) * DGKE (1,7 kb) * DSTYK (2,8 kb) * EMP2 (0,5 kb) * ETV4 (1,4 kb) * ETV5 (1,5 kb) * EYA1 (1,8 kb) * FGF20 (0,6 kb) * FOXC1 (1,6 kb) * FOXC2 (1,5 kb) * FRAS1 (12,0 kb) * FREM1 (6,5 kb) * FREM2 (9,5 kb) * GATA3 (1,3 kb) * GDNF (0,6 kb) * GLA (1,3 kb) * GLIS2 (1,6 kb) * GREM1 (0,5 kb) * GRHPR (1,0 kb) * GRIP1 (3,2 kb) * HNF1B (1,7 kb) * HOGA1 (1,0 kb) * HPSE2 (1,8 kb) * IFT172 (5,2 kb) * INF2 (3,7 kb) * INVS (3,2 kb) * IQCB1 (1,8 kb) * ITGA3 (3,1 kb) * ITGA8 (3,2 kb) * ITGB4 (5,3 kb) * KANK1 (4,1 kb) * KANK2 (2,5 kb) * KANK4 (3,0 kb) * LAMB2 (5,4 kb) * LMX1B (1,2 kb) * LRIG2 (3,2 kb) * MUC1 (1,4 kb) * MYH9 (5,9 kb) * MYO1E (3,3 kb) * NEIL1 (1,2 kb) * NEK8 (2,1 kb) * NPHP1 (2,2 kb) * NPHP3 (4,0 kb) * NPHP4 (4,3 kb) * NPHS1 (3,7 kb) * NPHS2 (1,1 kb) * OFD1 (3,0 kb) * PAX2 (1,2 kb) * PAX8 (1,3 kb) * PDSS2 (1,2 kb) * PKD1 (12,9 kb) * PKD2 (2,9 kb) * PKHD1 (12,2 kb) * PLCE1 (6,9 kb) * PTPRO (3,6 kb) * REN (1,2 kb) * RET (3,3 kb) * ROBO2 (4,1 kb) * RPGRIP1L (3,9 kb) * SALL1 (4,0 kb) * SCARB2 (1,4 kb) * SDCCAG8 (2,1 kb) * SIX1 (0,8 kb) * SIX2 (0,9 kb) * SIX5 (2,2 kb) * SLC41A1 (1,5 kb) * SMARCAL1 (2,9 kb) * SOX17 (1,2 kb) * TMEM216 (0,4 kb) * TMEM237 (1,2 kb) * TMEM67 (3,0 kb) * TRAP1 (2,1 kb) * TRPC6 (2,8 kb) * TTC21B (3,9 kb) * UMOD (2,0 kb) * UPK2 (0,5 kb) * UPK3A (0,9 kb) * WDR19 (4,0 kb) * WNT4 (1,0 kb) * WT1 (1,5 kb) * XPNPEP3 (1,5 kb) * ZIC3 (1,4 kb) * ZNF423 (3,8 kb) 146

147 13.1 Alport-Syndrom Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Beim Alport-Syndrom handelt es sich um eine progressive hereditäre Nephropathie. Klinische Zeichen sind zunächst Proteinurie und Hämaturie, im weiteren Verlauf entwickeln die Patienten ein terminales Nierenversagen (ESRD). Zusätzlich werden extrarenale Manifestationen, wie Innenohr-Schwerhörigkeit und Augenveränderungen (Lenticonus anterior) beobachtet. Ursache sind vor allem Veränderungen im Typ IV-Kollagen, die zu strukturellen Defekten in der glomerulären Basalmembran führen (COL4A3, COL4A4, COL4A5). Abhängig vom ursächlichen Gen werden ein X-chromosomaler, ein autosomal-rezessiver und ein autosomal-dominanter Erbgang unterschieden. Typ IV-Kollagen besteht aus sechs homologen alpha- Ketten, codiert durch die Gene COL4A1-COL4A6. Jede alpha-kette enthält eine Kollagen-Domäne, einen Kollagenschwanz und zwei nicht-kollagene Domänen (NC1/NC2). Durch die Aminosäure Glycin an jeder 3. Position bildet der Kollagenschwanz eine Triple-Helix-Struktur aus. Mutationen im MYH9-Gen verursachen teilweise überlappende Phänotypen zum Alport-Syndrom, u.a. das Fechtner-Syndrom, welches durch Makro-Thrombozytopenie, ggf. Glomerulonephritis, Schwerhörigkeit und Katarakt gekennzeichnet ist. Die Häufigkeit für alle Formen des Alport-Syndroms liegt bei ca. 1:5.000, der X-chromosomale Erbgang ist mit 85% am häufigsten. Bei autosomal-dominantem Erbgang ist der Verlauf oft milder mit späterer ESRD. Etwa 15% der Fälle werden durch Neumutationen verursacht. Inframe- oder Missense-Mutationen sind mit mildem Verlauf und spätem Beginn der ESRD assoziiert, Frameshift-, Nonsense- und große Rearrangement-Mutationen führen zu schwerem Verlauf mit früher ESRD. Mutationen in der Triple-Helix des Kollagenschwanzes führen zur Abknickung oder verändertem dreidimensionalen Aufbau der Helix bzw. Verkürzung des Genproduktes. Die Heterozygotenfrequenz für den autosomal-rezessiven Erbgang liegt bei unter 1:120. Die Dünne Basalmembran Nephropathie (thin basement membrane nephropathy, TBMN) ist phänotypisch nicht vom Anlageträger für ein autosomal-rezessives Alport-Syndrom zu unterscheiden. Einige Patienten mit Familiärer Benigner Hämaturie (FBH) tragen eine heterozygote Mutation in COL4A3 bzw. COL4A4. Kinder von Eltern mit FBH und jeweils einer heterozygoten Mutation in COL4A3 können ein Alport-Syndrom entwickeln. Daher gilt die FBH als Heterozygotie für die autosomal-rezessive Form des Alport-Syndroms. Anlageträgerinnen der X-chromosomalen Form können eine Hämaturie und eine geringe Proteinurie und selten später eine ESRD zeigen. Literatur Mencarelli et al, J Med Genet 52:163 (2015) / Rosado et al, Kidney Blood Press Res 40:435 (2015) / Hertz et al, Eur J Hum Genet 23:e1 (2014) / Pierides et al, Hippokratia 17:207 (2013) / Savige et al, J Am Soc Nephrol 24:364 (2013) / Hou et al, Am J Nephrol 27:538 (2007) / Hudson et al, N Engl J Med 348:2543 (2003) Humangenetik Alport-Syndrom COL4A3, COL4A4, COL4A5, MYH9 21,0 kb Erkrankungen, OMIM, ICD-10, Gene bei Alport-Syndrom Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Alport-Syndrom, autosomal dominant Q87.8 AD COL4A3*, ** Alport-Syndrom, autosomal rezessiv Q87.8 AR COL4A3*, ** Alport-Syndrom, autosomal rezessiv Q87.8 AR COL4A4*, ** Alport-Syndrom, X-linked Q87.8 X-linked COL4A5*, ** Alport-Syndrom Phänotyp - Q87.8 AD MYH9*, ** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 147

148 13.2 Angeborene Fehlbildungen der Nieren und ableitenden Harnwege (CAKUT) Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Angeborene Fehlbildungen der Nieren und ableitenden Harnwege (congenital anomalies of the kidney and urinary tract, CAKUT) werden bei ca. 3-6:1.000 Neugeborene beobachtet und sind die Hauptursache für chronisches Nierenversagen im Kindesalter. Das phänotypische Spektrum von CAKUT reicht von vesikoureteralem Reflux bis hin zur Nierenagenesie. CAKUT wird sowohl isoliert beobachtet als auch in Zusammenhang mit komplexen Fehlbildungssyndromen. Bisher sind bereits mehr als 40 Gene bekannt, die mit CAKUT assoziiert sind. Entsprechend der klinischen Symptomatik ist in einigen Fällen die Anforderung eines entsprechenden Subpanels sinnvoll: - Fehlbildungen der ableitenden Harnwege - Nierenagenesie/Hypoplasie - Renal tubuläre Dysgenesie Literatur Bergmann et al, J AM Soc Nephrol 22:2047 (2011) / Saisawat et al, Kidney Int 81:196 (2011) Individuell konfigurierbare MGPS CAKUT Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ACE (3,9 kb) * ACTA2 (1,1 kb) * ACTG2 (1,1 kb) * AGT(1,4 kb) * AGTR1 (1,2 kb) * ANOS1 (2,0 kb) * BICC1 (2,9 kb) * BMP4 (1,2 kb) * BMP7 (1,3 kb) * CDC5L (2,4 kb) * CHD1L (2,7 kb) * CHRM3 (1,8 kb) * DACH1 (2,1 kb) * DSTYK (2,8 kb) * ETV4 (1,4 kb) * ETV5 (1,5 kb) * EYA1 (1,8 kb) * FGF20 (0,6 kb) * FOXC1 (1,6 kb) * FOXC2 (1,5 kb) * FRAS1 (12,0 kb) * FREM1 (6,5 kb) * FREM2 (9,5 kb) * GATA3 (1,3 kb) * GDNF (0,6 kb) * GREM1 (0,5 kb) * GRIP1 (3,2 kb) * HNF1B (1,7 kb) * HPSE2 (1,8 kb) * ITGA3 (3,1 kb) * ITGA8 (3,2 kb) * LRIG2 (3,2 kb) * MUC1 (1,4 kb) * PAX2 (1,2 kb) * PAX8 (1,3 kb) * REN (1,2 kb) * RET (3,3 kb) * ROBO2 (4,1 kb) * SALL1 (4,0 kb) * SIX1 (0,8 kb) * SIX2 (0,9 kb) * SIX5 (2,2 kb) * SOX17 (1,2 kb) * TRAP1 (2,1 kb) * UMOD (2,0 kb) * UPK2 (0,5 kb) * UPK3A (0,9 kb) * WNT4 (1,0 kb) * WT1 (1,5 kb) * ZIC3 (1,4 kb) 148

149 Erkrankungen, OMIM, ICD-10, Gene bei CAKUT Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Branchio-oto-renales Syndrom Typ Q87.8 AD EYA1*, ** Branchio-oto-renales Syndrom Typ Q87.8 AD SIX5* Branchio-oto-renales Syndrom Typ Q87.8 AD SIX1* CAKUT / VACTERL Assoziation, X-linked Q63.9 X-linked ZIC Denys-Drash Syndrom Q63.9 AD WT1*, ** Fehlbildungen der ableitenden Harnwege - Q63.9 AD BMP Fehlbildungen der ableitenden Harnwege - Q63.9 AD CHD1L Fehlbildungen der ableitenden Harnwege Q63.9 AD HNF1B*, ** Fehlbildungen der ableitenden Harnwege Q63.9 AR ITGA Fehlbildungen der ableitenden Harnwege - Q63.9 AD PAX Fehlbildungen der ableitenden Harnwege Q63.9 AR RET*, ** Fehlbildungen der ableitenden Harnwege / Q63.9 AR HPSE2* Urofaziales Syndrom Typ 1 Fehlbildungen der ableitenden Harnwege / Q87.8 AD EYA1*, ** Branchio-oto-renales Syndrom Typ 1 Fehlbildungen der ableitenden Harnwege / - Q63.9 AR TRAP CAKUT und/oder VACTERL Phänotyp Fehlbildungen der ableitenden Harnwege / Q63.9 AR FRAS Fraser-Syndrom Fehlbildungen der ableitenden Harnwege / Q63.9 AR FREM Fraser-Syndrom Fehlbildungen der ableitenden Harnwege / Q63.9 AR FREM Manitoba-okulo-tricho-anales Syndrom /BNAR Fehlbildungen der ableitenden Harnwege / - Q79.4 AD ACTA2* Prune-Belly Syndrom Fehlbildungen der ableitenden Harnwege / Q79.4 AR CHRM3* Prune-Belly Syndrom Fehlbildungen der ableitenden Harnwege / Q87.8 AD SALL Townes-Brocks Syndrom Fehlbildungen der ableitenden Harnwege / Q63.9 AR LRIG2* Urofacial syndrome Typ 2 Frasier Syndrom Q63.9 AD WT1*, ** Hyperuricämische Nephropathie, Q63.8 AD REN familiär juvenil Typ 2 Hypoparathyroidisum, sensorineurale Schwerhörigkeit Q63.9 AD GATA und renale Dysplasie Interstitielle Lungenerkrankung, Nephrotisches Q63.9 AR ITGA Syndrom und Epidermolysis bullosa, kongenital Kongenitale Fehlbildung der Nieren und - Q63.9 AD BMP ableitenden Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und - Q63.9 AD BMP ableitenden Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden - Q63.9 AD CDC5L Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden Harnwege (CAKUT) - Q63.9 AD CHD1L Humangenetik 149

150 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Kongenitale Fehlbildung der Nieren und ableitenden - Q79.4 AR DACH Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden Q79.4 AD DSTYK Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden - Q ETV Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden - Q ETV Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden - Q GDNF** Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden - Q63.9 AR GREM Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden Q63.9 AD HNF1B*, ** Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden - Q63.9 X-linked ANOS1*, ** Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden - Q PAX Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden - Q63.9 AD SIX Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden - Q UPK Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden Q63.9 AD DSTYK Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden Q63.9 AD GATA Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden Q13.8 AD FOXC1*, ** Harnwege (CAKUT) / Axenfeld-Rieger Syndrom Typ 3 Kongenitale Fehlbildung der Nieren und ableitenden Q87.0 AR FRAS Harnwege (CAKUT) / Fraser-Syndrom Kongenitale Fehlbildung der Nieren und ableitenden Q87.0 AR FREM Harnwege (CAKUT) / Fraser-Syndrom Kongenitale Fehlbildung der Nieren und ableitenden Q63.9 AR GRIP Harnwege (CAKUT) / Fraser-Syndrom Kongenitale Fehlbildung der Nieren und ableitenden Q82.0 AD FOXC2** Harnwege (CAKUT) / Lymphödem-Disti- chiasis mit Nierenfehlbildung und Diabetes mellitus Kongenitale Fehlbildung der Nieren und ableitenden Q63.9 AR RET*, ** Harnwege (CAKUT) / Nierenagenesie/Hypoplasie Phänotyp Kongenitale Fehlbildung der Nieren und ableitenden Q63.9 X-linked ZIC Harnwege (CAKUT) / VACTERL Assozia- tion, X-linked Kongenitale Fehlbildung der Nieren und ableitenden Q63.9 AD PAX Harnwege (CAKUT); Fokal segmentale Glomerulosklerose Typ 7 Kongenitale Fehlbildung der Nieren und ableitenden Harnwege (CAKUT); Papillorenales Syndrom Q63.9 AD PAX

151 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Kongenitale Fehlbildung der Nieren und ableitenden Q63.9 AD PAX Harnwege (CAKUT); Renales Kolombom Syndrom Kongenitale Fehlbildung der Nieren und ableitenden Q63.9 AD ROBO Harnwege (CAKUT); Vesicoureteraler Reflux Typ 2 Kongenitale Fehlbildung der Nieren und ableitenden Q63.9 AD SOX Harnwege (CAKUT); Vesicoureteraler Reflux Typ 3 Manitoba-okulo-tricho-anales Syndrom / Bifide Q87.8 AR FREM Nase, anorektale und renale Fehlbildungen -BNAR Meacham-Syndrom Q63.9 AD WT1*, ** Medullär-zystische Nierenerkrankung Type Q63.9 AD MUC Nephrotisches Syndrom, isoliert - NPHS Q63.9 AD WT1*, ** Nierenagenesie / Hypoplasie Phänotyp - Q63.9 X-linked ANOS1*, ** Nierenagenesie/Hypoplasie Phänotyp Q63.9 AR FGF Nierenagenesie/Hypoplasie Phänotyp Q63.9 AR ITGA Nierenagenesie/Hypoplasie Phänotyp - Q63.9 AD UPK3A Nierenagenesie/Hypoplasie Phänotyp - Q63.9 AD BMP Nierenagenesie/Hypoplasie Phänotyp - Q63.9 AR GREM Nierenagenesie/Hypoplasie Phänotyp Q63.9 AD HNF1B*, ** Nierenagenesie/Hypoplasie Phänotyp - Q63.9 AD PAX Nierenagenesie/Hypoplasie Phänotyp - Q63.9 AR RET*, ** Nierenagenesie/Hypoplasie Phänotyp - Q63.9 AD SIX Nierenagenesie/Hypoplasie Phänotyp - CAKUT - Q63.9 AR TRAP und/oder VACTERL Phänotyp Nierenagenesie/Hypoplasie Phänotyp / BNAR - Q63.9 AR FREM Nierenagenesie/Hypoplasie Phänotyp / Q63.9 AR FREM Fraser Syndrom Nierenagenesie/Hypoplasie Phänotyp / Q63.9 AR FRAS Fraser-Syndrom Nierenagenesie/Hypoplasie Phänotyp / Q63.9 AR WNT SERKAL syndrome Nierenagenesie/Hypoplasie Phänotyp / Q87.8 AD SALL Townes-Brocks Syndrom Nierenagenesie/Hypoplasie Phänotyp - Q63.9 AR TRAP und/oder VACTERL Phänotyp Nierenagenesie/Hypoplasie Typ Q63.9 AD DSTYK Prune-Belly-Syndrom - Q79.4 AD ACTA2* Prune-Belly-Syndrom Q79.4 AR CHRM3* Renale tubuläre Dysgenesie Q63.8 AR AGT Renale tubuläre Dysgenesie Q63.8 AR AGTR Renale-zystische Dysplasie, Suszeptibilität Q63.8 AD BICC Renale tubuläre Dysgenesie Q63.8 AR ACE Renale tubuläre Dysgenesie Q63.8 AR REN Renale tubuläre Dysgenesie Q63.8 AR AGT Renale tubuläre Dysgenesie Q63.8 AR AGTR Humangenetik 151

152 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen SERKAL-Syndrom Q63.9 AR WNT Townes-Brocks Syndrom Q87.8 AD SALL UMOD-assoziierte Nierenerkrankung - Q63.9 AD UMOD* Urofaziales Syndrom Typ Q63.9 AR LRIG2* Urofaziales Syndrom Typ Q63.9 AR LRIG2* Urofaziales Syndrom Typ Q63.9 AR HPSE2* Vesicoureteraler Reflux Typ Q63.9 AD ROBO Vesicoureteraler Reflux Typ Q63.9 AD SOX Viscerale Myopathie / Prune-Belly Syndrom Q79.4 AD ACTG Wilms-Tumor, isoliert Q63.9 AD WT1*, ** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Fehlbildungen der ableitenden Harnwege Fehlbildungen der ableitenden Harnwege ACTA2, ACTG2, BMP4, CHD1L, CHRM3, DSTYK, GATA3, HNF1B, ITGA8, PAX2, ROBO2, SOX17 24,6 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ACTA2, ACTG2, BMP4, CHD1L, CHRM3, DSTYK, GATA3, HNF1B, ITGA8, PAX2, ROBO2, SOX17 BMP7, DACH1, EYA1, FRAS1, FREM1, FREM2, HPSE2, LRIG2, RET, SALL1, TRAP1 72,3 kb Nierenagenesie/Hypoplasie Nierenagenesie/Hypoplasie BMP4, CDC5L, DSTYK, FGF20, HNF1B, ITGA8, PAX2, RET, SALL1, SIX2, TRAP1, UPK3A 24,3 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. BMP4, CDC5L, DSTYK, FGF20, HNF1B, ITGA8, PAX2, RET, SALL1, SIX2, TRAP1, UPK3A ANOS1, FRAS1, FREM1, FREM2, GREM1, WNT4 56,0 kb 152

153 Renale tubuläre Dysgenesie Renale tubuläre Dysgenesie ACE, AGT, AGTR1, REN 7,8 kb 13.3 Nephronophthise (NPHP) Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Bei NPHP handelt es sich um eine autosomal-rezessiv vererbte zystische Nierenerkrankung, die für 6-10% des terminalen Nierenversagens bei Kindern verantwortlich gemacht wird und damit ursächlich für ca. 10% der Nierentransplantationen im Kindesalter ist. Zusätzlich werden bei 10-15% der Patienten extrarenale Manifestationen, wie z.b. Retinitis Pigmentosa (Senior-Løken-Syndrom), okulomotorische Apraxie Typ Cogan (Cogan-Syndrom) sowie Sehnervkolobome und Kleinhirnwurmaplasie (Joubert-Syndrom) beobachtet. Die Häufigkeit für NPHP wird mit ca. 1: angegeben. Bei der NPHP sind immer beide Nieren in den Krankheitsprozess involviert. Makroskopisch fällt bei normal großen oder nur geringfügig verkleinerten Nieren oberflächlich eine feine Granulierung auf. Im Bereich der Rinden-Mark-Grenze bilden sich fünf bis mehr als 50 Zysten aus, die einen Durchmesser zwischen fünf und 15 mm einnehmen können. Lichtmikroskopisch werden im frühen Stadium der NPHP die charakteristischen Veränderungen einer stark verdickten tubulären Basalmembran sowie einer lymphohistiozytären, peritubulären Infiltration festgestellt, die später in eine diffus sklerosierende, tubulointerstitielle Nephropathie münden. Elektronenmikroskopisch können Verdickungen, Aufsplitterungen und Fältelungen mit Fibroblasteneinlagerung festgestellt werden. NPHP zählt zu den sogenannten Ziliopathien und weist eine große Genlocus-Heterogenität auf. Bisher konnten Mutationen in 25 Genen in Assoziation mit NPHP identifiziert werden. Bei ca. 85% der Patienten mit NPHP kann eine homozygote Deletion des NPHP1-Gens nachgewiesen werden. Literatur Chaki et al, Kidney Int 80:1239 (2011) / Hoefele et al, Der Nephrologe 2:372 (2007) / Hildebrandt et al, Pediatr Nephrol 16:168 (2001) / Hildebrandt et al, Kidney 51:261 (1997) Humangenetik Nephronophthise (NPHP) CEP290, GLIS2, INVS, IQCB1, NPHP1, NPHP3, NPHP4 24,5 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CEP290, GLIS2, INVS, IQCB1, NPHP1, NPHP3, NPHP4 AHI1, ANKS6, ATXN10, CC2D2A, CEP164, CEP83, DCDC2, IFT172, MAPKBP1, NEK8, PAX2, RPGRIP1L, SDCCAG8, SLC41A1, TMEM216, TMEM237, TMEM67, TTC21B, WDR19, XPNPEP3, ZNF423 83,4 kb 153

154 Erkrankungen, OMIM, ICD-10, Gene bei Nephronophthise Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Joubert-Syndrom Typ Q04.3 AR TMEM Joubert-Syndrom Typ Q04.3 AR TMEM Nephronophthise Phänotyp - Q61.5 AR ATXN Nephronophthise Phänotyp Q60.4 AD PAX Nephronophthise Phänotyp - Q61.5 AR SLC41A Nephronophthise Phänotyp / Q04.3 AR AHI Joubert-Syndrom Typ 3 Nephronophthise Phänotyp / Q04.3 AR CC2D2A Joubert-Syndrom Typ 9 Nephronophthise Typ Q61.5 AR NPHP1*, ** Nephronophthise Typ 2, infantil Q61.5 AR INVS Nephronophthise Typ Q61.5 AR NPHP Nephronophthise Typ Q61.5 AR NPHP Nephronophthise Typ 5 - Q61.5 AR IQCB Nephronophthise Typ 6 - Q61.5 AR CEP Nephronophthise Typ Q61.5 AR GLIS Nephronophthise Typ 8 - Q61.5 AR RPGRIP1L Nephronophthise Typ Q61.5 AR NEK Nephronophthise Typ 10 - Q61.5 AR SDCCAG Nephronophthise Typ Q61.5 AR TMEM Nephronophthise Typ Q61.5 AR TTC21B Nephronophthise Typ Q61.5 AR WDR Nephronophthise Typ Q61.5 AR ZNF Nephronophthise Typ Q61.5 AR CEP Nephronophthise Typ Q61.5 AR ANKS Nephronophthise Typ 17 - Q61.5 AR IFT Nephronophthise Typ Q61.5 AR CEP Nephronophthise-ähnliche Nephropathie Typ Q61.5 AR XPNPEP Nephronophthise Typ Q61.5 AR DCDC Nephronophthise Typ Q61.5 AR MAPKBP * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 154

155 13.4 Nephrotisches Syndrom (NS)/Fokal segmentale Glomerulosklerose (FSGS) Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Das nephrotische Syndrom (NS) beruht auf einer Dysfunktion des glomerulären Filters der Nieren, wodurch es zum exzessiven Verlust von Plasmaproteinen mit großer Proteinurie und Hypalbuminämie kommt. Zusätzlich können Ödeme und eine sekundäre Hyperlipidämie auftreten. Bei 58% der Patienten mit einem steroidresistenten NS zeigt sich ein rascher Verlust der Nierenfunktion bis hin zum Nierenversagen. Entsprechend den verschiedenen Erkrankungsursachen lässt sich das idiopathische (primäre) NS von symptomatischen (sekundären) Formen im Rahmen anderer Grunderkrankungen (immunologische Systemerkrankungen, metabolische Erkrankungen, chronische Infektionen, Intoxikationen) und vom kongenitalen NS abgrenzen. In den vergangenen Jahren wurden im Zusammenhang mit dem NS Mutationen in verschiedensten Genen identifiziert, die in den Podozyten exprimiert werden. Retrospektive Studien an Patienten mit genetisch und nicht-genetisch bedingtem steroid-resistenten nephrotischen Syndrom bzgl. dem Ansprechen auf eine intensivierte Immunsuppression mit Cyclosporin A belegen, dass Betroffene mit genetisch bedingter Erkrankung nicht durch eine intensivierte Immunsuppression in (Voll-) Remission zu bringen sind. Humangenetik Literatur Bullich et al, Eur J Hum Genet 23:1192 (2015) / Sadowski et al, J Am Soc Nephrol 26:1279 ( 2015) / Lovric et al,, Clin J Am Soc Nephrol 9:1109 (2014) / Vivante et al,, Pediatr Nephrol 29:695 (2014) / Büscher et al, Clin J Am Soc Nephrol 5:2075 (2010) Nephrotisches Syndrom (NS) / Fokal segmentale Glomerulosklerose (FSGS) ACTN4, CD2AP, INF2, NPHS1, NPHS2, PLCE1, TRPC6, WT1 24,5 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ACTN4, CD2AP, INF2, NPHS1, NPHS2, PLCE1, TRPC6, WT1 ADCK4, ANLN, APOL1, ARHGAP24, ARHG- DIA, CFH, COL4A3, COL4A4, COL4A5, COQ2, COQ6, CRB2, CUBN, DGKE, EMP2, GLA, ITGA3, ITGB4, KANK1, KANK2, KANK4, LAMB2, LMX1B, MYH9, MYO1E, NEIL1, PAX2, PDSS2, PTPRO, SCARB2, SMAR- CAL1 118,6 kb 155

156 Erkrankungen, OMIM, ICD-10, Gene bei Nephrotischem Syndrom (NS)/ Fokal segmentaler Glomerulosklerose (FSGS) Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Coenzyme Q10 Defizienz N04.9 AR COQ6* Fokal segmentale Glomerulosklerose Phänotyp - N COL4A3*, ** Fokal segmentale Glomerulosklerose Phänotyp - N COL4A4*, ** Fokal segmentale Glomerulosklerose Phänotyp - N COL4A5*, ** Fokal segmentale Glomerulosklerose Phänotyp - N ITGB Fokal segmentale Glomerulosklerose Phänotyp - N MYH9*, ** Fokal segmentale Glomerulosklerose Typ N04.9 AD ACTN4* Fokal segmentale Glomerulosklerose Typ N04.9 AD TRPC6* Fokal segmentale Glomerulosklerose Typ N04.9 AD CD2AP* Fokal segmentale Glomerulosklerose Typ N04.9 AD APOL Fokal segmentale Glomerulosklerose Typ N04.9 AD INF2* Fokal segmentale Glomerulosklerose Typ N04.9 AR MYO1E Fokal segmentale Glomerulosklerose Typ N04.9 AD PAX Fokal segmentale Glomerulosklerose Typ N04.9 AD ANLN Fokal segmentale Glomerulosklerose Typ N04.9 AR CRB Interstitial lung disease, nephrotic syndrome, N04.9 AR ITGA and epidermolysis bullosa, congenital Morbus Fabry, renale Variante - N04.9 XL GLA*, ** Nephrotisches Syndrom - N04.9 AR CFH Nephrotisches Syndrom - N04.9 AR COQ Nephrotisches Syndrom - N04.9 AR CUBN Nephrotisches Syndrom - N KANK Nephrotisches Syndrom - N KANK Nephrotisches Syndrom - N KANK Nephrotisches Syndrom - N04.9 AR NEIL Nephrotisches Syndrom - N04.9 AR PDSS Nephrotisches Syndrom - N04.9 AR SCARB Nephrotisches Syndrom - N04.9 AR SMARCAL Nephrotisches Syndrom Typ N04.9 AR NPHS1* Nephrotisches Syndrom Typ N04.9 AR NPHS2* Nephrotisches Syndrom Typ N04.9 AR PLCE1* Nephrotisches Syndrom Typ N04.9 AD WT1*, ** Nephrotisches Syndrom Typ N04.9 AR LAMB2* Nephrotisches Syndrom Typ N04.9 AR PTPRO Nephrotisches Syndrom Typ N04.9 AR DGKE Nephrotisches Syndrom Typ N04.9 AR ARHGDIA Nephrotisches Syndrom Typ N04.9 AR ADCK Nephrotisches Syndrom Typ N04.9 AR EMP Nephrotisches Syndrom, Fokal segmentale Glomerulosklerose - N04.9 AR LMX1B Phänotyp Nephrotisches Syndrom, FSGS - N04.9 AD ARHGAP * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 156

157 13.5 Nierenerkrankungen, polyzystische Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Die polyzystischen Nierenerkrankungen (polycystic kidney disease, PKD) sind charakterisiert durch die progrediente Entwicklung flüssigkeitsgefüllter Zysten in allen Bereichen der Nephrone und Sammelrohre und die beiseitige Ausbildung vergrößerter, polyzystischer Nieren. Man unterscheidet die autosomal-dominante Form (ADPKD) von der autosomal-rezessiven Form der polyzystischen Nierenerkrankung (ARPKD). Während die ADPKD mit einer Lebenserwartung bis ins hohe Erwachsenenalter einhergeht, besteht bei Betroffenen mit einer ARPKD in der Regel eine verkürzte Lebenserwartung mit Auftreten multipler Nierenzysten oft bereits pränatal, in der Regel jedoch spätestens in den ersten Lebensjahren. Bei der ADPKD handelt es sich um bilateral auftretende unterschiedlich große Zysten, während bei der ARPKD bilaterale, multiple, gleichmäßig kleine Zysten charakteristisch sind. Die ARPKD hat eine Inzidenz von ca. 1: Molekulare Ursache sind Mutationen im PKHD1-Gen. Bei der ADPKD handelt es sich um die häufigste Form der polyzystischen Nierenerkrankungen. Gemäß EMA (European Medicines Agency) gilt sie innerhalb Europas als seltene Erkrankung, die mit einer Prävalenz von etwa 1:2500 auftritt. Sie kann bereits im Kindesalter mit Hämaturie, Bluthochdruck und Infektion der Nierenzysten beginnen. Zwischen dem 30. und dem 70. Lebensjahr tritt meist eine Niereninsuffizienz auf, die bei 50% der Patienten bis zum 60. Lebensjahr zum Nierenversagen führt. 95% der Patienten haben eine positive Familienanamnese. Molekulare Ursache sind Mutationen im PKD1- (85% der Fälle) und im PKD2-Gen (15% der Fälle). Bei PKD1-Mutationsträgern manifestiert sich die Erkrankung früher, und auch Nierenversagen tritt im Schnitt 20 Jahre früher auf als bei PKD2-Mutationsträgern (Genotyp-Phänotyp-Korrelation). Das PKD1- Gen umfasst 46 Exons, wobei der Bereich von Exon 1-32 weiter proximal auf Chromosom 16 in sechs duplizierten Kopien als Pseudogen vorkommt. Das PKD2-Gen umfasst 15 Exons. Die bisher identifizierten Punktmutationen in beiden Genen beinhalten alle Mutationstypen und sind über alle Exons verteilt. Genomische Deletionen sind bei ADPKD mit 4% für PKD1 und weniger als 1% für PKD2 relativ selten. Eine Ausnahme ist das TSC2/PKD1 Contiguous Gene Syndrome, bei dem große genomische Deletionen das PKD1-Gen sowie das daran angrenzende TSC2-Gen umfassen. Diese Patienten weisen allerdings klinische Symptome einer Tuberösen Sklerose mit der frühen Manifestation von Nierenzysten auf. Diese Mikrodeletionen können mittels FISH-Diagnostik erfasst werden. Die Sensitivität der Mutationsanalyse für PKD1 und PKD2 liegt bei Patienten, bei denen die klinischen Kriterien für ADPKD erfüllt sind, bei 75-90%. Die Genprodukte (Polycystin-1 und -2) sind transmembrane Glykoproteine der primären Zilien der Nierenepithelzellen, die über ihre zytoplasmatischen C-Termini miteinander interagieren. Somit gehören die polyzystischen Nierenerkrankungen zu den Ziliopathien. Der Polycystin1/Polycystin-2-Komplex ist über verschiedene Signaltransduktions-Kaskaden an Proliferation, Apoptose, Differenzierung, sowie der Regulation von Zellform und Durchmesser der Nierentubuli beteiligt. Die Entwicklung der Zysten folgt dem 2-Treffer-Modell, wonach zu der Keimbahnmutation in einem der beiden Gene ein zweites, somatisches Mutationsereignis im gleichen oder dem anderen PKD-Gen (Transheterozygotie) die Tumorsuppressorfunktion beider Proteine inaktiviert (Loss of Heterozygosity, LOH). Literatur Hoefele et al, Nephrol Dial Transplant 26:2181 (2011) / Harris et al, Nat Rev Nephrol 6:197 (2010) / Harris et al, Annu Rev Med 60:321 (2009) / Tan et al, Hum Mutat 30:264 (2009) / Consugar et al, Kidney Int 74:1468 (2008) / Kozlowski et al, Genomics 91:203 (2007) / Garcia-Gonzalez et al, Mol Genet Metab 92:160 (2007) / Rosetti et al, J Am Soc Nephrol 18:2143 (2007) / Klein et al, Dade Behring News (2006) / Boucher et al, Eur J Hum Genet 12: 347 (2004) / Wilson, N Engl J Med 350: 151 (2004) / Phakdeekitcharoen et al, J Am Soc Nephrol 12: 955 (2001) / Rosetti et al, Am J Hum Genet 68: 46 (2001) / Brook-Carter et al, Nature Genet 8: 328 (1994) Humangenetik 157

158 Polyzystische Nierenerkrankung 1 - autosomal-dominant PKD1, PKD2 15,8 kb Erweiterte Diagnostik Polyzystische Nierenerkrankung 2 - autosomal-dominant BMP4, HNF1B, PAX2, 4,1 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. BMP4, HNF1B, PAX2, PKD1, PKD2 BICC1, CHD1L, FRAS1, MUC1, OFD1, PKHD1, ROBO2, SIX2, UMOD 60,7 kb Polyzystische Nierenerkrankung 1 - autosomal-rezessiv PKHD1 12,2 kb Erweiterte Diagnostik Polyzystische Nierenerkrankung 2 - autosomal-rezessiv FRAS1 12,0 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. FRAS1, PKHD1 BICC1, BMP4, CHD1L, HNF1B, MUC1, OFD1, PAX2, PKD1, PKD2, ROBO2, SIX2, UMOD 60,7 kb 158

159 Erkrankungen, OMIM, ICD-10, Gene bei polyzystischen Nierenerkrankungen, autosomal-rezessiv Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Autosomal-dominante polyzystische Nierenerkrankung Q61.2 AD PKD1*, ** (ADPKD) Autosomal-dominante polyzystische Nierenerkrankung Q61.2 AD PKD2*, ** (ADPKD) Autosomal-rezessive polyzystische Nieren- und Q61.1 AR PKHD Lebererkrankung (ARPKD) Multizystisch-dysplastische Nierenerkrankung - Q63.9 AD BMP Multizystisch-dysplastische Nierenerkrankung - Q63.9 AD CHD1L Multizystisch-dysplastische Nierenerkrankung Q63.9 AD ROBO Medullär-zystische Nierenerkrankung Type Q63.9 AD MUC Polyzystische Nieren Phänotyp - Q60.4 AD PAX Polyzystische Nieren Phänotyp / CAKUT - Q63.9 AD SIX Polyzystische Nieren Phänotyp / Q63.9 AR FRAS Fraser Syndrom Polyzystische Nieren Phänotyp / Q04.3 XL OFD Oro-fazio-digitales Syndrom Typ 1 & 7 Renal cysts and diabetes Syndrom (RCAD) Q61.8 AD HNF1B*, ** Renal-zystische Dysplasie, Suszeptibilität Q63.8 AD BICC Medullär-zystische Nierenerkrankung Typ Q63.9 AD UMOD* * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt Humangenetik 13.6 Hyperoxalurie Hyperoxalurie AGXT, GRHPR, HOGA1 3,1 kb Erkrankungen, OMIM, ICD-10, Gene bei Hyperoxalurie Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Hyperoxalurie, primär, Typ 1 (HP1) E74.8 AR AGXT*,** Hyperoxalurie, primär, Typ 2 (HP2) E74.8 AR GRHPR** Hyperoxalurie, primär, Typ 3 (HP3) E74.8 AR HOGA * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 159

