Peter Schuster. Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA

Transkript

1

2 Darwins Optimierung aus der Sicht von Chemie und Physik Peter Schuster Institut für Theoretische Chemie, Universität Wien, Austria and The Santa Fe Institute, Santa Fe, New Mexico, USA Faktum Evolution Naturhistorisches Museum Wien,

3 Web-Page for further information:

4 Farbmuster auf Tierfellen, -flügeln und -panzern

5 1. Musterbildung in Physik und Chemie 2. Muster in der Biologie 3. Darwins Prinzip der natürlichen Auslese 4. Vermehrung und Evolution von Molekülen 5. Chemische Kinetik der molekularen Evolution 6. Evolutionsexperimente mit Molekülen 7. Ursachen und Konsequenzen der Neutralität 8. Komplexität in der Biologie

7 kalt heiß Raleigh-Bénard Konvektion und Ausbildung von Hurrikanen

8 View from south pole South pole Red spot Roter Fleck des Jupiters: Beobachtung eines gigantischen Wirbels Bilder sind entnommen von James Gleick, Chaos. Penguin Books, New York, 1988

9 Veränderung in der lokalen Konzentration = = Diffusion + Chemische Reaktion A.M. Turing The chemical basis of morphogenesis. Phil.Trans.Roy.Soc.London B 237: Alan M. Turing,

10 Liesegang Ringe 1895 Belousov-Zhabotinskii Reaktion 1959 Musterbildung durch chemische Selbstorganisation: Liesegang Ringe durch Fällung aus übersättigten Lösungen, Raum-Zeit-Muster in der Belousov-Zhabotinskii Reaktion, und stationäre Turing Muster. Turing Muster: Boissonade, De Kepper 1990

12 Mutter mutmaßlicher Vater Fellmuster in einer Inzuchtlinie von verwilderten Katzen Eltern und Tochter Tochter

13 Bates mimicry Müller s mimicry Different forms of mimicry observed in nature

14 milk snake Bates mimicry false coral snake coral snake Emsley s or Mertens mimicry Different forms of mimicry observed in nature

16 Drei notwendige Bedingungen für Darwinsche Evolution: 1. Vermehrung 2. Variation 3. Selektion Empirisch erkanntes Prinzip der natürlichen Auslese

17 s = f f 2 1 = 1 f 0.1 Two variants with a mean progeny of ten or eleven descendants

18 N1 ( 0) = 9999, N2(0) = 1; s = 0.1, 0.02, 0.01 Selection of advantageous mutants in populations of N = individuals

19 Genotype, Genome GCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTGAAGATCTGGAGGTCCTGTGTTCGATCCACAGAATTCGCACCA RNA biochemistry systems biology molecular biology genetics structural biology the new biology epigenetics molecular evolution is the chemistry of living environment matter molecular genetics systems biology bioinfomatics Unfolding of the genotype DNA Phenotype John Kendrew Manfred Eigen protein Thomas Cech RNA catalysis Linus Pauling and Emile Zuckerkandl molecular evolution Gerhard Braunitzer hemoglobin sequence Max Perutz James D. Watson und Francis H.C. Crick DNA structure

21 James D. Watson, 1928-, and Francis H.C. Crick, Nobel prize fifty years double helix The three-dimensional structure of a short double helical stack of B-DNA

22 DNA structure and DNA replication

23 Replication fork in DNA replication The mechanism of DNA replication is semi-conservative

24 Complementary replication is the simplest copying mechanism of RNA. Complementarity is determined by Watson-Crick base pairs: G C and A=U

25 Drei notwendige Bedingungen für Darwinsche Evolution: 1. Vermehrung, 2. Variation, and 3. Selektion. Variation in Form von Rekombination und/oder Mutation verändert die Genotypen wogegen Selektion nur auf den Phänotypen operiert. Im Darwinschen Szenario treten Variationen in Form von Rekombinationsund/oder Mutationsereignissen unkorreliert mit ihren Effekt auf den Selektionprocess auf und erscheinen daher zufällig. Alle drei Bedingungen werden nicht nur von zellulären Organismen erfüllt sondern auch von Molekülen in geigneten zellfreien Assays.

