Einblicke in das menschliche Erbgut (Genom) am Computer

Save this PDF as:
 WORD  PNG  TXT  JPG

Größe: px
Ab Seite anzeigen:

Download "Einblicke in das menschliche Erbgut (Genom) am Computer"

Transkript

1 Einblicke in das menschliche Erbgut (Genom) am Computer Prof. Dr. Antje Krause FH Bingen / Binger Nacht der Wissenschaft

2 Das menschliche Genom ist entschlüsselt Pressemeldung im Februar 2001 Aber was heißt eigentlich entschlüsselt? Entschlüsselt? 2

3 Das menschliche Genom... ist auf 2 * 22 Chromosomen verteilt + X/X oder X/Y liegt im Zellkern ist eng zusammengefaltet wird von speziellen Proteinen zusammengehalten 3

4 Karyogramm 5

5 Das menschliche Genom... besteht aus ca. 3 Mrd Basen (in beide Richtungen lesbar, nur 4 verschiedene Buchstaben/Basen!) enthält ca Gene diese können jedoch mindestens Genprodukte erzeugen Durchschnittliche Länge eines Gens: 3000 Basen Längstes Gen: 2,4 Mio Basen (Titin im Herzmuskel) Von nur 50% der Gene ist die Funktion bekannt Über 40% der Gene findet man auch in der Fruchtfliege oder im Fadenwurm Nur ca. 2% des Genoms sind Gene, über die restlichen 98% weiß man noch sehr wenig! 6

6 Wievielen Telefonbüchern entspricht das, wenn jedes Buch 1000 Seiten hat? Bücher 1 Buch 300 Seiten 14 Seiten 7

7 Wie lang ist die DNA in unseren Zellen? Länge einer Base * Anzahl Basen pro Zelle * Anzahl Zellen 0,34 * 10-9 m * 2 * 3 * 10 9 * m km km Länge der DNA 70mal zur Sonne und wieder zurück! 8

8 Whole Genome Shotgun Sequencing Genom im Reagenzglas in kleine Schnipsel zerschneiden Schnipsel sequenzieren (Fragmente, Basen) Fragmente im Computer zu Text zusammensetzen Sequenzierautomat 9

9 Vergleichbar mit geschredderten Akten? DNA ist kein natürlichsprachlicher Text es gibt keine Satzzeichen, Leerzeichen, Absätze usw. niemand kennt den Inhalt 10

10 Fragmente im Computer zu Text zusammensetzen? 11

11 Probleme? 3 Mrd Buchstaben 3,75 Mio Fragmente zu je 800 Buchstaben 18,75 Mio Fragmente, wenn jeder Buchstabe durchschnittlich auf 5 Fragmenten vorkommen soll außerdem können wir den Text in 2 Richtungen lesen, d.h. wir kennen die Richtung eines Fragmentes nicht außerdem kommen viele Textteile mehrfach vor außerdem ist der Text auf den Fragmenten fehlerhaft 12

12 Next Generation Sequencing (NGS) Second Generation Sequencing, Pyrosequencing, Sequencing-by-Hybridization, Sequencing-by- Synthesis Liefert mehrere Terabyte an Rohdaten pro Experiment Sequenzieren ist damit kostengünstiger und schneller geworden Anbieter: Illumina / Solexa (Genome Analyzer) Roche / 454 (Genome Sequencer FLX) ABI (SOLiD) 13