160 14. Pankreatitis, hereditäre Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Die Pankreatitis wird generell in akute und chronische Formen eingeteilt. Chronische Pankreatitis beschreibt ein komplexes, hochvariables und kontinuierliches Entzündungssyndrom, definiert durch anfänglich repetitive Episoden akuter Pankreatitis, die sich im weiteren Verlauf zu einer chronischen Pankreasentzündung entwickeln können. Eine progressive Fibrose des Pankreasparenchyms, Parenchymverkalkungen und Pankreasgangkonkremente führen letztendlich zur irreversiblen Zerstörung des Organs aufgrund des Versagens exokriner und endokriner Funktionen. Das Risiko für die Entstehung eines duktalen Adenokarzinoms der Bauchspeicheldrüse ist stark erhöht. Klinische Anzeichen sind u.a. wiederholte Attacken abdominaler Schmerzen mit erhöhten Serumwerten der Pankreasenzyme, typische Pankreasschmerzen, Steatorrhoe und Diabetes mellitus. Die Inzidenz der chronischen Pankreatitis wird in industrialisierten Ländern auf 3,5 bis 10: geschätzt, wobei die Hauptursache chronischem Alkoholabusus zugeschrieben wird. Als weitere Risikofaktoren sind u.a. genetische Veränderungen, Hypertriglyzeridämie, Autoimmunität und Hyperkalzämie zu nennen. Bei dem Versuch, die Erkrankung in verschiedene klinische Entitäten einzuordnen, werden in der Literatur u.a. Begriffe wie hereditäre, idiopathische, familiäre und sporadische Pankreatitis verwendet. Eine einheitliche, allgemeingültige Definition gibt es bisher nicht, insbesondere wird der Terminus hereditäre Pankreatitis in unterschiedlichen Zusammenhängen verwendet. Nach heutigem Kenntnisstand sind Veränderungen in den Genen PRSS1 (kationisches Trypsinogen), SPINK1 (Serinproteaseinhibitor Kazal Typ I), CFTR (cystic fibrosis transmembrane conductance regulator) und CTRC (Chymotrypsin C) unterschiedlich stark an der Entstehung und Penetranz einer chronischen Pankreatitis ursächlich oder prädisponierend beteiligt. Neueren Studien zufolge konnten bei dieser Patientengruppe auch Mutationen im CPA1-Gen gefunden werden. Diverse Erbgänge, auch ein sog. digenischer Vererbungsmodus (Transheterozygotie) werden beobachtet, d.h. Mutationen in zwei der o.g. Gene liegen gemeinsam vor. Bei ca. 49% der der Patienten mit chronischer Pankreatitis können Mutationen in den o.g. Genen nachgewiesen werden. Die Stufendiagnostik erfolgt nach Häufigkeit beschriebener Mutationen. Literatur Witt, Dig Dis 28: (2010) / Chen et al, Annu Rev Genomics Hum. Genet. 10:3.1 (2009) / Keim, World J Gastroenterol. 14:1011 (2008) / Teich et al, Hum Mutat 27:721 (2006) / Audrezet et al, Europ J Hum Genet 10:100 (2002) / Le Marechal et al, BMC Genetics 2:19 (2001) / Witt et al, Nat Genet 25:213 (2000) / Keim et al, Dt Ärzteblatt 95; 40:2473 (1998) / Gorry et al, Gastroenterology 113:1063 (1997) # Pankreatitis, hereditäre CASR, CFTR, CPA1, CTRC, PRSS1, SPINK1 10,7 kb Erkrankungen, OMIM, ICD-10, Gene bei hereditärer Pankreatitis Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Pankreatitis, chronisch K86.10 CASR Pankreatitis, chronisch K86.9 CFTR*,** Pankreatitis, chronisch K86.9 CPA1* Pankreatitis, chronisch K86.9 CTRC* Pankreatitis, chronisch K86.9 PRSS1*,** Pankreatitis, chronisch K86.9 SPINK1*,** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 160

161 15. RASopathien Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Als RASopathien wird eine klinisch und genetisch heterogene Gruppe von Erkrankungen bezeichnet, die durch Keimbahnmutationen in Genen, die für Proteine des RAS/Mitogen-aktivierten Proteinkinase-Signalwegs codieren, verursacht werden. Die klinischen Symptome betreffen mehrere Organsysteme (Integument, kardiovaskuläres System, Skelett, Muskulatur, Gastrointestinaltrakt, ZNS, Auge). Bei einigen Syndromen liegen charakteristische kraniofaziale Merkmale vor, bei einigen besteht ein erhöhtes Tumorrisiko. Klinisch gibt es starke Überlappungen zwischen den einzelnen Krankheitsbildern, die eine sichere klinische Diagnose und damit eine gezielte Diagnostik erschweren können. Da zudem mehrere dieser Erkrankungen durch Mutationen in verschiedenen Genen bzw. im gleichen Gen des RAS/MAPK-Signalwegs verursacht sein können, kann zur Abklärung eine Stufendiagnostik unter Einsatz des Next Generation Sequencing (NGS) sinnvoll sein. Humangenetik Schematische Darstellung der phänotypischen und genetischen Heterogenität bei RASopathien. Die einzelnen Subpanels sind farblich voneinander abgegrenzt, Core Genes sind fett gedruckt. NFNS: Neurofibromatose-Noonan-Syndrom NF1: Neurofibromatose Typ 1 CFC: Cardio-Fazio-Cutanes-Syndrom NSLL: Noonan-Syndrom-ähnliche Erkrankung mit oder ohne juvenile myelomonozytäre Leukämie NSLAH: Noonan-Syndrom-ähnliche Erkrankung mit losem Anagenhaar Die Untersuchung der RASopathien erfolgt stufenweise, wie unten aufgeführt: Noonan-Syndrom Stufe I EBM Kapitel Mutationssuche PTPN11 Kapitel Kapitel Noonan-Syndrom Stufe II EBM Kapitel Mutationssuche BRAF, CBL, KRAS, LZTR1, MAP2K1, MAP2K2, NRAS, PPP1CB, RAF1, RASA2, RIT1, RRAS, SHOC2, SOS1, SOS2 161

162 # RASopathien HRAS, NF1, SPRED1 10,4 kb Erkrankungen, OMIM, ICD-10, Gene bei RASopathien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Cardio-Fazio-Cutanes-Syndrom (CFC) Typ Q87 AD BRAF* Cardio-Fazio-Cutanes-Syndrom (CFC) Typ Q87 AD KRAS* Cardio-Fazio-Cutanes-Syndrom (CFC) Typ Q87 AD MAP2K1* Cardio-Fazio-Cutanes-Syndrom (CFC) Typ Q87 AD MAP2K2* Costello-Syndrom L81.9 AD HRAS* Legius syndrom Q85.9 AD SPRED1*, ** LEOPARD-Syndrom Typ L81.9 AD PTPN11* LEOPARD-Syndrom Typ L81.9 AD RAF1* LEOPARD-Syndrom Typ L81.9 AD BRAF* Neurofibromatose-Noonan-Syndrom (NFNS) L81.9 AD NF1*, ** Neurofibromatose-Noonan-Syndrom (NFNS) L81.9 AD PTPN11* Noonan-Syndrom - Q87 AD CBL* Noonan-Syndrom - Q87.1 AD RASA2* Noonan-Syndrom - Q87.1 AD RRAS* Noonan-Syndrom Q87 AD SHOC2* Noonan-Syndrom - Q87.1 AD PPP1CB* Noonan-Syndrom - Q87 AD MAP2K1* Noonan-Syndrom - Q87.1 AD NF1*, ** Noonan-Syndrom Typ Q87.1 AD PTPN11* Noonan-Syndrom Typ Q87.1 AD KRAS* Noonan-Syndrom Typ Q87.1 AD SOS1* Noonan-Syndrom Typ Q87.1 AD RAF1* Noonan-Syndrom Typ Q87.1 AD NRAS* Noonan-Syndrom Typ Q87.1 AD BRAF* Noonan-Syndrom Typ Q87.1 AD RIT1* Noonan-Syndrom Typ Q87.2 AD SOS2* Noonan-Syndrom Typ Q LZTR * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 15.1 Cardio-Fazio-Cutanes-Syndrom (CFC) Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh In der Literatur wurden bisher ca. 100 Patienten mit CFC beschrieben. Es wird davon ausgegangen, dass es weltweit 200 bis 300 Betroffene gibt, wobei die Erkrankung unterdiagnostiziert ist. Bei dieser zum Formenkreis der RASopathien gehörenden Erkrankung ist eine differenzialdiagnostische Abgrenzung zu den anderen Syndromen aus dem Spektrum im Säuglings- und Kleinkindalter aufgrund der phänotypischen Ähnlichkeit schwierig. Die Bestätigung der Diagnose erfolgt meist auf molekulargenetischer Ebene. Charakteristika wie Gedeihstörung, Entwicklungs- und Wachstumsverzögerung, Gesichtsdysmorphien (Lidachsenverlauf nach außen unten, Hypertelorismus, hohe Stirn), Pigmentveränderungen, Anomalien des Gastrointestinaltraktes und des zentralen Nervensystems, Herzfehler, Thoraxdeformitäten können einher- 162

163 gehen mit ektodermaler Beteiligung in Form von dünnem Haar und Nagelhypoplasien. Im Erwachsenenalter zeigt sich eine trockene, hyperkeratotische Haut mit zusätzlicher palmoplantarer Hyperkeratose. Eine erhöhte Prädisposition für maligne Erkrankungen wurde bisher nicht beobachtet. Das CFC ist genetisch heterogen. Die vier Gene BRAF, KRAS, MAP2K1 und MAP2K2 können das CFC verursachen. Literatur Roberts et al, The Lancet 381:333 (2013) / Rodriguez-Viciana et al, Science 311:1287 (2006) / Niihori et al, Nat Genet 38:294 (2006) / Tartaglia et al, Clin Genet 63:423 (2003) Cardio-Fazio-Cutanes-Syndrom Mutationssuche bis 25 kb BRAF, KRAS, MAP2K1, MAP2K2 5,2 kb Humangenetik Erkrankungen, OMIM, ICD-10, Gene bei Cardio-Fazio-Cutanem-Syndrom Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Diag. Sensivität Cardio-Fazio-Cutanes-Syndrom Q87 AD BRAF* % (CFC) Typ 1 Cardio-Fazio-Cutanes-Syndrom Q87 AD KRAS* % (CFC) Typ 2 Cardio-Fazio-Cutanes-Syndrom Q87 AD MAP2K1* % (CFC) Typ 3 Cardio-Fazio-Cutanes-Syndrom Q87 AD MAP2K2* % (CFC) Typ 4 * auch einzeln anforderbar Core Genes sind fett gedruckt 15.2 Costello-Syndrom Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Das zum Formenkreis der RASopathien zählende Costello-Syndrom ist eine sehr seltene Erkrankung mit einer geschätzten Inzidenz von 1: (Vereinigtes Königreich) oder 1: (in Japan). Der Erbgang ist autosomal-dominant. Für RASopathien typische Symptome wie pränatales Nackenödem, postnatal faziale Dysmorphien, Kleinwuchs, milde bis moderate mentale Retardierung und Herzfehler sind hier ebenfalls beschrieben. Als ein Hauptmerkmal fallen perinasal und/oder perinanal benigne kutane Papillome auf. Charakteristisch ist weiterhin die zunehmende Pigmentierung der Haut. Bei 90% der Betroffenen fällt pränatal im Ultraschall ein schweres Polyhydramnion oder Nackenödem auf. Perinatal sind Ödeme maßgeblich verantwortlich für ein anfänglich hohes Geburtsgewicht, gefolgt von einer schweren Gedeihstörung aufgrund erheblicher Ernährungsprobleme. Bei den Herzfehlern handelt es sich im Wesentlichen um Hypertrophe Kardiomyopathie (HCM) und Artiumseptumdefekte in Verbindung mit Arrythmien. Das Risiko für die Entwicklung solider Tumore (hauptsächlich Rhabdomyosarkom) in der Kindheit oder im frühen Erwachsenenalter ist auf etwa 15% erhöht. Das einzige für Costello-Syndrom ursächliche Gen ist das HRAS-Gen % der Mutationen betreffen die Aminosäure Glycin an Position 12 in Exon 2 des Proteins GTPase HRas, vereinzelt sind auch andere Mutationen des HRAS-Gens beschrieben. Literatur Abe IL: International Meeting on Genetic Syndromes of the Ras/MAPK Pathway (2011) / Gripp et al, Am J Med Genet. A 155:2263 (2011) / Tartaglia et Gelb, Mol Syndromol. 1:2 (2010) / Sol-Church et al, Am J Med Genet. A 149A:315 (2009) / Zampino et al, Hum Mut. 28:265 (2007) / Aoki et al, Nat Genet. 37:1038 (2005) 163

164 Costello-Syndrom Mutationssuche bis 25 kb HRAS 0,6 kb 15.3 LEOPARD-Syndrom Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Das LEOPARD-Syndrom oder kardiomyopathische Lentiginose ist eine seltene, autosomal-dominant vererbte Erkrankung, die 1969 erstmals von Gorlin beschrieben wurde. LEOPARD ist ein Akronym für die charakteristischen klinischen Symptome - multiple Lentigines - elektrokardiographische Anomalien - okulärer Hypertelorismus - Pulmonalstenose - abnormes Genitale - Retardierung des Wachstums - Schwerhörigkeit (Deafness) 2002 wurden auch bei LEOPARD-Syndrom wie bereits bei dem teilweise klinisch überlappenden Noonan- Syndrom Mutationen im PTPN11-Gen als molekulare Ursache identifiziert. Bei etwa 90% aller LS-Patienten können Mutationen im PTPN11-Gen nachgewiesen werden, wobei diese ausschließlich zu Aminosäureaustauschen führen. Im Gegensatz zum Noonan-Syndrom kommen hier wiederkehrende spezifische PTPN11-Aminosäureaustausche vor, die zum Verlust der katalytischen Aktivität der Nicht-Rezeptor Protein-Tyrosin-Phosphatase SHP-2 führen. Bei jeweils <5% der LS-Patienten wurden bisher Mutationen in den Proto-Onkogenen RAF1 und BRAF identifiziert. Bei weniger als 5% der Patienten kann bisher keine genetische Ursache nachgewiesen werden, wobei hier Mutationen in weiteren Genen der RAS-ERK-MAP-Kinase Signaltransduktion vermutet werden. Literatur Sarkozy et al, Hum Mutat 30:695 (2009) / Sarkozy et al, Orphanet J Rare Dis 3:13 (2008) / Pandit et al, Nat Genet 39:1007 (2007) / Kontaridis et al, J Biol Chem 281:6785 (2006) / Tartaglia et al, Am J Hum Genet 78:279 (2006) / Sarkozy et al, J Med Genet 41:e68 (2004) / Digilio et al, Am J Hum Genet 71:389 (2002) / Legius et al, J Med Genet 39:571 (2002) / Gorlin et al, Am J Dis Child 117:652 (1969) LEOPARD-Syndrom Mutationssuche bis 25 kb BRAF, PTPN11, RAF1 6,0 kb Erkrankungen, OMIM, ICD-10, Gene bei LEOPARD-Syndrom Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Diag. Sensivität LEOPARD-Syndrom Typ L81.9 AD PTPN11* % LEOPARD-Syndrom Typ L81.9 AD RAF1* < 5% LEOPARD-Syndrom Typ L81.9 AD BRAF* < 5% * auch einzeln anforderbar Core Genes sind fett gedruckt 164

165 15.4 Noonan-Syndrom Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh, Dr. rer. nat. Karin Mayer Beim Noonan-Syndrom handelt es sich um eine autosomal-dominant vererbte Erkrankung, deren Häufigkeit mit 1: Lebendgeburten angegeben wird. Das variable Symptomenspektrum umfasst faziale Dysmorphien (breite Stirn, Hypertelorismus, Ohrentiefstand, Lidachsenverlauf nach außen unten), proportionierten Kleinwuchs, Pterygium colli, Brustdeformationen, Kryptorchidismus, mentale Retardierung, eine leichte Blutungsneigung sowie Herzfehler, meist in Form einer Pulmonalstenose oder einer hypertrophen Kardiomyopathie. Das PTPN11-Gen, das für eine zytoplasmatische Protein-Tyrosin-Phoshatase (SHP-2) codiert, ist das hauptsächlich bei Noonan-Syndrom betroffene Gen. Mutationen im PTPN11-Gen, die fast ausschließlich zu Aminosäureaustauschen führen, sind die molekulare Ursache in etwa 50% aller bisher untersuchten Noonan-Patienten. Bisher wurden Mutationen in zehn weiteren Genen der RAS-ERK-MAP-Kinase-Signaltransduktion bei Noonan-Syndrom identifiziert. In bis zu 15% der Noonan-Patienten, die keine Mutation im PTPN11-Gen aufwiesen, wurden Mutationen im SOS1 (Son of Sevenless)-Gen nachgewiesen. Der klinische Phänotyp von Patienten mit SOS1-Mutationen weist die typischen Charakteristika des Noonan-Syndroms auf, wobei das Längenwachstum und die mentale Entwicklung normal verlaufen und die Herzfehler weniger stark ausgeprägt sind. Bei ca. 8% der Noonan-Patienten konnten Mutationen im RAF1-Gen identifiziert werden, wobei fast alle Patienten mit RAF1-Mutationen eine Hypertrophe Kardiomyopathie aufweisen. In dem vor kurzem entdeckten RIT1-Gen wurden bisher bei ca. 5% der Patienten mit dieser Erkrankung Mutationen entdeckt. Daneben wurden in etwa 3% der Noonan-Patienten Mutationen im KRAS-Gen identifiziert, wobei diese überwiegend zu schwerwiegenden Phänotypen führen. Seltener werden bei Noonan-Syndrom Mutationen in den Genen MEK1 und BRAF identifiziert, wobei diese Gene häufiger bei Patienten mit Cardio-Facio-Cutanem (CFC) Syndrom verändert sind. MEK1-Mutationen wurden bisher bei weniger als 4% der untersuchten Patienten mit Noonan-Syndrom beschrieben. Die Häufigkeit von Mutationen im BRAF-Gen bei Noonan-Syndrom wird auf 2% geschätzt. Hier weisen die beschriebenen Patienten neonatale Wachstumsverzögerung, leichte kognitive Defizite und Muskelhypotonie auf. Noch seltener sind mit 1% Mutationen im NRAS-Gen und im CBL-Gen. Aktuell sind zwei neue Gene RASA2 und A2ML1 mit Hilfe der NGS-Methode identifiziert worden, wobei die bisher ermittelten Daten darauf hinweisen, dass A2ML1-Mutationen eher zu einem milderen Phänotyp führen. Mutationen dieser o.g. Gene und der Gene MEK2, SHOC2, HRAS und NF1 finden sich u.a. auch bei Patienten mit dem Noonan-Syndrom ähnlichen Erkrankungen, wie z.b. CFC-, LEOPARD-, Noonan-Syndrom mit juveniler myelomonozytärer Leukämie (JMML), Neurofibromatose-Noonan-Syndrom u.a. Mutationen im NF1- Gen wurden auch bei NS-Patienten, die die klinischen Kriterien einer klassischen Neurofibromatose (NF) nicht erfüllen, nachgewiesen. Bei etwa 25% aller Patienten mit klinisch diagnostiziertem Noonan-Syndrom kann in den genannten Genen keine Mutation nachgewiesen werden. Humangenetik Literatur Chen et al, PNAS 111:11473 ( 2014) / Vissers et al, Eur J Hum Genet doi: /ejhg ( 2014) / Aoki et al, Am J Hum Genet, 93: (2013) / Tartaglia et al, Best Pract Res Clin Endocrinol Metab 25:161 (2011) / Tartaglia et al, Mol Syndromol 1:2 (2010) / Cirstea et al, Nat Genet 42:27 (2010) / Sarkozy et al, Hum Mutat 30:695 (2009) / Nava et al, J Med Genet 44:763 (2007) / Razzaque et al, Nat Genet 39:1013 (2007) / Roberts et al, Nat Genet 39 (2007) / Carta et al, Am J Hum Genet 79: 129 (2006) / Schubbert et al, Nature Genet 38: 331 (2006) / Noonan, Am J Dis Child 116:373 (1968) Noonan-Syndrom Stufe I EBM Kapitel Mutationssuche PTPN11 Kapitel

166 Kapitel Noonan-Syndrom Stufe II EBM Kapitel Mutationssuche BRAF, CBL, KRAS, LZTR1, MAP2K1, MAP2K2, NRAS, PPP1CB, RAF1, RASA2, RIT1, RRAS, SHOC2, SOS1, SOS2 Erkrankungen, OMIM, ICD-10, Gene bei Noonan-Syndrom Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Cardio-Fazio-Cutanes-Syndrom (CFC) Typ Q87 AD MAP2K2* Noonan-Syndrom - Q87 AD CBL* Noonan-Syndrom - Q87 AD MAP2K1* Noonan-Syndrom - Q87.1 AD NF1*, ** Noonan-Syndrom - Q87.1 AD RASA2* Noonan-Syndrom - Q87.1 AD RRAS* Noonan-Syndrom - Q87 AD SHOC2* Noonan-Syndrom - Q87.2 AD SOS2* Noonan-Syndrom - Q87.1 AD PPP1CB* Noonan-Syndrom Q87.1 AD LZTR Noonan-Syndrom Typ Q87.1 AD PTPN11* Noonan-Syndrom Typ Q87.1 AD KRAS* Noonan-Syndrom Typ Q87.1 AD SOS1* Noonan-Syndrom Typ Q87.1 AD RAF1* Noonan-Syndrom Typ Q87.1 AD NRAS* Noonan-Syndrom Typ Q87.1 AD BRAF* Noonan-Syndrom Typ Q87.1 AD RIT1* * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 166

167 16. Schwerhörigkeit/Taubheit Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Bilateraler permanenter sensorineuraler Hörverlust, mit einer Inzidenz von 1:500 Neugeborenen, stellt eine der häufigsten angeborenen Störungen dar. Bei Erwachsenen wächst die Prävalenz auf 3,5:1.000 an. Der Anteil genetisch bedingter, sensorineuraler Taubheit beträgt ca %. Nur ein kleiner Prozentsatz der prälingualen Taubheit ist syndromal oder wird autosomal-dominant oder mitochondrial vererbt. Mehr als 70% genetisch bedingter Taubheit ist nicht-syndromal, ca. 80% der nicht-syndromalen, genetisch bedingten Taubheit folgt einem autosomal-rezessiven Erbgang. Mit der Untersuchung der Gene GJB2 und GJB6 können ca. 50% der Fälle mit autosomal-rezessiver, nicht-syndromaler, sensorineuraler Taubheit aufgeklärt werden. Aufgrund der klinischen und genetischen Heterogenität angeborener Hörstörungen kann eine Stufendiagnostik unter Einsatz von NGS mit zusätzlicher Analyse von rund 100 Genen, einschließlich mitochondrial codierter, sinnvoll sein. Bei der Anforderung dieser Panels sind Stammbauminformationen und die Angabe umfassender klinischer Daten dringend notwendig, um die Interpretationssicherheit zu erhöhen. Literatur Vona et al, Mol Cell Probes (2015) / Mani et al, Europ J of Hum Genet 17:502 (2009) / Petersen et al, Clin Genet 69:371 (2006) / Snoeckx et al, Am J Hum Genet 77:945 (2005) / Cryns et al, J Med Genet 41:147 (2004) / Pallares-Ruiz et al, Eur J Hum Genet 10:72 (2002) / Rabionet et al, Hum Genet 106:40 (2000) / Murgia et al, J Med Genet 36:829 (1999) / Lench et al, Lancet 351:415 (1998) Humangenetik Taubheit Individuell konfigurierbare MGPS Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ABHD12 (1,2 kb) * ABHD12 (1.2 kb) * ACTG1 (1.1 kb) * ADCY1 (3.4 kb) * ADGRV1 (18.9 kb) * BDP1 (7.9 kb) * BSND (1.0 kb) * CABP2 (0.7 kb) * CCDC50 (1.4 kb) * CDC14A (1.9 kb) * CDH23 (10.1 kb) * CEACAM16 (1.3 kb) * CIB2 (0.6 kb) * CLDN14 (0.7 kb) * CLIC5 (1.2 kb) * CLPP (0.8 kb) * CLRN1 (0.7 kb) * COCH (1.6 kb) * COL11A2 (5.2 kb) * COL4A6 (5.1 kb) * CRYM (0.9 kb) * DCDC2 (1.4 kb) * DFNA5 (1.5 kb) * DFNB59 (1.1 kb) * DIABLO (0.7 kb) * DIAPH1 (3.8 kb) * DIAPH3 (3.6 kb) * DSPP (3.9 kb) * ELMOD3 (1.1 kb) * EPS8 (2.5 kb) * EPS8L2 (2.1 kb) * ESPN (2.6 kb) * ESRRB (1.5 kb) * EYA1 (1.8 kb) * EYA4 (1.9 kb) * FAM65B (3.2 kb) * FOXI1 (1.1 kb) * GIPC3 (0.9 kb) * GJB2 (0.7 kb) * GJB3 (0.8 kb) * GJB6 (0.8 kb) * GPSM2 (2.1 kb) * GRHL2 (1.9 kb) * GRXCR1 (0.9 kb) * GRXCR2 (0.7 kb) * HARS (1.5 kb) * HGF (2.2 kb) * HOMER2 (1.1 kb) * ILDR1 (1.6 kb) * KARS (1.9 kb) * KCNE1 (0.4 kb) * KCNJ10 (1.1 kb) * KCNQ1 (2.0 kb) * KCNQ4 (2.1 kb) * LHFPL5 (0.7 kb) * LOXHD1 (6.6 kb) * LRTOMT (0.9 kb) * MARVELD2 (1.7 kb) * MET (4.2 kb) * MSRB3 (0.6 kb) * MYH14 (6.1 kb) * MYH9 (5.9 kb) * MYO15A (10.6 kb) * MYO3A (4.8 kb) * MYO6 (3.9 kb) * MYO7A (6.6 kb) * NARS2 (1.4 kb) * OSBPL2 (1.4 kb) * OTOA (3.4 kb) * OTOF (6.0 kb) * OTOG (8.8 kb) * OTOGL (7.0 kb) * P2RX2 (1.5 kb) * PCDH15 (5.9 kb) * PDZD7 (3.1 kb) * PNPT1 (2.3 kb) * POU3F4 (1.1 kb) * POU4F3 (1.0 kb) * PRPS1 (1.0 kb) * PTPRQ (6.4 kb) * RDX (1.8 kb) * S1PR2 (1.1 kb) * SERPINB6 (1.2 kb) * SIX1 (0.9 kb) * SIX5 (2.2 kb) * SLC17A8 (1.8 kb) * SLC26A4 (2.3 kb) * SLC26A5 (2.2 kb) * SLITRK6 (2.5 kb) * SMPX (0.3 kb) * STRC (5.3 kb) * SYNE4 (1.2 kb) * TBC1D24 (1.7 kb) * TECTA (6.5 kb) * TJP2 (3.7 kb) * TMC1 (2.3 kb) * TMEM132E (3.2 kb) * TMIE (0.5 kb) * TMPRSS3 (1.4 kb) * TNC (6.6 kb) * TPRN (2.1 kb) * TRIOBP (7.1 kb) * TSPEAR (2.0 kb) * USH1C (2.7 kb) * USH1G (1.4 kb) * USH2A (15.6 kb) * WFS1 (2.7 kb) * WHRN (2.7 kb) 167

168 Erkrankungen, OMIM, ICD-10, Gene bei Schwerhörigkeit/Taubheit Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen?Taubheit, autosomal-dominant H91.9 AD HOMER ?Taubheit, autosomal-rezessiv H91.9 AR MET Auditorische Neuropathie H91.9 AD DIAPH autosomal-rezessiv digenische Vererbung mit H91.9 AR GJB3*, ** GJB2-Gen s , auch DFNA2B; auch Schwerhörigkeit mit periferer Neuropathie AD) Bartter Syndrom, Typ 4A H91.9 AR BSND Branchio-oto-renales Syndrom Typ H SIX5* Branchiootisches-Syndrom 1, BOS H91.9 AD EYA1*, ** Chudley-McCullough-Syndrom H91.9 AR GPSM Taubheit, autosomal-recessiv H91.9 AR SYNE DFNA H91.9 AD DIAPH DFNA2A H91.9 AD KCNQ DFNA2B (auch Schwerhörigkeit mit periferer H91.9 AD GJB3*, ** Neuropathie; auch autosomal rezessive digenische Vererbung mit GJB2-Gen s ) DFNA3A (auch DFNB1A, s. autosomal-rezessive H91.9 AD GJB2*, ** Form) *** DFNA3B (auch DFNB1B, s. autosomal-rezessive H91.9 AD GJB6*, ** Formen; auch digenische Vererbung mit GJB2- Gen s ) *** DFNA4A H91.9 AD MYH DFNA4B H91.9 AD CEACAM DFNA H91.9 AD DFNA DFNA6/14/38 (auch Wolfram-Syndrom, s. syndromale H91.9 AD WFS1** Formen) DFNA H91.9 AD COCH DFNA H91.9 AD EYA DFNA11 (auch Usher-Syndrom Typ 1B, s. syndromale H91.9 AD MYO7A* Formen; auch DFNB2, s. autosomal- rezessive Formen) DFNA12 (DFNA8) (auch DFNB21, s. autosomalrezessive H91.9 AD TECTA Formen) DFNA13 (auch DFNB53, s. autosomal-rezessive H91.9 AD COL11A2* Formen) DFNA H91.9 AD POU4F DFNA17 (auch Makrothrombozytopenie und H91.9 AD MYH9*, ** progressive sensorineurale Taubheit, s. syndromale Formen) DFNA20/ DFNA H91.9 AD ACTG DFNA22 (auch DFNB37, s. autosomal-rezessive H91.9 AD MYO Formen) DFNA23 (auch Brachiootic syndrome 3) H91.9 AD SIX1* DFNA H91.9 AD SLC17A DFNA H91.9 AD GRHL DFNA36 (auch DFNB7, s. autosomal-rezessive Formen) H91.9 AD/AR TMC

169 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen DFNA H91.9 AD DSPP DFNA H91.9 AD CCDC DFNA51 (nur, wenn das Gen dupliziert ist) H91.9 AD TJP2** DFNA H91.9 AD DIABLO DFNB1B (auch DFNA3B s. autosomal-dominante H91.9 AR GJB6*, ** Formen, auch digenische Vererbungen mit GJB2-Gen, s ) DFNB2 (auch Usher-Syndrom Typ 1B, s. syndromale H91.9 AR MYO7A* Formen; auch DFNA11, s. autosomal-do- minante Formen) DFNB H91.9 AR MYO15A DFNB H91.9 AR SLC26A4*, ** DFNB4 mit erweitertem vestibulären Aquädukt H91.9 AR KCNJ (EVA); auch digenisch vererbt mit FOXI1-Gen, s ; auch digenisch vererbt mit SLC26A4) DFNB H91.9 AR TMIE DFNB7 (auch DFNA36, s. autosomal-dominante H91.9 AR TMC Formen) DFNB8 (DFNB10) H91.9 AR TMPRSS DFNB H91.9 AR OTOF DFNB12 (auch Usher-Syndrom Typ 1D s. syndromale H91.9 AR CDH23* Formen) DFNB15 (DFNB72; DFNB95) H91.9 AR GIPC DFNB H91.9 AR STRC* DFNB18 (auch Usher-Syndrom Typ 1C, s. syndromale H91.9 AR USH1C Formen) DFNB21 (auch DFNA12 (DFNA8), s. autosomaldominante H91.9 AR TECTA Formen) DFNB H91.9 AR OTOA DFNB23 (auch Usher-Syndrom Typ 1F, s. syndromale H91.9 AR PCDH15*, ** Formen, auch digenische Vererbung mit CDH23 Gen, s ) DFNB H91.9 AR RDX DFNB H91.9 AR GRXCR DFNB H91.9 AR TRIOBP DFNB H91.9 AR CLDN DFNB H91.9 AR MYO3A DFNB H91.9 AR ESRRB DFNB36 (auch autosomal-dominant) H91.9 AR ESPN DFNB37 (auch DFNA22, s. autosomal-dominante H91.9 AR MYO Formen) DFNB H91.9 AR HGF DFNB H91.9 AR ILDR DFNB48 (auch Usher-Syndrom Typ IJ, s. syndromale H91.9 AR CIB Formen) DFNB H91.9 AR MARVELD DFNB53 (auch DFNA13 s. autosomal-dominante Formen) H91.9 AR COL11A2* Humangenetik 169

170 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen DFNB H91.9 AR DFNB DFNB H91.9 AR SLC26A DFNB H91.9 AR LRTOMT DFNB67 (DFNB66) H91.9 AR LHFPL DFNB H91.9 AR MSRB DFNB H91.9 AR LOXHD DFNB H91.9 AR TPRN DFNB84A H91.9 AR PTPRQ DFNB84B H91.9 AR OTOGL DFNB H91.9 AR SERPINB DFNB94 - H91.9 AR NARS DFNB H91.9 AR TSPEAR DFNB99 - H91.9 AR TMEM132E Früher DFNB82/ H91.9 AR GPSM Jervell-Lange-Nielsen-Syndrom H91.9 AR KCNQ1*, ** Jervell-Lange-Nielsen-Syndrom H91.9 AR KCNE1*, ** Makrothrombozytopenie und progressive H91.9 AD MYH9*, ** sensorineurale Taubheit Pendred-Syndrom (auch DFNB4 mit erweitertem H91.9 AR SLC26A4*, ** vestibulären Aquädukt (EVA); beide auch digenisch vererbt mit FOXI1-Gen, s , auch digenisch vererbt mit KCNJ10-Gen, s ) Perrault-Syndrom H91.9 AR CLPP Polyneuropathie, Gehörverlust, Ataxie, Retinitis H91.9 AR ABHD Pigmentosa und Katarakt Sensorineurale Taubheit mit milder Nierendysfunktion H91.9 AR BSND (ehemals DFNB73) Taubheit und Myopie H91.9 AR SLITRK Taubheit, autosomal-rezessiv H91.9 AR TBC1D Taubheit, autosomal-dominant H91.9 AD TNC Taubheit, autosomal-dominant H91.9 AD OSBPL Taubheit, autosomal-rezessiv 31 (auch Usher H91.9 AR WHRN Syndrom Typ 2D, s. syndromale Formen) Taubheit, autosomal-dominant H91.9 AD CRYM Taubheit, autosomal-dominant H91.9 AD P2RX Taubheit, autosomal-dominant 50, DFNA H91.9 AD MIR Taubheit, autosomal-dominant H91.9 AD TBC1D Taubheit, autosomal-dominant H91.9 AR BDP Taubheit, autosomal-recessiv H91.9 AR ADCY Taubheit, autosomal-rezessiv 1A H91.9 AR GJB2*, ** Taubheit, autosomal-rezessiv 18B H91.9 AR OTOG Taubheit, autosomal-rezessiv H91.9 AR DFNB Taubheit, autosomal-rezessiv H91.9 AR DCDC Taubheit, autosomal-rezessiv H91.9 AR S1PR Taubheit, autosomal-rezessiv H91.9 AR PNPT

171 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Taubheit, autosomal-rezessiv H91.9 AR ELMOD Taubheit, autosomal-rezessiv H91.9 AR CABP Taubheit, autosomal-rezessiv H91.9 AR GRXCR Taubheit, autosomal-rezessiv H91.9 AR EPS Taubheit, autosomal-rezessiv H91.9 AR CLIC Taubheit, autosomal-rezessiv H91.9 AR FAM65B Taubheit, autosomal-rezessiv H91.9 AR KARS Taubheit, autosomal-rezessiv H91.9 AR CDC14A Taubheit, mitochondrial H91.9 mitochondrial COX Taubheit, X-chromosomal H91.9 X-linked PRPS Taubheit, X-chromosomal H91.9 X-linked POU3F4** Taubheit, X-chromosomal H91.9 X-linked SMPX Taubheit, X-chromosomal H91.9 X-linked COL4A Usher-Syndrom Typ 1B (auch DFNB2, s autosomal-rezessive H91.9 AR MYO7A* Formen; auch DFNA11, s. autoso- mal-dominante Formen) Usher-Syndrom Typ 1C H91.9 AR USH1C (auch DFNB18, s. autosomal-rezessive Formen) Usher-Syndrom Typ 1D (auch DFNB12. s. autosomal-rezessive H91.9 AR CDH23* Formen; auch digentische Ver- erbung mit PCDH15-Gen, s ) Usher-Syndrom Typ 1F (auch DFNB23, s. autosomal-rezessive H91.9 AR PCDH15*, ** Formen, auch digenische Ver- erbung mit CDH23-Gen, s ) Usher-Syndrom Typ 1G H91.9 AR USH1G Usher-Syndrom Typ 1J (auch DFNB48 s. autosomal-rezessive H91.9 AR CIB Formen) Usher-Syndrom Typ 2A H91.9 AR USH2A*, ** Usher-Syndrom Typ 2C H91.9 AR ADGRV Usher-Syndrom Typ 2C H91.9 AR PDZD Usher-Syndrom Typ 2D H91.9 AR WHRN Usher-Syndrom Typ 3A H91.9 AR CLRN Usher-Syndrom Typ 3B H91.9 AR HARS Usher-Syndrom Typ IJ H91.9 AR CIB (auch DFNB48 s. autosomal-rezessive Formen) Vergrößerter vestibulärer Aquedukt H91.9 AR FOXI Wolfram-Syndrom H91.9 AR WFS1** Wolfram-ähnliches Syndrom AD H91.9 AD WFS1** H91.9 AD MIR H91.9 AD MIR H91.9 AR EPS8L * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse *** Kapitel Core Genes sind fett gedruckt Humangenetik 171

172 Erkrankungen, OMIM, ICD-10, mitochondriale Gene bei Schwerhörigkeit/Taubheit Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Taubheit, mitochondrial H91.9 mitochondrial MT-COI mitochondrial MT-ATP mitochondrial MT-ATP mitochondrial MT-CO mitochondrial MT-CO mitochondrial MT-CYB mitochondrial MT-ND mitochondrial MT-ND mitochondrial MT-ND mitochondrial MT-ND mitochondrial MT-ND4L mitochondrial MT-ND mitochondrial MT-ND mitochondrial MT-RNR mitochondrial MT-RNR mitochondrial MT-TA mitochondrial MT-TV mitochondrial MT-TD mitochondrial MT-TE mitochondrial MT-TF mitochondrial MT-TG mitochondrial MT-TH mitochondrial MT-TI mitochondrial MT-TK mitochondrial MT-TL mitochondrial MT-L mitochondrial MT-TM mitochondrial MT-TN mitochondrial MT-TP mitochondrial MT-TQ mitochondrial MT-TR mitochondrial MT-TS mitochondrial MT-TS mitochondrial MT-TT mitochondrial MT-TW mitochondrial MT-TY * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse *** Kapitel Core Genes sind fett gedruckt 172