26 RNA sample Time Stock solution: Q RNA-replicase, ATP, CTP, GTP and UTP, buffer Application of the serial transfer technique to RNA evolution in the test tube

27 Decrease in mean fitness due to quasispecies formation The increase in RNA production rate during a serial transfer experiment

29 Replication and mutation are parallel chemical reactions.

30 Chemical kinetics of replication and mutation as parallel reactions

31 p = 0 Formation of a quasispecies in sequence space

32 p = 0.25 p cr Formation of a quasispecies in sequence space

35 p p cr Uniform distribution in sequence space

36 Quasispecies Driving virus populations through threshold The error threshold in replication-mutation ensembles

37

38 Molecular evolution of viruses

40 An example of artificial selection with RNA molecules or breeding of biomolecules

41 The SELEX-technique for evolutionary design of strongly binding molecules called aptamers

42 tobramycin RNA aptamer, n = 27 Formation of secondary structure of the tobramycin binding RNA aptamer with K D = 9 nm L. Jiang, A. K. Suri, R. Fiala, D. J. Patel, Saccharide-RNA recognition in an aminoglycoside antibiotic- RNA aptamer complex. Chemistry & Biology 4:35-50 (1997)

43 The three-dimensional structure of the tobramycin aptamer complex L. Jiang, A. K. Suri, R. Fiala, D. J. Patel, Chemistry & Biology 4:35-50 (1997)

44 Christian Jäckel, Peter Kast, and Donald Hilvert. Protein design by directed evolution. Annu.Rev.Biophys. 37: , 2008

45 Application of molecular evolution to problems in biotechnology

46 Artificial evolution in biotechnology and pharmacology G.F. Joyce Directed evolution of nucleic acid enzymes. Annu.Rev.Biochem. 73: C. Jäckel, P. Kast, and D. Hilvert Protein design by directed evolution. Annu.Rev.Biophys. 37: S.J. Wrenn and P.B. Harbury Chemical evolution as a tool for molecular discovery. Annu.Rev.Biochem. 76:

48 Was bedeutet Neutralität? Selektive Neutralität = = mehrere Genotypen weisen identische Fitness auf. Strukturelle Neutralität = = mehrere Genotypen bilden identische Strukturen aus.

49 Motoo Kimuras Populationsgenetik der neutralen Evolution. Evolutionary rate at the molecular level. Nature 217: , The Neutral Theory of Molecular Evolution. Cambridge University Press. Cambridge, UK, 1983.

50 The inverse folding algorithm searches for sequences that form a given RNA structure.

51 Evolution in silico W. Fontana, P. Schuster, Science 280 (1998),

52 Structure of randomly chosen initial sequence Phenylalanyl-tRNA as target structure

53 Replication rate constant (Fitness): f k = / [ + d (k) S ] d (k) S = d H (S k,s ) Selection pressure: The population size, N = # RNA moleucles, is determined by the flux: N ( t) N ± N Mutation rate: p = / Nucleotide Replication The flow reactor as a device for studying the evolution of molecules in vitro and in silico.

54 In silico optimization in the flow reactor: Evolutionary Trajectory

55 A sketch of optimization on neutral networks

56 Randomly chosen initial structure Phenylalanyl-tRNA as target structure

58 A sketch of a genetic and metabolic network

59 A B C D E F G H I J K L 1 Biochemical Pathways The reaction network of cellular metabolism published by Boehringer-Ingelheim.

60 The citric acid or Krebs cycle (enlarged from previous slide).

61 The bacterial cell as an example for the simplest form of autonomous life Escherichia coli genome: 4 million nucleotides 4460 genes The structure of the bacterium Escherichia coli

62 E. coli: Genome length nucleotides Number of cell types 1 Number of genes Four books, 300 pages each Man: Genome length nucleotides Number of cell types 200 Number of genes A library of 3000 volumes, 300 pages each Complexity in biology

63 Wolfgang Wieser Die Erfindung der Individualität oder Die zwei Gesichter der Evolution. Spektrum Akademischer Verlag, Heidelberg 1998

64 BRITISH TIT (RELATIVE BRAIN MASS x 1000) 2/3 Alan C. Wilson The molecular basis of evolution. Scientific American 253(4):

65 Evolution does not design with the eyes of an engineer, evolution works like a tinkerer. Francois Jacob, Pantheon Books, New York 1982

66 The difficulty to define the notion of gene. Helen Pearson, Nature 441: , 2006

67 ENCODE stands for ENCyclopedia Of DNA Elements. ENCODE Project Consortium. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 447: , 2007

68 Web-Page for further information:

69