13 CCTTCCCCCCATCCCAGGCAGGCTGACAGCGGTCATGTTTCTGCCTACAGCGCCTGCCTATCTCTTTTGAATGTCCTTCTCTAC ACTACTCTGTACTTATGGTGCCAGGTTTCTCTTAAGAATGTCCCCTTTGTCCTTCTTATCAGCATGTAGCCAGCAATATTGTGA CATTTTTACTGCAGAGTGAATGATGACTGGGGCATCTTAAATGGAGTTCTGGGGTGTTTCTTTCTGCATAGGTACCTCTGCAGT AGTAGTTTCCAAAATACTTTTGGTAATTTTTAACCTTAAAGTTAACCTTAAAGTTAAGCTAAGTAAAAGATTTGCATTAAATAT CTAGACCATTTATAAATAAGATACAATACTAAAACATTACTGAAGATAAATAATTCTAGTTTACATACTTTTGGCTACTTATTT TTACAGAGAAACTAAAGATATTTTAGCCCATTAATAAACATGTTTTTGTCTACCACACTGAGAAATTGTACTATGAGGAAACAC ATCCCTCTAGATGTTGGGAGATGGTATACTCATACATTTTCTAACCTACTATAGAATGCTAACATATGACAGTTTATAACTGTC TACTTCCTAGTTTTCTCTGGAAAATAAAAGATTACTAAGTATTAAAATTATAATCAATATGTGTAAATAAAACTACTGGAAATA ATAGAATAACTAGAAACAACTCTATGCAAAGCATGCAAGAAAAGTAGTGCATGTTTTGCAAGTAAAGTAGGACGTATTTTTTAT AAGGAAAACCATACAAAAGATACAAATAAAAAGAGATACCTAGCCTTCCCTGTGTTATATTTGTATGGGTAAAATGTCATGTTT TCAGAAAMANFANGWARDASWORTTCAATGTTCTCCTTATCCATGCTATGTGCCAGTATAGAGTTATGAGTCATAATTCCAATT ATTATTTTAAATGTTGTGCTGGGTGCAGTGGCTCACGTCTGTAATCCCACCACTTTGGGAGGCCTAGGCAGGTGGATCACAAGG TCAGGAGATCGAGAACATCCTGGCTGACATGGTGAAACCCCATCTCTACTAAAAATACAAAAAATTAGCCAGGCGTGGTGGTGG GCACCTGTACTCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATGGCATGAACCAGGGAGGCAGAGCTTGCAGTGAGCCAAGATA GCGCCACTGCACTCCAGCATGGGCAACAGAGCGAGACTCTGTCTCTAAATAAATAAATAAATAAATAAATAAATGTTTTATCCC ACAGAAAAAATCGAATATCCTTGTCAGTTGTGGTATAATGAACTCTCATCAGATCTTTCATCACAGCCATTTCATATTCTTTAT CATTTAGATATTATTTCCCCCTGATGCTTTCCTGAAAGCTCCTGCAATCAGCTACAGGTCAGAATGTTCATCTCCATCACGGGA CTCCCTCTGAGACACACAGAAAAGAGTATGCAAGATAGTCTGGTTATAGGCTTCTGATGATATTGCTTAAATAACTTTAAGACC ATACACTTCGCTCAGTGAAGATCTCCAGAAGTCTGCTTCAGAAATTGATGGGTTCATGACACTGCTAACCCAAGATGCAACAAG ACTGGAATTGATTACATGGTACTGAATGAACTGATGAAAATTGATTATAATTTTATAGCTTTTTGGAGCATTGCTGGTTCTTTA ATGTTCTAGTTTCTGGACTTAAGAAATCTCTTTCTCTTAACCTAACTGTAACATACAATTTAGTAGATTATACTTTTGAAAACA GAAGTGAAGCATTTATCTTTTTTCCCCTGCCTGATTTTTCCAGAATTTTGAAATCCTTACTGAACACTCTTATTTTTACGATGA TATAGTTGTTAGCAAAAGTCCAATAAGAATCTGTTCACCTTGAACAGAGACCTCAGAAATAATGCCGCATATCTACAACCATCT GATCTTTGACAAACCTGACAAAAACAAGCAATGGGGAAAGGATTCCCTATTTAWERBINICHATAAATGGTGCTGGGAAAACTG GCTAGCCATATGTAGAAAGCTGAAACTGGATCCCTTCCTTACACATTATACAAAAATTAATTCAAGATGGATTAAAGACTTACA TGTTAGACCTAAAACCATAAAAACCCTAGAAGAAAACCTAGGCAATACCATTCAGGACATAGGCATGGGCAGGGACTTCATGTT TAAAACACCAAAAACAATGGCAACAAAAGCCAAAATGGACAAATGGGATCTAATTAAACTAAAGAGCTTCTGCACAGCAAAAAA AAACCTACTGTCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAACCTACTCATCTGACAAAGGGCTAATATCC AGAATCTACAATGAACACAAAGAAATTTACAAGAAAAAAACAAACAACCCCATCAAAAAGTGGGCGAAGGATGTGAACAGACAC TTCTCAAAAGAAGACATTTATGCAGCCAAAAGACATGTGAAGGAATGCTCATCATCATTGGCCATCAGAGAAATGCAAATCAAA 16 ATCACAATGAGACACCATCTCACACCAGTTAGAATGGCGATCATTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGA GAAATAGGAACACTTTTACACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTAGAAGATGGTGTGGCGATTCCTCAGGGAT