173 16.1 Schwerhörigkeit/Taubheit, autosomal-dominant Schwerhörigkeit/Taubheit autosomal-dominant (AD) ACTG1, COCH, COL11A2, DFNA5, DIAPH1, KCNQ4, MYH14, WFS1 24,1 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ACTG1, COCH, COL11A2, DFNA5, DIAPH1, KCNQ4, MYH14, WFS1 CCDC50, CEACAM16, COL4A6, CRYM, DIABLO, DIAPH3, DSPP, EYA4, GJB2, GJB3, GJB6, GRHL2, HOMER2, MYH9, MYO6, MYO7A, OSBPL2, P2RX2, POU3F4, POU4F3, PRPS1, SIX1, SLC17A8, SMPX, TBC1D24, TECTA, TJP2, TMC1, TNC 94,2 kb Humangenetik 16.2 Schwerhörigkeit/Taubheit, autosomal-rezessiv Schwerhörigkeit/Taubheit autosomal-rezessiv (AR) 1 CDH23, MYO7A, PCDH15, SLC26A4 24,9 kb Erweiterte Diagnostik Schwerhörigkeit/Taubheit autosomal-rezessiv (AR) 2 ILDR1, MYO15A, OTOA, STRC, TMC1, TMPRSS3 24,6 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CDH23, MYO7A, PCDH15, SLC26A4 ILDR1, MYO15A, OTOA, STRC, TMC1, TMPRSS3 ABHD12, ADCY1, BDP1, BSND, CABP2, CDC14A, CIB2, CLDN14, CLIC5, COL11A2, COL4A6, DCDC2, DFNB59, ELMOD3, EPS8, EPS8L2, ESPN, ESRRB, FAM65B, FOXI1, GIPC3, GJB2, GJB3, GJB6, GPSM2, GRXCR1, GRXCR2, HGF, KARS, KCNE1, KCNQ1, LHFPL5, LOXHD1, LRTOMT, MARVELD2, MET, MSRB3, MYO3A, MYO6, NARS2, OTOF, OTOG, OTOGL, PNPT1, POU3F4, PRPS1, PTPRQ, RDX, S1PR2, SERPINB6, SLC26A5, SLITRK6, SMPX, SYNE4, TBC1D24, TECTA, TMEM132E, TMIE, TPRN, TRIOBP, TSPEAR, USH1C, WHRN 203,3 kb 173

174 16.3 Schwerhörigkeit/Taubheit, syndromal Individuell konfigurierbare MGPS Schwerhörigkeit/Taubheit, syndromal Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ADGRV1 (18.9 kb) * BSND (1.0 kb) * CDH23 (10.1 kb) * CIB2 (0.6 kb) * CLPP (0.8 kb) * CLRN1 (0.7 kb) * EYA1 (1.8 kb) * FOXI1 (1.1 kb) * GPSM2 (2.1 kb) * HARS (1.5 kb) * KCNE1 (0.4 kb) * KCNJ10 (1.1 kb) * KCNQ1 (2.0 kb) * MYH9 (5.9 kb) * MYO7A (6.6 kb) * PCDH15 (5.9 kb) * PDZD7 (3.1 kb) * SIX5 (2.2 kb) * SLC26A4 (2.3 kb) * USH1C (2.7 kb) * USH1G (1.4 kb) * USH2A (15.6 kb) * WFS1 (2.7 kb) * WHRN (2.7 kb) 16.4 Schwerhörigkeit/Taubheit, mitochondrial Dr. rer. biol. hum. S. Chahrokh-Zadeh, Dipl.-Biol. Birgit Busse Irreversibler Hörverlust ist eine schwerwiegende Komplikation bei der Behandlung mit Aminoglykosid-Antibiotika wie Streptomycin, Gentamicin und Kanamycin. Seit vielen Jahren ist bekannt, dass Mutationen in den maternal vererbten mitochondrialen Genen hierbei eine wichtige Rolle spielen. Mutationen an Positionen m.1494c>t und m.1555a>g des mitochondrialen 12S rrna-gens (MT-RNR1) sind mit dem Risiko Aminoglykosid-induzierter Taubheit assoziiert. Auch die Position m.961 (MT-RNR1) wird in diesem Zusammenhang in der Datenbank für mitochondriale Mutationen (MITOMAP) aufgeführt, wobei diesbezügliche Aussagen noch unklar sind. Der Wirkungsmechanismus der Aminoglykoside beruht auf der irreversiblen Bindung an die verwandte 30S Untereinheit der bakteriellen Ribosomen, die zu einer Störung der Proteinbiosynthese führt. Auch die Mutation m.7445a>g im MT-TS1-Vorläufer-Gen, welches für die mitochondriale trnaser(ucn) codiert (und gleichzeitig das MT-CO1-Gen (mitochondriale Cytochrom C Oxidase-Untereinheit 1) betrifft, konnte im Zusammenhang mit Aminoglykosid-induziertem Hörverlust identifiziert werden. Gleichzeitig wurde diese Mutation bei Patienten mit nicht-syndromischem sensorineuralem Hörverlust ohne Antibiotikaeinnahme nachgewiesen. Eine kombinierte Anlageträgerschaft der Mutation m.1555a>g und der Variante m.7444g>a (MT-CO1) scheint das höchste Risiko für einen Hörverlust zu bergen. Literatur Andey et al, (2015) / Bitner-Glindzicz et al, N Engl J Med 360:640 (2009) / Vandebona et al N Engl J Med 360:642 (2009) / Maász et al, Curr Med Chem 15:1257 (2008) / Jin et al, Biochem Biophys Res Commun 361:133 (2007) / Ballana et al, Biochem Biophys Res Commun 341:950 (2006) # Taubheit mitochondrial Mutationssuche entspr. EBM Kapitel , GOP Untersuchung des gesamten mitochondrialen Genoms mit Angabe des Heteroplasmiegrades. 174

175 16.5 Usher-Syndrom (USH) Dr. rer. biol. hum. Soheyla Chahrokh-Zadeh Das Usher Syndrom (USH), eine Gruppe von klinisch und genetisch heterogenen, autosomal-rezessiven Erkrankungen mit bilateralem sensorineuralem Hörverlust, z.t. auch vestibulärer Dysfunktion und gradueller retinaler Degeneration, Retinitis Pigmentosa (RP), ist die Haupt-Ursache (>50%) für Taub-Blindheit. Die Prävalenz wird auf 1:6.000 geschätzt. Drei Haupt-Subtypen USH1, USH2 und USH3 werden vor allem durch Schwere und Progression der Schwerhörigkeit und Präsenz der vestibulären Mitbeteiligung unterschieden. Bisher sind 12 Gene und ein sog. Modifier-Gen (PDZD7) identifiziert. USH1 macht 30-40% aller USH-Typen aus und stellt die schwerste Form mit hochgradiger kongenitaler Schwerhörigkeit, präpubertärer Beeinträchtigung der Sehkraft (RP) und oft vestibulärer Dysfunktion dar. Bei Patienten mit USH1 wird oft zunächst ausschließlich die Schwerhörigkeit diagnostiziert, bis die Gesichtsfeldbeeinträchtigung (sog. Tunnelblick) und Nachtblindheit (erste Anzeichen einer RP) so weit fortgeschritten sind, dass sie ebenfalls auffallen. Eine frühe Diagnosestellung ist jedoch wichtig für eine angemessene Beschulung und Förderung im Kindesalter. Die Klassifikation der einzelnen Subtypen aufgrund klinischer Daten ist nur unzureichend, da die phänotypische Variabilität, selbst bei Vorliegen identischer Mutationen, sehr hoch sein kann. Neun Loci und sechs Gene sind bisher bekannt: MYO7A (USH1B; 53%- 63% aller USH1), USH1C (USH1C; 1%-15%), CDH23 (USH1D; 7%-20%), PCDH15 (USH1F; 7%-12%), USH1G (USH1G) und CIB2 (USH1J). Der am häufigsten auftretende Subtyp betrifft USH2 (moderater bis schwerer Hörverlust, eher postpubertäre RP und normale vestibuläre Funktion). Die meisten Mutationen sind im USH2A-Gen (USH2A; 57%- 79%) nachweisbar. Mutationen in den oben aufgeführten Genen sind auch bei Patienten mit autosomal-rezessiver nicht-syndromaler, kongenitaler oder prälingualer Schwerhörigkeit, z.b. MYO7A bei DFNA11 (autosomal-dominant) und DFNB2 (autosomal-rezessiv), CDH23 bei DFNB12, PCDH15 bei DFNB23 beschrieben. Auch digenische Vererbung, mit jeweils einer Mutation in einem der betroffenen Gene z.b. CDH23 und PCDH15 sind bekannt. Autosomal-rezessive nicht-syndromale, kongenitale oder prälinguale Schwerhörigkeit ist genetisch heterogen, mit bis dato bis zu 50 bekannten Genen und ca. 25 Loci. Literatur Krawitz et al, Mol Genet&Genomic Med 2:393 (2014) / Rong et al, PLOS ONE 9: e97808 ( 2014) / García-García et al, Mol Vis 19:367 ( 2013) / Kimberling et al, Genet Med. 12: 512 (2010) / Ebermann et al, J Clin Invest 120:1812 (2010) Usher-Syndrom Typ 1 CDH23, MYO7A, PCDH15, USH1G 24,0 kb Erweiterte Diagnostik Humangenetik Usher-Syndrom Typ 1 und 2 MYO7A, USH2A 22,3 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CDH23, MYO7A, PCDH15, USH1G MYO7A, USH2A ADGRV1, CDH23, CIB2, CLRN1, HARS, MYO7A, PCDH15, PDZD7, USH1C, USH1G, USH2A, WHRN 116,1 kb 175

176 Erkrankungen, OMIM, ICD-10, Gene bei Usher-Syndrom Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Usher-Syndrom Typ 1B (auch DFNB2, s. autosomal-rezessive H91.9 MYO7A* Formen; auch DFNA11, s. autosomal-dominante Formen) Usher-Syndrom Typ 1C (auch DFNB18, s. autosomal-rezessive H91.9 USH1C Formen) Usher-Syndrom Typ 1D (auch DFNB12. s. autosomal-rezessive H91.9 CDH23* Formen; auch digenische Vererbung mit PCDH15-Gen, s ) Usher-Syndrom Typ 1F (auch DFNB23, s. autosomal-rezessive H91.9 PCDH15*,** Formen, auch digenische Vererbung mit CDH23-Gen, s ) Usher-Syndrom Typ 1G H91.9 SANS Usher-Syndrom Typ 2A H91.9 USH2A*,** Usher-Syndrom Typ 2C H91.9 PDZD Usher-Syndrom Typ 2C H91.9 GPR Usher-Syndrom Typ 2D H91.9 WHRN Usher-Syndrom Typ 3A H91.9 CLRN Usher-Syndrom Typ 3B H91.9 HARS Usher-Syndrom Typ IJ (auch DFNB48 s. autosomal-rezessive Formen) H91.9 CIB * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 176

177 17. Stoffwechselerkrankungen Dipl.-Biol. Birgit Busse 17.1 CDG-Syndrom - Kongenitale Defekte der Glykosylierung Kongenitale Defekte der Glykosylierung sind erblich bedingte Defekte der Glykoproteinbiosythese und zählen zu den genetisch-bedingten Stoffwechseldefekten. Es handelt sich meist um schwere Multiorganerkankungen mit häufig ausgeprägten neurologischen Störungen. Mittlerweile sind verschiedenste Subtypen der CDG-Syndrome bekannt, die nach der Lokalisation des jeweiligen Defektes innerhalb der Zelle und nicht nach klinischen Gesichtspunkten eingruppiert wurden. Mittels NGS-Paneldiagnostik können aktuell 43 Gene für verschiedene CDG-Typen untersucht werden. Am häufigsten ist das CDG-Syndrom Typ Ia, verursacht durch einen Phosphomanno-Mutase-Mangel durch Mutationen im PMM2-Gen. Typisch ist eine ausgeprägte Entwicklungsstörung, es können Hirnfehlbildungen, Skelett-Anomalien, invertierte Mamillen, Gerinnungsdefekte und weitere Symptome hinzukommen. Die Verdachtsdiagnose wird in der Regel zunächst durch eine Stoffwechseldiagnostik mittels Nachweis einer abnormen Glykosylierung der Glykoproteine des Serums, durch eine Serum-Transferrin-Elektrophorese, gestellt und dann mittels molekulargenetischer Untersuchung bestätigt. Ein solcher Nachweis einer auffälligen Glykosylierung der Glykoproteine des Serums liegt jedoch nicht bei allen Typen der CDG-Syndrome vor, so dass bei weiterhin bestehendem Verdacht, auch im Falle eines unauffälligen Befundes der Serum-Transferrin-Elektrophorese, eine NGS-Paneldiagnostik indiziert sein kann und im Einzelfall zur Diagnose und damit zu genaueren Aussagen zur Prognose und zum Wiederholungsrisiko führen kann. Literatur Timal et al, Hum Mol Genet 21, No. 19, 2012 Humangenetik CDG-Syndrom Individuell konfigurierbare MGPS Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ALG1 (1.4 kb) * ALG11 (1.5 kb) * ALG12 (1.5 kb) * ALG13 (3.4 kb) * ALG2 (1.2 kb) * ALG3 (1.3 kb) * ALG6 (1.5 kb) * ALG8 (1.6 kb) * ALG9 (1.9 kb) * B4GALT1 (1.2 kb) * CAD (6.7 kb) * CCDC115 (0.5 kb) * COG1 (2.9 kb) * COG4 (2.4 kb) * COG5 (2.6 kb) * COG6 (2.0 kb) * COG7 (2.3 kb) * COG8 (1.8 kb) * DDOST (1.4 kb) * DOLK (1.6 kb) * DPAGT1 (1.2 kb) * DPM1 (0.8 kb) * DPM2 (0.3 kb) * DPM3 (0.4 kb) * MGAT2 (1.3 kb) * MOGS (2.5 kb) * MPDU1 (0.7 kb) * MPI (1.3 kb) * NGLY1 (2.0 kb) * PGM1 (1.7 kb) * PMM2 (0.7 kb) * RFT1 (1.6 kb) * SLC35A1 (1.0 kb) * SLC35A2 (1.3 kb) * SLC35C1 (1.1 kb) * SLC39A8 (1.4 kb) * SRD5A3 (1.0 kb) * SSR4 (0.6 kb) * STT3A (2.1 kb) * STT3B (2.5 kb) * TMEM165 (1.0 kb) * TMEM199 (0.6 kb) * TUSC3 (1.0 kb) 177

178 CDG-Syndrom ALG12, ALG3, ALG6, ALG8, DPM1, MOGS, MPDU1, MPI, PMM2, SLC35C1, SRD5A3, TUSC3 15,0 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ALG12, ALG3, ALG6, ALG8, DPM1, MOGS, MPDU1, MPI, PMM2, SLC35C1, SRD5A3, TUSC3 ALG1, ALG11, ALG13, ALG2, ALG9, B4GALT1, CAD, CCDC115, COG1, COG4, COG5, COG6, COG7, COG8, DDOST, DOLK, DPAGT1, DPM2, DPM3, MGAT2, NGLY1, PGM1, RFT1, SLC35A1, SLC35A2, SLC39A8, SSR4, STT3A, STT3B, TMEM165, TMEM199 68,7 kb Erkrankungen, OMIM, ICD-10, Gene bei CDG-Syndrom Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen CDG Congenital disorder of deglycosylation - Typ 1v E77.8 AR NGLY CDG Congenital disorder of glycosylation - Typ 1x E77.8 AR STT3B CDG Congenital disorder of glycosylation - Typ 1a E77.8 AR PMM CDG Congenital disorder of glycosylation - Typ 1b E77.8 AR MPI CDG Congenital disorder of glycosylation - Typ 1c E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1d E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1e E77.8 AR DPM CDG Congenital disorder of glycosylation - Typ 1f E77.8 AR MPDU CDG Congenital disorder of glycosylation - Typ 1g E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1h E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1i E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1j E77.8 AR DPAGT CDG Congenital disorder of glycosylation - Typ 1k E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1l E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1m E77.8 AR DOLK CDG Congenital disorder of glycosylation - Typ 1n E77.8 AR RFT CDG Congenital disorder of glycosylation - Typ 1o E77.8 AR DPM CDG Congenital disorder of glycosylation - Typ 1p E77.8 AR ALG CDG Congenital disorder of glycosylation - Typ 1q E77.8 AR SRD5A CDG Congenital disorder of glycosylation - Typ 1r E77.8 AR DDOST CDG Congenital disorder of glycosylation - Typ 1s / E77.8 XL ALG Frühkindliche epileptische Enzephalopathie 36 CDG Congenital disorder of glycosylation - Typ 1t E77.8 AR PGM CDG Congenital disorder of glycosylation - Typ 1u E77.8 AR DPM

179 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen CDG Congenital disorder of glycosylation - Typ 1w E77.8 AR STT3A CDG Congenital disorder of glycosylation - Typ 1y E77.8 AR SSR CDG Congenital disorder of glycosylation - Typ 1z E77.8 AR CAD CDG Congenital disorder of glycosylation - Typ 2a E77.8 AR MGAT CDG Congenital disorder of glycosylation - Typ 2b E77.8 AR MOGS CDG Congenital disorder of glycosylation - Typ 2c E77.8 AR SLC35C CDG Congenital disorder of glycosylation - Typ 2d E77.8 AR B4GALT CDG Congenital disorder of glycosylation - Typ 2e E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2f E77.8 AR SLC35A CDG Congenital disorder of glycosylation - Typ 2g E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2h E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2i E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2j E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2k E77.8 AR TMEM CDG Congenital disorder of glycosylation - Typ 2l E77.8 AR COG CDG Congenital disorder of glycosylation - Typ 2m E77.8 AR SLC35A CDG Congenital disorder of glycosylation - Typ 2n E77.8 AR SLC39A CDG Congenital disorder of glycosylation - Typ 2o E77.8 AR CCDC CDG Congenital disorder of glycosylation - Typ 2p E77.8 AR TMEM Mentale Retardierung, autosomal rezessiv F79.- AR TUSC Humangenetik 17.2 Fettstoffwechselstörungen M. Sc. Kathrin Wittkowski Fettstoffwechselstörungen gehören zu den Hauptrisikofaktoren für Herz-Kreislauf-Erkrankungen, welche die häufigste Todesursache in Deutschland darstellen. Bei dieser Art von Störungen liegt eine Erhöhung beziehungsweise eine Verschiebung der Zusammensetzung der Lipide im Blut vor. Dies kann zu Arteriosklerose und in der Folge zu Herz-Kreislauf-Erkrankungen führen. Eine Fettstoffwechselstörung kann sowohl genetisch bedingt sein (primäre Fettstoffwechselstörung), als auch Folge anderer Grunderkrankungen wie z.b. Diabetes mellitus, Hypothyreose, Nierenerkrankungen oder anderer Stoffwechselerkrankungen sein (sekundäre Fettstoffwechselstörung). Die primären Fettstoffwechselstörungen werden unterteilt in primäre Hypercholesterinämien, primäre Hypertriglyceridämien, gemischte Hyperlipoproteinämien und Hypolipoproteinämien. Die genetische Diagnostik dient der Diagnosesicherung und ist im Rahmen einer Familienuntersuchung relevant. Literatur Parhofer, Dtsch Arztebl Int. 113(15):261 (2016) / Ramasamy, Clin Chim Acta 454:143 (2016) / Schulze-Bahr et al, Dtsch Med Wochenschr 140(20):1538 (2015) 179

180 Schematische Darstellung der phänotypischen und genetischen Heterogenität bei Fettstoffwechselstörungen. Die einzelnen Subpanels sind farblich voneinander abgegrenzt, Core Genes sind fett gedruckt. Fettstoffwechselerkrankungen Individuell konfigurierbare MGPS Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ABCA1 (6.8 kb) * ANGPTL3 (1.4 kb) * APOA1 (0.8 kb) * APOA5 (1.1 kb) * APOB (13.7 kb) * APOC2 (0.3 kb) * APOE (1.0 kb) * GPIHBP1 (0.6 kb) * LCAT (1.3 kb) * LDLR (2.6 kb) * LDLRAP1 (0.9 kb) * LIPC (1.5 kb) * LPL (1.4 kb) * MTTP (2.8 kb) * PCSK9 (2.1 kb) Primäre Hypercholesterinämie APOB, LDLR, LDLRAP1, PCSK9 Primäre Hypertriglyceridämie APOA5, APOC2, GPIHBP1, LPL Gemischte Hyperlipoproteinämie APOA1, APOE, LIPC 16,3 kb 3,4 kb 3,3 kb 180

181 Hypoalphalipoproteinämie ABCA1, APOA1, LCAT 8,9 kb Erweiterte Diagnostik Hypobetalipoproteinämie ANGPTL3, APOB, MTTP, PCSK9 19,9 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. Humangenetik ABCA1, ANGPTL3, APOA1, APOB, LCAT, MTTP, PCSK9 28,8 kb 181

182 Erkrankungen, OMIM, ICD-10, Gene bei primären Fettstoffwechselstörungen Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen LDL-Rezeptor-Defizienz E78.0 AD LDLR* Apolipoprotein B-Defizienz E78.0 AD APOB* PCSK9-assoziierte Hypercholesterinämie E78.0 AD PCSK9* LDL-Adaptor-Protein-Defizienz E78.0 AR LDLRAP1* Lipoproteinlipase-Defizienz E78.3 AR LPL* Apolipoprotein C-II-Defizienz E78.3 AR APOC2* GPIHBP1-Defizienz E78.3 AR GPIHBP1* Apolipoprotein A-V-Defizienz E78.3 AD APOA5* Familiäre Dysbetalipoproteinämie E78.2 AR APOE* Hepatische Lipase-Defizienz E78.4 AR LIPC* Apolipoprotein A-I-Defizienz E78.6 AR APOA1* Tangier-Erkrankung E78.6 AR ABCA1* Tangier-Erkrankung E78.6 AR APOA1* LCAT-Mangel E78.6 AR LCAT* Familiäre Hypobetalipoproteinämie (FHBL) E78.6 AD APOB* Familiäre Hypobetalipoproteinämie (FHBL) E78.6 AD PCSK9* Familiäre Hypobetalipoproteinämie (FHBL) E78.6 AR ANGPTL3* Abetalipoproteinämie (ABL) E78.6 AR MTTP* * auch einzeln anforderbar Core Genes sind fett gedruckt 17.3 Hereditäre Hämochromatose Dr. rer. nat. Christoph Marschall, M. Sc. Kathrin Wittkowski Die Hämochromatose beruht auf einer erworbenen oder angeborenen Störung des Eisenstoffwechsels. Durch eine erhöhte Eisenresorption im Dünndarm kommt es zu einer Eisenakkumulation in verschiedenen Organen, insbesondere in der Leber. Bei frühzeitiger Diagnose ist die Erkrankung gut therapierbar, unbehandelt führt sie häufig zu Leberzirrhose, Lebertumoren, Diabetes mellitus oder Herzrhythmusstörungen. Bei der erblichen Form (hereditäre Hämochromatose, HH) handelt es sich um eine Erkrankung mit autosomal-rezessivem Erbgang, die in >90% der Fälle durch Homozygotie für die C282Y-Variante (rs ) im HFE-Gen verursacht wird. Die Häufigkeit dieses Genotyps liegt im mitteleuropäischen Raum zwischen 1:200 und 1:400. Die Penetranz ist nicht vollständig, so dass nicht alle homozygoten Merkmalsträger an einer klinisch manifesten Hämochromatose erkranken. Der Nachweis dieses Genotyps bei symptomatischen Patienten kann als Bestätigung für eine HH gesehen werden. Heterozygote Merkmalsträger (5-10% der Bevölkerung) haben kein erhöhtes Erkrankungsrisiko. Die ebenfalls bekannte H63D-Variante ist nicht mit hereditärer Hämochromatose assoziiert, aber in homozygoter Form ein Risikofaktor für eine leichte Eisenakkumulation, insbesondere in Kombination mit anderen Risikofaktoren wie z.b. Alkohol oder bestimmten Stoffwechselerkrankungen. Bei Patienten mit klinisch bestätigter Hämochromatose, bei denen die C282Y-Variante nicht oder nur in heterozygoter Form nachgewiesen wurde und bei denen weiterhin der Verdacht auf eine hereditäre Hämochromatose besteht (z.b. aufgrund einer Transferrinsättigung von >50%, einem Serumferritinwert von >200 µg/l oder einer positiven Leberbiopsie), kann eine Analyse des kompletten HFE-Gens zum Nachweis seltener Mutationen oder eine Panel-Diagnostik der Hämochromatose-assoziierten Gene HFE, HFE2, HAMP, TRF2, SLC40A1 und BMP6 durchgeführt werden. Literatur Porto et al, Eur J Hum Genet (2015) / Clark et al, Clin Biochem Rev 31:3 (2010) / Leitlinien zur molekulargenetischen Diagnostik der HH, medgen 18 (2006) / Adams et al, N Engl J Med 352:1769 (2005) / Beutler et al, Ann Intern Med 133:329 (2000) / Mura et al, Blood 93:2502 (1999) / Feder et al, J Biol Chem 272:14025 (1997) / Feder et al, Nature Genet 13:399 (1996) / Jazwinska et al, Nature Genet 14:249 (1996) 182

183 Hämochromatose Stufe I HFE-C282Y/-H63D Genotypisierung Hämochromatose Stufe II BMP6, HAMP, HFE, HFE2, SLC40A1, TFR2 Erkrankungen, OMIM, ICD-10, Gene bei Hämochromatose * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 8,2 kb Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Hämochromatose Typ E83.1 AR HFE*,** Hämochromatose Typ 2A (juvenile H.) E83.1 AR HJV** Hämochromatose Typ 2B (juvenile H.) E83.1 AR HAMP** Hämochromatose Typ E83.1 AR TFR2** Hämochromatose Typ E83.1 AD SLC40A1** Hämochromatose Typ 6 E83.1 AD BMP Humangenetik 17.4 Harnstoffzyklus-Defekte Dipl.-Biol. Birgit Busse Für den Nachweis von Harnstoffzyklus-Defekten wird die genetische Diagnostik empfohlen, da die Messung von Enzymaktivitäten z.t. an Biopsie-Gewebe vorgenommen werden müsste und zudem nicht immer zuverlässig ist. Literatur UCD GUIDELINE-AWMF-Leitlinien-Registernummer 027/006, 2012 Individuell konfigurierbare MGPS Harnstoffzyklus-Defekt Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ARG1 (1.0 kb) * ASL (1.4 kb) * ASS1 (1.2 kb) * CPS1 (4.5 kb) * NAGS (1.6 kb) * OTC (1.1 kb) * SLC25A13 (2.0 kb) * SLC25A15 (0.9 kb) Harnstoffzyklus-Defekt ARG1, ASL, ASS1, CPS1, NAGS, OTC, SLC25A13, SLC25A15 13,7 kb 183

184 Erkrankungen, OMIM, ICD-10, Gene bei Harnstoffzyklus-Defekten Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Arginase-1-Mangel (Hyperargininämie) E72.2 AR ARG Argininosuccinat-Lyase(ASL)-Mangel (Argininbernsteinsäure-Krankheit) E72.2 AR ASL Argininosuccinat-Synthetase(ASS)-Mangel (Citrullinämie E72.2 AR ASS Typ 1) Carbamoylphosphat-Synthetase(CPS)-1-Mangel E72.2 AR CPS Citrullinämie Typ 2, adult E72.2 AR SLC25A Citrullinämie Typ 2, neonatal E72.2 AR SLC25A HHH-Syndrom E72.2 AR SLC25A N-Acetylglutamat-Synthetase(NAGS)-Mangel E72.2 AR NAGS Ornithin-Transcarbamylase(OTC)-Mangel E72.2 XR OTC Hyperoxalurie Dipl.-Biol. Christina Sofeso, Dr. med. Imma Rost Bei der Hyperoxalurie handelt es sich um eine autosomal-rezessiv vererbte Stoffwechselkrankheit, die bereits im Säuglings- oder Kleinkindalter durch Oxalatablagerung zu einer chronischen Niereninsuffizienz und/oder zu Urolithiasis begleitet von Fieber, Hämaturie und Nierenkoliken und, bei vollständigem Verschluss der Harnwege, zu akutem Nierenversagen führt. Als ursächlich sind Mutationen in drei verschiedenen Genen beschrieben. Hyperoxalurie AGXT, GRHPR, HOGA1 3,1 kb Erkrankungen, OMIM, ICD-10, Gene bei Hyperoxalurie Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Hyperoxalurie, primär, Typ 1 (HP1) E74.8 AR AGXT*,** Hyperoxalurie, primär, Typ 2 (HP2) E74.8 AR GRHPR** Hyperoxalurie, primär, Typ 3 (HP3) E74.8 AR HOGA * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 17.6 Maligne Hyperthermie (MH) Dipl.-Biol. Birgit Busse Bei der Malignen Hyperthermie (MH) handelt es sich um eine pharmakogenetisch bedingte Ca2 + -Regulationsstörung der Skelettmuskulatur. Bei genetisch prädisponierten Personen kann dabei die Gabe volatiler Anästhetika (Flurane) sowie depolarisierender Muskelrelaxantien (z.b. Suxamethason) zu einer potentiell lebensbedrohlichen hypermetabolischen Stoffwechselentgleisung führen. Die Symptome präsentieren sich sehr variabel und reichen von moderaten Verlaufsformen mit geringer Ausprägung bis hin zur schweren MH-Krise. Klassische Anzeichen einer fulminanten MH-Krise in der Frühphase sind Tachykardie, Hyperkapnie, Hypoxämie und Masseterspasmen, in der Spätphase kommen Azidose, Hyperkalämie, Rhabdomyolyse und Hyperthermie hinzu. Durch das Antidot Dantrolen konnte die Mortalitätsrate bei MH-Krisen auf <5% gesenkt werden. Die Prävalenz der MH in der deutschen Bevölkerung wird auf 1: geschätzt. Die Inzidenz für eine fulminante MH-Krise liegt bei ca. 1: Bei prädisponierten Patienten muss die Gabe von Triggersubstanzen vermieden werden. Ohne Trigger-Substanzen besteht in der Regel eine inapparente Myopathie. 184

185 Der Goldstandard für die Diagnostik der MH-Dispostion ist der in vitro Muskelkontraktionstest (IVCT). Daneben ist die molekulargenetische Untersuchung ein wichtiger Bestandteil der Diagnostik. Mutationen im Ryanodinrezeptor 1-Gen (RYR1) sowie im Dihydropyridin-Rezeptor-Gen (spannungsabhängiger L-Typ-Calciumkanal, CACNA1S) sind mit einer Prädisposition für MH assoziiert. Die Vererbung erfolgt autosomaldominant mit unvollständiger Penetranz. Bei ca. 75% der MH-Familien konnten Mutationen in einem dieser Gene identifiziert werden. Der Nachweis einer ursächlichen Mutation ermöglicht die Identifizierung weiterer gefährdeter Angehöriger anhand einer Zieldiagnostik. Da in den Studien nicht bei allen betroffenen Patienten Mutationen im RYR1- oder CACNA1S-Gen identifiziert wurden, schließt ein negativer molekulargenetischer Befund das Vorliegen einer MH jedoch nicht aus. Daher sollte bei bestehendem Verdacht und negativem genetischen Befund der IVCT zur Sicherung der Diagnose durchgeführt werden Literatur Bandschapp et al, Swiss Med Wkly 142:w13652 (2012) / Glahn et al, British Journal of Anaesthesia 105:417 (2010) / DGAInfo Anästh Intensivmed 49: (2008) / Rosenberg et al, Orphanet encyclopedia (2004) Humangenetik # Maligne Hyperthermie CACNA1S, RYR1 20,7 kb Erkrankungen, OMIM, ICD-10, Gene bei Maligner Hyperthermie Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Maligne Hyperthermie T88.3 RYR1* T88.3 CACNA1S* * auch einzeln anforderbar 17.7 MODY-Diabetes M. Sc. Kathrin Wittkowski, Dipl.-Biol. Birgit Busse "Maturity-onset Diabetes of the Young (MODY) bezeichnet eine autosomal-dominant vererbte Gruppe klinisch heterogener nicht immer insulin-abhängiger Formen des Diabetes, die durch verschiedene Störungen der Betazell-Funktionen im Pankreas charakterisiert werden. MODY ist die häufigste Form des monogenen Diabetes und ist für bis zu 5% diabetischer Erkrankungen in Europa verantwortlich. Die verschiedenen Formen des MODY-Diabetes werden nach ihrer Klinik und den entsprechenden von Mutationen betroffenen Genen klassifiziert. Derzeit werden 14 Typen unterschieden, wobei MODY Typ 2 und 3 die häufigsten Formen darstellen. Literatur Yorifuji et al, Pediatr Diabetes 13:26 (2012) / Thanabalasingham et al, BMJ 343:d6044 (2011) / Ellard et al, Diabetologia 51:546 (2008) / Bellanne-Chantelot et al, Diabetes 57:503 (2008) / Skupien et al, Diabetes Metab 34:524 (2008) / Ellard et al, Hum Mut 27:854 (2006) / Fajans et al, N Engl J Med 345:971 (2001) MODY-Diabetes # ABCC8, APPL1, BLK, CEL, GCK, HNF1A, HNF1B, HNF4A, INS, KCNJ11, KLF11, NEUROD1, PAX4, PDX1 23,0 kb 185

186 Erkrankungen, OMIM, ICD-10, Gene bei MODY-Diabetes Erkrankung OMIM-P ICD-10 Gen OMIM-Gen MODY-Diabetes Typ E11.9 HNF4A*,** MODY-Diabetes Typ E11.9 GCK*,** MODY-Diabetes Typ E11.9 HNF1A*,** MODY-Diabetes Typ E11.9 PDX1* MODY-Diabetes Typ E11.9 HNF1B** MODY-Diabetes Typ E11.9 NEUROD1* MODY-Diabetes Typ E11.9 KLF11* MODY-Diabetes Typ E11.9 CEL* MODY-Diabetes Typ E11.9 PAX4* MODY-Diabetes Typ E11.9 INS* MODY-Diabetes Typ E11.9 BLK* MODY-Diabetes Typ E11.9 ABCC8* MODY-Diabetes Typ E11.9 KCNJ11* MODY-Diabetes Typ E11.9 APPL * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 17.8 Mukopolysaccharidosen (MPS) M. Sc. Kathrin Wittkowski, Dipl.-Biol. Birgit Busse Mukopolysaccharidosen gehören zur Gruppe der lysosomalen Speichererkrankungen. Das jeweilige Krankheitsbild wird durch den Defekt eines lysosomalen Enzyms bestimmt, das den schrittweisen Abbau komplexer Kohlenhydrate katalysiert. Bei den Mukopolysaccharidosen handelt es sich um Störungen im Abbau der Glykosaminoglykane. Das jeweilige Krankheitsbild ist abhängig vom MPS-Typ. Für eine Reihe dieser Erkrankungen steht mittlerweile eine Enzym-Ersatztherapie zur Verfügung. Literatur Beck, medgen DOI /s z(2015) / Giuliani, Genet Mol Biol 35(4):924 (2012) / Beck, Dtsch Arztebl 98(34): A-2188/B-1891/C-1764 (2001) Mukopolysaccharidosen Individuell konfigurierbare MGPS Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ARSB1.6 kb * GALNS (1.6 kb) * GLB1 (2.0 kb) * GUSB (2.0 kb) * HGSNAT (1.9 kb) * HYAL1 (1.3 kb) * IDS (1.6 kb) * IDUA (2.0 kb) * NAGLU (2.2 kb) * SGSH (1.5 kb) 186

187 Erkrankungen, OMIM, ICD-10, Gene bei Mukopolysaccharidosen Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Mukopolysaccharidose Ih Hurler Syndrom E76.- IDUA Mukopolysaccharidose Ih/s Hurler/Scheie Syndrom E76.- IDUA Mukopolysaccharidose Is Scheie Syndrom E76.- IDUA Mukopolysaccharidose II (Hunter) E76.- IDS** Mukopolysaccharidisis Typ IIIA (Sanfilippo A) E76.- SGSH Mukopolysaccharidose Typ IIIB (Sanfilippo B) E76.- NAGLU Mukopolysaccharidose Typ IIIC (Sanfilippo C) E76.- HGSNAT Mukopolysaccharidose IVA E76.- GALNS Mukopolysaccharidose Typ IVB (Morquio) E76.- GLB Mukopolysaccharidose V E76.- IDUA Mukopolysaccharidose Typ VI (Maroteaux-Lamy) E76.- ARSB Mukopolysaccharidose VII E76.- GUSB Mukopolysaccharidose Typ IX E76.- HYAL ** Deletions-/Duplikationsanalyse Humangenetik 17.9 Porphyrien Dipl.-Biol. Birgit Busse Porphyrien werden durch Enzymdefekte der Häm-Biosynthese verursacht, wodurch es zur Akkumulation und Ablagerung von Intermediärprodukten im Gewebe kommt. Die Porphyrien werden in akute und nicht akute Porphyrien unterteilt. Je nach Typ und Noxen-Exposition treten abdominale, neurologische und/oder kutane Symptome auf. Klinisch und laborchemisch gibt es zum Teil Überlappungen zwischen den verschiedenen Porphyrie-Typen, so dass keine sichere Diagnose gestellt werden kann. Sollte das Metaboliten-Profil aus Urin- und/oder Stuhlprobe keinen eindeutigen Hinweis auf einen bestimmten Porphyrie-Typ geben, kann zur Abklärung eine genetische Diagnostik unter Einsatz von NGS zielführend sein. Literatur Whatley et al, Ann Clin Biochem 50:204 (2013) / Thunell et al, Br J Clin Pharmacol 64:668 (2007) / Poblete-Gutiérrez et al, Hautarzt 57:493 (2006) / Herrick et al, Best Pract Res Clin Gastroenterol 19:235 (2005) / Petrides, Dtsch Ärztebl 94: A3407 (1997) Porphyrien, akute ALAD, CPOX, HMBS, PPOX 4,9 kb Erkrankungen, OMIM, ICD-10, Gene bei akuten Porphyrien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Akute intermittierende Porphyrie E80.2 AD HMBS*,** Porphyria variegata (PV) E80.2 AD PPOX*,** Hereditäre Koproporphyrie (HCP) E80.2 AD CPOX*,** Akute hepatische Porphyrie (ALA-Dehydratase E80.2 AR ALAD** Defizienz) * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 187

188 Porphyrien, nicht akute ALAS2, FECH, UROD, UROS 4,9 kb Erkrankungen, OMIM, ICD-10, Gene bei nicht akuten Porphyrien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Porphyria cutanea tarda (PCT) E80.2 AD UROD*,** Erythropoetische Protoporphyrie (EPP) E80.2 AR XL * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse FECH*,** ALAS2* Kongenitale erythropoetische Porphyrie (CEP) E80.2 AR UROS*,** Hepatoerythropoetische Porphyrie (HEP) E80.2 AR UROD*,**