14 Personalisierte Medizin Idee: Wenn das Genom jedes einzelnen Menschen bekannt ist, kann jeder Patient individuell behandelt werden Ziele: Nebenwirkungen von Medikamenten minimieren, Krankheiten gezielter und effektiver behandeln momentan noch unrentabel für Pharmakonzerne Problem: der gläserne Mensch was ist mit dem Datenschutz? 33

15 Wem gehört mein Genom? Was ist eigentlich ein Krankheitsgen? Was heißt krank? Reicht es, das entsprechende Gen zu haben? Was tue ich, wenn ich ein Krankheitsgen habe? Dürfen Gene patentiert werden? Soll mein Arbeitgeber / meine Krankenversicherung / meine Lebensversicherung Einblick in meine Gene haben? 34

16 Und nun? (Mai 2007) Firma: Ziel: Entwicklung einer Suchmaschine für persönliche genetische Daten Zugriff geplant für Individuen und zu Forschungszwecken Google hat 3,9 Mio $ investiert Foto: DNA Google Logo At Google Kirkland by Flickr 35

17 Analyse von ca SNPs für 499 $ inklusive Abstammung Genotypisierung, keine Sequenzierung! 36

18 Januar 2008: auch für Europäer und Kanadier! 37

19 Suche nach Markern von 28 Krankheitsbildern für 999 $ keine Sequenzierung! 38

20 Analyse von 1 Mio Varianten Suche nach Markern von Krankheiten für 500 $ inklusive Abstammung keine Sequenzierung! 39

21 Stand Januar 2008: komplette Sequenzierung für $ noch im Teststadium 40

22 Und nun? (Mai 2007) Firma: 454 LifeSciences Sequenzierung von James D. Watsons Genom (1962 Nobelpreis für Aufklärung der Struktur der DNA) Project Jim Kosten: 1 Mio $ Zeitaufwand: 2 Monate Genom auf DVD Veröffentlicht unter: jimwatsonsequence.cshl.edu Einzige Forderung von Dr. Watson: Alzheimer-Gen muss unkenntlich gemacht werden... und andere bekannte Krankheitsgene?... und bisher nicht bekannte Krankheitsgene? 41

23 Januar Genomes Project komplette Sequenzierung Suche nach Gemeinsamkeiten und Unterschieden 2000 Individuen aus 20 Populationen weltweit Dauer: 3 Jahre Mio $ insgesamt

24 Sequenzierung in den Schlagzeilen Mai 2008: komplettes Genom einer Frau sequenziert August 2008: mitochondriales Genom des Neandertalers sequenziert Februar 2009: komplettes Genom des Neandertalers sequenziert August 2009: komplettes Genom eines Koreaners sequenziert Februar 2010: komplette Genome von vier Buschmännern aus Südafrika sequenziert (u.a. Desmond Tutu) März 2010: komplettes Genom einer ganzen Familie sequenziert (Vater, Mutter und 2 Kinder; $ pro Genom) März 2010: neue Menschenform in Sibirien entdeckt (mitochondriales Genom sequenziert) März 2010: Patente der Firma Myriad auf Brustkrebsgene BRCA1 und BRCA2 für ungültig erklärt 44

25 ENSEMBL 46

26 aktuell 52 mehrzellige Spezies 47

27 Human Homo sapiens 48

28 Karyotype 49

29 Chromosom 21 (Chromosome summary) Known Genes = Bekannte Gene %GC = Anteil der Basen G und C Repeats = Wiederholungen (meist viralen Ursprungs) Variations = z.b. SNPs (single nucleotide polymorphisms) = individuelle Varianten verschiedener Menschen 50