189 18. Ziliopathien Dr. med. Sandra Wilson, Dipl.-Biol. Christina Sofeso Zilien gehören zu den elementar wichtigen Zellorganellen und dienen z.b. in der Niere als Mechano-, Chemo- und Osmosensoren. Sie spielen eine entscheidende Rolle bei zahlreichen Signalwegen, die für eine adäquate Organentwicklung, die Aufrechterhaltung der Gewebehomöostase und bei grundsätzlichen Entwicklungsprozessen wichtig sind. Am Aufbau von Zilien sind zahlreiche Proteine und damit Gene beteiligt, was die klinische und auch genetische Heterogenität der im Folgenden aufgeführten Erkrankungen erklärt. Bei den primären ziliären Dyskinesien (PCD) handelt es sich um autosomal-rezessive Erkrankungen, bei denen die Anlage und Bewegung des Flimmerepithels (Cilien) in den Atemwegen gestört ist, wodurch es zu einer Infekt-Neigung der Atemwege, Nasennebenhöhlen und zu gehäuften Mittelohrentzündungen kommt. Des Weiteren kann es zu Fertilitätsstörungen durch Bewegungsstörung der Samenzellen oder Bewegungsstörung der Zilien in den Eileitern kommen. Bei zusätzlichem Auftreten einer seitenverkehrten Anlage der inneren Organe (Situs inversus) spricht man von einem Kartagener-Syndrom. Inzwischen sind bereits mehr als 30 Gene identifiziert worden, die mit PCD bzw. Kartagener-Syndrom assoziiert werden. Der Begriff Heterotaxie wird für Patienten mit isoliertem Situs inversus verschiedenster Ausprägung verwendet, wobei hier oft auch Herzfehler und andere Organfehlbildungen wie z.b. Asplenie oder Polysplenie beobachtet werden. Bisher sind mehr als 10 Gene bekannt, die mit isolierter Heterotaxie assoziiert sind, meist handelt es sich um autosomal-dominant erbliche Ursachen, selten sind autosomal-rezessive und auch X-chromosomale Erbgänge beschrieben. Aufgrund der phänotypischen Überlappung wird vermutet, dass es sich bei einigen Patienten mit der klinischen Diagnose einer Heterotaxie auch um ein Kartagener-Syndrom handeln kann, so dass dies bei der molekulargenetischen Diagnostik berücksichtigt werden muss. Zilien spielen unter anderem in den Nieren eine große Rolle. Sowohl polyzystische Nierenerkrankungen (autosomal-dominant und autosomal-rezessiv erbliche) als auch die Gruppe der Nephronophthisen zählen zu den Ziliopathien. Beim Krankheitsbild der Nephronophthisen (NPHP) handelt es sich um autosomal-rezessiv vererbte zystische Nierenerkrankungen, die oft auch in Kombination mit zusätzlichen extrarenalen Manifestationen auftreten. Eine Nephronophthise in Kombination mit einer Retinitis Pigmentosa wird als Senior-Løken- Syndrom bezeichnet, mit dem aktuell acht Gene assoziiert sind. Eine Nephronophthise in Kombination mit Sehnervenkolobomen oder Retinopathie und Kleinhirnwurmaplasie wird als Joubert-Syndrom bezeichnet, mit dem aktuell über 20 Gene assoziiert sind. Eine Nephronophthise in Kombination mit Kleinwuchs, schmalem Thorax mit kurzen Rippen, einer Polydaktylie und Retinopathie wird als Kurzrippen-Polydaktylie-Syndrom, Jeune-Syndrom oder auch als Ellis-van-Creveld-Syndrom bezeichnet, eine Gruppe von Erkrankungen, mit der derzeit mehr als 15 Gene assoziiert sind. Eine Nephronophthise in Kombination mit einer okzipitalen Omphalozele, Polydaktylie und Leberfibrose wird als Meckel-Gruber-Syndrom bezeichnet, ein Phänotyp, mit dem ebenfalls aktuell bereits mehr als 15 Gene assoziiert sind. Eine Retinitis Pigmentosa wird in Kombination mit verschiedensten anderen Fehlbildungen und Symptomen bei Ziliopathien sehr oft beobachtet, da Zilien im Auge eine große Rolle spielen. Beim Bardet-Biedl-Syndrom (BBS) handelt es sich um eine Ziliopathie, bei der eine Retinitis Pigmentosa, Nierenfunktionsstörungen und eine Polydaktylie in Kombination mit Adipositas, einem Hypogonadismus und Verhaltensauffälligkeiten beobachtet werden. Es handelt sich überwiegend um autosomal-rezessiv erbliche genetische Ursachen, allerdings wurde beim Bardet-Biedl-Syndrom auch eine sogenannte triallelische Vererbung beschrieben. Es können mehr als zwei Mutationen in mehr als einem Genlocus ursächlich sein, so dass zu einer autosomal-rezessiven Vererbung zweier Mutationen in einem Gen noch eine weitere Mutation in einem anderen BBS-Gen als Modifikator zur klinischen Ausprägung der Erkrankung beitragen kann. Inzwischen wurden bereits 19 verschiedene BBS-Gene und weitere Modifikator-Gene beschrieben. Beim Alström-Syndrom handelt es sich um eine seltene Erkrankung, die phänotypische Ähnlichkeiten zum Bardet-Biedl-Syndrom zeigt, und die durch autosomal-rezessive genetische Veränderungen im ALMS1-Gen verursacht wird. Zu den Symptomen des Alström-Syndroms gehören eine Retinitis Pigmentosa, eine Adipositas, Nieren- und Leberfunktionsstörungen, eine Insulin-Resistenz und Hyperinsulinämie sowie eine dilatative Kardiomyopathie. Auch die Gruppe der Oro-fazio-digitalen Syndrome (OFD) zählt zu den Ziliopathien. Typische Symptome sind kraniofaziale Fehlbildungen und Dysmorphien, Fehlbildungen der Finger und ZNS-Fehlbildungen. Gelegentlich werden auch polyzystische Nierenerkrankungen sowie Beteiligung von Leber und Pankreas beobachtet. Das OFD-Syndrom zählt zu den Differenzialdiagnosen von Meckel-Gruber-Syndrom und Humangenetik 189

190 Joubert-Syndrom. Die häufigste Form des OFD-Syndroms, OFD-Syndrom Typ 1, wird X-chromosomal vererbt und ist embryonal letal im männlichen Geschlecht. Andere Subtypen des OFD-Syndroms folgen in der Regel einem autosomal-rezessiven Erbgang. Aufgrund der großen klinischen und auch genetischen Heterogenität der Ziliopathien kann eine molekulargenetische Abklärung mittels NGS die exakte Zuordnung erleichtern. Literatur Schmidts, J Pediatr Genet 3:46 (2014) / Barker et al, Organogenesis 10:96 (2014) / Romani et al, Lancet Neurol 12:894 (2013) / Ronquillo et al, Vision Res 75:88 (2012) / Brugmann et al, Am J Med Genet A 152A:2995 (2010) Schematische Darstellung der phänotypischen und genetischen Heterogenität bei Ziliopathien. Die einzelnen Subpanels sind farblich voneinander abgegrenzt, "Core Genes" sind fett gedruckt. Exon 1-33 des PKD1-Gens werden auf Grund der Pseudogenproblematik mittels Long-Range-PCR und Sanger-Sequenzierung analysiert. 190

191 Ziliopathien Individuell konfigurierbare MGPS Für bestimmte Indikationsgruppen bieten wir die Möglichkeit einer individuellen Panelkonfiguration. Nutzen Sie hierfür den Panelkonfigurator auf unserer Homepage unter NGS-Panel - Humangenetik. * ACVR2B (1.5 kb) * AHI1 (3.6 kb) * ALMS1 (12.5 kb) * ANKS6 (2.6 kb) * ARL13B (1.3 kb) * ARL6 (0.6 kb) * ARMC4 (3.1 kb) * ATXN10 (1.4 kb) * B9D1 (0.6 kb) * B9D2 (0.5 kb) * BBIP1 (0.3 kb) * BBS1 (1.8 kb) * BBS10 (2.2 kb) * BBS12 (2.1 kb) * BBS2 (2.2 kb) * BBS4 (1.6 kb) * BBS5 (1.0 kb) * BBS7 (2.1 kb) * BBS9 (2.7 kb) * BICC1 (2.9 kb) * BMP4 (1.2 kb) * C21orf59 (0.9 kb) * C2CD3 (5.9 kb) * C5orf42 (9.6 kb) * CC2D2A (4.9 kb) * CCDC103 (0.7 kb) * CCDC114 (2.0 kb) * CCDC151 (1.8 kb) * CCDC28B (0.6 kb) * CCDC39 (2.8 kb) * CCDC40 (3.4 kb) * CCDC65 (1.5 kb) * CCNO (1.1 kb) * CENPF (9.3 kb) * CEP104 (2.8 kb) * CEP120 (3.0 kb) * CEP164 (4.4 kb) * CEP290 (7.4 kb) * CEP41 (1.1 kb) * CEP83 (2.1 kb) * CFAP53 (1.5 kb) * CFC1 (0.7 kb) * CHD1L (2.7 kb) * CRELD1 (1.3 kb) * CSPP1 (3.7 kb) * DCDC2 (1.4 kb) * DDX59 (1.9 kb) * DNAAF1 (2.2 kb) * DNAAF2 (2.5 kb) * DNAAF3 (1.8 kb) * DNAAF5 (2.6 kb) * DNAH1 (12.8 kb) * DNAH11 (13.5 kb) * DNAH5 (13.9 kb) * DNAH8 (14.1 kb) * DNAI1 (2.1 kb) * DNAI2 (1.8 kb) * DNAJB13 (0.9 kb) * DNAL1 (0.6 kb) * DRC1 (2.2 kb) * DYNC2H1 (12.9 kb) * DYNC2LI1 (1.1 kb) * DYX1C1 (1.3 kb) * EVC (3.0 kb) * EVC2 (3.9 kb) * FRAS1 (12.0 kb) * GAS8 (1.4 kb) * GDF1 (1.1 kb) * GLIS2 (1.6 kb) * HNF1B (1.7 kb) * HYDIN (15.4 kb) * HYLS1 (0.9 kb) * IFT122 (3.9 kb) * IFT140 (4.4 kb) * IFT172 (5.2 kb) * IFT27 (0.6 kb) * IFT43 (0.6 kb) * IFT52 (1.3 kb) * IFT74 (1.8 kb) * IFT80 (2.3 kb) * INPP5E (1.9 kb) * INVS (3.2 kb) * IQCB1 (1.8 kb) * KIAA0556 (4.9 kb) * KIAA0586 (4.9 kb) * KIF14 (4.9 kb) * KIF7 (4.0 kb) * LEFTY2 (1.1 kb) * LRRC6 (1.4 kb) * LZTFL1 (0.9 kb) * MAPKBP1 (4.5 kb) * MCIDAS (1.2 kb) * MKKS (1.7 kb) * MKS1 (1.7 kb) * MUC1 (0.8 kb) * NEK1 (3.8 kb) * NEK8 (2.1 kb) * NME8 (1.8 kb) * NODAL (1.0 kb) * NPHP1 (2.2 kb) * NPHP3 (4.0 kb) * NPHP4 (4.3 kb) * OFD1 (3.0 kb) * PAX2 (1.3 kb) * PDE6D (0.5 kb) * PKD1 (12.9 kb) * PKD2 (2.9 kb) * PKHD1 (12.2 kb) * POC1B (1.4 kb) * ROBO2 (4.1 kb) * RPGR (2.4 kb) * RPGRIP1 (3.9 kb) * RPGRIP1L (3.9 kb) * RSPH1 (0.9 kb) * RSPH3 (1.7 kb) * RSPH4A (2.1 kb) * RSPH9 (0.8 kb) * SDCCAG8 (2.1 kb) * SIX2 (0.9 kb) * SLC41A1 (1.5 kb) * SPAG1 (2.8 kb) * TCTN1 (1.8 kb) * TCTN2 (2.1 kb) * TCTN3 (1.8 kb) * TMEM138 (0.5 kb) * TMEM216 (0.4 kb) * TMEM231 (1.1 kb) * TMEM237 (1.2 kb) * TMEM67 (3.0 kb) * TRAF3IP1 (2.1 kb) * TRIM32 (2.0 kb) * TTC21B (3.9 kb) * TTC25 (1.8 kb) * TTC8 (1.5 kb) * UMOD (1.9 kb) * WDPCP (2.2 kb) * WDR19 (4.0 kb) * WDR34 (1.6 kb) * WDR35 (3.5 kb) * WDR60 (3.2 kb) * XPNPEP3 (1.5 kb) * ZIC3 (1.4 kb) * ZMYND10 (1.3 kb) * ZNF423 (3.9 kb) Humangenetik 191

192 Erkrankungen, OMIM, ICD-10, Gene bei Ziliopathien Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Alström-Syndrom Q87.8 AR ALMS Autosomal dominante polyzystische Nierenerkrankung Q61.2 AD PKD1*, ** (ADPKD) Autosomal dominante polyzystische Nierenerkrankung Q61.2 AD PKD2*, ** (ADPKD) Autosomal rezessive polyzystische Nieren und Q61.1 AR PKHD Lebererkrankung (ARPKD) Bardet-Biedl Syndrom Typ Q87.89 AR BBS Bardet-Biedl Syndrom Typ Q87.89 AR BBS Bardet-Biedl Syndrom Typ Q87.89 AR ARL Bardet-Biedl Syndrom Typ Q87.89 AR BBS Bardet-Biedl Syndrom Typ Q87.89 AR BBS Bardet-Biedl Syndrom Typ Q87.89 AR MKKS Bardet-Biedl Syndrom Typ Q87.89 AR BBS Bardet-Biedl Syndrom Typ Q87.89 AR TTC Bardet-Biedl Syndrom Typ Q87.89 AR BBS Bardet-Biedl Syndrom Typ Q87.89 AR BBS Bardet-Biedl Syndrom Typ Q87.89 AR TRIM Bardet-Biedl Syndrom Typ Q87.89 AR BBS Bardet-Biedl Syndrom Typ Q87.89 AR MKS Bardet-Biedl Syndrom Typ Q87.89 AR CEP Bardet-Biedl Syndrom Typ Q87.89 AR WDPCP Bardet-Biedl Syndrom Typ Q87.89 AR SDCCAG Bardet-Biedl Syndrom Typ Q87.89 AR LZTFL Bardet-Biedl Syndrom Typ Q87.89 AR BBIP Bardet-Biedl Syndrom Typ Q87.89 AR IFT Bardet-Biedl Syndrom, Modifier Q87.89 AR CCDC28B Bardet-Biedl Syndrom, Modifier Q87.89 AR TMEM Bardet-Biedl Syndrom, Phänotyp - Q87.89 AR IFT Bardet-Biedl Syndrom, Phänotyp - Q87.89 AR NPHP1*, ** Double-outlet right ventricle Q89.3 AD, AR GDF Ellis-van-Creveld-Syndrom Typ Q77.2 AR EVC Ellis-van-Creveld-Syndrom Typ Q77.2 AR EVC Fallot Tetralogie Q89.3 AD, AR GDF Heterotaxie Q89.3 AD, AR GDF Heterotaxie / Atrioventrikulärer Septum Defekt, Q89.3 AD CRELD Suszeptibilität Typ 2 Heterotaxie Phänotyp Q89.3 AD LEFTY Heterotaxie Phänotyp - Q89.3 AD NPHP Heterotaxie, viszeral Typ Q89.3 XL ZIC Heterotaxie, viszeral Typ Q89.3 AD CFC Heterotaxie, viszeral Typ Q89.3 AD ACVR2B Heterotaxie, viszeral Typ Q89.3 AD NODAL Heterotaxie, viszeral Typ Q89.3 AR CFAP

193 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Jeune-Syndrom / OFD Typ 4 Phänotyp Q77.2 AR TCTN Jeune-Syndrom /Joubert-Syndrom Typ 21 Phänotyp Q77.2 AR CSPP Joubert-Syndrom Phänotyp - Q04.3 AR POC1B Joubert-Syndrom Typ Q04.3 AR INPP5E Joubert-Syndrom Typ Q04.3 AR AHI Joubert-Syndrom Typ Q04.3 AR CEP Joubert-Syndrom Typ Q04.3 AR ARL13B Joubert-Syndrom Typ Q04.3 AR CC2D2A Joubert-Syndrom Typ Q04.3 XLR OFD Joubert-Syndrom Typ Q04.3 AR KIF Joubert-Syndrom Typ Q04.3 AR CEP Joubert-Syndrom Typ Q04.3 AR C5orf Joubert-Syndrom Typ Q04.3 AR CSPP Joubert-Syndrom Typ Q04.3 AR PDE6D Joubert-Syndrom Typ Q04.3 AR KIAA Kongenitale Fehlbildung der Nieren und ableitenden - Q63.9 AD BMP Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden - Q63.9 AD CHD1L Harnwege (CAKUT) Kongenitale Fehlbildung der Nieren und ableitenden Q63.9 AD ROBO Harnwege (CAKUT) Kranio-Ektodermale Dysplasie Typ Q77.2 AR IFT Kranio-Ektodermale Dysplasie Typ Q77.2 AR IFT Kranio-Ektodermale Dysplasie Typ Q77.2 AR WDR Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 AR IFT Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 AR DYNC2H Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 AR TTC21B Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 AR WDR Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 AR NEK Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 AR WDR Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 AR WDR Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 AR IFT Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 AR IFT Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 AR WDR Kurzrippen-Polydaktylie-Syndrom Typ Q77.2 AR CEP Meckel-Gruber-Syndrom Typ Q61.9 AR MKS Meckel-Gruber-Syndrom Typ Q61.9 AR TMEM Meckel-Gruber-Syndrom Typ Q61.9 AR TMEM Meckel-Gruber-Syndrom Typ Q61.9 AR CEP Meckel-Gruber-Syndrom Typ Q61.9 AR RPGRIP1L Meckel-Gruber-Syndrom Typ Q61.9 AR CC2D2A Meckel-Gruber-Syndrom Typ Q61.9 AR NPHP Meckel-Gruber-Syndrom Typ Q04.3 AR TCTN Meckel-Gruber-Syndrom Typ Q61.9 AR TCTN Humangenetik 193

194 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Meckel-Gruber Syndrom Typ Q61.9 AR B9D Meckel-Gruber Syndrom Typ Q61.9 AR B9D Meckel-Gruber Syndrom Typ Q61.9 AR TMEM Meckel-Gruber Syndrom Typ Q61.9 AR KIF Meckel/Joubert-Syndrom Phänotyp - Q61.9 AR C5orf Meckel/Joubert-Syndrom Phänotyp - Q61.9 AD CEP Meckel/Joubert-Syndrom Phänotyp - Q61.9 AR TCTN Meckel/Joubert-Syndrom Phänotyp - Q61.9 AR TMEM Meckel/Joubert-Syndrom Phänotyp - Q61.9 AR TMEM Meckel/Joubert-Syndrom Phänotyp - Q61.9 AD TTC21B Medullär-zystische Nierenerkrankung Type Q63.9 AD MUC Nephronophthise Phänotyp - Q61.5 AR ATXN Nephronophthise Phänotyp Q60.4 AD PAX Nephronophthise Phänotyp - Q61.5 AR SLC41A Nephronophthise Phänotyp / Q04.3 AR AHI Joubert-Syndrom Typ 3 Nephronophthise Phänotyp / Q04.3 AR CC2D2A Joubert-Syndrom Typ 9 Nephronophthise Typ Q61.5 AR NPHP1*, ** Nephronophthise Typ 2, infantil Q61.5 AR INVS Nephronophthise Typ Q61.5 AR NPHP Nephronophthise Typ Q61.5 AR NPHP Nephronophthise Typ 5 - Q61.5 AR IQCB Nephronophthise Typ 6 - Q61.5 AR CEP Nephronophthise Typ Q61.5 AR GLIS Nephronophthise Typ 8 - Q61.5 AR RPGRIP1L Nephronophthise Typ Q61.5 AR NEK Nephronophthise Typ 10 - Q61.5 AR SDCCAG Nephronophthise Typ Q61.5 AR TMEM Nephronophthise Typ Q61.5 AR TTC21B Nephronophthise Typ Q61.5 AR WDR Nephronophthise Typ Q61.5 AR ZNF Nephronophthise Typ Q61.5 AR CEP Nephronophthise Typ Q61.5 AR ANKS Nephronophthise Typ 17 - Q61.5 AR IFT Nephronophthise Typ Q61.5 AR CEP Nephronophthise-ähnliche Nephropathie Typ Q61.5 AR XPNPEP Oro-fazio-digitales Syndrom Typ 1 & Q04.3 XLD OFD Oro-fazio-digitales Syndrom Typ 3 - Q04.3 AR TMEM Oro-fazio-digitales Syndrom Typ 4 / Q04.3 AR TCTN Mohr-Majewski syndrome Oro-fazio-digitales Syndrom Typ Q04.3 AR DDX Oro-fazio-digitales Syndrom Typ Q04.3 AR C5orf Oro-fazio-digitales Syndrom Typ 6-ähnlich - Q04.3 AR TMEM Oro-fazio-digitales Syndrom Typ Q04.3 AR C2CD

195 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Polyzystische Nieren Phänotyp - Q60.4 AD PAX Polyzystische Nieren Phänotyp / CAKUT - Q63.9 AD SIX Polyzystische Nieren Phänotyp / Q63.9 AR FRAS Fraser Syndrom Polyzystische Nieren Phänotyp / Q04.3 XLD OFD Oro-fazio-digitales Syndrom Typ 1 & 7 Primäre ziliäre Dyskinesie Phänotyp - J98.0 AR DNAH Primäre ziliäre Dyskinesie Phänotyp - J98.0 AR DNAH Primäre ziliäre Dyskinesie Phänotyp - J98.0 AR MCIDAS Primäre ziliäre Dyskinesie Typ J98.0 AR DNAI Primäre ziliäre Dyskinesie Typ 1 / Q89.3 AR DNAI Kartagener Syndrom Primäre ziliäre Dyskinesie Typ J98.0 AR DNAAF Primäre ziliäre Dyskinesie Typ J98.0 AR DNAH Primäre ziliäre Dyskinesie Typ 3 / Q89.3 AR DNAH Kartagener Syndrom Primäre ziliäre Dyskinesie Typ J98.0 AR HYDIN Primäre ziliäre Dyskinesie Typ J98.0 AR NME Primäre ziliäre Dyskinesie Typ J98.0 AR DNAH Primäre ziliäre Dyskinesie Typ 7 / Q89.3 AR DNAH Kartagener Syndrom Primäre ziliäre Dyskinesie Typ J98.0 AR DNAI Primäre ziliäre Dyskinesie Typ J98.0 AR DNAAF Primäre ziliäre Dyskinesie Typ J98.0 AR RSPH4A Primäre ziliäre Dyskinesie Typ J98.0 AR RSPH Primäre ziliäre Dyskinesie Typ J98.0 AR DNAAF Primäre ziliäre Dyskinesie Typ J98.0 AR CCDC Primäre ziliäre Dyskinesie Typ J98.0 AR CCDC Primäre ziliäre Dyskinesie Typ J98.0 AR DNAL Primäre ziliäre Dyskinesie Typ J98.0 AR CCDC Primäre ziliäre Dyskinesie Typ J98.0 AR DNAAF Primäre ziliäre Dyskinesie Typ J98.0 AR LRRC Primäre ziliäre Dyskinesie Typ J98.0 AR CCDC Primäre ziliäre Dyskinesie Typ J98.0 AR DRC Primäre ziliäre Dyskinesie Typ J98.0 AR ZMYND Primäre ziliäre Dyskinesie Typ J98.0 AR ARMC Primäre ziliäre Dyskinesie Typ J98.0 AR RSPH Primäre ziliäre Dyskinesie Typ J98.0 AR DYX1C Primäre ziliäre Dyskinesie Typ J98.0 AR C21orf Primäre ziliäre Dyskinesie Typ J98.0 AR CCDC Primäre ziliäre Dyskinesie Typ J98.0 AR SPAG Primäre ziliäre Dyskinesie Typ J98.0 AR CCNO Primäre ziliäre Dyskinesie Typ J98.0 AR CCDC Primäre ziliäre Dyskinesie Typ J98.0 AR CENPF Primäre ziliäre Dyskinesie Typ J98.0 AR RSPH Humangenetik 195

196 Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Renal cysts and diabetes Syndrom (RCAD) Q61.8 AD HNF1B*, ** Renal-zystische Dysplasie, Suszeptibilität Q63.8 AD BICC Senior-Løken-Syndrom Typ Q61.5 AR NPHP1*, ** Senior-Løken-Syndrom Typ 2 - Q61.5 AR INVS Senior-Løken-Syndrom Typ 3 - Q61.5 AR NPHP Senior-Løken-Syndrom Typ Q61.5 AR NPHP Senior-Løken-Syndrom Typ Q61.5 AR IQCB Senior-Løken-Syndrom Typ Q61.5 AR CEP Senior-Løken-Syndrom Typ Q61.5 AR SDCCAG Senior-Løken-Syndrom Typ Q61.5 AR WDR Senior-Løken Syndrom Typ Q61.5 AR TRAF3IP Transposition der großen Gefäße Typ Q89.3 AD, AR GDF UMOD-assoziierte Nierenerkrankung - Q63.9 AD UMOD* Joubert-Syndrom Typ Q04.3 AR TCTN Joubert-Syndrom Typ Q04.3 AR CEP ?Joubert-Syndrom Typ Q04.3 AR KIAA Hydrolethalus-Syndrom AR HYLS RPGRIP Kurzrippen-Polytaktylie-Syndrom Typ Q77.2 AR DYNC2LI Kurzrippen-Thorax-Dysplasie mit oder ohne Q77.2 AR IFT Polytaktylie?Bardet-Biedel-Syndrom Typ Q87.89 AR IFT Primäre ziliäre Dyskinesie Typ J98.0 AR DNAJB Primäre ziliäre Dyskinesie Typ J98.0 AR GAS Primäre ziliäre Dyskinesie Typ J98.0 AR TTC RPGR Nephronophthise Typ Q61.5 AR DCDC Nephronophthise Typ Q61.5 AR MAPKBP * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Core Genes sind fett gedruckt 196

197 18.1 Bardet-Biedl-Syndrom (BBS) Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Beim Bardet-Biedl-Syndrom (BBS) handelt es sich um eine Ziliopathie, bei der eine Retinitis Pigmentosa, Nierenfunktionsstörungen und eine Polydaktylie in Kombination mit Adipositas, einem Hypogonadismus und Verhaltensauffälligkeiten beobachtet werden. Es handelt sich überwiegend um autosomal-rezessiv erbliche genetische Ursachen, allerdings wurde beim BBS auch eine sogenannte triallelische Vererbung beschrieben. Es können mehr als zwei Mutationen in mehr als einem Genlokus ursächlich sein, so dass zu einer autosomal-rezessiven Vererbung zweier Mutationen in einem Gen, noch eine weitere Mutation in einem anderen BBS-Gen als Modifikator zur klinischen Ausprägung der Erkrankung beitragen kann. Inzwischen wurden bereits 19 verschiedene BBS-Gene und weitere Modifikator-Gene beschrieben. Beim Alström-Syndrom handelt es sich um eine seltene Erkrankung, die phänotypische Ähnlichkeiten zum BBS zeigt und die durch autosomal-rezessive genetische Veränderungen im ALMS1-Gen verursacht wird. Zu den Symptomen des Alström-Syndroms gehören eine Retinitis Pigmentosa, eine Adipositas, Nieren- und Leberfunktionsstörungen, eine Insulin-Resistenz und Hyperinsulinämie sowie eine dilatative Kardiomyopathie. In etwa 80% der klinisch diagnostizierten untersuchten Fälle werden Mutationen in den bisher bekannnten BBS-Genen detektiert, wobei die Gene BBS1 und BBS10 bei Europäern am häufigsten betroffen sind (23 bzw. 20% der Fälle). Literatur Schmidts, J Pediatr Genet 3:46 (2014) / Barker et al, Organogenesis 10:96 (2014) / Romani et al, Lancet Neurol 12:894 (2013) / Ronquillo et al, Vision Res 75:88 (2012) / Brugmann et al, Am J Med Genet A 152A:2995 (2010) Bardet-Biedl-Syndrom ARL6, BBIP1, BBS1, BBS10, BBS12, BBS2, BBS4, BBS5, BBS7, BBS9, IFT27, LZTFL1, MKKS, MKS1, TRIM32, TTC8 24,8 kb Erweiterte Diagnostik Humangenetik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ARL6, BBIP1, BBS1, BBS10, BBS12, BBS2, BBS4, BBS5, BBS7, BBS9, IFT27, LZTFL1, MKKS, MKS1, TRIM32, TTC8 ALMS1, CCDC28B, CEP290, IFT172, IFT74, NPHP1, SDCCAG8, TMEM67, WDPCP 61,9 kb 18.2 Heterotaxie Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Der Begriff Heterotaxie wird für Patienten mit isoliertem Situs inversus verschiedenster Ausprägung verwendet, wobei hier oft auch Herzfehler und andere Organfehlbildungen wie z.b. Asplenie oder Polysplenie beobachtet werden. Bisher sind mehr als 10 Gene bekannt, die mit isolierter Heterotaxie assoziiert sind, meist handelt es sich um autosomal-dominant erbliche Ursachen, selten sind autosomal-rezessive und auch X-chromosomale Erbgänge beschrieben. Aufgrund der phänotypischen Überlappung wird vermutet, dass es sich bei einigen Patienten mit der klinischen Diagnose einer Heterotaxie auch um ein Kartagener- Syndrom handeln kann, welches zur Gruppe der sogenannten Primären ziliären Dyskinesien zählt, so dass dies bei der molekulargenetischen Diagnostik berücksichtigt werden sollte. Literatur Schmidts, J Pediatr Genet 3:46 (2014) / Barker et al, Organogenesis 10:96 (2014) / Romani et al, Lancet Neurol 12:894 (2013) / Ronquillo et al, Vision Res 75:88 (2012) / Brugmann et al, Am J Med Genet A 152A:2995 (2010) 197

198 Heterotaxie 1 ACVR2B, CFAP53, CRELD1, DNAI1, GDF1, LEFTY2, NODAL, NPHP4, ZIC3 Heterotaxie 2 ACVR2B, CFAP53, CRELD1, DNAI1, GDF1, LEFTY2, NODAL, NPHP4, ZIC3 15,4 kb 15,4 kb 18.3 Jeune-/Kurzrippen-Polydaktylie-Syndrom Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Beim Jeune-/Kurzrippen-Polydaktylie-Syndrom handelt es sich um eine in der Regel autosomal-rezessiv vererbte Erkrankung. Eine Nephronophthise in Kombination mit Kleinwuchs, schmalem Thorax mit kurzen Rippen, einer Polydaktylie und Retinopathie wird als Kurzrippen-Polydaktylie-Syndrom, Jeune-Syndrom oder auch als Ellis-van-Creveld-Syndrom bezeichnet. Diese Gruppe von Erkrankungen weist eine große Genlocus-Heterogenität auf, es sind derzeit mehr als 15 assoziierte Gene bekannt. Ähnlich der Nephronophthise wird das Jeune-/Kurzrippen-Polydaktylie-Syndrom zu den sogenannten Ziliopathien gezählt. Literatur Schmidts, J Pediatr Genet 3:46 (2014) / Barker et al, Organogenesis 10:96 (2014) / Romani et al, Lancet Neurol 12:894 (2013) / Ronquillo et al, Vision Res 75:88 (2012) / Brugmann et al, Am J Med Genet A 152A:2995 (2010) Jeune-/ Kurzrippen-Polydaktylie-Syndrom DYNC2H1, IFT80, NEK1, TTC21B, WDR34 24,6 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. DYNC2H1, IFT80, NEK1, TTC21B, WDR34 CEP120, CSPP1, DYNC2LI1, EVC, EVC2, IFT122, IFT140, IFT172, IFT43, IFT52, KIAA0586, TCTN3, WDR19, WDR35, WDR60 72,2 kb 18.4 Joubert-Syndrom Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Beim Joubert-Syndrom (JBTS) handelt es sich um eine autosomal-rezessive Erkrankung, die durch angeborene Fehlbildungen des Hirnstamms und Agenesie/Hypoplasie des Kleinhirnwurms ( molar tooth sign in der Magnetresonanztomographie) gekennzeichnet ist. Häufige Symptome in der Neonatalperiode sind eine Tachy-/Dyspnoe, Nystagmus, vertikale Blicklähmung und Muskelhypotonie. Später kann eine zerebelläre Ataxie mit Verzögerung der motorischen Entwicklung beobachtet werden. Die kognitive Entwicklung der Patienten kann von normaler Intelligenz bis hin zu schweren Defiziten reichen. In einigen Fällen kann das JBTS mit Nephronophthise (17-27% der Fälle), Sehnervkolobom, Leberfibrose und Polydaktylie assoziiert 198

199 sein. Die Häufigkeit für das Auftreten von JBTS wird mit ca. 1: angegeben. Das JBTS weist eine große Genlocus-Heterogenität auf. Bisher konnten Mutationen in multiplen Genen identifiziert werden, eine Mutationsanalyse ist daher umfangreich. Ähnlich der Nephronophthise wird das Joubert-Syndrom zu den sogenannten Ziliopathien gezählt. Literatur Knopp et al, Mol Cell Probes 29(5):299 (2015) / Wolf et al, Pediatr Nephrol 26:181 (2011) / Boltshauser & Isler, Neuropädiatrie 8:57 (1977) / Joubert et al, Neurology 19:813 (1969) Joubert Syndrom AHI1, CC2D2A, CEP290, NPHP1, RPGRIP1L, TMEM216, TMEM67 25,4 kb Erweiterte Diagnostik Humangenetik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. AHI1, CC2D2A, CEP290, NPHP1, RPGRIP1L, TMEM216, TMEM67 ARL13B, ATXN10, B9D1, C5orf42, CEP104, CEP41, CSPP1, HYLS1, INPP5E, KIAA0556, KIAA0586, KIF7, MKS1, OFD1, PDE6D, POC1B, TCTN1, TCTN2, TCTN3, TMEM138, TMEM231, TMEM237, TTC21B, ZNF423 85,4 kb 18.5 Meckel-Gruber-Syndrom Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Beim Meckel-Gruber-Syndrom (MKS) handelt es sich um eine autosomal-rezessiv vererbte Erkrankung. Sie ist gekennzeichnet durch Nierenzysten, okzipitale Enzephalozele und weitere Hirnfehlbildungen, Mikrophthalmie, Polydaktylie, Situs inversus, Gallengangsdysplasie, Leberzysten/Leberfibrose und pulmonale Hypoplasie. Neugeborene mit MKS versterben meist innerhalb der ersten zwei Lebenswochen. Oftmals wird schon pränatal bei der Ultraschall-Untersuchung an der Kombination der Fehlbildungen der Verdacht auf das Vorliegen eines MKS geäußert. Die Häufigkeit für das Auftreten von MKS wird mit ca. 1-8: angegeben, wobei die Häufigkeit in Populationen mit gehäuften Verwandtenehen deutlich erhöht ist. Ähnlich der Nephronophthise weist auch das MKS Genlocus-Heterogenie auf. Bisher konnten Mutationen in 18 Genen identifiziert werden, eine Mutationsanalyse ist daher sehr umfangreich. Das MKS zählt zu den sogenannten Ziliopathien. Zilien sind spezielle Zellfortsätze, die unterschiedliche Aufgaben erfüllen. Sie dienen u.a. als Mechano-, Chemo- und Osmosensoren. Desweiteren spielen sie eine entscheidende Rolle bei zahlreichen Signalwegen und sind für eine adäquate Organentwicklung, die Aufrechterhaltung der Gewebehomöostase und bei grundsätzlichen Entwicklungsprozessen wichtig. Literatur Knopp et al, Mol Cell Probes 29(5):299 (2015) / Sang et al, Cell 145:513 (2011) / Wolf et al, Pediatr Nephrol 26:181 (2011) 199

200 Meckel-Gruber Syndrom B9D1, B9D2, CC2D2A, CEP290, MKS1, RPGRIP1L, TCTN2, TMEM138, TMEM216, TMEM67 25,1 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. B9D1, B9D2, CC2D2A, CEP290, MKS1, RPGRIP1L, TCTN2, TMEM138, TMEM216, TMEM67 C5orf42, CEP41, CSPP1, KIF14, NPHP3, TCTN3, TMEM231, TMEM237, TTC21B 85,4 kb 18.6 Nephronophthise (NPHP) Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Bei NPHP handelt es sich um eine autosomal-rezessiv vererbte zystische Nierenerkrankung, die für 6 10% des terminalen Nierenversagens bei Kindern verantwortlich gemacht wird und damit ursächlich für ca. 10% der Nierentransplantationen im Kindesalter ist. Zusätzlich werden bei 10-15% der Patienten extrarenale Manifestationen, wie z.b. Retinitis Pigmentosa (Senior-Løken-Syndrom), okulomotorische Apraxie Typ Cogan (Cogan-Syndrom) sowie Sehnervkolobome und Kleinhirnwurmaplasie (Joubert-Syndrom) beobachtet. Die Häufigkeit für NPHP wird mit ca. 1: angegeben. Bei der NPHP sind immer beide Nieren in den Krankheitsprozess involviert. Makroskopisch fällt bei normal großen oder nur geringfügig verkleinerten Nieren oberflächlich eine feine Granulierung auf. Im Bereich der Rinden-Mark-Grenze bilden sich fünf bis mehr als 50 Zysten aus, die einen Durchmesser zwischen fünf und 15 mm einnehmen können. Lichtmikroskopisch werden im frühen Stadium der NPHP die charakteristischen Veränderungen einer stark verdickten tubulären Basalmembran sowie einer lymphohistiozytären, peritubulären Infiltration festgestellt, die später in eine diffus sklerosierende, tubulointerstitielle Nephropathie münden. Elektronenmikroskopisch können Verdickungen, Aufsplitterungen und Fältelungen mit Fibroblasteneinlagerung festgestellt werden. NPHP zählt zu den sogenannten Ziliopathien und weist eine große Genlocus-Heterogenität auf. Bisher konnten Mutationen in 25 Genen in Assoziation mit NPHP identifiziert werden. Bei ca. 85% der Patienten mit NPHP kann eine homozygote Deletion des NPHP1-Gens nachgewiesen werden. Literatur Chaki et al, Kidney Int 80:1239 (2011) / Hoefele et al, Der Nephrologe 2:372 (2007) / Hildebrandt et al, Pediatr Nephrol 16:168 (2001) / Hildebrandt et al, Kidney 51:261 (1997) 200

201 Nephronophthise (NPHP) CEP290, GLIS2, INVS, IQCB1, NPHP1, NPHP3, NPHP4 24,5 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. Humangenetik CEP290, GLIS2, INVS, IQCB1, NPHP1, NPHP3, NPHP4 AHI1, ANKS6, ATXN10, CC2D2A, CEP164, CEP83, DCDC2, IFT172, MAPKBP1, NEK8, PAX2, RPGRIP1L, SDCCAG8, SLC41A1, TMEM216, TMEM237, TMEM67, TTC21B, WDR19, XPNPEP3, ZNF423 83,4 kb Oro-fazio-digitales Syndrom (OFD) Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Typische Symptome der Oro-fazio-digitalen Syndrome sind kraniofaziale Fehlbildungen und Dysmorphien, Fehlbildungen der Finger und ZNS-Fehlbildungen. Gelegentlich werden auch polyzystische Nierenerkrankungen sowie Beteiligung von Leber und Pankreas beobachtet. Das OFD-Syndrom zählt zu den Differenzialdiagnosen von Meckel-Gruber-Syndrom und Joubert-Syndrom. Die häufigste Form des OFD-Syndroms, OFD-Syndrom Typ 1, wird X-chromosomal vererbt und ist embryonal letal im männlichen Geschlecht. Andere Subtypen des OFD-Syndroms folgen in der Regel einem autosomal-rezessiven Erbgang. Literatur Schmidts, J Pediatr Genet 3:46 (2014) / Barker et al, Organogenesis 10:96 (2014) / Romani et al, Lancet Neurol 12:894 (2013) / Ronquillo et al, Vision Res 75:88 (2012) / Brugmann et al, Am J Med Genet A 152A:2995 (2010) Oro-fazio-digitales Syndrom (OFD) C2CD3, C5orf42, DDX59, OFD1, TCTN3, TMEM216, TMEM231 23,7 kb 18.8 Polyzystische Nierenerkrankungen Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Die polyzystischen Nierenerkrankungen sind charakterisiert durch die progrediente Entwicklung flüssigkeitsgefüllter Zysten in allen Bereichen der Nephrone und Sammelrohre und die beiseitige Ausbildung vergrößerter, polyzystischer Nieren. Man unterscheidet die autosomal-dominante Form (ADPKD) von der autosomal-rezessiven Form der polyzystischen Nierenerkrankung (ARPKD). Während die ADPKD mit einer Lebenserwartung bis ins hohe Erwachsenenalter einhergeht, besteht bei Betroffenen mit einer ARPKD in der Regel eine verkürzte Lebenserwartung mit Auftreten multipler Nierenzysten oft bereits pränatal, in der Regel jedoch spätestens in den ersten Lebensjahren. Bei der ADPKD handelt es sich um bilateral auftretende unterschiedlich große Zysten, während bei der ARPKD bilaterale, multiple, gleichmäßig kleine Zysten charakteristisch sind. Die ARPKD hat eine Inzidenz von ca. 1: Molekulare Ursache sind Mutationen im PKHD1-Gen. Bei der ADPKD handelt es sich um die häufigste Form der polyzystischen Nierenerkrankungen. Gemäß EMA (European Medicines Agency) gilt sie innerhalb Europas als seltene Erkrankung, die mit einer Prävalenz 201

202 von etwa 1:2.500 auftritt. Sie kann bereits im Kindesalter mit Hämaturie, Bluthochdruck und Infektion der Nierenzysten beginnen. Zwischen dem 30. und dem 70. Lebensjahr tritt meist eine Niereninsuffizienz auf, die bei 50% der Patienten bis zum 60. Lebensjahr zum Nierenversagen führt. 95% der Patienten haben eine positive Familienanamnese. Molekulare Ursache sind Mutationen im PKD1- (85% der Fälle) und im PKD2- Gen (15% der Fälle). Bei PKD1-Mutationsträgern manifestiert sich die Erkrankung früher, und auch Nierenversagen tritt im Schnitt 20 Jahre früher auf als bei PKD2-Mutationsträgern (Genotyp-Phänotyp-Korrelation). Das PKD1-Gen umfasst 46 Exons, wobei der Bereich von Exon 1-32 weiter proximal auf Chromosom 16 in sechs duplizierten Kopien als Pseudogen vorkommt. Das PKD2-Gen umfasst 15 Exons. Die bisher identifizierten Punktmutationen in beiden Genen beinhalten alle Mutationstypen und sind über alle Exons verteilt. Genomische Deletionen sind bei ADPKD mit 4% für PKD1 und weniger als 1% für PKD2 relativ selten. Eine Ausnahme ist das TSC2/PKD1 Contiguous Gene Syndrome, bei dem große genomische Deletionen das PKD1-Gen sowie das daran angrenzende TSC2-Gen umfassen. Diese Patienten weisen allerdings klinische Symptome einer Tuberösen Sklerose mit der frühen Manifestation von Nierenzysten auf. Diese Mikrodeletionen können mittels FISH-Diagnostik erfasst werden. Die Sensitivität der Mutationsanalyse für PKD1 und PKD2 liegt bei Patienten, bei denen die klinischen Kriterien für ADPKD erfüllt sind, bei 75-90%. Die Genprodukte (Polycystin-1 und -2) sind transmembrane Glykoproteine der primären Zilien der Nierenepithelzellen, die über ihre zytoplasmatischen C-Termini miteinander interagieren. Somit gehören die polyzystischen Nierenerkrankungen zu den Ziliopathien. Der Polycystin1/Polycystin-2-Komplex ist über verschiedene Signaltransduktions-Kaskaden an Proliferation, Apoptose, Differenzierung, sowie der Regulation von Zellform und Durchmesser der Nierentubuli beteiligt. Die Entwicklung der Zysten folgt dem 2- Treffer-Modell, wonach zu der Keimbahnmutation in einem der beiden Gene ein zweites, somatisches Mutationsereignis im gleichen oder dem anderen PKD-Gen (Transheterozygotie) die Tumorsuppressorfunktion beider Proteine inaktiviert (Loss of Heterozygosity, LOH). Literatur Hoefele et al, Nephrol Dial Transplant 26:2181 (2011) / Harris et al, Nat Rev Nephrol 6:197 (2010) / Harris et al, Annu Rev Med 60:321 (2009) / Tan et al, Hum Mutat 30:264 (2009) / Consugar et al, Kidney Int 74:1468 (2008) / Kozlowski et al, Genomics 91:203 (2007) / Garcia-Gonzalez et al, Mol Genet Metab 92:160 (2007) / Rosetti et al, J Am Soc Nephrol 18:2143 (2007) / Klein et Mayer, Dade Behring News (2006) / Boucher et Sandford, Eur J Hum Genet 12: 347 (2004) / Wilson, N Engl J Med 350: 151 (2004) / Phakdeekitcharoen et al, J Am Soc Nephrol 12: 955 (2001) / Rosetti et al, Am J Hum Genet 68: 46 (2001) / Brook-Carter et al, Nature Genet 8: 328 (1994) Polyzystische Nierenerkrankung 1 - autosomal-dominant PKD1, PKD2 15,8 kb Erweiterte Diagnostik Polyzystische Nierenerkrankung 2 - autosomal-dominant BMP4, HNF1B, PAX2, 4,1 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. BMP4, HNF1B, PAX2, PKD1, PKD2 BICC1, CHD1L, FRAS1, MUC1, OFD1, PKHD1, ROBO2, SIX2, UMOD 60,7 kb 202

203 Polyzystische Nierenerkrankung 1 - autosomal-rezessiv PKHD1 12,2 kb Erweiterte Diagnostik Polyzystische Nierenerkrankung 2 - autosomal-rezessiv FRAS1 12,0 kb Humangenetik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. FRAS1, PKHD1 BICC1, BMP4, CHD1L, HNF1B, MUC1, OFD1, PAX2, PKD1, PKD2, ROBO2, SIX2, UMOD 60,7 kb 18.9 Primäre ziliäre Dyskinesie Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Bei den primären ziliären Dyskinesien (PCD) handelt es sich um autosomal-rezessive Erkrankungen, bei denen die Anlage und Bewegung des Flimmerepithels (Zilien) in den Atemwegen gestört ist, wodurch es zu einer Infektneigung der Atemwege, Nasennebenhöhlen und zu gehäuften Mittelohrentzündungen kommt. Des Weiteren kann es zu Fertilitätsstörungen durch Bewegungsstörung der Samenzellen oder Bewegungsstörung der Zilien in den Eileitern kommen. Bei zusätzlichem Auftreten einer seitenverkehrten Anlage der inneren Organe (Situs inversus) spricht man von einem Kartagener-Syndrom. Inzwischen sind bereits mehr als 30 Gene identifiziert worden, die mit PCD bzw. Kartagener-Syndrom assoziiert werden. Der Begriff Heterotaxie wird für Patienten mit isoliertem Situs inversus verschiedenster Ausprägung verwendet, wobei hier oft auch Herzfehler und andere Organfehlbildungen wie z.b. Asplenie oder Polysplenie beobachtet werden. Literatur Schmidts, J Pediatr Genet 3:46 (2014) / Barker et al, Organogenesis 10:96 (2014) / Romani et al, Lancet Neurol 12:894 (2013)/Ronquillo et al, Vision Res 75:88 (2012) / Brugmann et al, Am J Med Genet A 152A:2995 (2010) 203

204 Primäre ziliäre Dyskinesie CCDC39, DNAH5, DNAI1 18,8 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CCDC39, DNAH5, DNAI1 ARMC4, C21orf59, CCDC103, CCDC114, CCDC151, CCDC40, CCDC65, CCNO, CENPF, DNAAF1, DNAAF2, DNAAF3, DNAAF5, DNAH1, DNAH11, DNAH8, DNAI2, DNAJB13, DNAL1, DRC1, DYX1C1, GAS8, HYDIN, LRRC6, MCIDAS, NME8, OFD1, RPGR, RSPH1, RSPH3, RSPH4A, RSPH9, SPAG1, TTC25, ZMYND10 137,0 kb Senior-Løken-Syndrom Dipl.-Biol. Christina Sofeso, Dr. med. Sandra Wilson Beim Senior-Løken-Syndrom handelt es sich um eine autosomal-rezessiv vererbte Erkrankung. Eine Nephronophthise in Kombination mit einer Retinitis Pigmentosa wird als Senior-Løken-Syndrom bezeichnet. Diese Gruppe von Erkrankungen weist eine große Genlocus-Heterogenität auf, es sind derzeit acht assoziierte Gene bekannt. Ähnlich der Nephronophthise wird das Senior-Løken-Syndrom zu den sogenannten Ziliopathien gezählt. Literatur Schmidts, J Pediatr Genet 3:46 (2014) / Barker et al, Organogenesis 10:96 (2014) / Romani et al, Lancet Neurol 12:894 (2013) / Ronquillo et al, Vision Res 75:88 (2012) / Brugmann et al, Am J Med Genet A 152A:2995 (2010) Senior-Løken-Syndrom CEP290, INVS, IQCB1, NPHP1, NPHP3, NPHP4, SDCCAG8 25,0 kb Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. CEP290, INVS, IQCB1, NPHP1, NPHP3, NPHP4, SDCCAG8 TRAF3IP1, WDR19 31,1 kb 204

205 MGPS bei hereditärer Tumorprädisposition 19. Hereditäre Tumorsyndrome 19.1 Familiäres Mamma- und Ovarialkarzinom M.Sc. Anne Holtorf Etwa 5-10% aller Mamma- und Ovarialkarzinome sind erblich bedingt und folgen einem autosomal-dominanten Erbgang. Das Deutsche Konsortium Familiärer Brust- und Eierstockkrebs (GC-HBOC) hat zur Identifizierung dieser Hochrisiko-Patienten Einschlusskriterien erstellt: - Mindestens 3 Frauen aus der gleichen Linie einer Familie erkrankten an Brustkrebs (unabhängig vom Alter); - Mindestens 2 Frauen, davon 1 jünger als 50 Jahre, aus der gleichen Linie einer Familie erkrankten an Brustkrebs; - Mindestens 2 Frauen aus der gleichen Linie einer Familie erkrankten an Eierstockkrebs; - Mindestens 1 Frau erkrankte an Brustkrebs und 1 weitere Frau an Eierstockkrebs, oder 1 Frau erkrankte an Brust- und Eierstockkrebs; - Mindestens 1 Frau unter 36 Jahren erkrankte an Brustkrebs; - Mindestens 1 Frau unter 50 Jahren erkrankte an bilateralem Brustkrebs; oder - Mindestens 1 Mann erkrankte an Brustkrebs und 1 Frau an Brust- oder Eierstockkrebs. Humangenetik Eine molekulargenetische Untersuchung bei V.a. HBOC kann nur bei Erfüllung eines der Einschlusskriterien durchgeführt werden. Derzeit kann die Diagnostik bei Vorliegen eines triple-negativen Mammakarzinoms nur im Rahmen der Forschung durchgeführt werden, oder bei einem rezidivierenden high-grade serösen Ovarialkarzinom am Tumormaterial zur Frage einer möglichen Therapie mit PARP-Inhibitoren. Bei ca. 24% der Betroffenen einer HBOC-Familie wird eine kausale Mutation in den Genen BRCA1 oder BRCA2 nachgewiesen. Patienten mit nachgewiesener BRCA1/2-Mutation besitzen ein deutlich erhöhtes Risiko, an einem Mamma-, Ovarialkarzinom oder an weiteren Tumoren zu erkranken. Die Analyse dreier weiterer Gene bei V.a. HBOC ist fakultativer Bestandteil der Regelleistung (EBM Kap , Ziffer 11440). Durch die Untersuchung von CHEK2, PALB2 und RAD51C können in weiteren ca. 5% der erblichen Brust- /Ovarialkarzinomfamilien kausale Mutationen nachgewiesen werden. Pathogene Varianten in CHEK2 und PALB2 sind mit einem erhöhten Risiko für Brustkrebs assoziiert, RAD51C-Mutationen gehen vor allem mit einem erhöhten Ovarialkarzinomrisiko einher. Betroffenen mit einer nachgewiesenen kausalen Mutation in einem der fünf Gene wird gemäß den S3-Leitlinien ein engmaschiges Vorsorgeprogramm empfohlen. Bei unauffälligem Befund kann eine erweiterte Diagnostik angeschlossen werden. Das Dt. Konsortium Familiärer Brust- und Eierstockkrebs empfiehlt die Untersuchung der Gene ATM, NBN und RAD51D, welche mit einem moderat erhöhten Risiko für die Entstehung von Mamma- bzw. Ovarialkarzinomen assoziiert sind. Zusätzlich gehen die Tumorprädispositionssyndrome Li-Fraumeni-Syndrom (TP53) und das hereditäre diffuse Magenkarzinom (CDH1) mit einem deutlich erhöhten Brustkrebsrisiko für Anlageträger einher. Schätzungsweise 5-6% der HBOC-Familien tragen kausale Varianten in einem dieser fünf Gene. Die erweiterte molekulargenetische Diagnostik ist nur nach vorangegangener Beantragung bei und Genehmigung durch die zuständige Krankenkasse möglich (Stufe II, EBM Kap , Ziffer 11490). Die Paneldiagnostik wird i.d.r. bei Indexpatienten durchgeführt. Die molekulargenetische Untersuchung von gesunden Risikopersonen wird nur gezielt auf die in der Familie bereits nachgewiesene Mutation vorgenommen, vorausgesetzt eine genetische Beratung der/des Ratsuchenden ist zuvor erfolgt. Literatur Kast et al, J Med Genet 53:465 (2016) / Scalia-Wilbur et al, Semin Radiat Oncol 26:3 (2016) / Meindl et al, medgen 27:202 ( 2015) / Muendlein et al, J Cancer Clin Oncol; 141:2005 (2015) / Minion et al, Gynecol Oncol 137:86 (2015) / Song. et al, Hum Mol Genet; 23:4703 (2014) / S3-Leitlinie für die Diagnostik, Therapie und Nachsorge des Mammakarzinims, Langversion 3.0 (2012) / TCGA Network Nature; 474: 609 (2011) Familiäres Mamma- und Ovarialkarzinom Mutationssuche, Deletions-/Duplikationsdiagnostik entspr. EBM Kapitel GOP BRCA1, BRCA2, CHEK2, PALP2, RAD51C Kapitel

206 Familiäres Mamma- und Ovarialkarzinom Erweiterte Diagnostik EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik, dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ATM, CDH1, NBN, RAD51D, TP53 Erkrankungen, OMIM, ICD-10, Gene bei familiärem Mamma- und Ovarialkarzinom Stufe I: Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Familiäres Mamma- und Ovarialkarzinom (Stufe I) Aufgrund der kleinen Größe der Familien werden die Amsterdam-II-Kriterien heute jedoch nur selten erfüllt. In diesen Fällen können die revidierten Bethesda-Kriterien zunächst Hinweise auf Vorliegen eines HNPCC- C50.- C56.- BRCA1 *, # BRCA2 *, # CHEK2 *, ## PALB2 *, ## RAD51C *, ## * auch einzeln anforderbar # obligat ## fakultativ Core Genes sind fett gedruckt Erkrankungen, OMIM, ICD-10, Gene bei familiärem Mamma- und Ovarialkarzinom Stufe II: Familiäres Mamma- und Ovarialkarzinom (Stufe II) C50.- C56.- ATM *,** CDH1 *,** NBN * RAD51D *,** TP53 *,** * auch einzeln anforderbar ** Duplikations-/Deletionsanalyse mittels MLPA 19.2 Hereditäres nicht-polypöses Kolonkarzinom (HNPCC) M.Sc. Anne Holtorf Das kolorektale Karzinom (CRC) ist eine der häufigsten Tumorentitäten der westlichen Industrienationen. Etwa 2-3% aller CRC werden dem Hereditären nicht-polypösen Kolonkarzinom Syndrom (HNPCC- oder Lynch-Syndrom) zugeschrieben und werden durch Mutationen in einem der vier DNA-Mismatch-Reparaturgene MLH1, MSH2, MSH6 oder PMS2, und seltener durch Deletionen größerer Genabschnitte in EPCAM verursacht. Für Mutationsträger liegt das durchschnittliche Erkrankungsalter vor dem 50. Lebensjahr. Neben dem Kolonkarzinom ist für weibliche Anlagenträger das Risiko für Endometriumkarzinome stark erhöht. Außerdem gehören Ovarial-, Magen- und Urothelkarzinome, sowie Karzinome des Dünndarms zum Tumorspektrum des HNPCC-Syndroms. Eine seltene phänotypische Variante des HNPCC-Syndroms ist das Muir-Torre-Syndrom, bei dem zusätzlich Talgdrüsentumoren und Keratoakanthome der Haut bei Betroffenen beobachtet werden. Ein HNPCC-/Lynch-Syndrom liegt definitionsgemäß vor, wenn alle der sogenannten Amsterdam-II-Kriterien erfüllt sind: - Mindestens drei Familienangehörige mit histologisch gesichertem kolorektalen oder HNPCC-assoziiertem Karzinom; - Ein Erkrankter ist erstgradig mit den beiden anderen verwandt; - Erkrankungen in mind. zwei aufeinanderfolgenden Generationen; - Mindestens ein Patient mit der Diagnose kolorektales Karzinom vor dem 50. Lebensjahr; - Ausschluss einer familiären adenomatösen Polyposis (FAP). 206

207 Syndroms liefern: - Person mit kolorektalem Karzinom vor dem 51. Lebensjahr; - Person mit synchronen oder metachronen HNPCC-assoziierten Tumoren; - Person mit kolorektalem Karzinom mit MSI-Histologie vor dem 61. Lebensjahr; - Person mit kolorektalem Karzinom (unabhängig vom Alter) und einem Verwandten 1. Grades, bei dem ebenfalls ein HNPCC-assoziierter Tumor vor dem 51. Lebensjahr; - Person mit kolorektalem Karzinom (unabhängig vom Alter) und mind. zwei Verwandten 1. oder 2. Gra des, bei denen auch ein HNPCC-assoziierter Tumor diagnostiziert wurde (unabhängig vom Alter). Ist eines der revidierten Bethesda-Kriterien erfüllt, so wird zunächst eine molekularpathologische Untersuchung am Tumorgewebe durchgeführt, wobei die Genprodukte von MLH1, MSH2, MSH6 und PMS2 immunhistochemisch angefärbt werden und/oder eine Mikrosatelliten-Analyse durchgeführt wird. Je nach Befund werden anschließend bei nachgewiesener Mikrosatelliteninstabilität und/oder immunhistochemischem Ausfall der MLH1-/PMS2-Proteine bzw. MSH2-/MSH6-Proteine die jeweiligen Gene molekulargenetisch analysiert (EBM Kap , Ziffer 11431). Die Untersuchung aller vier Gene ist nur möglich, wenn keine molekularpathologischen Untersuchungen am Tumormaterial durchgeführt werden können oder kein Tumormaterial zur Verfügung steht (EBM Kap , Ziffer 11432). Humangenetik Literatur Da Silva et al, Anticancer Res 36:4399 (2016) / Peltomäki Fam Cancer 15:385 (2016) / Shai et al, Fam Cancer 13:499 (2014) / Steinke et al, Dtsch Arztebl Int 110:32 (2013) / Holinski-Feder et al,medgen 18:246 (2006) Hereditäres nicht-polypöses Kolonkarzinom (HNPCC) Mutationssuche, Deletions-/Duplikationsdiagnostik entspr. EBM Kap , Ziffer MLH1, PMS2 oder MSH2, MSH6 (und Deletionsdiagnostik EPCAM) Hereditäres nicht-polypöses Kolonkarzinom (HNPCC) wenn kein Tumormaterial untersucht werden kann Mutationssuche, Deletions-/Duplikationsdiagnostik entspr. EBM Kap , Ziffer MLH1, MSH2, MSH6, PMS2, Deletionsdiagnostik EPCAM Erkrankungen, OMIM, ICD-10, Gene bei hereditärem nicht-poypösem Kolonkarzinom Erkrankung OMIM-P ICD-10 Gen OMIM-Gen HNPCC (Lynch-Syndrom) C18.- MLH1*,** MSH2*,** MSH6*,** PMS2*,** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 19.3 Gastrointestinale Polyposis-Syndrome M.Sc. Anne Holtorf Etwa 1-2% aller kolorektalen Karzinome (CRC) sind auf gastrointestinale Polyposis-Syndrome zurückzuführen. Mitunter lassen sich erbliche Polyposis-Syndrome durch die Anzahl und Verteilung der Polypen sowie dem histologischen Befund gut voneinander abgrenzen. Bei der Familiären adenomatösen Polyposis (FAP, attenuierte FAP) und der MUTYH-assoziierten Polyposis (MAP) werden hauptsächlich adenomatöse Kolonpolypen diagnostiziert. Die Anzahl der Polypen kann dabei zwischen 10 und über 1000 schwanken. Das Gardner-Syndrom und das Turcot-Syndrom sind phänotypische Varianten der FAP, bei denen zusätzlich zu intestinalen Polypen bestimmte extrakolonische Manifestationen bereits im Säuglings-/Kleinkindalter diagnostiziert werden: bei Betroffenen des Gardner-Syndroms werden neben kolonischen Manifestationen auch gutartige Tumoren der Knochen, der Haut und des Bin- 207

208 degewebes beobachtet. Beim Turcot-Syndrom manifestieren sich auch Hirntumoren. Die FAP wird durch Mutationen im APC-Gen ausgelöst und folgt einem autosomal-dominanten Erbgang. Die MUTYH-assoziierte FAP wird autosomal-rezessiv vererbt. Für das juvenile Polyposis-Syndrom (JPS) und das Peutz-Jeghers-Syndrom (PJS) sind harmatomatöse Polypen charakteristisch. Die Symptomatik und die Anzahl der Polypen ist mitunter sehr variabel, auch innerhalb einer Familie, so dass nicht immer eine eindeutige Verdachtsdiagnose gestellt werden und daher eine umfangreichere Diagnostik sinnvoll sein kann. Charakteristisch für PJS sind Pigmentflecken, die auf der Haut und den Schleimhäuten entstehen und häufig bereits im Alter von 2 Jahren beobachtet werden. Die juvenile Polyposis wird durch Mutationen in den Genen SMAD4 oder BMPR1A ausgelöst. PJS entsteht aufgrund von STK11-Mutationen. Beide Syndrome werden autosomal-dominant vererbt. Literatur Brosens L.A. et al. Adv Exp Med Biol 908:347 (2016) / Waller A. et al. J Pediatr Genet 5:78 (2016) / Syngal S. et al., Am J Gastroenterol 110:223 (2015) / Vieira J. et al., Eur J Hum Genet 23:715 (2015) / Jung I. et al. World J Gastointest Oncol 7:347 (2015) / Half E. et al., Orphanet J Rare Dis 4:22 (2009) FAP/aFAP/MAP Mutationssuche, Deletions-/Duplikationsdiagnostik entspr. EBM Kap , Ziffer und APC, MUTYH 10,2 kb Erkrankungen, OMIM, ICD-10, Gene bei familiärer adenomatöser Polyposis coli Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Familiäre Adenomatöse Polyposis, (FAP, afap) D12.6 APC *,** MUTYH-assoziierte Polyposis (MAP) D12.6 MUTYH * * auch einzeln anforderbar ** Duplikations-/Deletionsanalyse mittels MLPA Gastrointestinale Polyposis-Syndrome Mutationssuche, Deletions-/Duplikationsdiagnostik entspr. EBM Kap , Ziffer und APC, MUTYH, SMAD4, BMPR1A, STK11 Erkrankungen, OMIM, ICD-10, Gene bei Polyposis coli-syndrom * auch einzeln anforderbar ** Duplikations-/Deletionsanalyse mittels MLPA 16,1 kb Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Familiäre Adenomatöse Polyposis(FAP, afap) D12.6 APC *,** MUTYH-assoziierte Polyposis (MAP) D12.6 MUTYH * Juvenile Polyposis-Syndrom (JPS) D12.6 SMAD4 *,** BMPR1A *,** Peutz-Jeghers Syndrom (PJS) Q85.8 STK11 *,**

209 19.4 Multiple Endokrine Neoplasien M.Sc. Anne Holtorf Als multiple endokrine Neoplasien (MEN) werden verschiedene, erbliche Syndrome bezeichnet, die die Ausbildung benigner und maligner Läsionen von endokrinen Drüsen begünstigen. Prinzipiell unterscheidet man das MEN1-, MEN2- und MEN4-Syndrom. Beim MEN1-Syndrom treten hauptsächlich Adenome od. maligne Tumoren der Nebenschilddrüse (primärer Hyperparathyreoidismus), Adenome od. maligne Tumoren des endokrinen Duodenums und Pankreas, sowie der Adenohypophyse auf. Das MEN1-Syndrom wird autosomal-dominant vererbt und durch Mutationen im MEN1-Gen hervorgerufen. Die Prävalenz von MEN1 wird auf etwa 1: geschätzt. Die Nebenschilddrüse und die Hypophyse sind auch beim MEN4-Syndrom am häufigsten betroffen. Hier können außerdem Tumoren der Reproduktionsorgane, der Nieren oder Nebennieren beobachtet werden. Das betroffene Gen ist CDKN1B. Das MEN4-Syndrom ist äußerst selten, aktuell wird die Prävalenz auf 1: geschätzt. Vermutlich sind etwa 3% der Patienten mit MEN1-assoziierten Manifestationen vom MEN4-Syndrom betroffen. Leitsymptom des MEN2-Syndroms ist das medulläre Schilddrüsenkarzinom, das bereits im Kindesalter auftreten kann. Es werden drei klinische Unterformen von MEN2 unterschieden. Beim MEN2A-Syndrom werden neben dem Schilddrüsenkarzinom in 50% der Patienten Phäochromozytome und 30% Nebenschilddrüsenadenome manifest. Beim MEN2B-Syndrom sind ebenfalls nahezu alle Patienten von einem Schilddrüsenkarzinom betroffen, welches sich bereits im Säuglings- oder Kleinkindalter entwickeln kann. Außerdem ist MEN2B charakterisiert durch das Auftreten von Phäochromozytomen, einem typisch marfanoiden Habitus, intestinalen Ganglioneuromatosen und Schleimhautneuromatosen. Beim Familiären medullären Schilddrüsenkarzinom (FMTC) entwickeln die Patienten ausschließlich Schilddrüsentumoren. Ursächlich für alle Varianten des MEN2-Syndroms sind Mutationen im RET-Gen. Literatur Thakker R.V. J Intern Med 280:574 (2016) / Schernthaner-Reiter M.H. et al, Neuroendocrinology 103:18 (2016) / Romei C. et al, Nat Rev Endocrinol 12:192 (2016) / Minnetti M. and Grossman A. Best Pract Res Clin Endocrinol Metab 30:115 (2016) / Pappa T. und Alevzaki M. Endocrine 53:7 (2016) Humangenetik Multiple endokrine Neoplasien Mutationssuche, Deletions-/Duplikationsdiagnostik entspr. EBM Kap , Ziffer und MEN1, RET, CDKN1B 5,8 kb Erkrankungen, OMIM, ICD-10, Gene bei multipler endokriner Neoplasie Erkrankung OMIM-P ICD-10 Gen OMIM-Gen MEN D44.- MEN1 *,** MEN2A MEN2B FMTC C73 D44.- RET * MEN D44.- E21.0 * auch einzeln anforderbar ** Duplikations-/Deletionsanalyse mittels MLPA CDKN1B *,**

210 19.5 Phäochromozytom/Paragangliom M.Sc. Anne Holtorf Phäochromozytome und Paragangliome sind seltene, neuroendokrine Tumoren mit einer Prävalenz von etwa 1-9/ , die aus sympathischen oder parasympathischen Ganglien entstehen und vom Kopf bis ins Becken auftreten können. Phäochromozytome sind Paragangliome, die sich aus den Neuronen des Nebennierenmarks heraus entwickeln. Phäochromozytome und Paragangliome sind meist durch eine übermäßige Produktion und Sekretion von Katecholaminen gekennzeichnet sind, Betroffene zeigen daher häufig anfallsartig oder dauerhaft erhöhten Blutdruck und eine erhöhte Herzfrequenz. Bei etwa einem Drittel aller Phäochromozytome/Paragangliome sind pathogene Varianten in verschiedenen Genen ursächlich für das Auftreten der Erkrankung. Von diesen genetisch bedingten Phäochromozytomen/ Paragangliomen sind wiederum etwa ein Drittel auf Mutationen in den Genen SDHA, SDHAF2, SDHB, SDHC, SDHD oder MAX zurückzuführen. Des Weiteren können die Läsionen im Rahmen eines MEN2-Syndroms (RET) oder des von Hippel-Lindau Syndroms (VHL) auftreten, vor allem wenn sich die Tumoren in einem jungen Alter entwickeln. Außerdem werden sie bei Neurofibromatose Typ I Patienten (NF1) beobachtet. Es sind weitere Gene beschrieben, die mit dem Auftreten von Paragangliomen/Phäochromozytomen diskutiert werden, die aber in weiteren Studien nicht bestätigt werden konnten. Literatur Bausch B. et al. JAMA Oncol epub ahead of prind (2017) / Gunawardane P.T. und Grossman A. Adv Exp Med Biol epub ahead of print (2016) / Lenders J.W. et al. J Clin Endocrinol Metab 99:1915 (2014)/ Gimenez-Roqueplo A-P et al. Horm Metab Res 44:328 (2012) / Neumann HP et al. N Engl J Med 346:1459 (2002) Phäochromozytom/Paragangliom Mutationssuche, Deletions-/Duplikationsdiagnostik entspr. EBM Kap , Ziffer und SDHA, SDHAF2, SDHB, SDHC, SDHD, MAX, VHL, RET 8,8 kb Erkrankungen, OMIM, ICD-10, Gene bei Phäochromozytom/Paragangliom Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Phäochromozytom/Paragangliom-Syndrom Paragangliom I, Phäochromozytom Paragangliom II Paragangliom III Paragangliom IV, Phäochromozytom Paragangliom V Phäochromozytom MEN2A MEN2B C74.1 D35.- D44.7 * auch einzeln anforderbar ** Duplikations-/Deletionsanalyse mittels MLPA SDHD *,** SDHAF2 *,** SDHC *,** SDHB *,** SDHA *,** MAX *,** D44.- RET * Von Hippel-Lindau-Syndrom Q85.8 VHL*,**

211 neonatalis bei Erkrankung des Neugeborenen 20.1 neonatalis basic Das Neugeborenen-Screening dient als bevölkerungsmedizinische Präventionsmaßnahme der frühzeitigen Erkennung und qualitätsgesicherten Therapie aller Neugeborenen mit bestimmten behandelbaren endokrinen und metabolischen Störungen. Die genetische Diagnostik dient dabei in der Regel der Diagnosesicherung des Screeningbefundes sowie in manchen Fällen auch der Therapieplanung. Falls aufgrund des Screening-Resultats bereits ein betroffenes Enzym als defekt identifiziert werden konnte, erfolgt die gezielte genetische Untersuchung des relevanten Gens zumeist mittels Sanger-Sequenzierung. Die parallele Sequenzierung aller Gene des Neugeborenen-Screenings mittels NGS-Panel ist alternativ bei schwer erkrankten Neugeborenen und unklarer Biochemie möglich. Literatur Nennstiel-Ratzel et al, AWMF Leitlinie 024/012 Neugeborenen-Screening auf angeborene Stoffwechselstörungen und Endokrinopathien (2011) Humangenetik Erkrankung OMIM-P ICD-10 Gen OMIM-Gen Adrenogenitales Syndrom (AGS) E25.09 CYP21A2*,** Ahornsiruperkrankung (MSUD) E71.0 BCKDHB* BCKDHA* Ahornsiruperkrankung Typ E71.0 DBT* Biotinidase-Defizienz E71.0 BTD* Carnitin-Palmitoyl-Transferase-Mangel Typ1A E71.1 CPT1A* Carnitin-Palmitoyl-Transferase-Mangel Typ E71.1 CPT2* Carnitin Acylcarnitin Translokase Defizienz (CACTD) E71.1 SLC25A Galaktosämie E74.2 GALT*,** Glutarazidurie Typ I E72.9 GCDH* Isovalerianazidämie E71.1 IVD* Mittelketten-Acyl-CoA-Dehydrogenase Defizienz (MCAD) E71.- ACADM* Very Long Chain-Acyl-CoA-Dehydrogenase Defizienz (VLCAD) E71.3 ACADVL*,** Long Chain-Acyl-CoA-Dehydrogenase Defizienz (LCHAD) E71.- HADHA* Phenylketonurie/Hyperphenylalaninämie (PKU/HPA) E70.0/ E70.01 PAH*,** * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 20.2 neonatalis extended (> 600 Gene) Schwere und schwerste Erkrankungen des Neugeborenen können auch auf monogen vererbten, meist seltenen Erkrankungen beruhen, die nicht immer durch das Neugeborenen-Screening erfasst werden. Für die prognostische Einschätzung und eine mögliche Therapie ist eine rasche Diagnostik essentiell. Da manche Erkrankungen nur durch aufwendige Stoffwechseluntersuchungen diagnostiziert werden können, stellt die genetische Diagnostik mittels umfangreichen NGS-Panels eine ergänzende Möglichkeit der Ursachenklärung dar. Das neonatalis extended - Panel soll primär der raschen Diagnosefindung, Früherkennung bzw. Bestätigung von schwerwiegenden Erkrankungen des Neugeborenen, Säuglings und Kleinkindes dienen, die mittels herkömmlicher Nachweisverfahren nur durch (zeit-)aufwendige Testverfahren nachgewiesen werden können. Derzeit können verschiedene Erkrankungsgruppen bereits als Panel angefordert werden. Für Rückfragen stehen wir jederzeit gerne zur Verfügung. Literatur Soden et al, Sci Transl Med, 6(265): 265ra168 (2014) / Saunders et al, Sci Transl Med.4(154):154ra135.(2012) 211

212 neonatalis extended Schematische Darstellung der phänotypischen und genetischen Heterogenität bei Erkrankungen des Säuglings und Kleinkinds. Die größte und wichtigste Erkrankungsgruppe stellt genetisch bedingte Stoffwechselerkrankungen dar, die sowohl im Kingsmore Panel wie auch im neonatalis extended Panel enthalten sind. Auf therapierbare Stoffwechseldefekte wird heute fast jedes Neugeborene in den westlichen Industrienationen durch das Neugeborenen-Screening mittels Tandem-Massenspektrometrie untersucht (s. auch Tabelle auf S. 211). Die biochemischen Untersuchungsergebnisse können bei Bedarf durch eine genetische Untersuchung (neonatalis basic) bestätigt werden. Bei schwerer Erkrankung des Säuglings und Kleinkinds kann in bestimmten Fällen eine breit angelegte genetische Paneluntersuchung zur Diagnosefindung beitragen. Seit ein paar Jahren wird hierzu das sog. Kingsmore-Panel angeboten, welches jedoch einige Gene, die mit schweren Erkrankungen des Säuglings und Kleinkinds assoziiert sind, nicht enthält (diagnostische Lücke). Aus diesem Grund wurde in unserem Haus ein erweitertes Panel (neonatalis extended, ca. 600 Gene) entwickelt, welches z.b. auch weitere neuromuskuläre Erkrankungen, epileptische Enzephalopathien oder Syndrome enthält. Das neonatalis extended Panel ist keine Regelleistung, d.h. es muss eine Kostenübernahme beim Versicherer beantragt werden 212