30 Synteny Chromosom 21 des Menschen im Vergleich mit Chromosomen der Maus 51

31 Chromosome summary 52

32 Region in detail 53

33 54

34 hide transcripts 55

35 Human Genome Nomenclature 56

36 57

37 Was kommt als nächstes?

38 Prof. Dr. Antje Krause Bioinformatik Fachhochschule Bingen Berlinstr Bingen am Rhein Tel: 06721/

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Einblicke in das menschliche Genom aus Sicht der Bioinformatik Prof. Dr. Antje Krause FH Bingen a.krause@fh-bingen.de Kurzer Ausflug in die Genetik DNA (Desoxyribonukleinsäure)

Mehr

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory

UNIVERSITÄTSKLINIKUM Schleswig-Holstein. Sequenzierung. Norbert Arnold. Dept. Gynecology and Obstetrics Oncology Laboratory Sequenzierung Norbert Arnold Neue Sequenziertechnologien (seit 2005) Next Generation Sequenzierung (NGS, Erste Generation) Unterschiedliche Plattformen mit unterschiedlichen Strategien Roche 454 (basierend

Mehr

Prof. Dr. Antje Krause. akrause@fh-bingen.de. 05.11.08 Prof. Dr. Antje Krause

Prof. Dr. Antje Krause. akrause@fh-bingen.de. 05.11.08 Prof. Dr. Antje Krause Bioinformatiki ik an der FH Bingen Prof. Dr. Antje Krause FH Bingen akrause@fh-bingen.de 1 Was ist Bioinformatik? interdisziplinäres Fach Nutzung von Methoden der Informatik (und der Mathematik) zur Analyse

Mehr

Sequenziertechnologien

Sequenziertechnologien Sequenziertechnologien Folien teilweise von G. Thallinger übernommen 11 Entwicklung der Sequenziertechnologie First Generation 1977 Sanger Sequenzierung (GOLD Standard) Second Generation 2005 454 Sequencing

Mehr

Neue DNA Sequenzierungstechnologien im Überblick

Neue DNA Sequenzierungstechnologien im Überblick Neue DNA Sequenzierungstechnologien im Überblick Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Max-Planck-Gesellschaft 80 Institute

Mehr

Zentronukleäre Myopathien von der Diagnose zur Therapie

Zentronukleäre Myopathien von der Diagnose zur Therapie MTM Familientreffen Göttingen, 5./6. Juni 2014 Zentronukleäre Myopathien von der Diagnose zur Therapie Dr. Johann Böhm IGBMC, Strasbourg Ein paar Worte über Strasbourg.and über das IGBMC Ein paar Worte

Mehr

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern

Genetik - The Human Genome Project. Überblick über die Genetik. Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern Genetik - The Human Genome Project Überblick über die Genetik Die gesamte Erbinformation eines Menschen befindet sich in jedem Zellkern seines Körpers. 1 2 Im Organismus müsssen nun ständig Enzyme u. a.

Mehr

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Evolution & Genetik (Beispiel Hämoglobin) Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de DNA (Desoxyribonukleinsäure) 5 3 CGATGTACATCG GCTACATGTAGC 3 5 Doppelhelix Basen: Adenin,

Mehr

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung

NEXT-GENERATION SEQUENCING. Von der Probenvorbereitung bis zur bioinformatischen Auswertung FRAUNHOFER-INSTITUT FÜR GRENZFLÄCHEN- UND BIOVERFAHRENSTECHNIK IGB NEXT-GENERATION SEQUENCING Von der Probenvorbereitung bis zur bioinformatischen Auswertung »Progress in science depends on new techniques,

Mehr

Bioinformatik an der FH Bingen

Bioinformatik an der FH Bingen Bioinformatik an der FH Bingen Prof. Dr. Antje Krause 05.11.2010 Wie alles begann... 1955 erste Proteinsequenz (nach 12 Jahren Arbeit) veröffentlicht (Insulin vom Rind) Frederick Sanger MALWTRLRPLLALLALWPPPPA

Mehr

Genomsequenzierung für Anfänger

Genomsequenzierung für Anfänger Genomsequenzierung für Anfänger Philipp Pagel 8. November 2005 1 DNA Sequenzierung Heute wird DNA üblicherweise mit der sogenannten Sanger (oder chain-terminationoder Didesoxy-) Methode sequenziert dessen

Mehr

Das Human-Genom und seine sich abzeichnende Dynamik

Das Human-Genom und seine sich abzeichnende Dynamik Das Human-Genom und seine sich abzeichnende Dynamik Matthias Platzer Genomanalyse Leibniz Institut für Altersforschung - Fritz-Lipmann Institut (FLI) Humangenom - Sequenzierung 1. Methode 2. Ergebnisse