213 Clinical Exome Sequencing (CES)/Whole Exome Sequencing (WES) 21. CES/WES Dr. med. Imma Rost, Dr. med. Sandra Wilson Da Entwicklungsstörungen sehr oft sporadisch, d.h. als Einzelfall in der Familie auftreten, ist es naheliegend, Neumutationen in Genen, die z.b. bedeutsam für die Entwicklung und Verschaltung von Neuronen sind, als häufige Ursache zu vermuten, zumal der Mensch eine hohe Neumutationsrate aufweist. Mehrere Studien in den letzten beiden Jahren, in denen Patienten mit schwerer Intelligenzminderung (IQ<50) mittels neuer Hochdurchsatz-Techniken wie der Exom-Sequenzierung untersucht wurden, konnten bestätigen, dass dominante Neumutationen offenbar zu einem großen Teil zur Ursache der schweren Intelligenzminderung beitragen (z. B. Vissers L. et al, Nat Genet, 2010, de Ligt, J. et al, NEJM, 2012 und Rauch, A. et al, Lancet, 2012). Während bei chromosomalen Trisomien das Risiko mit dem mütterlichen Alter steigt, nimmt die Rate an dominanten Neumutationen mit dem väterlichen Alter zu (Veltman JA et al, Nat Rev Genet, 2012). Bei den untersuchten Patienten wurden Varianten in verschiedenen Genen gefunden, wobei in der Studie von de Ligt et al bei 16% der Patienten eine kausale Mutation in einem bereits im Zusammenhang mit Entwicklungsstörungen beschriebenen Gen gefunden wurde, bei Rauch et al bei 35% der Patienten. Man geht daher nach diesen Studien davon aus, dass bis zu 30% der schweren, nicht-syndromalen Entwicklungsstörungen durch de novo Punktmutationen und kleine Indels verursacht werden, wobei eine große genetische Heterogenität zu beobachten ist. Darüber hinaus spielen auch autosomal-rezessive Mutationen bei den Entwicklungsstörungen eine wichtige Rolle (ursächlich bei ca % der Betroffenen) sowie Mutationen X-chromosomaler Gene (ursächlich bei ca. 5-10% der männlichen Betroffenen). Mutationen in noch unbekannten bzw. nicht im Zusammenhang mit Entwicklungsstörungen bekannten Genen erfordern einen immensen Aufwand, einschließlich funktioneller Tests, um den ursächlichen Zusammenhang zu beweisen. Daher ist die Gesamtgenom-Sequenzierung noch nicht für den Routineeinsatz geeignet. Denkbar als Diagnostik ist aber bereits die simultane Sequenzierung aller Exons Gene, die mit neurologischen bzw. Entwicklungsstörungen in Zusammenhang stehen und die bereits in den Datenbanken gelistet sind, mittels WES. Um bei der aufwendigen Auswertung vererbte genetische Varianten erkennen zu können, sollten bei dieser Fragestellung immer Trios, d.h. das betroffene Kind und seine Eltern, untersucht werden. Humangenetik Unter Anwendung von Next Generation Sequencing ist also zu erwarten, dass ein weiterer Anteil von wahrscheinlich ca. 30% der bisher ungeklärten schweren Entwicklungsstörungen ursächlich definiert werden kann. Die diagnostische Vorgehensweise könnte daher in Zukunft wie im Diagramm dargestellt, verlaufen. Vor der Untersuchung mit WES muss immer eine genetische Beratung erfolgen. Inhalt der Beratung ist dabei auch, wie mit zusätzlichen Informationen, die neben der eigentlichen Indikation bei der Untersuchung einer Vielzahl von Genen anfallen können, umgegangen werden soll. Bei Minderjährigen würden z.b. entsprechend dem GenDG Gene, die spätmanifestierende Erkrankungen verursachen können, nicht in die Auswertung einbezogen. 213

214 Zusätzlich zu der Diagnostik von Entwicklungsstörungen kann WES genutzt werden, um die bestehende Diagnostik bei einer gezielten Fragestellung bzw. Verdachtsdiagnose zu erweitern. Auch die Untersuchung mit WES ist derzeit keine Regelleistung der Krankenkassen. Vor der Untersuchung muss daher eine Kostenübernahme bei der Krankenversicherung beantragt werden. WES unterliegt den Regelungen des Gendiagnostik-Gesetzes (GenDG), d.h. es ist eine ausführliche Aufklärung und eine schriftliche Einwilligung sowie vor prädiktiven Analysen (d.h. Untersuchung von Gesunden) zusätzlich eine genetische Beratung erforderlich. Da der Untersuchungsansatz sehr viele krankheitsassoziierte Gene umfasst, bieten wir für bestimmte Erkrankungen (z.b. hereditäre Krebserkrankungen oder neurodegenerative Erkrankungen) eine Wahlmöglichkeit, diese Gene in die Auswertung mit einzubeziehen oder auszublenden (Opt-in/Opt-out). Außerdem muss über die Möglichkeit von Zusatzbefunden aus der gleichen Indikationsgruppe informiert und die Wahlmöglichkeit festgelegt werden. CES/WES sind keine Regelleistungen - dzt. nur nach genehmigter Kostenübernahme durch den Versicherer oder im Rahmen der Forschung. 214

215 Ultradeep Sequencing einzelner Gene bei Seltenen Erkrankungen 22. Nachweis von Mosaiken am Beispiel des Tuberöse Sklerose Complex (TSC) Dr. rer. nat. Karin Mayer Mit den bisher eingesetzten Routineverfahren zur Mutationssuche (Sanger-Sequenzierung) kann z.b. bei Tuberöse Sklerose Complex (TSC) bei % der Patienten mit klinisch gesicherter Diagnose molekulargenetisch keine Ursache nachgewiesen werden. Bei einem Teil dieser Patienten liegen genetische Mosaike in verschiedenen Geweben in z. T. unterschiedlichem Ausmaß vor, wobei der Anteil der Zellen mit Mutation im TSC1- oder TSC2-Gen im untersuchten Gewebe unter der Nachweisgrenze der Sanger-Sequenzierung liegt. Ein weiterer Anteil von Mutationen befindet sich in den regulatorischen Regionen beider TSC-Gene. Durch die Analyse der gesamten genomischen Regionen beider TSC-Gene mit einer Sequenziertiefe (coverage) von x ist es möglich, Mosaike mit <1 % Mutationsanteil und Intronmutationen jenseits der Exon/Intron-Übergänge zu detektieren. Literatur Nellist et al, BMC Med Genet 16:10 (2015) / Mayer et al, Eur J Hum Genet 20 (Supp1): Abstract P11.132, 287 (2012) / Qin et al, Hum Genet 127:573 (2010) / Mayer K et al, Biochim Biophys Acta 1502:495 (2000) Humangenetik Nachweis einer Mutation (SNV) in 7% der reads Nachweis von Intron-Mutationen: Beispiel TSC2 c c>t Tuberöse Sklerose Complex (TSC) EBM Kapitel , GOP Mutationssuche bis 25 kb TSC1, TSC2 8,9 kb Tuberöse Sklerose Complex (TSC) Erweiterte Diagnostik Mutationssuche und Deletions-/Duplikationsanalyse in 110,7 kb gesamtgenomischer Sequenz mit >1000x coverage (nur nach genehmigter Kostenübernahme durch den Versicherer oder im Rahmen der Forschung) 215

216 MGPS / Ultradeep Sequencing (UDS) bei Leukämien und Lymphomen Untersuchungen fallen unter Kapitel (indikationsbezogene Diagnostik hämatologischer Neoplasien) 23. Erkrankungen der myeloischen Zellreihe 23.1 Akute myeloische Leukämie (AML) AML-Prognose-Panel EBM Kap , GOP 19453, Mutationssuche bis 20 kb ASXL1 (Exon 13), CEBPa (Exon 1), FLT3-ITD (Exon 14-16), FLT3-TKD (Exon 20), IDH1 (Exon 4), IDH2 (Exon 4), NPM1 (Exon 11), RUNX1 (Exon1-8), TP53 (Exon 2-11) 6,8 kb Erweiterte Diagnostik MDS-AML Overlap sec. AML-Panel EBM Kap , GOP 19453, Mutationssuche bis 20 kb ASXL1 (Exon 13), BCOR (Exon 2-15), ETV6 (Exon 2-8), EZH2 (Exon 2-20), RUNX1 (Exon 1-8), SF3B1 (Exon 13-16), SRSF2 (Exon 1,2), STAG2 (Exon 3-34), TP53 (Exon 2-11), U2AF1 (Exon 2,6,7), ZRSR2 (Exon 1-11) 19,8 kb AML-Basis-Panel EBM Kap , GOP 19453, Mutationssuche bis 20 kb ASXL1 (Exon 13), CEBPa (Exon 1), DNMT3A (Exon 2-23), FLT3-ITD (Exon 14-16), FLT3-TKD (Exon 20), GATA2 (Exon 2-6), IDH1 (Exon 4), IDH2 (Exon 4), KIT (Exon 8,9,11,17), KRAS (Exon 2-4), NPM1 (Exon 11), NRAS (Exon 2-4), RUNX1 (Exon 1-8), TET2 (Exon 3-11), TP53 (Exon 2-11) 19,0 kb EBM Kap , GOP 19454*, Mutationssuche in mehr als 20 kb *Eine erweiterte Diagnostik schließt die Durchführung der bis zu 20 kb (Ziffer 19453) im gleichen Krankheitsfall aus. ASXL1 (Exon 13), CEBPa (Exon 1), FLT3-ITD (Exon 14-16), FLT3-TKD (Exon 20), IDH1 (Exon 4), IDH2 (Exon 4), NPM1 (Exon 11), RUNX1 (Exon1-8), TP53 (Exon 2-11), IDH1 (Exon 4), SXL1 (Exon 13), DNMT3A (Exon 2-23), GATA2 (Exon 2-6), KIT (Exon 8,9,11,17), KRAS (Exon 2-4), NRAS (Exon 2-4), RUNX1 (Exon 1-8) TET2 (Exon 3-11), WT1 (Exon 1-9) BRAF (Exon 11,12,15),, CBL (Exon 8,9),, CDKN2A (Exon 1,3), CUX1 (Exon 1-24), GNAS (Exon 1-13), IKZF1 (Exon 3,8), PHF6 (Exon 2-10), PTPN11 (Exon 3,4,8,13), RAD21 (Exon 2-14), SF3B1 (Exon 13-16), SMC1A (Exon 1-25), SMC3 (Exon 1-29), 37,0 kb 216

217 Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Akute myeloische Leukämie (AML) C92.00 ASXL1 BCOR BRAF CBL CDKN2A CEBPa CUX1 DNMT3A ETV6 EZH2 FLT3 GATA2 GNAS IDH1 IDH2 IKZF1 KIT KRAS NPM1 NRAS PHF6 PTPN11 RAD21 RUNX1 SF3B1 SMC1A SMC3 SRSF2 STAG2 TET2 TP53 U2AF1 WT1 ZRSR ,12,15 8,9 1, , ,8 8,9,11, , 4, 8, ,2 3, ,6, Humangenetik 217

218 23.2 Myelodysplastisches Syndrom (MDS) MDS Panel EBM Kap , GOP 19453, Mutationssuche bis 20 kb ASXL1 (Exon 13), DNMT3A (Exon 2-23), ETV6 (Exon 2-8), EZH2 (Exon 2-20), IDH1 (Exon 4), IDH2 (Exon 4), NRAS (Exon 2-4), RUNX1 (Exon 1-8), SF3B1 (Exon 13-16), SRSF2 (Exon 1,2), TET2 (Exon 3-11), TP53 (Exon 2-11), U2AF1 (Exon 2,6,7), ZRSR2 (Exon 1-11) 20,0 kb Erweiterte Diagnostik EBM Kap , GOP 19454*, Mutationssuche in mehr als 20 kb *Eine erweiterte Diagnostik schließt die Durchführung der bis zu 20 kb (Ziffer 19453) im gleichen Krankheitsfall aus. ASXL1 (Exon 13), DNMT3A (Exon 2-23), ETV6 (Exon 2-8), EZH2 (Exon 2-20), IDH1 (Exon 4), IDH2 (Exon 4), NRAS (Exon 2-4), RUNX1 (Exon 1-8), SF3B1 (Exon 13-16), SRSF2 (Exon 1,2), TET2 (Exon 3-11), TP53 (Exon 2-11), U2AF1 (Exon 2,6,7), ZRSR2 (Exon 1-11) BCOR (Exon 2-15), BCORL1 (Exon 1-12), BRAF (Exon 11,12,15), CBL (Exon 8,9), CEBPa (Exon 1), GATA2 (Exon 2-6), GNAS (Exon 1-13), KIT (Exon 8,9,11,17), KRAS (Exon 2-4), NPM1 (Exon 11 ), PHF6 (Exon 2-10), PRPF8 (Exon 2-43), PTEN (Exon 1-9), PTPN11 (Exon 3,4,8,13), RAD21 (Exon 2-14), STAG2 (Exon 3-34) 35,0 kb Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Myelodysplastisches Syndrom D46.9 ASXL1 BCOR BRAF CBL CDKN2A CEBPa CUX1 DNMT3A ETV6 EZH2 FLT3 GATA2 GNAS IDH1 IDH2 IKZF1 KIT KRAS NPM1 NRAS PHF6 PTPN11 RAD21 RUNX1 SF3B1 SMC1A SMC3 SRSF2 STAG2 TET2 TP53 U2AF1 WT1 ZRSR ,12,15 8,9 1, , ,8 8,9,11, , 4, 8, ,2 3, ,6,

219 23.3 Chronische myelomonozytäre Leukämie (CMML) MDS Panel EBM Kap , GOP 19453, Mutationssuche bis 20 kb ASXL1 (Exon 13), CBL (Exon 8,9), EZH2 (Exon 2-20), JAK2 (Exon 14), KIT (Exon 8,9,11,17), KRAS (Exon 2-4), NRAS (Exon 2-4), PHF6 (Exon 2-10), RUNX1 (Exon 1-8), SETBP1 (Exon 4), SF3B1 (Exon 13-16), SRSF2 (Exon 1,2), TET2 (Exon 3-11), U2AF1 (Exon 2,6,7), ZRSR2 (Exon 1-11) 20,0 kb Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Chronische myelomonozytäre Leukämie (CMML) C93.1 ASXL1 CBL EZH2 JAK2 KIT KRAS NRAS PHF6 RUNX1 SETBP1 SF3B1 SRSF2 TET2 U2AF1 ZRSR ,9,11, ,6, Humangenetik 23.4 Atypische chronische myeloische Leukämie (acml) Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Atypische chronische myeloische Leukämie (acml) 23.5 Chronische myeloische Leukämie (CML) 23.6 Chronische Neutrophilenleukämie (CNL) 23.7 Polyzythämia Vera (PV) C92.2 ASXL1 CBL CSF3R KRAS NRAS SETBP Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Chronische myeloische Leukämie (CML) C92.1 ABL Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Chronische Neutrophilenleukämie (CNL) - D47.1 ASXL1 CSF3R SETBP1 ELANA Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Polyzythämia Vera (PV) D45.0 JAK2 EZH2 TET2 12,

220 23.8 Primäre Myelofibrose (PMF) Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Primäre Myelofibrose (PMF) D47.4 ASXL1 CALR EZH2 IDH1 IDH2 JAK2 MPL SRSF2 TET Essentielle Thrombozythämie (ET) Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Essentielle Thrombozythämie (ET) D47.3 JAK2 CALR MPL TET Mastozytose Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Mastozytose C96.2 KIT Erkrankungen der lymphatischen Zellreihe 24.1 Akute lymphatische Leukämie (ALL) Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen B-Zell-Reihe T-Zell-Reihe 24.2 Chronische lymphatische Leukämie (CLL) C91.0 ABL1 DNMT3A NOTCH1 FBXW7 IDH1 IDH2 RUNX1 PHF Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Chronische lymphatische Leukämie (CLL) C91.1 BIRC3 NOTCH1 SF3B1 TP53 BTK PLCG2 FBXW7 MYD88 XPO seltene Gene

221 24.3 Haarzellleukämie (HZL) Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Haarzellleukämie (HZL) - C91.4 BRAF Morbus Waldenström (MW) Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Chronische Neutrophilenleukämie (CNL) C88.0 MYD88 CXCR Lymphom Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Lymphom diverse diverse TP53 UBR Humangenetik 24.6 Großzellige granuläre Lymphozyten-Leukämie (T-LGL, NK-LGL) Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Chronische Neutrophilenleukämie (CNL) - C91.7 STAT

222 Multi-Gen-Panels in der Reproduktionsmedizin 25.1 Hypogonadotroper Hypogonadismus, Kallmann-Syndrom Dr. rer. nat. Annett Wagner, Dr. med. Imma Rost Das Kallmann-Syndrom ist gekennzeichnet durch die beiden Leitsymptome fehlender/verminderter Geruchssinn (Anosmie) und hypogonadotroper Hypogonadismus. Die Häufigkeit wird mit 1:8000 (Männer) und 1: (Frauen) angegeben. Es werden drei Erbgänge beschrieben: Die X-chromosomal-rezessive Form mit Mutationen bzw. Deletionen im ANOS1-Gen (KAL1; ca. 8% der Patienten), die autosomal-dominante Form mit Mutationen im FGFR1-Gen (Fibroblasten-Wachstumsfaktor-Rezeptor-1-Gen, KAL2; ca. 10% der Patienten) und die autosomal-rezessive Form mit Mutationen in den Genen PROKR2 (Prokineticin-Rezeptor-2-Gen, KAL3) und PROK2 (Prokineticin-2-Gen, KAL4) (ca. 9% der Patienten). Für das Kallmann-Syndrom bzw. idiopathischen hypogonadotropen Hypogonadismus (IHH) mit Normosmie als klinisch leichtere Varianten des CHARGE-Syndroms sind außerdem Mutationen in CHD7 (Chromodomain Helikase DNA-Bindungsprotein-7-Gen, KAL5; 6-8% der Patienten) beschrieben. Eine weitere autosomal-dominante Form wird durch Mutationen im FGF8 (Fibroblasten-Wachstumsfaktor-8-Gen, KAL6; ca. 2 % der Patienten) verursacht. Die Untersuchung dieser sechs Gene kann bei ca. 30% der Kallmann-Syndrom-Patienten die Ursache der Symptomatik klären. Als ursächlich für einen hypogonadotropen Hypogonadismus sind außerdem Mutationen in einer Reihe weiterer Gene beschrieben. Die Analyse der Gene FSHB, GNRH1, GNRHR, KISS1, KISS1R, LHB, SEMA3A, SOX10, TAC3 und TACR3 ( Kallmann-Syndrom Stufe II ) kann nachgefordert werden. Weitere Gene können derzeit für Kassenpatienten nur nach Beantragung und Genehmigung der GKV untersucht werden. Literatur Marcos et al, J Clin Endocrinol Metab 99:E2138 (2014) / Dode and Hardelin, Eur J Hum Genet17:139 (2009) Kallmann-Syndrom Stufe I ANOS1, CHD7, FGF8, FGFR1, PROK2, PROKR2 15,9 kb Erweiterte Diagnostik Kallmann-Syndrom Stufe II FSHB, GNRH1, GNRHR, KISS1, KISS1R, LHB, SEMA3A, SOX10, TAC3, TACR3 9,2 kb EBM Kap , GOP nicht frei anforderbar! Mutationssuche, Deletions-/Duplikationsdiagnostik in mehr als 25 kb (beinhaltet die ), dzt. nur nach genehmigter Kostenübernahme durch den Versicherer 1) (erfordert eine ausfuḧrliche Begru ndung der medizinischen Notwendigkeit sowie den Nachweis der therapeutischen Konsequenz für jedes untersuchte Gen im Einzelfall). Eine erweiterte Diagnostik schließt die Durchführung der im gleichen Krankheitsfall aus. 1) Dzt. werden weniger als 10% der Anträge genehmigt (Stand 1/2017). Die Genehmigungspflicht wurde vom BMG beanstandet, gegen die Beanstandung ist eine Klage des G-BA anhängig. Aktuelle Informationen finden Sie auf unserer Homepage oder in unserem Bulletin. ANOS1, CHD7, FGF8, FGFR1, PROK2, PROKR2 FSHB, GNRH1, GNRHR, KISS1, KISS1R, LHB, SEMA3A, SOX10, TAC3, TACR3 DUSP6, FEZF1, FGF17, FLRT3, HS6ST1, IL17RD, NSMF, SPRY4, WDR11 39,9 kb 222

223 Erkrankungen, OMIM, ICD-10, Gene bei Kallmann-Syndrom Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Hypogonadotroper Hypogonadismus E SOX Hypogonadotroper Hypogonadismus E23.- XL ANOS1*, ** mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD FGFR1*, ** mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD PROKR2*, ** mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD PROK2*, ** mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD CHD7*, ** mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AR FGF8* mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AR GNRHR** ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AR KISS1R** mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E NSMF** mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AR TAC mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AR TACR mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AR GNRH mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AR KISS mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD WDR mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD HS6ST mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD SEMA3A mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD SPRY mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD IL17RD mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD DUSP mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD FGF mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AD FLRT mit Anosmie Hypogonadotroper Hypogonadismus E23.- AR FEZF mit oder ohne Anosmie Hypogonadotroper Hypogonadismus E23.- AR LHB mit oder ohne Anosmie Hypogonadotroper Hypogonadismus 24 ohne Anosmie E23.- AR FSHB * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse Humangenetik 223

224 25.2 Vorzeitige Ovarialinsuffizienz (POF) Dr. rer. nat. Annett Wagner, Dr. med. Imma Rost Mit bis zu 40% zählen ovarielle Störungen zu den wichtigsten Sterilitätsfaktoren bei der Frau. Die vorzeitige Ovarialinsuffizienz (Premature Ovarian Failure = POF) äußert sich durch eine sekundäre Amenorrhoe und tritt bei ca. 1% aller Frauen vor dem 40. Lebensjahr auf. Ursache ist eine Störung im Hypothalamus-Hypophyse-Ovar-Regelkreis. Charakteristischerweise zeigt sich biochemisch ein hypergonadotroper Hypogonadismus. Aus dieser Konstellation ergeben sich neben der Infertilität klimakterische Beschwerden (Climacterium praecox) und z. T. weitere neurologische, metabolische und kardiovaskuläre Symptome. Als genetische Ursachen der vorzeitigen Ovarialinsuffizienz werden bei ca. 10% der betroffenen Frauen Prämutationen im FMR1-Gen (Fragiles X-Mentale Retardierung) gefunden, in 2% Mutationen im BMP15-Gen (Bone Morphogenetic Protein-15-Gen) und in weniger als 1% Mutationen im FSHR-Gen (Follikel Stimulierendes Hormon Rezeptor-Gen). Außerdem sind Mutationen in einer Reihe anderer Gene im Zusammenhang mit POF beschrieben, die eine diagnostische Sensitivität von je 1-2% haben: INHA, DIAPH2, FOXL2, NOBOX, FIGLA, NR5A1, STAG3, SOHLH1, SOHLH2, GDF9, LHCGR, ESR1 Literatur Rossetti et al, Clin Genet 91: 183 (2017) / Ledig & Wieacker, Med Gent 2:237 (2011) / Rossetti et al, Hum Mutat 30:804 (2009) / Lussiana et al, Obstet Gynecol Surv 63:785 (2008) / Dixit et al, Hum Genet 119:408 (2006) / Layman, J Clin Endocrinol Metab 91:1673 (2006) Vorzeitige Ovarialinsuffizienz (POF) BMP15, DIAPH2, ESR1, FIGLA, FOXL2, FSHR, GDF9, INHA, LHCGR, NOBOX, NR5A1, SOHLH1, SOHLH2 STAG3 24,2 kb Erkrankungen, OMIM, ICD-10, Gene bei vorzeitiger Ovarialinsuffizienz (POF) Erkrankung OMIM-P ICD-10 Vererbung Gen OMIM-Gen Ovarialdysgenesie Typ E28 AR FSHR* Ovarialdysgenesie Typ E28 XL BMP15* POF, premature ovarian failure E28 XL BMP15* POF, premature ovarian failure E28 AR FSHR* POF, premature ovarian failure E28 - GDF POF, premature ovarian failure E28 - INHA POF, premature ovarian failure E28 - SOHLH POF, premature ovarian failure E28 - SOHLH POF, premature ovarian failure, LH-Resistenz E28 AR LHCGR POF, premature ovarian failure, Typ 2A E28 XL DIAPH POF, premature ovarian failure, Typ E28 - FOXL POF, premature ovarian failure, Typ E28 AD NOBOX POF, premature ovarian failure, Typ E28 AD FIGLA POF, premature ovarian failure, Typ E28 AD NR5A POF, premature ovarian failure, Typ E28 AR STAG POF, premature ovarian failure, Östrogenresistenz E28 AR ESR * auch einzeln anforderbar ** Deletions-/Duplikationsanalyse 224

225 Prenatalis -Nicht-invasiver Pränataltest (NIPT) Wissenschaftlicher Hintergrund des nicht-invasiven Pränataltests (NIPT) Prenatalis Die Existenz zellfreier, fetaler DNA (cell free fetal DNA, cffdna) im mütterlichen Blut und die Verfügbarkeit von Hochdurchsatz-Technologien zur DNA-Sequenzanalyse (Next Generation Sequencing, NGS) ermöglichen seit wenigen Jahren eine neue Form der nicht-invasiven pränatalen Untersuchung, durch die mit hoher Sicherheit Aussagen über das Vorliegen bestimmter Aneuploidien getroffen werden können. Aus einer Blutprobe der Schwangeren wird zellfreie DNA isoliert (inkl. des Anteils an zellfreier, fetaler DNA) und nach Anreicherung sequenziert. Durch quantitative Auswertung einer sehr großen Anzahl von Sequenz-Reads kann festgestellt werden, ob beim Feten mit hoher Wahrscheinlichkeit eine Trisomie für Chromosom 21 (Down-Syndrom), 18 (Edwards-Syndrom) oder 13 (Pätau-Syndrom) oder eine Aneuploidie der Geschlechtschromosomen vorliegt. Technologie und Methode Sequencing-by-Synthesis (SBS) Ablauf eines nicht-invasiven Pränataltests (NIPT) Ein NIPT kann mittels moderner Hochdurchsatzverfahren (Next Generation Sequencing, NGS) an zellfreier fetaler DNA, die während der Schwangerschaft im mütterlichen Blut bzw. Plasma vorhanden ist, die häufigsten chromosomalen Fehlverteilungen (Trisomie 21, 18 und 13 und ggf., abhängig vom Testverfahren, Fehlverteilungen der Geschlechtschromosomen) nachweisen. Damit kann das Eingriffsrisiko der invasiven Pränataldiagnostik für diese Fragestellung vermieden werden. Allerdings sollten positive Ergebnisse durch eine Fruchtwasserpunktion bestätigt werden. Alle Testverfahren sind auf eine ausreichend hohe Fraktion an fetaler DNA vor dem Hintergrund mütterlicher DNA angewiesen. Die fetale Fraktion steigt mit der Schwangerschaftsdauer und sollte nicht unter 4% liegen. Die derzeitige Empfehlung lautet, die Blutabnahme nicht vor der 10. Schwangerschaftswoche vorzunehmen. Die derzeit in Deutschland verfügbaren Tests wurden an Kollektiven mit einem erhöhten Risiko validiert, d.h. erhöhtes mütterliches Alter bzw. auffälliges Ersttrimester-Screening. Für Ratsuchende ohne erhöhtes Risiko (z.b. Schwangere mit unauffälliger Familienanamnese oder jüngere Schwangere) fehlen derzeit noch aussagekräftige Daten. Trotz der hohen Sensitivität und Spezifität können sich falsch-positive und falschnegative Resultate ergeben, weshalb die Tests derzeit nicht als diagnostisch gelten. Die Empfehlung lautet daher, jeden auffälligen Befund durch eine diagnostische Fruchtwasserpunktion zu sichern. Nach genetischer Beratung (NIPT unterliegt dem Gendiagnostikgesetz) werden der Schwangeren 10 ml Blut (BCT-Spezialröhrchen) abgenommen. Nach Aufreinigung des Blutplasmas wird die zellfreie DNA von Fetus und Mutter nach Anreicherung mittels NGS quantitativ und/oder qualitativ analysiert. Bearbeitungszeiten: Befundübermittlung innerhalb von 3-5 Werktagen Eine schnelle Befundübermittlung kann nur erfolgen wenn folgende Bedingungen erfüllt sind: - vollständig ausgefüllter Untersuchungsauftrag - vollständig befülltes BCT-Blutröhrchen (Streck ) - Anmeldung der Abholung am MVZ Martinsried - Angabe einer verifizierten Faxnummer zur Befundübermittlung oder Verwendung des Arzt-Informations-Systems Als Ergebnis erhält der behandelnde Arzt eine Risikoabschätzung hinsichtlich des Vorliegens einer Trisomie 21, 18 und 13 und ggf. der Geschlechtschromosomen. Auch bei Zwillingsschwangerschaften ist der Prenatalis -NIPT anwendbar. Ist der Test in seltenen Fällen (z.b. zu niedrige fetale Fraktion) nicht auswertbar, kann dieser zu einem späteren Zeitpunkt der Schwangerschaft durch eine erneute Blutentnahme wiederholt oder je nach Indikation und Schwangerschaftsalter eine diagnostische Fruchtwasserpunktion vorgenommen werden. Andere genetische Störungen, beispielsweise verursacht durch chromosomale Strukturauffälligkeiten, Translokationen oder Mutationen in einzelnen Genen, können derzeit noch nicht untersucht werden. Humangenetik 225

226 226

227 Targeted Cancer Panels an Tumormaterial (Molekularpathologie) 27. Tumoren des Gastrointestinaltraktes Dr. med. Theo Kraus, Prof. Dr. med. B. Dockhorn-Dworniczak 27.1 Gastrointestinale Stromatumoren (GIST) [2 Gene, Hotspots] Gastrointestinale Stromatumoren (GIST) sind zwar seltene Tumoren, dennoch sind sie die häufigsten mesenchymalen Neoplasien des gastrointestinalen Traktes. Sie repräsentieren ein morphologisches und biologisches Kontinuum von zufällig entdeckten, benignen Mikro-GIST bis hin zu großen Sarkomen. GIST werden in 3 morphologische Untergruppen eingeteilt: ca. 70% sind vom spindelzelligen Subtyp, ca. 10 % sind vom epithelioiden Subtyp und ca. 20% sind vom gemischt spindelzellig-epithelioiden Subtyp. Zur histologischen Diagnosesicherung eines GIST ist die Immunhistochemie unerlässlich. In etwa 95% aller GIST lassen sich CD117 (KIT-Rezeptor) oder DOG1 positive Zellen nachweisbar, etwa 70-80% der Fälle exprimieren zudem CD34. Trotz der klinikopathologischen Unterschiede teilen die meisten GIST das gleiche molekularpathologische Profil. Dieses schließt Mutationen des KIT- (mutiert in ca % der Fälle) und PDGFRα- (mutiert in ca. 5-7% der Fälle) Gens mit ein. Da moderne Therapieoptionen, beispielsweise mit Tyrosinkinaseinhibitor (TKI) in Abhängigkeit des molekularen Profils unterschiedliche Effizienzen zeigen, kann nach Bestimmung des Mutationsstatus ein optimiertes Therapiekonzept erarbeitet werden. Gastrointestinale Stromatumoren (GIST) Mutationsanalyse gemäß EBM Kapitel (2 Gene) Pathologie KIT, PDGFRa Hotspots Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Gastrointestinale Stromatumoren (GIST) C16, C17, C18, C19, C20 KIT PDGFRa 9, 11, 13, 17 12, 14, Kolorektales Karzinom (CRC) [4 Gene, Hotspots] Etwa 14% aller Tumoren des Erwachsenenalters sind kolorektale Karzinome (CRC). Jährlich erkranken in Deutschland ca Männer und ca Frauen an Tumoren des Dickdarms. Die Prognose der Dickdarmkarzinome ist abhängig von der Lokalisation (Kolon versus Rektum) und vom Stadium bei Diagnosestellung. Während die 5-Jahres-Überlebensrate im Stadium I und II bei 85% bis 90% liegt, so sinkt sie im Stadium III auf etwa 60% und im Stadium IV auf 5%. Mit Einführung neuer Chemotherapeutika konnten in den letzten Jahren wesentliche Fortschritte in der Therapie der CRC erzielt werden. Das Ansprechen einer Chemotherapie ist hierbei allerdings abhängig vom molekularen Profil des Tumors. Dies schließt die Bestimmung des KRAS- (mutiert in ca. 50% der Fälle), NRAS- (mutiert in ca. 5% der Fälle), BRAF- (mutiert in ca. 20% der Fälle) und PIK3CA- (mutiert in ca. 20% der Fälle) Status mit ein. Abhängig vom molekularpathologischen Profil kann dann das weitere, therapeutische Vorgehen geplant werden. Eine anti-egfr-therapie ist beispielsweise nur bei Patienten wirksam, die keine Mutation in KRAS oder NRAS aufweisen. Auch bei Patienten mit BRAF Mutation zeigt eine anti-egfr-therapie keine Verbesserung hinsichtlich des Gesamtüberlebens und des progressionsfreien Überlebens. Auch Patienten mit Mutationen des PIK3CA-Gens (insbesondere in Exon 20) scheinen von einer anti-egfr-therapie nicht zu profitieren. Kolorektales Karzinom Mutationsanalyse gemäß EBM Kapitel (4Gene) BRAF, KRAS, NRAS, PIK3CA Hotspots 227

228 Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Kolorektales Karzinom (CRC) C18, C19, C20 BRAF KRAS NRAS PIK3CA , Pankreaskarzinom [2 Gene, Hotspots] Das Pankreaskarzinom weist die niedrigste Überlebensrate unter allen Tumorerkrankungen auf und ist die vierthäufigste tumorbedingte Todesursache. Da bösartige Neubildungen der Bauchspeicheldrüse in den frühen Stadien oft keine oder nur unspezifische Symptome verursachen, wird der Tumor häufig erst spät erkannt, so dass die relative 5-Jahres-Überlebensrate in Deutschland bei etwa 8% liegt. Histologisch lassen sich intraepitheliale Neoplasien von intraduktalen papillären muzinösen Neoplasien und muzinösen zystischen Neoplasien unterscheiden. Molekularpathologisch lassen sich bei den einzelnen Entitäten spezifische Mutationen nachweisen: Während 41-66% der intraduktalen papillären muzinösen Neoplasien Mutationen des GNAS-Gens aufweisen, finden sich in nahezu alle intraduktalen papillären muzinösen Neoplasien Mutationen des KRAS-Gens, wobei im weiteren Verlauf Mutationen der CDKN2A-, TP53-, SMAD4- und BRCA2- Gene akkumulieren können. Pankreaskarzinom Mutationsanalyse gemäß EBM Kapitel (2 Gene) GNAS, KRAS Hotspots Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Pankreaskarzinom C25 GNAS KRAS 28. Schilddrüsenkarzinom [5 Gene, Hotspots] Dr. med. Theo Kraus, Prof. Dr. med. B. Dockhorn-Dworniczak Schilddrüsenkarzinome sind die häufigsten Tumoren des endokrinen Systems und repräsentieren 1-5% der Tumoren bei Frauen und <2% der Tumoren bei Männern. Das Spektrum der Schilddrüsenkarzinome ist sehr heterogen, wobei zwei unterschiedliche epitheliale Zelltypen als ursächlich zu sehen sind. Die meisten Schilddrüsenkarzinome entstehen aus follikulären Zellen, dazu gehören papilläre Schilddrüsenkarzinome (PTC, 75-85% aller Fälle), follikuläre Schilddrüsenkarzinome (FTC, 10-15% aller Fälle), Hürthle-Zell-Karzinome und anaplastische Schilddrüsenkarzinome (ATC). Medulläre Schilddrüsenkarzinome (MTC) hingegen entstehen aus parafollikulären Calcitonin-produzierenden Zellen und können Teil der multiplen endokrinen Neoplasie Typ 2 (MEN2) sein. Molekularpathologisch ist insbesondere die Bestimmung des BRAF-, NRAS-, HRAS-, KRAS- und RET-Status von Bedeutung. Tumoren mit Mutationen des BRAF-Gens sind häufig undifferenziert und mit einem aggressiven Tumorverhalten und einem schlechteren Ansprechen auf eine Radio- Jodtherapie assoziiert. Tumoren mit Mutationen der NRAS, HRAS und KRAS-Gene sind häufig differenziert und mit follikulärem Wachstum assoziiert. Bei medullären Schilddrüsenkarzinomen finden sich in ca. 50% der Fälle somatische Mutationen des RET-Gens, bei etwa 25% der Fälle liegen Keimbahnmutationen des RET-Gens vor. Bei Verdacht auf eine erbliche Tumorerkrankung (Keimbahnmutation) ist im Vorfeld der Analyse eine humangenetische Beratung angebracht Schilddrüsenkarzinom Mutationsanalyse gemäß EBM Kapitel (5 Gene) BRAF, HRAS, KRAS, RET, NRAS Hotspots 228

229 Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Schilddrüsenkarzinom , C BRAF HRAS KRAS RET NRAS Ovarialkarzinom [2 Gene] Dr. med. Theo Kraus, Prof. Dr. med. B. Dockhorn-Dworniczak Das Ovarialkarzinom ist mit ca Erkrankungen pro Jahr die zweithäufigste bösartige Erkrankung der weiblichen Geschlechtsorgane und die fünfthäufigste tumorbedingte Todesursache bei Frauen. Neben Bestimmung des histologischen Subtyps ist therapeutisch insbesondere der BRCA1- und BRCA2-Mutationsstatus entscheidend, da unter bestimmten Voraussetzungen eine Monotherapie mit Olaparib bei high-grade serösen Ovarialkarzinomen durchgeführt werden kann. Bei Verdacht auf eine erbliche Tumorerkrankung (Keimbahnmutation) ist im Vorfeld der Analyse eine humangenetische Beratung angebracht. Ovarialkarzinom Translokationsanalyse gemäß EBM Kapitel (2 Gene) BRCA1, BRCA2 Anlyse gemäß Ziffer Pathologie Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Ovarialkarzinom C56 BRCA1 BRCA2 30. Malignes Melanom [5 Gene, Hotspots] Dr. med. Theo Kraus, Prof. Dr. med. B. Dockhorn-Dworniczak Das maligne Melanom ist für etwa 1,5-2% aller malignen Tumoren in Deutschland verantwortlich. Laut Schätzungen des Robert-Koch-Instituts lassen sich etwa Erkrankungen pro Jahr in Deutschland beobachten, wobei ca Melanom-assoziierte Todesfällen pro Jahr auftreten. In Hinblick auf eine individualisierte Therapie ist insbesondere die molekularpathologische Bestimmung des BRAF-, NRAS- und KIT-Mutationsstatus erforderlich. Bei 40-60% der Melanome lassen sich Mutationen des BRAF-Gens nachweisen. Patienten mit BRAF-mutiertem Tumor zeigen ein gutes Ansprechen auf eine Chemotherapie mit den BRAF-Tyrosinkinaseinhibitoren Vemurafenib und Dabrafenib bzw. mit dem MEK1/2-Inhibitor Trametinib. Mutationen des NRAS-Gens finden sich in ca % der Melanome. Wenngleich sich NRAS- und BRAF-Mutationen typischerweise ausschließen, so lassen sich teilweise NRAS-Mutationen unter Therapie bei einem BRAF-mutierten Melanom im Sinne einer Subklonexpansion beobachten, was zu einer Therapieresistenz des Tumors führen kann. Auch wenn sich KIT-Mutationen nur selten bei kutanen Melanomen nachweisen lassen, so zeigen dennoch 30% der Patienten mit einem KIT-mutierten Tumor ein Ansprechen auf eine Therapie mit Imatinib Malignes Melanom Mutationsanalyse gemäß EBM Kapitel (5 Gene) BRAF, KIT, NRAS, GNAQ, GNAS Hotspots 229

230 Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Malignes Melanom C43 BRAF KIT NRAS GNAQ GNAS 15 9, 11, 13, Lungenkarzinom (NSCLC) [6 Gene, Hotspots; 3 Gene, Translokationen] Dr. med. Theo Kraus, Prof. Dr. med. B. Dockhorn-Dworniczak Das Lungenkarzinom ist der weltweit am häufigsten zum Tode führende Tumor. Etwa 80% der Lungenkarzinompatienten erkranken an einem nicht-kleinzelligen Karzinom (NSCLC). Histologisch kann das NSCLC in ein Adenokarzinom und ein Plattenepithelkarzinom differenziert werden. Trotz eines modernen Therapieregimes liegt das mediane Überleben immer noch bei nur 8-10 Monaten, die 5-Jahre-Überlebensrate liegt bei unter 15%. NSCLC zeigen eine Vielzahl somatischer Mutationen und genomischer Rearrangements. In Adenokarzinomen lassen sich beispielsweise in 46% TP53-, in 17% STK11-, in 17% KEAP1-, in 33% KRAS-, in 14% EGFR- und in 10% BRAF-Mutationen nachweisen. In Plattenepithelkarzinomen lassen sich in bis zu 83% der Fälle Mutationen des TP53-Gens beobachten. Entsprechend des molekularpathologischen Tumorprofils stehen mittlerweile teils spezifische Chemotherapeutika zur Verfügung. Bei Nachweis von EGFR- Mutationen stehen die Tyrosinkinaseinhibitoren Gefitinib, Erlotinib und Afatanib zur Verfügung. Bei Vorliegen einer KRAS-Mutation könnte eine Kombination einer MEK-Inhibierung mit Selumetinib oder Trametinib in Verbindung mit einer konventionellen Chemotherapie prognostisch günstig sein. Bei Nachweis einer BRAF-Mutation stehen die BRAF-Tyrosinkinaseinhibitoren Vemurafenib und Dabrafenib zur Verfügung. Bei Tumoren mit EML4-ALK1 Rearrangement bzw. ROS1 Rearrangement konnte in Studien ein gutes Ansprechen auf eine Therapie mit ALK1-Inhibitoren wie Crizotinib oder Ceritinib gezeigt werden. Ferner zeigen Tumoren mit RET-Rearrangement ein positives Ansprechen auf eine Therapie mit RET- bzw. Multikinase- Inhibitoren, wie beispielsweise Cabozantinib. Lungenkarzinom Mutationsanalyse gemäß EBM Kapitel (6 Gene) BRAF, EGFR, KRAS, MET, NRAS, ERBB2 Lungenkarzinom Translokationen Translokationsanalyse gemäß EBM Kapitel (3 Gene) ALK, ROS1, RET Hotspots Fusionsnachweise Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Lungenkarzinom, nicht-kleinzellig (NSCLC) C34 BRAF EGFR KRAS MET NRAS ERBB , 14, 16, 19 2, 3, 4 8,

231 32. Harnblasenkarzinom [1 Gen, Hotspots] Dr. med. Theo Kraus, Prof. Dr. med. B. Dockhorn-Dworniczak Das Harnblasenkarzinom ist mit 2-3% aller Malignome der zweithäufigste urologische Tumor und die fünfthäufigste Tumorerkrankung beim Mann. Das durchschnittliche Erkrankungsalter liegt bei Jahren, nur 5% der Patienten sind jünger als 45 Jahre. Prinzipiell lassen sich nicht muskelinvasive Blasenkarzinome von muskelinvasiven Blasenkarzinomen unterscheiden. Auch molekularpathologisch ist eine Differenzierung möglich: Wohingegen nicht muskelinvasive Blasenkarzinome häufig FGFR3-Mutationen besitzen, finden sich in muskelinvasiven Blasenkarzinomen insbesondere TP53-Mutationen, wobei sich FGFR3- und TP53-Mutationen gegenseitig ausschließen. Der Nachweis einer FGFR3-Mutation wird künftig insbesondere in Hinblick auf pan-fgfr-inhibitoren von therapeutischer Bedeutung. Harnblasenkarzinom Mutationsanalyse gemäß EBM Kapitel (1 Gen) FGFR3 Hotspots Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Harnblasenkarzinom C67.9 FGFR3 7, 10, Pathologie 33. Tumoren des Nervensystems Dr. med. Theo Kraus, Prof. Dr. med. B. Dockhorn-Dworniczak Mit der Revision der vierten Edition der WHO-Klassifikation für Tumoren des Zentralen Nervensystems 2016 wurden erstmals neben histologischen Kriterien auch molekulargenetische Aspekte als essentielle Bestandteile der Tumordiagnostik integriert. Dadurch wird der Weg für eine individualisierte Therapie und den Einsatz molekularer Therapeutika eröffnet. Die Paneldiagnostiik ermöglicht eine rasche Analyse des molekularen Tumorprofils. In einem molekularen Tumorboard, auch mittels Telepathologie, können die Befunde der molekularen Analysen interdisziplinär besprochen werden, so dass individualisierte Therapieentscheidungen valide getroffen und zeitnah umgesetzt werden können Gliome Gliome stellen die häufigsten hirneigenen Tumoren des Erwachsenen dar. Seit der WHO-Klassifikation 2016 ist die Bestimmung von molekularpathologischen Markern ein essentieller Bestandteil der Diagnostik. In der Folge ist die Bedeutung einer kleinen Auswahl dieser Marker beschrieben. Mittels Gliom-spezifischer Gen-Panel-Diagnostik können alle therapeutisch/prognostischen Marker parallel bestimmt werden, um zeitnah ein umfassendes molekularpathologisches Profil zu ermitteln. In einem interdisziplinären, molekularen Tumorboard können, auch mittels Telepathologie, die Ergebnisse ausführlich erörtert werden, so dass eine fundierte Planung und Umsetzung eines individualisierten Therapiekonzeptes ermöglicht wird. Während beispielsweise Mutationen des BRAF-Gens überwiegend in niedriggradigen, gutartigen Gliomen, beispielsweise pilozytischen Astrozytomen, zu finden sind, lassen sich Mutationen der Isozitratdehydrogenase (IDH) 1 bzw. 2 insbesondere in diffusen und anaplastischen Gliomen sowie in sekundären Glioblastomen nachweisen. Neben der molekulargenetischen Differenzierung der Gliome in IDH1/2 mutierte und IDH1/2 Wildtyp Tumoren ist der IDH-Status aber auch für die Abschätzung der Prognose von essentieller Bedeutung. Tumoren mit IDH1/2 Mutation zeigen in Studien beispielsweise eine signifikant bessere Prognose als Tumoren ohne IDH1/2 Mutation. Der Verlust chromosomalen Materials auf dem kurzen Arm von Chromosom 1 und auf dem langen Arm von Chromosom 19 (LOH1p/19q) hingegen charakterisiert Oligodendrogliome und ermöglicht so eine molekulare Abgrenzung von Astrozytomen. Auch klinisch ist dieses molekulare Charakteristikum von großer Bedeutung: Während Tumoren ohne LOH1p/19q eine intermediäre Prognose zeigen, ist bei Patienten mit LOH1p/19q von einer günstigen Prognose auszugehen. 231

232 Primäre Glioblastome sind molekularpathologisch durch fehlende Mutationen in den IDH1 und IDH2 Genen gekennzeichnet. Häufig besitzen diese Tumoren allerdings Mutationen des TP53-Gens, Amplifikationen des Epidermal Growth Factor Receptors (EGFR) oder des Telomerase Reverse Transcriptase (TERT) Promoters. Auch diese molekularen Charakteristika (einschließlich der Variante EGFRvIII) sind von klinischer Relevanz. Studien konnten beispielsweise zeigen, dass Mutationen des TERT-Promoters mit einer ungünstigeren Prognose bei Gliompatienten assoziiert sind. Insbesondere bei Mittellinien-, Hirnstamm- sowie pädiatrischen Gliomen finden sich ferner Mutationen in den Histonvarianten H3F3A bzw. HIST1H3B/C. In Studien konnte gezeigt werden, dass diese Tumoren zumeist mit einer sehr ungünstigen Prognose assoziiert sind. Einen sehr wichtigen, unter anderem therapeutisch relevanten Marker, stellt die Methylierung des O6-Methylguanin-DNA-Methyltransferase (MGMT) Promoters dar. So konnte beispielsweise in zahlreichen Studien gezeigt werden, dass Patienten mit methyliertem MGMT-Promoter des Tumors ein deutlich besseres Ansprechen auf eine Chemotherapie mit alkylierenden Zytostatika (z.b. Temozolomid) zeigen und im Vergleich zu Patienten mit unmethylierten MGMT-Promoter des Tumors ein signifikant längeres Gesamtüberleben besitzen. Gliom-Mini-Panel Analysen gemäß EBM Kapitel (4 Gene und 2 Zusatzanalysen) Mutationsanalysen: EGFR, IDH1, IDH2, TERT Methylierungsanalyse: MGMT-Promotor Strukturanalyse: LOH1p/19q < 20 kb oder Diagnostisch-therapeutisches Gliom-Basis-Panel Analysen gemäß EBM Kapitel (10 Gene und 2 Zusatzanalysen) Mutationsanalysen: ATRX, BRAF, CIC, EGFR, FUBP1, H3F3A, IDH1, IDH2, TERT, TP53 Methylierungsanalyse: MGMT-Promotor Strukturanalyse: LOH1p/19q < 20 kb oder Diagnostisch-therapeutisches Gliom-Pädiatrie-Panel Analysen gemäß EBM Kapitel (15 Gene und 3 Zusatzanalysen) Mutationsanalysen: ACVR1, ATRX, BRAF, CIC, CTNNB1, DDX3X, EGFR, FUBP1, H3F3A, HIST1H3B, HIST1H3C, IDH1, IDH2, TERT, TP53 < 20 kb Methylierungsanalyse: MGMT-Promotor BRAF Strukturanalyse: BRAF-KIAA1549-Fusion, LOH1p/19q Gliom-Komprehensiv-Panel Erweiterte Diagnostik zusätzllich zu den Analysen des Gliom-Pädiatrie-Panel folgende Mutationsanalysen, dzt. nur nach genehmigter Kostenübernahme durch den Versicherer (entspr. EBM Kapitel 19.4) oder im Rahmen der Forschung: AKT1, CDKN2B, FGFR1, FGFR2, HRAS, KRAS, MET, NF1, NF2, NRAS, PIK3CA, PIK3R1, PTCH1, PTEN, PTPN11, RB1, SETD2, SMO > 20 kb oder Individualisierte Panel-Anforderung nach Rücksprache möglich 232

233 Pathologie Flussdiagramm zur Berücksichtigung typischer molekularer Profile bei Gliomen. Durch die Integration histologischer sowie molekularer Charakteristika ist eine sehr differenzierte Einteilung der Hirntumoren möglich, die auch Aussagen in Hinblick auf ein potentielles Therapieansprechen und die Prognose erlaubt. Paneldiagnostik bei Hirntumoren. Die Anwendung einer Paneldiagnostik mittels Next Generation Sequencing ermöglicht die schnelle, effiziente und umfassende Charakterisierung des molekulare Tumorprofils, so dass Therapieentscheidungen rasch und valide gentroffen werden können. * Methylierungsanalyse; ** Strukturanalyse. 233

234 Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Gliome C71 ACVR AKT1 4, ATRX BRAF BRAF-KIAA1549 Strukturanalyse - CDKN2B 1, CIC CTNNB1 2-5, 2-12, 14, DDX3X EGFR FGFR1 4, FGFR2 7, 9, FUBP H3F3A HIST1H3B HIST1H3C HRAS 2, IDH IDH KRAS LOH1p/19q Strukturanalyse - MET 2, 11, 14, 16, MGMT Promoter NF1 4, NF NRAS PIK3CA 2, 5, 7, 8, 10, 14, PIK3R PTCH PTEN 1, 3, PTPN11 3, RB1 4, 6, 11, 14, 17, 18, SETD SMO TERT Promoter TP53 2, Medulloblastom Beim Medulloblastom handelt es sich um einen hoch malignen, embryonalen Tumor des Kleinhirns, der insbesondere im Kleinkindes- und Kindesalter auftritt und mit einer sehr ungünstigen Prognose assoziiert ist. Ergänzend zur histologischen Einteilung lassen sich Medulloblastome molekularpathologisch anhand spezifischer Transkriptommuster einteilen, wobei keine exakte Zuordnung der histologischen und molekularen Subentitäten möglich ist. In Studien konnte allerdings gezeigt werden, dass das molekulare Tumorprofil prognostisch bedeutend ist. Mittels molekularpathologischer Transkriptomanalyse lassen sich dabei Medulloblastome mit aktiviertem WNT-Signalweg, Medulloblastome mit aktiviertem SHH (Sonic hedgehog) -Signalweg und TP53-Mutation 234

235 bzw. ohne TP53-Mutation sowie nicht SHH-/WNT-aktivierte Medulloblastome (sog. Gruppe 3 und Gruppe 4 Medulloblastome) unterscheiden. Studien konnten dabei zeigen, dass insbesondere Medulloblastome mit aktiviertem WNT-Signalweg mit einer sehr guten Prognose, Medulloblastome mit aktiviertem SHH-Signalweg mit einer intermediären Prognose und nicht SHH-/WNT-aktivierte Medulloblastome mit einer ungünstigen Prognose assoziiert sind. Molekularpathologische Mutationsanalysen konnten zeigen, dass Medulloblastome regelmäßig Mutationen der DDX3X-, SMO-, CTNNB1-, PTCH1-, TERT- und TP53-Gene besitzen. Die in etwa 28% der Fälle vorhandenen SMO-Mutationen sowie Mutationen des PTCH1-Gens weisen dabei auf eine Aktivierung des SHH-Signalweges hin und sind mit einer intermediären Prognose assoziiert. Mutationen des CTNNB1-Gens finden sich bei ca. 11% der Medulloblastome und deuten auf eine Aktivierung des WNT-Signalweges hin. Dieses molekularpathologische Charakteristikum ist mit einer sehr günstigen Prognose assoziiert. Medulloblastom-Panel Analysen gemäß EBM Kapitel lekularpathologische (6 Gene) Charakteristikum ist mit einer sehr günstigen Prognose assoziiert. CTNNB1, DDX3X, PTCH1, SMO, TERT, TP53 < 20 kb CTNNB1, DDX3X, PTCH1, SMO, TP53 oder Individualisierte Panel-Anforderung nach Rücksprache möglich Pathologie Molekulare Marker zur Differenzierung von Medulloblastomen. Medulloblastome werden anhand ihrer Expressionsprofile und der zugrunde liegenden aktivierten Signaltransduktionskaskaden in die molekularen Gruppen WNT-aktivierte Tumoren, SHH-aktiviert Tumoren, Gruppe 3 Tumoren und Gruppe 4 Tumoren eingeteilt. Insbesondere bei den SHH-aktivierten Tumoren ist auch der TP53-Mutationsstatus von klinischer Bedeutung. Anhand der Mutationsmuster distinkter Gene können so viele Medulloblastome bereits einer molekularen Subgruppe zugeordnet werden, ohne dass ein komplettes Expressionsprofil erstellt werden muss. Für die Gruppe 3 und Gruppe 4 Tumoren sind bisher noch keine distinkten Mutationen bekannt. Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Medulloblastome C71 CTNNB1 2-5, 2-12, 14, DDX3X PTCH SMO TERT Promoter TP53 2,

236 34.3 Paragangliom und Phäochromozytom Paragangliome sind meist gutartige, neuroendokrine Tumoren, die aus autonomen Ganglien entstehen. Es kann hierbei sowohl das sympathische wie auch das parasympathische Nervensystem betroffen sein. Ähnlich wie Phäochromozytome zeigen auch Paragangliome genetische Veränderungen. Hierbei ist zu beachten, dass etwa 50% der Paragangliome/Phäochromozytome des Erwachsenenalters und über 80% der Paragangliome/Phäochromozytome des Kindesalters vererbt sind und im Rahmen autosomal dominant vererbter genetischer Syndrome auftreten. Insbesondere beim Auftreten multipler Paragangliome/Päochromozytome oder beim Auftreten in Kombination mit anderen Tumorerkrankungen. Mutationen betreffen dabei insbesondere die MAX-, NF1-, RET-, VHL-, SDHA-, SDHAF2-, SDHB-, SDHC- und SDHD-Gene. Das Vorliegen eines einzelnen benignen Paraganglioms ist allerdings zumeist sporadisch bedingt, ebenso handelt es sich bei spinalen Paragangliomen in über 90% der Fälle um sporadische Tumoren. Bei Verdacht auf eine erbliche Tumorerkranung (Keimbahnmutation) ist im Vorfeld der Analyse eine humangenetische Beratung angebracht. Paragangliom- und Phäochromozytom-Panel Analysen gemäß EBM Kapitel lekularpathologische (6 Gene) Charakteristikum ist mit einer sehr günstigen Prognose assoziiert. MAX, NF1, SDHA, SDHAF2, SFHB, SDHC, SDHD, RET, VHL < 20 kb CTNNB1, DDX3X, PTCH1, SMO, TP53 oder Individualisierte Panel-Anforderung nach Rücksprache möglich Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Paragangliom, D44.7, MAX Phäochromozytom C74.1, SDHA D44.1, E27.5 SDHAF SDHB SDHC SDHD RET VHL

237 Liquids 35. Liquid Biopsy/Liquid Profiling zum Nachweis von zirkulierenden Tumorzellen und zirkullierenden zellfreien Tumor-Nukleinsäuren Dr. med. Theo Kraus, Prof. Dr. med. B. Dockhorn-Dworniczak Die Liquid Biopsy/Liquid Profiling (Liquids) ist ein neuartiges Verfahren, bei dem Körperflüssigkeiten, wie beispielsweise Blut, Liquor oder Zystenpunktat, untersucht werden, um Informationen über eine Tumorerkrankung zu gewinnen. Hierzu werden beispielsweise in der Flüssigkeit befindliche, zirkulierende Tumorzellen (circulating tumor cells, CTC) oder zellfreie zirkulierende Tumor-Nukleinsäuren isoliert und es wird anhand hoch-sensitiver Verfahren versucht, tumorspezifische Mutationen nachzuweisen. Der Stellenwert dieses sehr neue Verfahren wird in Zukunft im Rahmen der Tumornachsorge und potentiell auch im Rahmen der Frühdiagnostik bei Tumoren noch weiter zunehmen Gastrointestinale Stromatumoren (GIST) Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Gastrointestinale Stromatumoren (GIST) C16, C17, C18, C19, C Kolorektales Karzinom (CRC) 35.3 Pankreaskarzinom KIT PDGFRa 9, 11, 13, 17 12, 14, Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Kolorektales Karzinom (CRC) C18, C19, C20 BRAF KRAS NRAS PIK3CA APC TP , Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Pankreaskarzinom C25 GNAS KRAS Pathologie 35.4 Malignes Melanom Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Malignes Melanom C43 BRAF KIT NRAS GNAQ GNAS 35.5 Lungenkarzinom (NSCLC) Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Lungenkarzinom, nicht-kleinzellig (NSCLC) C34 BRAF EGFR KRAS MET NRAS ERBB Gliom Weitere Untersuchungen sind nach individueller Rücksprache möglich. 15 9, 11, 13, , 14, 16, 19 2, 3, 4 8, Erkrankung OMIM-P ICD-10 Gene Exon OMIM-Gen Gliom C71 IDH1 BRAF H3F3A

238 Companion Diagnostics an Tumormaterial 35. Companion Diagnostics Dr. med. Theo Kraus, Prof. Dr. med. B. Dockhorn-Dworniczak Als Companion Diagnostics bezeichnet man molekularpathologische Untersuchungen, die bei geplanter medikamentöser Therapie durchgeführt werden, um festzustellen, ob mit einem Therapieansprechen beim untersuchten Patienten zu rechnen ist. Liegen die entsprechenden molekularpathologischen Merkmale vor, so ist mit einem Ansprechen des Patienten auf eine gezielte medikamentösen Therapie zu rechnen. Therapie Erkrankung Gene Afatenib Nicht-kleinzelliges Lungenkarzinom (NSCLC) EGFR AGI5198 Glioblastom IDH1 AGI6780 Leukämie IDH2 Bevacizumab Kolorektales Karzinom BRAF, KRAS, NRAS, PIK3CA Binimetinib Melanom BRAF, NRAS Binimetinib Nicht-kleinzelliges Lungenkarzinom (NSCLC) BRAF Cabozantinib Nicht-kleinzelliges Lungenkarzinom (NSCLC) RET-Rearrangements Cabozantinib Schilddrüsenkarzinom RET Ceritinib Nicht-kleinzelliges Lungenkarzinom (NSCLC) ALK1-Rearrangements, ROS1-Rearrangements Cetuximab Kolorektales Karzinom BRAF. KRAS, NRAS, PIK3CA Combimetinib Melanom BRAF Combimetinib Nicht-kleinzelliges Lungenkarzinom (NSCLC) BRAF Crizotinib Nicht-kleinzelliges Lungenkarzinom (NSCLC) ALK1-Rearrangements, ROS1-Rearrangements Dabrafenib Melanom BRAF Dabrafenib Nicht-kleinzelliges Lungenkarzinom (NSCLC) BRAF Dabrafenib Schilddrüsenkarzinom BRAF Dasatinib Melanom KIT Encorafenib Melanom BRAF Encorafenib Nicht-kleinzelliges Lungenkarzinom (NSCLC) BRAF Erlotinib Nicht-kleinzelliges Lungenkarzinom (NSCLC) EGFR, KRAS Gefitinib Nicht-kleinzelliges Lungenkarzinom (NSCLC) EGFR, KRAS Imatinib Gastrointestinale Stromatumoren (GIST) KIT, PDGFRa Imatinib Melanom KIT Nilotinib Melanom KIT Olaparib Ovarialkarzinom BRCA1, BRCA2 Panitumumab Kolorektales Karzinom BRAF, KRAS, NRAS, PIK3CA Regorafenib Gastrointestinale Stromatumoren (GIST) KIT, PDGFRa Regorafenib Kolorektales Karzinom KRAS Selumetinib Nicht-kleinzelliges Lungenkarzinom (NSCLC) KRAS Sunitinib Gastrointestinale Stromatumoren (GIST) KIT, PDGFRa Sunitinib Melanom KIT Trametinib Melanom BRAF Trametinib Nicht-kleinzelliges Lungenkarzinom (NSCLC) KRAS Trametinib Schilddrüsenkarzinom BRAF Vandetanib Schilddrüsenkarzinom RET Vemurafenib Melanom BRAF Vemurafenib Nicht-kleinzelliges Lungenkarzinom (NSCLC) BRAF 238

239 HLA-Typisierung 36. HLA-Typsierung Dr. med. Kaimo Hirv, Dr. rer. nat. Barbara Bangol Die Typisierung von HLA-Merkmalen spielt eine bedeutende Rolle in der Transplantations- und Transfusionsmedizin sowie bei der Differenzialdiagnostik verschiedener Erkrankungen, die mit dem Vorhandensein bestimmter HLA-Allele assoziiert sind. Eine besondere Bedeutung kommt dem HLA-System bei der Auswahl von Blutstammzellspendern zu. Die allogene Transplantation von Knochenmark (KMT) oder peripheren Blutstammzellen (PBSCT) ist bei malignen Erkrankungen und Funktionsstörungen der blutbildenden Organe oft die einzige kurative Therapiemöglichkeit. Als allgemein anerkanntes Kriterium für eine erfolgversprechende Stammzelltransplantation gilt die Gewebeverträglichkeit von Spender und Empfänger, die anhand der Bestimmung der HLA-Merkmale beurteilt wird. Entsprechend der Richtlinien der EFI (European Federation for Immunogenetics) und DGI (Deutsche Gesellschaft für Immungenetik) ist dabei die Untersuchung von fünf HLA-Genen erforderlich, wobei als klinisch-biologisch relevant zur Zeit nur Exon 2 und 3 der HLA- Klasse-I-Merkmale (HLA-A, -B, -C) bzw. Exon 2 der HLA-Klasse-II-Merkmale (HLA-DRB1, -DQB1) betrachtet werden. Auf die Analyse weiterer Exons oder Gene wird daher meist aus Zeit- und Kostengründen verzichtet. NGS-Technologien ermöglichen es inzwischen, die Sequenzierkapazitäten im Vergleich zu herkömmlichen Methoden (SBT, SSO) um ein Vielfaches zu erhöhen, so dass größere Genbereiche im Hochdurchsatz kostengünstig sequenziert werden können. Dank klonaler Amplifikation wird zudem eine deutlich bessere Auflösung der Ergebnisse erzielt. Besonders bei der Typisierung neu registrierter Blutstammzellspender können, aufgrund des hohen Probenaufkommens, die Vorteile der NGS-Technologien geltend gemacht werden. Auch bei vollständiger Übereinstimmung der untersuchten HLA-Merkmale können verschiedene Komplikationen, wie die Graft-versus-Host-Erkrankung (GvHD), ein Rezidiv der Grunderkrankung oder eine Transplantatabstoßung nach der Transplantation auftreten. Es ist möglich, dass Polymorphismen außerhalb der routinemäßig untersuchten Exons der HLA-Gene das Risiko einer GvHD oder eines Rezidivs beeinflussen. Auch andere, bislang nicht berücksichtigte HLA-Gene, z. B. HLA-DQA1, HLA-DPA1 könnten einen Einfluss auf die Transplantationsergebnisse haben. Diese zusätzlichen Informationen können zur optimierten Spenderauswahl führen und am Ende zur Verbesserung der Transplantationsergebnisse beitragen. Literatur European Federation for Immunogenetics (EFI) Standards, / Grumbt et al, Transfus Med Hemother 40:196 (2013) / Shiina et al, Tissue Antigens 80:305 (2012) / Finke et al, Biol Blood Marrow Transplant 18:1716 (2012) / Petersdorf et al, Sci Transl Med 4:144ra101 (2012) / Lind et al, Hum Immunol 71:1033 (2010) / Lee et al, Blood 110:4576 (2007) Transfusionsmedizin 239

240 36.1 Hochauflösende HLA-Typisierung Simultane Sequenzierung der Exons 2 und 3 der Merkmale HLA-A, -B, -C, -DRB1, -DQB1 und -DPB1 zur Auswahl geeigneter Blutstammzellspender und zur Registerspendertypisierung für die Aufnahme in die Blutstammzellspenderdatei. Gen OMIM-Gen Abdeckung HLA-A Exon 2, Exon 3 HLA-B Exon 2, Exon 3 HLA-C Exon 2, Exon 3 HLA-DRB Exon 2, Exon 3 HLA-DQB Exon 2, Exon 3 HLA-DPB Exon 2, Exon Ultrahochauflösende HLA-Typisierung Simultane Sequenzierung der kompletten Gene der klassischen HLA-Merkmale HLA-A, -B, -C, -DRB1, -DQA1, -DQB1, -DPA1 und -DPB1 sowie der nicht-klassischen HLA-Merkmale HLA-E, -F und -G zur Beurteilung der Gewebeverträglichkeit in der Transplantationsmedizin Gen OMIM-Gen Abdeckung HLA-A 'UTR* - 3'UTR HLA-B 'UTR - 3'UTR HLA-C 'UTR - 3'UTR HLA-E 'UTR - 3'UTR HLA-F 'UTR - 3'UTR HLA-G 'UTR - 3'UTR HLA-DRB 'UTR - 3'UTR (ohne Intron 1) HLA-DQA 'UTR - 3'UTR HLA-DQB 'UTR - 3'UTR HLA-DPA 'UTR - 3'UTR HLA-DPB 'UTR - 3'UTR *UTR, untranslatierte Region 240

241 Mikrobiologie/Virologie 37. enteralis - Mikrobiom-Analyse (simultane Sequenzierung der Gesamtheit der enteralen Bakterien zur Erfassung von Fehlbesiedelungen) Dr. med. Hartmut Campe Die Mikrobiom-Analyse von Stuhlproben ist im enteralis-test zu einem vollständigen Workflow von der Probennahme bis zum fertigen Ergebnisreport zusammengefasst. Informationen zum enteralis-test finden Sie unter Die Mikrobiom-Analyse einer Stuhlprobe ermöglicht die Beschreibung aller Bakterienarten und -gattungen, die den Dickdarm besiedeln. Die simultane Sequenzierung ist damit doppelt so umfassend wie die bis heute verwendeten kulturellen Verfahren, die nur die Hälfte der ca verschiedenen Arten des Darmmikrobioms nachweisen können. Diagnostische Aussagen erlaubt die enterale Mikrobiomanalyse über Verarmungen und zu Mengenverschiebungen der bakteriellen Arten und Gattungen (Fehlbesiedelungen), die z.b. Folgen einer pseudomembranösen Colitis bei Clostridium difficile Infektion führen oder Folgen einer Breitbandantibiose sein können. Bei refraktären C.difficile Infektionen wird immer öfter eine Fäkaltransplantation durchgeführt, deren therapeutischer Erfolg mit einer enteralen Mikrobiomanalyse überprüft und mit dem Nachweis der wiederhergestellten Diversität der enteralen Arten auch belegt werden kann. Die Analyse liefert Aussagen über Artenreichtum ( alpha-diversity ), über die quantitative Zusammensetzung des Mikrobioms (auf Phylumebene), über einen Vergleich ( beta-diversity ) des analysierten Mikrobioms mit einem Kollektiv Gesunder (Kollektiv aus dem Human Microbiome Project) und stellt die Ergebnisse interaktiv in einem Krona-Diagramm (Ausschnitt) dar: Mikrobiologie/Virologie Literatur van Nood et al, N Engl J Med; 368(5): 407 (2013) 241

242 38. HIV/HCV Genotypisierung und Resistenztestung (Ultratiefe Sequenzierung von HCV/HIV RNA zur frühzeitigen Entdeckung von Therapieresistenzen) Dr. med. Hartmut Campe Die genotypische Resistenztestung von HIV mittels Sanger-Technologie ist ein therapiebegleitendes Standardverfahren. Die genetische Information der Reversen Transkriptase, der Protease und der Integrase werden auf Resistenz-vermittelnde Mutationen untersucht und die Wirksamkeit der Medikamente aus den entsprechenden Klassen mit gängigen Algorithmen (Stanford, HIV-Grade, ) überprüft. Die ultratiefe Sequenzierung kann Subpopulationen resistenter Viren sensitiver erfassen als es mit der Populations-basierten Sangermethode möglich ist. Dem behandelnden HIV-Schwerpunktarzt ermöglichen diese Informationen die Wahl zwischen Standardempfehlungen auf der Basis des Populationsniveaus und einer weiter individualisierten Therapie unter Rücksichtnahme auf minoritäre Viruspopulationen. Die gleiche Vorgehensweise etabliert sich derzeit für die Resistenzanalysen der neuen Therapeutika (DAAs; direct acting agents) gegen chronische HCV-Infektionen. Zielregionen sind NS3, NS4 und NS5. Außerdem spielt bei der Therapieauswahl die exakte Bestimmung des HCV-Genotyps, die mit NGS ebenfalls möglich ist, unverändert eine große Rolle. Bei der Diagnostik von Therapieresistenzen gegen eine virustatische Behandlung ist es wichtig, möglichst frühzeitig mutante Viruspopulationen zu identifizieren. Die Erkennung minorer, resistenter Populationen ist nur durch ultratiefes NGS möglich. Erkrankung Gene Amplicons wichtigste Resistenzmutationen HIV reverse Transkriptase Protease Integrase M184VI, K65R, L74VI, T215YF, K103NS I47A, I50L, I84V, N88S T66IAK, Y143CRH, Q148HRK HCV NS3 1 Q80K 242

243 Laboratoriumsmedizin 39. cf-dna-analyse Dr. med. Hanns-Georg Klein Die Laboratoriumsmedizin beschäftigt sich als klassisches Querschnittsfach mit der Analyse bzw. der Zusammensetzung von Bestandteilen (zellulären Bestandteilen, Proteinen, klinisch-chemischen Kenngrößen, Produkten des Intermediärstoffwechsel etc.) in verschiedenen Körperflüssigkeiten (Blut, Plasma, Serum, Urin, Liquor, flüssiges Punktat etc.) des Menschen. Die Analyse von humanen Nukleinsäuren aus den genannten Kompartimenten hat in den vergangenen Jahren an Bedeutung gewonnen und wurde durch technische Errungenschaften wie das Next Generation Sequencing (NGS), aber auch durch die Kombination von digitaler PCR mit durchflußzytometrischen Verfahren (sog. BEAMing-Technologie, Sysmex Ltd. Japan) revolutioniert. Die Bedeutung von NGS in der Laboratoriumsmedizin erschließt sich vor allem durch 1. die Analyse von somatischen Mutationen (molekularen Signaturen) in pathologisch veränderten kernhaltigen Zellen des Blutkreislaufs oder Knochenmarks, z.b. in der Leukämie-Diagnostik, 2. die Untersuchung von zellfreier DNA, die durch den programmierten Zelltod in den Blutkreislauf abgegeben wurde, z.b. zellfreie Tumor-DNA (ct-dna), 3. die Sequenzierung von nukleinsäurehaltigen Vesikeln (Exosomen) oder 4. die Analyse von micro- und small-interfering RNA (mirna, sirna). Schematische Darstellung eines Blutgefäßes mit seinen physiologischen zellulären Bestandteilen (Erythrozyten, Leukozyten, Thrombozyten) sowie untergehenden Zellen z.b. einer Neoplasie, wodurch zellfreie Tumor-DNA (ct-dna) freigesetzt wird (Halbwertszeit im Blut ca. 30 min). Somatische molekulare Signaturen Der Nachweis von somatischen Mutationen in leukämischen Zellen hat inzwischen seinen festen Platz in der Routineanalytik gefunden. Während die gezielte Diagnostik und das Follow-up (Minimal Residual Disease) nach wie vor häufig mit PCR-basierten Verfahren durchgeführt werden (real-time PCR, digitale PCR), kommt den NGS-Technologien bei dem Nachweis von somatischen Neumutationen (Driver- oder Resistenz-Mutationen) eine entscheidende Rolle zu. Im Gegensatz zur herkömmlichen Sanger-Sequenzierung einzelner Gene (Nachweisgrenze für Mosaike ca. 30%), ermöglicht NGS die rasche und kostengünstige parallele Untersuchung eines Panels von Leukämie-assoziierten Genen mit einer Nachweisgrenze von < 1% (in Abhängigkeit von der gewählten Abdeckung). Hierdurch können Neumutationen und das Entstehen autonomer Zellklone frühzeitg erkannt und einer individuellen Therapie zugeführt werden. Cancer -Panels s. auch Kapitel Molekulare Onkologie. Laboratoriumsmedizin 243

Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren

Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren Institut für Medizinische Genetik Entwicklungsstörungen und Intelligenzdefekte im Licht neuer gendiagnostischer Verfahren Prof. Dr. med. Anita Rauch Seite 1 Häufigkeit von Intelligenzminderung (ID) IQ

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Qualität aus ärztlichen Händen. Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter

Qualität aus ärztlichen Händen. Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter Qualität aus ärztlichen Händen Nicht invasiver Pränataltest (NIPT) Information für werdende Mütter Liebe Schwangere, als werdende Mutter befinden Sie sich wahrscheinlich in einer der emotionalsten Phasen

Mehr

Luzerner Kantonsspital Departement Institute. Gendiagnostik das neue Wunderstethoskop?