Mehr

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1

Inhaltsverzeichnis... I. Abbildungs- und Tabellenverzeichnis... VI. Abkürzungsverzeichnis... IX. 1 Einleitung... 1 I... I Abbildungs- und Tabellenverzeichnis... VI Abkürzungsverzeichnis... IX 1 Einleitung... 1 1.1 Untersuchte uro-rektale Fehlbildungen... 1 1.1.1 Blasenekstrophie-Epispadie-Komplex (BEEK)... 1 1.1.1.1

Mehr

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held

ACT/CVS neueste gendiagnostische Verfahren. 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held ACT/CVS neueste gendiagnostische Verfahren 20. THÜRINGER ULTRASCHALLTAGUNG für Frauenärzte 09. Bis 10. November Erfurt K. R. Held DNA, Gene, Chromosomen DNA besteht aus den Basenpaaren Adenin - Thymin

Mehr

Grundideen der Gentechnik

Grundideen der Gentechnik Grundideen der Gentechnik Die Gentechnik kombiniert Biotechnik und Züchtung. Wie in der Züchtung wird die Erbinformation eines Lebewesen verändert. Dabei nutzte man in den Anfängen der Gentechnik vor allem

Mehr

Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen

Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen Was kommt nach dem Human-GenomProjekt? Stand der Forschung und ethische Fragen Humangenom Größe 150 m 3.000.000.000 Nukleotide 3000 x 1000 x 1000 Bücher Seiten Buchstaben 1953 2003 Watson, J.D., and F.H.C.Crick.

Mehr

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel

Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Archivierung von NGS-Daten Artefaktsammlung oder Datenschatz? Michael Nothnagel Christian-Albrechts-Universität zu Kiel Next-Generation Sequencing (NGS) Nach Sanger Sequencing (1977) zweite Generation

Mehr

Erbgutanalyse mit wachsendem Automatisierungsgrad

Erbgutanalyse mit wachsendem Automatisierungsgrad Powered by Seiten-Adresse: https://www.gesundheitsindustriebw.de/de/fachbeitrag/aktuell/erbgutanalyse-mitwachsendem-automatisierungsgrad/ Erbgutanalyse mit wachsendem Automatisierungsgrad Mit einer eigens

Mehr

Bioinformatik: Hype oder Hoffnung?

Bioinformatik: Hype oder Hoffnung? Bioinformatik: Hype oder Hoffnung? Florian Markowetz Max-Planck-Institut für Molekulare Genetik Computational Molecular Biology Berlin Career Nights AKG Bensheim, 28. Januar 2005 1 Florian Markowetz, Bioinformatik:

Mehr

Homologie und Sequenzähnlichkeit. Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de

Homologie und Sequenzähnlichkeit. Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Homologie und Sequenzähnlichkeit Prof. Dr. Antje Krause FH Bingen 06721 / 409 253 akrause@fh-bingen.de Homologie Verwandtschaft aufgrund gleicher Abstammung basiert auf Speziation (Artbildung): aus einer

Mehr

FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom

FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom FOOD PROFILING: Authentizitätsüberprüfung von Edelkakao basierend auf Sequenzunterschieden im Chloroplastengenom HAMBURG SCHOOL OF FOOD SCIENCE Institut für Lebensmittelchemie Universität Hamburg, AiF/

Mehr

Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus?

Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Gliederung Seminar des Ausschusses für Genetik der ZAR, Salzburg, 18.03.2010 Grundlagen der genomische Selektion - Was sagt ein genomischer Zuchtwert aus? Versuch einer Begriffserklärung Wie weiß man,

Mehr

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen

Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen Fotos: M. Rindlisbacher Large Scale SNP Daten beim Pferd: Erste Erfahrungen und Anwendungen H. Hasler 1, F. Berruex 3, B. Haase 2, C. Flury 1, T. Leeb 2, V. Gerber 4, H. Simianer 5, D. Burger 3, P.A. Poncet

Mehr

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor.

Antwort: 2.Uracil. Antwort: 2. durch Wasserstoffverbindungen. Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Antwort: 2.Uracil Adenin, Cystein und Guanin kommen alle in der RNA und DNA vor. Thymin kommt nur in der DNA vor; Uracil nimmt seinen Platz in den RNA- Molekülen ein. Antwort: 2. durch Wasserstoffverbindungen

Mehr

Foto: Kate Whitley, www.biotechnologie.de

Foto: Kate Whitley, www.biotechnologie.de Foto: Kate Whitley, www.biotechnologie.de Inhalt o Was kann die genomische ZWS nicht? o QTL: Erfahrungen aus genomweiten Studien o Begriffklärung [Re-]Sequenzierung o Hochdurchsatzsequenzierung technische

Mehr

VERTIEFENDE INFORMATION Personalisierte Medizin: Bessere Diagnosen mit Hilfe der DNA-Analyse?

VERTIEFENDE INFORMATION Personalisierte Medizin: Bessere Diagnosen mit Hilfe der DNA-Analyse? - 1 - Personalisierte Medizin ist der Überbegriff für die Strategie, Medikamente und Therapien zu entwickeln, die besser auf den einzelnen Patienten zugeschnitten sind. Dabei sollen routinemäßige Gentests

Mehr

Patienteninformation: Gentestung bei familiärem Brust- und Eierstockkrebs (Basis-Information):

Patienteninformation: Gentestung bei familiärem Brust- und Eierstockkrebs (Basis-Information): Frauenklinik Gynäkologie und Gynäkologische Onkologie Patienteninformation: Gentestung bei familiärem Brust- und Eierstockkrebs (Basis-Information): Universitätsspital Basel Frauenklinik PD Dr. med. Nicole

Mehr

Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG

Personalisierte Medizin Die richtige Therapie für den richtigen Patienten. Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin Die richtige Therapie für den richtigen Patienten Monika Reuschling; Roche Diagnostics (Schweiz) AG Personalisierte Medizin: Was ist denn das? Februar 2011 Personalisierte Medizin:

Mehr

Individuelle Genomsequenzen Aussichten für die Tierzucht

Individuelle Genomsequenzen Aussichten für die Tierzucht Individuelle Genomsequenzen Aussichten für die Tierzucht Ruedi Fries WZW / Lehrstuhl für Tierzucht Agrarw. Symposium - 1 Auswirkungen der Genomischen Revolution auf die Tierzucht (und Pflanzenzucht) Agrarw.

Mehr

Personalisierte Medizin

Personalisierte Medizin Personalisierte Medizin Möglichkeiten und Grenzen Prof. Dr. Friedemann Horn Universität Leipzig, Institut für Klinische Immunologie, Molekulare Immunologie Fraunhofer Institut für Zelltherapie und Immunologie

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 011 9. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (.000.000.000 Basenpaare)

Mehr

Algorithmische Bioinformatik

Algorithmische Bioinformatik Algorithmische Bioinformatik Biologische Daten als Strings Ulf Leser Wissensmanagement in der Bioinformatik Ziele für heute Wert von Reduktionismus: Genome als Strings Reinschmecken in Stringmatching Erster

Mehr

Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren

Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren Terminologie der Formalgenetik zur Identifizierung genetischer Modulatoren Stefan-Marcel Loitsch, Christian von Mallinckrodt, Tim Hirche, Thomas OF Wagner Pneumologie und Allergologie, Medizinische Klinik

Mehr

Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik. Karl J. Lackner

Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik. Karl J. Lackner Wissenschaftlich-technische Entwicklungen im Bereich der Multiplex- und High-Throughput-Diagnostik Karl J. Lackner Hochdurchsatzverfahren in der molekularen bzw. genetischen Diagnostik Next Generation-Sequenzierung

Mehr

Wer bin ich? Was sagen mir meine Gene?

Wer bin ich? Was sagen mir meine Gene? Wer bin ich? Was sagen mir meine Gene? Prof. Theo Dingermann Institut für Pharmazeutische Biologie Biozentrum Max-von Laue-Str. 9 60438 Frankfurt am Main Dingermann@em.uni-frankfurt.de 02/03/11 Sind die

Mehr

Trio-Analyse (Exome-Seq)

Trio-Analyse (Exome-Seq) WS2017/2018 MSc Modul 7A Genomforschung und Sequenzanalyse - Einführung in Methoden der Bioinformatik- AG Hankeln Trio-Analyse (Exome-Seq) Mutationen mit Krankheitsrelevanz im Humangenom More than 3800

Mehr

Die Universität stellt sich vor

Die Universität stellt sich vor Die Universität stellt sich vor Prof. Dr. Till Tantau. Juni Überblick Die Universität zu Lübeck Exzellente Forschung...... führt zu exzellenter Lehre Die Universität in Zahlen Studierende. Professoren

Mehr

Inhalt des Vortrags. o genetische Grundlagen. o Wie findet man Erbfehler? o Zusammenfassung. Was ist ein Haplotyp?