Luzerner Kantonsspital Departement Institute. Gendiagnostik das neue Wunderstethoskop? Luzerner Kantonsspital Departement Institute Gendiagnostik das neue Wunderstethoskop? Prof. Dr. med. Joachim Diebold, Leiter Departement Institute und Chefarzt Pathologie, Leiter Zentralschweizer Krebsregister

Mehr

Methoden in der Humangenetik , Guntram Borck, Institut für Humangenetik

Methoden in der Humangenetik , Guntram Borck, Institut für Humangenetik Methoden in der Humangenetik 19.04.2018, Guntram Borck, Institut für Humangenetik Chromosomale Aberrationen Monogene Störungen Polygene und multifaktorielle Phänotypen Seltene Erkrankungen Nicht mehr als

Mehr

Allgemeine Indikationen zur Genetischen Beratung

Allgemeine Indikationen zur Genetischen Beratung ZENTRUM FÜR HUMANGENETIK UND LABORATORIUMSMEDIZIN Dr. Klein und Dr. Rost GENETIK IN DER PÄDIATRIE Beratung und Diagnostik www.medizinische-genetik.de Version 05-07 Genetik in der Kinderheilkunde Bei der

Mehr

ebm.aktuell EBM-Änderungen im Kapitel 11 Humangenetik zum 1. Oktober 2015 Juli 2015

ebm.aktuell EBM-Änderungen im Kapitel 11 Humangenetik zum 1. Oktober 2015 Juli 2015 ebm.aktuell EBM-Änderungen im Kapitel 11 Humangenetik zum 1. Oktober 2015 Juli 2015 Der Bewertungsausschuss hat die humangenetischen Beurteilungsleistungen neu gefasst und höher bewertet. Molekulargenetische

Mehr

Eine Reise zu den Herz - Genen

Eine Reise zu den Herz - Genen Eine Reise zu den Herz - Genen Berner Kardiologie Update 2014 12./13. September 2014 Schloss Hünigen Dr. med. Siv Fokstuen Service de médecine génétique Hôpitaux Universitaires de Genève Reise Programm

Mehr

Humane Genotyp-Phänotyp-Datenbanken: Ein Statusbericht

Humane Genotyp-Phänotyp-Datenbanken: Ein Statusbericht Workshop: Datenbank genomischer Varianten für die klinische Anwendung und die medizinische Forschung Essen 19. März 2014 Humane Genotyp-Phänotyp-Datenbanken: Ein Statusbericht Thomas Bettecken Max-Planck-Institut

Mehr

Liquid Biopsy ist noch nicht fit für die Diagnostik

Liquid Biopsy ist noch nicht fit für die Diagnostik Molekularbiologische Analysen an Blut Liquid Biopsy ist noch nicht fit für die Diagnostik Berlin (18. Mai 2015) - Molekularbiologische Analysen an Blut (sog. Liquid Biopsy Analysen) könnten in den nächsten

Mehr

Zusätzliche Behandlungs möglichkeiten für Ihre Patienten

Zusätzliche Behandlungs möglichkeiten für Ihre Patienten Zusätzliche Behandlungs möglichkeiten für Ihre Patienten Über FoundationOne Bei dem validierten umfassenden Tumorprofil von FoundationOne wird die gesamte codierende Sequenz von 315 krebsassoziierten Genen

Mehr

Genetisch-epidemiologische Register-Studien

Genetisch-epidemiologische Register-Studien Genetisch-epidemiologische Register-Studien am Beispiel des familiären Darmkrebses "HNPCC" (Teil 2) Dr. med. Christoph Engel Institut für Medizinische Informatik, Statistik und Epidemiologie (IMISE) Universität

Mehr

Humangenetik: Herausforderungen bei der Begutachtung

Humangenetik: Herausforderungen bei der Begutachtung Medizinischer Dienst der Krankenversicherung in Bayern Humangenetik: Herausforderungen bei der Begutachtung Jahrestagung 2019 Strukturen schaffen, Schnittstellen gestalten der Sozialmedizinischen Expertengruppe

Mehr

Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik. Karl J. Lackner

Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik. Karl J. Lackner Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik Karl J. Lackner Hochdurchsatzverfahren in der molekularen bzw. genetischen Diagnostik Next Generation-Sequenzierung

Mehr

genomischen Mutation in bis zu 25 Kilobasen kodierender Sequenz 11445

genomischen Mutation in bis zu 25 Kilobasen kodierender Sequenz 11445 05315 Zuschlag zu den Gebührenordnungspositionen 31840, 31841, 36840 und 36841 11501 Zuschlag zu den Gebührenordnungspositionen 11502 und 11503 für die Anwendung eines Kulturverfahrens zur Anzucht von

Mehr

und morgen? Moderne Methoden in der Humangenetik Schülerveranstaltung

und morgen? Moderne Methoden in der Humangenetik Schülerveranstaltung und morgen? Moderne Methoden in der Humangenetik Schülerveranstaltung 29.03.2017 PD Dr. med. Sabine Hoffjan MEDIZINISCHE FAKULTÄT Moderne Methoden Ethische Konfliktfelder 2 Next-generation sequencing (NGS)

Mehr

Zielgerichtetes amplikonbasiertes Sequenzieren bei Chronisch Lymphatischer Leukämie

Zielgerichtetes amplikonbasiertes Sequenzieren bei Chronisch Lymphatischer Leukämie Zielgerichtetes amplikonbasiertes Sequenzieren bei Chronisch Lymphatischer Leukämie 1. CLL Chronisch Lymphatische Leukämie Anreicherung von langlebigen monoklonalen reifen B-Zellen Häufigste Leukämie in

Mehr

Wie erblich sind Epilepsien?

Wie erblich sind Epilepsien? Wie erblich sind Epilepsien? Häufigkeit Epilepsie in Bevölkerung 5% erleiden ein Mal einen epileptischen Anfall 1% erkranken an Epilepsie Folie 2 Folie 3 3-5 % Epidemiologische Studie 1989 Rochester, Minnesota,

Mehr

Logbuch für das Praktische Jahr. Institut für Humangenetik Name:

Logbuch für das Praktische Jahr. Institut für Humangenetik Name: Logbuch für das Praktische Jahr Institut für Humangenetik Name: Liebe PJ-Studierende, herzlich Willkommen im Institut für Humangenetik des Universitätsklinikums Leipzig AöR. Wir freuen uns sehr, dass Sie

Mehr

Christian Veltmann. Plötzlicher Herztod plötzlicher Herztod. 73 Jahre Am Abend wie immer ins Bett Morgens tot

Christian Veltmann. Plötzlicher Herztod plötzlicher Herztod. 73 Jahre Am Abend wie immer ins Bett Morgens tot Der plötzliche Herztod in der Familie Was nun? Plötzlicher Herztod plötzlicher Herztod 73 Jahre Am Abend wie immer ins Bett Morgens tot Bild Opa 31 Jahre Beim Sport zusammengebrochen VF, frustran reanimiert

Mehr

Pränatale array-cgh. Abklären und erkennen. Für eine erweiterte pränatale Vorsorge

Pränatale array-cgh. Abklären und erkennen. Für eine erweiterte pränatale Vorsorge Pränatale array-cgh Abklären und erkennen Für eine erweiterte pränatale Vorsorge Untersuchung für Schwangere mit speziellen Risiken Array-CGH: Warum kann sie nötig sein? Chromosomen: Die Träger der Erbinformationen

Mehr

Nicht-invasive molekulargenetische Pränataldiagnostik

Nicht-invasive molekulargenetische Pränataldiagnostik Nicht-invasive molekulargenetische Pränataldiagnostik Dr. rer. medic. Wera Hofmann Medical Director LifeCodexx AG Dr. Wera Hofmann, Medical Director Porto, ECA 2011 July 2, 2011 page 1 2011 LifeCodexx

Mehr

Praxis für Humangene k Tübingen Dr. med. Dr. rer. nat. Saskia Biskup Fachärz n für Humangene k

Praxis für Humangene k Tübingen Dr. med. Dr. rer. nat. Saskia Biskup Fachärz n für Humangene k Allgemeine Informationen Fötus von Name Mutter: Vorname Mutter: Geburtsdatum Mutter: Geschlecht des Fötus: q männlich q weiblich q unbekannt Ausschluss MCC bereits erfolgt? Untersuchungsmaterial q Fruchtwasser

Mehr

Änderungen der Humangenetik im Kapitel 11, 19 und 32 des EBM zum 1. Juli 2016

Änderungen der Humangenetik im Kapitel 11, 19 und 32 des EBM zum 1. Juli 2016 Änderungen der Humangenetik im Kapitel 11, 19 und 32 des EBM zum 1. Juli 2016 Punktzahl Alt Neu 11310 bis 11312 11320 bis 11322 gestrichen 11330 bis 11334 Abschnitt 11.4.1 Pauschalen der in-vitro-diagnostik

Mehr

Neue Diagnostik für akute myeloische Leukämie

Neue Diagnostik für akute myeloische Leukämie Neue Diagnostik für akute myeloische Leukämie Neuherberg (9. März 2011) - Wissenschaftler des Helmholtz Zentrums München und der Ludwig-Maximilians-Universität München haben eine Methode entwickelt, mit

Mehr

Von Mendel bis -Omics Geschichte und Grundlagen der Humangenetik , Walther Vogel, Institut für Humangenetik

Von Mendel bis -Omics Geschichte und Grundlagen der Humangenetik , Walther Vogel, Institut für Humangenetik Von Mendel bis -Omics Geschichte und Grundlagen der Humangenetik 19.04.2018, Walther Vogel, Institut für Humangenetik Erste Grundlagen ca 1850 bis 1900 Gregor Mendel (1822 1884) Erbfaktoren (Gene) dominant

Mehr

Änderung per 1. Januar 2017

Änderung per 1. Januar 2017 Änderung per 1. Januar 2017 Kapitel 2: enetik 2.2.2 Molekulargenetische Analysen 2018.00 350 Chromosomenuntersuchung, konstitutioneller Karyotyp oder maligne Hämopathien, Zuschlag für In-situ- Hybridisierung

Mehr

Molekulare Diagnostik, Plattformen, analytische Ansätze, Funktionsweise, Bioinformatik bei Next Generation Sequencing

Molekulare Diagnostik, Plattformen, analytische Ansätze, Funktionsweise, Bioinformatik bei Next Generation Sequencing Molekulare Diagnostik, Plattformen, analytische Ansätze, Funktionsweise, Bioinformatik bei Next Generation Sequencing Humangenetik Multi-Gen-Panel-Sequenzierung (MGPS) bei Seltenen Erkrankungen (simultane

Mehr

Populationsrelevanz der Hämochromatose und klinische Konsequenzen

Populationsrelevanz der Hämochromatose und klinische Konsequenzen Populationsrelevanz der Hämochromatose und klinische Konsequenzen 60. Tagung der DGVS Köln, 15.09.2005 Prof. Dr. med. Manfred Stuhrmann-Spangenberg Institut für Humangenetik Medizinische Hochschule Hannover

Mehr

Welcher Krebs ist erblich?

Welcher Krebs ist erblich? Welcher Krebs ist erblich? Prof. Dr. med. Reiner Siebert Christian-Albrechts-Universität zu Kiel Universitätsklinikum, rsiebert@medgen.uni-kiel.de Welcher Krebs ist erblich? Krebs ist NIE erblich Krebs

Mehr

Humangenetik. Dr. Sabine Hentze

Humangenetik. Dr. Sabine Hentze Humangenetik Diagnostik Indikationen Ethische Fragen Dr. Sabine Hentze 1 Genetik ist Medizin Forschung Technologie und Informatik Politik 2 Humangenetik Diagnostik Indikationen Ethische Fragen 3 Diagnostische

Mehr

Humangenetische Untersuchungen Herausforderungen in der genetischen Pädiatrie. Carola Altus & Thomas Wex

Humangenetische Untersuchungen Herausforderungen in der genetischen Pädiatrie. Carola Altus & Thomas Wex Humangenetische Untersuchungen Herausforderungen in der genetischen Pädiatrie Carola Altus & Thomas Wex Humangenetik und Pädiatrie - eine enge Verbindung ca. 3-4 % der Kinder werden mit einer genetisch

Mehr

Medizinische Genetik: Beispiele aus der Praxis

Medizinische Genetik: Beispiele aus der Praxis Medizinische Genetik: Beispiele aus der Praxis SAGB/ASHM Jahrestagung Bern, 14.06.2012 Kontakt: Dr. Bernhard Steiner, Médecin Adjoint, Kinderspital Luzern bernhard.steiner@luks.ch Chinderarztpraxis, Ruopigenring

Mehr

Pränatales Screening auf Chromosomenstörungen

Pränatales Screening auf Chromosomenstörungen Patienten-Information LABOR ENDERS Pränatales Screening auf Chromosomenstörungen Leitfaden für werdende Mütter und Väter aenatales_screening_105x210_hks_65k.indd 1 09.12.16 07:41 2 Patienten-Information

Mehr

Vorgeburtliche Untersuchung aus dem Blut der Schwangeren zur Abklärung einer möglichen fetalen Trisomie 21, 18 und 13

Vorgeburtliche Untersuchung aus dem Blut der Schwangeren zur Abklärung einer möglichen fetalen Trisomie 21, 18 und 13 Patientinneninformation zum NIPT ( nicht-invasiver pränataler Test ) Vorgeburtliche Untersuchung aus dem Blut der Schwangeren zur Abklärung einer möglichen fetalen Trisomie 21, 18 und 13 Sehr geehrte Patientin,

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

B E S C H L U S S. des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 386. Sitzung am 12. Dezember Teil A

B E S C H L U S S. des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 386. Sitzung am 12. Dezember Teil A B E S C H L U S S des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 386. Sitzung am 12. Dezember 2016 Teil A zur Änderung des Einheitlichen Bewertungsmaßstabes (EBM) mit Wirkung zum 1. Januar

Mehr

Diese Kombination von multiplen Geburtsfehlern ist relativ häufig (ca. 1/ 8500 Neugeborene). Selten zeigen Betroffene eine normale Intelligenz.

Diese Kombination von multiplen Geburtsfehlern ist relativ häufig (ca. 1/ 8500 Neugeborene). Selten zeigen Betroffene eine normale Intelligenz. Praxis für Humangenetik Heinrich-von-Stephan-Str. 5 D-79100 Freiburg Information CHARGE-Syndrom Molekulargenetische Untersuchung des Gens CHD7 Praxis für Humangenetik Prof. Dr. med. Jürgen Kohlhase Facharzt

Mehr

Onkologisch-genetische Erkrankungen und deren psychosozialer Einfluss im familiären Kontext

Onkologisch-genetische Erkrankungen und deren psychosozialer Einfluss im familiären Kontext Onkologisch-genetische Erkrankungen und deren psychosozialer Einfluss im familiären Kontext Dorothea Wand Medizinische Genetik USB Schönbeinstrasse 40; CH-4031 Basel Fachtagung Päd. Onkologiepflege XI/2017

Mehr

Der Wert von nicht-invasiven pränatalen Tests (NIPT) Ein Zusatz zum Handbuch für Genetikberater

Der Wert von nicht-invasiven pränatalen Tests (NIPT) Ein Zusatz zum Handbuch für Genetikberater Der Wert von nicht-invasiven pränatalen Tests (NIPT) Ein Zusatz zum Handbuch für Genetikberater NIPTs verwenden zellfreie DNA. Blutprobe von der Mutter Mütterliche cfdna Fötale cfdna NIPTs verwenden zellfreie

Mehr

Aktuelle Trends bei NGS

Aktuelle Trends bei NGS Aktuelle Trends bei NGS Bernreiter Andreas 29.11.2017 Next-Generation-Sequencing (NGS) Massive parallel sequencing : 100.000 DNA Moleküle können gleichzeitig sequenziert werden. Humangenom kann in einer

Mehr

PraenaTest. Nicht-invasive Untersuchung auf Trisomien beim ungeborenen Kind. Qualität aus Deutschland JETZT NEU

PraenaTest. Nicht-invasive Untersuchung auf Trisomien beim ungeborenen Kind. Qualität aus Deutschland JETZT NEU JETZT NEU PraenaTest express Ihr Ergebnis in 1 Woche PraenaTest Qualität aus Deutschland Nicht-invasive Untersuchung auf Trisomien beim ungeborenen Kind Information und Aufklärung für Schwangere Liebe

Mehr

Ab 1. Juli 2016 neuer EBM Humangenetik (Kap. 11) Molekularpathologie (Kap. 19) NEXT GENERATION SEQUENCING 2. Auflage 2016 NGS

Ab 1. Juli 2016 neuer EBM Humangenetik (Kap. 11) Molekularpathologie (Kap. 19) NEXT GENERATION SEQUENCING 2. Auflage 2016 NGS ZENTRUM FÜR HUMANGENETIK UND LABORATORIUMSDIAGNOSTIK (MVZ) Dr. Klein, Dr. Rost und Kollegen Ab 1. Juli 2016 neuer EBM Humangenetik (Kap. 11) Molekularpathologie (Kap. 19) NEXT GENERATION SEQUENCING 2.

Mehr

Bioinformatik: The Next Generation

Bioinformatik: The Next Generation Bioinformatik: The Next Generation Prof. Dr. Caroline Friedel Lehr- und Forschungseinheit Bioinformatik Was ist Bioinformatik? Theoretische und Praktische Informatik Statistik, Mathematik Molekularbiologie,

Mehr

Humangenetische Beratung

Humangenetische Beratung Humangenetische Beratung Dr MEd. Martin GEncik Diagenos www.diagenos.com Allgemeines Indikation Inanspruchnahme, Rahmenbedingungen Qualifikationen Aufklärung vor Genetischer Beratung Anamnese und Befunderhebung

Mehr

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Prof. Dr. med. Brigitte Schlegelberger 670513011/15 Olaparib Zulassung in Europa: Rezidiv eines Platin-sensitiven Ovarialkarzinoms

Mehr

Entscheidungserhebliche Gründe

Entscheidungserhebliche Gründe Entscheidungserhebliche Gründe zum Beschluss des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 372. Sitzung am 11. März 2016 zur Änderung des Einheitlichen Bewertungsmaßstabes (EBM) mit Wirkung

Mehr

MGZ DAS HUMANGENETISCHE BERATUNGSGESPRÄCH. Patienteninformation. Medizinisch Genetisches Zentrum

MGZ DAS HUMANGENETISCHE BERATUNGSGESPRÄCH. Patienteninformation. Medizinisch Genetisches Zentrum MGZ Medizinisch Genetisches Zentrum Patienteninformation 1 DAS HUMANGENETISCHE BERATUNGSGESPRÄCH 3 DAS HUMANGENETISCHE BERATUNGS - GESPRÄCH Grundsätzlich ist die humangenetische Beratung ein Informa tionsgespräch,

Mehr

Bioinformatik: The Next Generation

Bioinformatik: The Next Generation Bioinformatik: The Next Generation Prof. Dr. Caroline Friedel Lehr- und Forschungseinheit Bioinformatik Was ist Bioinformatik? Prof. Dr. Caroline Friedel, Tag der offenen Tür der LMU 2 Was ist Bioinformatik?

Mehr

Bedeutung genetischer Diagnosen bei Patienten mit Intelligenzminderung und Epilepsie. Thomas Dorn

Bedeutung genetischer Diagnosen bei Patienten mit Intelligenzminderung und Epilepsie. Thomas Dorn Bedeutung genetischer Diagnosen bei Patienten mit Intelligenzminderung und Epilepsie Thomas Dorn 7.6.2018 Übersicht Fortschritte in der Diagnostik genetischer Erkrankungen SAMW Richtlinien Genetische Beratung

Mehr

Fachhandbuch für F09 - Humangenetik (9. FS) Inhaltsverzeichnis. 1. Übersicht über die Unterrichtsveranstaltungen... 2

Fachhandbuch für F09 - Humangenetik (9. FS) Inhaltsverzeichnis. 1. Übersicht über die Unterrichtsveranstaltungen... 2 Fachhandbuch für F09 - Humangenetik (9. FS) Inhaltsverzeichnis 1. Übersicht über die Unterrichtsveranstaltungen... 2 1.1. Vorlesung... 2 1.2. Seminar/Praktikum... 5 2. Beschreibung der Unterrichtsveranstaltungen...

Mehr

Testmethoden der Molekularpathologie. im Vergleich

Testmethoden der Molekularpathologie. im Vergleich Testmethoden der Molekularpathologie im Vergleich Andreas Bösl (Feldkirch) Gerlinde Winter (Graz) Testmethoden der Molekularpathologie PCR Fragmentanalyse Gelelektrophorese, Kapillarelektrophorese Sequenzierung

Mehr

Gemeinsame genetische Risikofaktoren bei häufigen Epilepsiesyndromen entdeckt

Gemeinsame genetische Risikofaktoren bei häufigen Epilepsiesyndromen entdeckt Epilepsie-Varianten Gemeinsame genetische Risikofaktoren bei häufigen Epilepsiesyndromen entdeckt Berlin (19. September 2014) - Epilepsien sind eine klinisch heterogene Gruppe neurologischer Erkrankungen.

Mehr

Trio-Analyse (Exome-Seq)

Trio-Analyse (Exome-Seq) WS2017/2018 MSc Modul 7A Genomforschung und Sequenzanalyse - Einführung in Methoden der Bioinformatik- AG Hankeln Trio-Analyse (Exome-Seq) Mutationen mit Krankheitsrelevanz im Humangenom More than 3800

Mehr

Psychosoziale Beratung im Kontext von pränataler Diagnostik

Psychosoziale Beratung im Kontext von pränataler Diagnostik Geisteswissenschaft Sandra Mette Psychosoziale Beratung im Kontext von pränataler Diagnostik Rolle und Aufgabe der Sozialen Arbeit Bachelorarbeit Bibliografische Information der Deutschen Nationalbibliothek:

Mehr

Matthias Paul Eric Schulze-Bahr

Matthias Paul Eric Schulze-Bahr Matthias Paul Eric Schulze-Bahr Modul 1 (von 2) Institut für Genetik von Herzerkrankungen Department für Kardiologie und Angiologie Genetische Erkrankungen: Rare diseases (SE) NAMSE Nationales Aktionsbündnis

Mehr

Pränatale Analytik Informationen für die Eltern

Pränatale Analytik Informationen für die Eltern Pränatale Analytik Informationen für die Eltern Liebe Eltern Sie entscheiden. Diese Broschüre vermittelt Ihnen wichtige Informationen zur pränatalen Diagnostik fetaler Trisomien. Die Entscheidung, einen

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

Essen / Düsseldorf Dresden. Frankfurt / Mainz. Heidelberg. Tübingen. München

Essen / Düsseldorf Dresden. Frankfurt / Mainz. Heidelberg. Tübingen. München Berlin Essen / Düsseldorf Dresden Frankfurt / Mainz Heidelberg Tübingen Freiburg München Was ist das MASTER Programm? Das MASTER Programm hat zum Ziel, auf Basis von Veränderungen im Erbgut einzelner Tumoren

Mehr

AlgoBio WS 16/17 Protein-DNA Interaktionen ChiP-Seq Datenanalyse. Annalisa Marsico

AlgoBio WS 16/17 Protein-DNA Interaktionen ChiP-Seq Datenanalyse. Annalisa Marsico AlgoBio WS 16/17 Protein-DNA Interaktionen ChiP-Seq Datenanalyse Annalisa Marsico 6.02.2017 Protein-DNA Interaktionen Häufig binden sich Proteine an DNA, um ihre biologische Funktion zu regulieren. Transkriptionsfaktoren

Mehr

Hämophilie Symposium, März , Reitter Sylvia

Hämophilie Symposium, März , Reitter Sylvia Hämophilie Symposium, März 2010 FVIII-Gen liegt auf Xq28 (langer Arm des X-Chromosoms) x Hämophilie Erbgang I Hämophilie Erbgang II FVIII-Gen besteht aus 26 Exons mit 186 Kilobasenpaaren (kb); Exon 14

Mehr

Pränataldiagnostik und NIPT heute

Pränataldiagnostik und NIPT heute Pränataldiagnostik und NIPT heute Peter Kozlowski praenatal.de COI: Keine Interessenkonflikte 15. Nordthüringer Ultraschalltagung Hochschule Nordhausen 23. Februar 2019 ETS vs. cfdna in NL mybabywatcher.com

Mehr

Genetik der Chorea Huntington

Genetik der Chorea Huntington Genetik der Chorea Huntington Prim. Univ. Doz. Dr. med. Hans-Christoph Duba Zentrum Medizinische Genetik Linz 17.10.2015 Genetik der Chorea Huntington 1 Chorea Huntington Chorea Huntington Häufigkeit =

Mehr

Entscheidungserhebliche Gründe

Entscheidungserhebliche Gründe Entscheidungserhebliche Gründe zum Beschluss des Bewertungsausschusses nach 87 Abs. 1 Satz 1 SGB V in seiner 376. Sitzung am 22. Juni 2016 zur Änderung des Einheitlichen Bewertungsmaßstabes (EBM) mit Wirkung

Mehr

2. Regensburger Patiententag

2. Regensburger Patiententag 2. Regensburger Patiententag 7. Feb. 2015 Neues aus der Therapie von Leukämien und Lymphomen Wolfgang Herr Innere Medizin III Hämatologie und Onkologie Leukämien und Lymphome entstehen durch Veränderungen

Mehr

Anwendung pränataldiagnostischer Verfahren im 1. Trimenon

Anwendung pränataldiagnostischer Verfahren im 1. Trimenon Anwendung pränataldiagnostischer Verfahren im 1. Trimenon (Stellungnahme der DEGUM Stufe III) Peter Kozlowski praenatal.de Stufe II Treffen Ost der DEGUM-Sektion Gynäkologie Leipzig 27. Januar 2018 g-ba.de

Mehr

Syndrom. MGZ München

Syndrom. MGZ München Li-Fraumeni Syndrom Elke Holinski-Feder MGZ München TP53 Funktion TP53 Survival years 30 45 60 Cancer free survival % females 65 33 3 males 83 62 22 Wu et al., Hum Genet 2011; Mai PL et al., Cancer 2016

Mehr

HABILITATIONSSCHRIFT. Syndromale Erkrankungsbilder mit mentaler Retardierung

HABILITATIONSSCHRIFT. Syndromale Erkrankungsbilder mit mentaler Retardierung Aus dem Charité Centrum 17 Institut für Medizinische Genetik Direktor: Prof. Dr. Stefan Mundlos HABILITATIONSSCHRIFT Syndromale Erkrankungsbilder mit mentaler Retardierung zur Erlangung der Venia legendi

Mehr

Ausprägungsfach Bioinformatik im Rahmen des Bachelor-Studiengangs Informatik. CIBIV Center for Integrative Bioinformatics Vienna

Ausprägungsfach Bioinformatik im Rahmen des Bachelor-Studiengangs Informatik. CIBIV Center for Integrative Bioinformatics Vienna Ausprägungsfach Bioinformatik im Rahmen des Bachelor-Studiengangs Informatik Center for Integrative Bioinformatics Vienna (CIBIV) Max F. Perutz Laboratories (MFPL) Vienna, Austria http://www.cibiv.at CIBIV

Mehr

ATTGACTTTGGACTAGAATCGATAAAATCCGCATCATCATACCCATTGGCCGGGTAACCCTG TCATGTCATTTAGGGATTTTTATTTTTAAAACGTATTATGGACCACAGGATCATGATCATGAC

ATTGACTTTGGACTAGAATCGATAAAATCCGCATCATCATACCCATTGGCCGGGTAACCCTG TCATGTCATTTAGGGATTTTTATTTTTAAAACGTATTATGGACCACAGGATCATGATCATGAC ATTGACTTTGGACTAGAATCGATAAAATCCGCATCATCATACCCATTGGCCGGGTAACCCTG ACGATTAGTCATCATGAGGGACTGGTTTAGGTTTCCACATGACGTATGCATTAAACCCTTTAG TGGAGGGTTTGGGGCCCATTCATGATCTCTCTCAAGGAGATACGATCATGTCCCCCCTTTTGG ACGTATGACTAAGGCCTACCATGGGACTGGTCAGTCATGCATGACATAGACTGGTACCATTT

Mehr

Grundlagen für die Personalisierte Medizin Forschung in Lebenswissenschaften, Medizin und Technologie

Grundlagen für die Personalisierte Medizin Forschung in Lebenswissenschaften, Medizin und Technologie Grundlagen für die Personalisierte Medizin Forschung in Lebenswissenschaften, Medizin und Technologie Prof. Wilhelm Krek Institut für Molekulare Gesundheitswissenschaften ETH Zürich Die Entschlüsselung

Mehr

Next Generation Gene Sequencing bei Brustkrebs

Next Generation Gene Sequencing bei Brustkrebs Institut für Medizinische Genetik Next Generation Gene Sequencing bei Brustkrebs Prof. Dr. med. Anita Rauch 08.10.2015 Seite 1 Benefit der Krebsfrüherkennung Antilla et al. 2014 08.10.2015 Anita Rauch

Mehr

Klinik für Hepatologie. Christoph Malenke

Klinik für Hepatologie. Christoph Malenke Dense genotyping of immune-related disease regions identifies nine new risk loci for primary sclerosing cholangitis Nat Genet. 2013 June; 45(6): 670 675 Christoph Malenke Klinik für Hepatologie 2 Gliederung

Mehr

Lernziele. Molekulargenetik I

Lernziele. Molekulargenetik I Molekulargenetik I Lernziele Nach dem Seminar können Sie o Vererbungsmodi vorwärts (Entwurf eines plausiblen Stammbaums zum bekannten Erbmodus) und rückwärts anwenden (wahrscheinlichsten Erbmodus aus vorgegebenem

Mehr

Genetische Beratung. Abklären, erkennen, vorsorgen. Informationen für Patienten und Familien mit genetischen Risiken

Genetische Beratung. Abklären, erkennen, vorsorgen. Informationen für Patienten und Familien mit genetischen Risiken Genetische Beratung Abklären, erkennen, vorsorgen Informationen für Patienten und Familien mit genetischen Risiken Haben Sie Fragen zu genetischen Risiken in Ihrer Familie? Wir beraten Sie gerne. Genetische

Mehr

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory Sequenzierung Norbert Arnold Neue Sequenziertechnologien (seit 2005) Next Generation Sequenzierung (NGS, Erste Generation) Unterschiedliche Plattformen mit unterschiedlichen Strategien Roche 454 (basierend

Mehr

Genetische Untersuchungen und Familienscreening

Genetische Untersuchungen und Familienscreening Genetische Untersuchungen und Familienscreening Fortbildung Kardiologische Gemeinschaftspraxis Kursaal, Hotel Allegro Bern 1. März 2012 Dr Siv Fokstuen Medizinische Genetik, Universitätsspital Genf Kardiologische

Mehr

Gemeinsam gegen den Krebs. Gemeinsam für das Leben. Informationen zum CIO Köln Bonn für Patienten und Interessierte

Gemeinsam gegen den Krebs. Gemeinsam für das Leben. Informationen zum CIO Köln Bonn für Patienten und Interessierte Gemeinsam gegen den Krebs. Gemeinsam für das Leben. Informationen zum CIO Köln Bonn für Patienten und Interessierte Wir bieten keine Behandlung nach Schema F! Die wissenschaftlichen Erkenntnisse der letzten

Mehr

Teil B. zur Änderung des Einheitlichen Bewertungsmaßstabes (EBM) mit Wirkung zum 1. April 2019

Teil B. zur Änderung des Einheitlichen Bewertungsmaßstabes (EBM) mit Wirkung zum 1. April 2019 Teil B zur Änderung des Einheitlichen Bewertungsmaßstabes (EBM) mit Wirkung zum 1. April 2019 1. Änderung des letzten Absatzes der Nr. 2.1.4 der Allgemeinen Bestimmungen zum EBM Bei Berechnung der nachfolgenden

Mehr

Dr Jean-Luc Dourson. Screening auf Trisomie 21 und andere fötale Aneuploidien. Nicht-invasive pränatale Tests 1

Dr Jean-Luc Dourson. Screening auf Trisomie 21 und andere fötale Aneuploidien. Nicht-invasive pränatale Tests 1 Dr Jean-Luc Dourson Screening auf Trisomie 21 und andere fötale Aneuploidien Nicht-invasive pränatale Tests 1 Nicht-invasive pränatale Tests (NIPT) auf die Trisomien 21, 18 und 13 1 BLUTENTNAHME 99 %

Mehr

Freitag, 10. Oktober 2014

Freitag, 10. Oktober 2014 Freitag, 10. Oktober 2014 Uhrzeit/Raum Raum 1 Raum 2 Raum 3 Raum 4 Raum 5 Raum 6 Raum 7 Raum 8 Raum 9 Raum 10 Raum 11 Raum 12 Raum 13 12:30 14:00 Best of the Year 14:00 14:30 Pause 14:30 16:00 Merck Serono

Mehr

Fragen Sie Ihren Gesundheitsdienstleister

Fragen Sie Ihren Gesundheitsdienstleister Ein einfacher, sicherer Bluttest, der hochsensible Ergebnisse bietet Ein moderner nicht invasiver Test zur Bewertung von fetaler Trisomie und Beurteilung des Y-Chromosoms Fragen Sie Ihren Gesundheitsdienstleister

Mehr

Screening vs. Testing

Screening vs. Testing Symposion Winter 2014 Verstehen, was man sieht! Screening vs. Testing Array-CGH und Panel-Diagnostik Syndrom-Diagnostik (Pränatal und beim geborenen Kind) 15. Februar 2014 Vortragssaal in der Frauenklinik

Mehr

Indikationskriterien für genetische Diagnostik Bewertung der Validität und des klinischen Nutzens

Indikationskriterien für genetische Diagnostik Bewertung der Validität und des klinischen Nutzens Indikationskriterien für genetische Diagnostik Bewertung der Validität und des klinischen Nutzens Indikationskriterien für die Krankheit: Williams-Beuren-Syndrom [7q11.23; ELN, LIMK1, GTF2I] 1. Allgemeine

Mehr

Wann sollten wir an monogene Diabetesformen denken? Sebastian Kummer Uni-Kinderklinik Düsseldorf

Wann sollten wir an monogene Diabetesformen denken? Sebastian Kummer Uni-Kinderklinik Düsseldorf Wann sollten wir an monogene Diabetesformen denken? Sebastian Kummer Uni-Kinderklinik Düsseldorf Anas, 6 Jahre Zufallsbefund Glukosurie BZ 150mg/dl. BZ-Messungen nüchtern um 110-140mg/dl, postprandial

Mehr

MGZ ARZTINFORMATION WAS IST BEI DER VERANLASSUNG VON GENETISCHER DIAGNOSTIK ZU BEACHTEN? Medizinisch Genetisches Zentrum

MGZ ARZTINFORMATION WAS IST BEI DER VERANLASSUNG VON GENETISCHER DIAGNOSTIK ZU BEACHTEN? Medizinisch Genetisches Zentrum MGZ Medizinisch Genetisches Zentrum ARZTINFORMATION WAS IST BEI DER VERANLASSUNG VON GENETISCHER DIAGNOSTIK ZU BEACHTEN? Im MGZ Medizinisch Genetischen Zentrum bieten Fachärztinnen für Humangenetik eine

Mehr

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms?

Brustkrebs aktuell - OSP am Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Brustkrebs aktuell - OSP am 21.10.2015 Was ist eigentlich die Aufgabe des Pathologen in Diagnostik und Therapie des Mammakarzinoms? Prof. Dr. German Ott, Institut für Pathologie Robert-Bosch-Krankenhaus

Mehr

MGZ. Medizinisch Genetisches Zentrum PATIENTENINFORMATION ERBLICHE KREBSERKRANKUNGEN

MGZ. Medizinisch Genetisches Zentrum PATIENTENINFORMATION ERBLICHE KREBSERKRANKUNGEN MGZ Medizinisch Genetisches Zentrum 1 PATIENTENINFORMATION ERBLICHE KREBSERKRANKUNGEN Sehr geehrte Patientin, sehr geehrter Patient, Krebserkrankungen betreffen jedes Jahr viele Personen in Deutschland

Mehr

Hauptvorlesung Neurologie. Neurogenetik. Dr. med. Alexander Schmidt. Institut für Neurogenetik, Klinik für Neurologie 16.

Hauptvorlesung Neurologie. Neurogenetik. Dr. med. Alexander Schmidt. Institut für Neurogenetik, Klinik für Neurologie 16. Hauptvorlesung Neurologie Neurogenetik Dr. med. Alexander Schmidt Institut für Neurogenetik, Klinik für Neurologie 16. Juni 2014 Neurogenetische Erkrankungen > 1000 Basalganglienerkrankungen Ataxien Heredodegenerative

Mehr

Angeborene Stoffwechsel- Erkrankungen

Angeborene Stoffwechsel- Erkrankungen Strohmeyer Stremmel Niederau (Hrsg.) Angeborene Stoffwechsel- Erkrankungen Genetik Pathophysiologie Klinik Diagnostik Therapie Inhalt Inhalt 5 Vorwort 11 Kohlenhydratstoffwechsel und Glykogenosen 13 Martin

Mehr

Auswahl des Versichertenklassifikationsmodells: Validierung der Diagnostik psychischer Störungen und der Festlegung von Aufgreifkriterien

Auswahl des Versichertenklassifikationsmodells: Validierung der Diagnostik psychischer Störungen und der Festlegung von Aufgreifkriterien Auswahl des Versichertenklassifikationsmodells: Validierung der Diagnostik psychischer Störungen und der Festlegung von Aufgreifkriterien der Bundespsychotherapeutenkammer vom 09.05.2008 BPtK Klosterstraße

Mehr

Genetische Beratung und Diagnostik. All is genetics. Familiäre Tumore Personalisierte Medizin

Genetische Beratung und Diagnostik. All is genetics. Familiäre Tumore Personalisierte Medizin Seminar Humangenetik 2015 Genetische Beratung und Diagnostik All is genetics. Familiäre Tumore Personalisierte Medizin 9. Dezember 2015 Seminarraum Seminar Humangenetik 2015 Genetische Beratung und Diagnostik

Mehr

LABOR ENDERS. Pränatales Screening auf Chromosomenstörungen. Leitfaden für werdende Mütter und Väter

LABOR ENDERS. Pränatales Screening auf Chromosomenstörungen. Leitfaden für werdende Mütter und Väter LABOR ENDERS Pränatales Screening auf Chromosomenstörungen Leitfaden für werdende Mütter und Väter Liebe Patientin, Häufigste Chromosomenstörung: Trisomie 21 Das Risiko für eine Trisomie 21 hängt stark

Mehr

E1.1. Kardiologische Untersuchung und Beratung von Verwandten 1. Grades eines Indexpatienten (Propositus)

E1.1. Kardiologische Untersuchung und Beratung von Verwandten 1. Grades eines Indexpatienten (Propositus) ANHANG Empfehlungen (E) E1: Untersuchung von Familienmitgliedern (Verwandte 1. Grades) bei monogenen oder syndromalen, kardiovaskulären Erkrankungen (sog. Kaskadenuntersuchung) (Abb. 2) Empfehlungsgrad

Mehr

Ersttrimester- Screening Was wird untersucht? MUSTER

Ersttrimester- Screening Was wird untersucht? MUSTER Ersttrimester- Screening Was wird untersucht? Sehr geehrte Patientin, schon seit vielen Jahrzehnten besteht die Möglichkeit durch eine Fruchtwasseruntersuchung (Amniocentese, AC) oder einer Mutterkuchenprobe

Mehr

Patienteninformation zur Molekularen Diagnostik und Therapie

Patienteninformation zur Molekularen Diagnostik und Therapie KLINIKUM DER UNIVERSITÄT MÜNCHEN CAMPUS GROSSHADERN CAMPUS INNENSTADT KREBSZENTRUM MÜNCHEN COMPREHENSIVE CANCER CENTER CCC LMU Patienteninformation zur Molekularen Diagnostik und Therapie 3 Sehr geehrte

Mehr

Genetische Individualisierung - Möglichkeiten und Grenzen aus technischer und ethischer Sicht

Genetische Individualisierung - Möglichkeiten und Grenzen aus technischer und ethischer Sicht J. Schmidtke Institut für Humangenetik Medizinische Hochschule Hannover Genetische Individualisierung - Möglichkeiten und Grenzen aus technischer und ethischer Sicht Hannover, 22.05.2003 Alle Menschen

Mehr

Antrag auf Ausführung und Abrechnung von molekulargenetischen Untersuchungen bei monogenen Erkrankungen

Antrag auf Ausführung und Abrechnung von molekulargenetischen Untersuchungen bei monogenen Erkrankungen Kassenärztliche Vereinigung Berlin Abteilung Qualitätssicherung Masurenallee 6A 14057 Berlin Praxisstempel Telefon (030) 31003-307, Fax (030) 31003-305 Antrag auf Ausführung und Abrechnung von molekulargenetischen

Mehr