Inhalt des Vortrags. o genetische Grundlagen. o Wie findet man Erbfehler? o Zusammenfassung. Was ist ein Haplotyp? Inhalt des Vortrags o genetische Grundlagen Was ist ein Haplotyp? o Wie findet man Erbfehler? basierend auf Phänotypen: Zwergwuchs basierend auf Genotypen: Braunvieh Haplotyp II o Zusammenfassung einige

Mehr

DATENQUALITÄT IN GENOMDATENBANKEN

DATENQUALITÄT IN GENOMDATENBANKEN DATENQUALITÄT IN GENOMDATENBANKEN Alexander Fehr 28. Januar 2004 Gliederung Motivation Biologische Grundkonzepte Genomdaten Datenproduktion und Fehler Data Cleansing 2 Motivation (1) Genomdatenbanken enthalten

Mehr

Anlage zur Akkreditierungsurkunde D PL 13372 01 00

Anlage zur Akkreditierungsurkunde D PL 13372 01 00 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D PL 13372 01 00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 22.05.2014 bis 25.03.2017 Ausstellungsdatum: 22.05.2014 Urkundeninhaber:

Mehr

Gene Silencing: was ist das noch mal?

Gene Silencing: was ist das noch mal? Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Gen Silencing macht einen zielstrebigen Schritt nach vorne Das

Mehr

Glaube an die Existenz von Regeln für Vergleiche und Kenntnis der Regeln

Glaube an die Existenz von Regeln für Vergleiche und Kenntnis der Regeln Glaube an die Existenz von Regeln für Vergleiche und Kenntnis der Regeln Regeln ja Regeln nein Kenntnis Regeln ja Kenntnis Regeln nein 0 % 10 % 20 % 30 % 40 % 50 % 60 % 70 % 80 % 90 % Glauben Sie, dass

Mehr

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen

Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Zielgerichtete Therapie mit Olaparib bei BRCA1/2- Mutationsträgerinnen Prof. Dr. med. Brigitte Schlegelberger 670513011/15 Olaparib Zulassung in Europa: Rezidiv eines Platin-sensitiven Ovarialkarzinoms

Mehr

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik

Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Lebensstil-Umweltfaktoren-Gene: Vom Wesen der Epigenetik Karl Heinimann, MD PhD Medizinische Genetik Universitätskinderspital beider Basel karl.heinimann@unibas.ch 14. Internationales Seminar DESO St.

Mehr

Was ist ein genetischer Fingerabdruck?

Was ist ein genetischer Fingerabdruck? Was ist ein genetischer Fingerabdruck? Genetischer Fingerabdruck od. DNA-Fingerprint ist ein molekularbiologisches Verfahren zur individuellen Identifizierung von Lebewesen Der genetische Fingerabdruck

Mehr

Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia

Nicht invasive Pränataldiagnostik. Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Alle Argumente sprechen für Prendia Nicht invasive Pränataldiagnostik Grundwissen Pränataldiagnostik 4 Grafik Pränataldiagnostiken 6 Die Produktefamilie 9 Robustheit von

Mehr

Humane Genotyp-Phänotyp-Datenbanken: Ein Statusbericht

Humane Genotyp-Phänotyp-Datenbanken: Ein Statusbericht Workshop: Datenbank genomischer Varianten für die klinische Anwendung und die medizinische Forschung Essen 19. März 2014 Humane Genotyp-Phänotyp-Datenbanken: Ein Statusbericht Thomas Bettecken Max-Planck-Institut

Mehr

G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010

G e n o m i k. Genomik?! Tobias Schäfer Institut für f. r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Institut für f r Biochemische Verfahren und Analysen (IBVA) Genomik?! Tobias Schäfer Institut für f r Biochemische Verfahren und Analysen (IBVA) 24.02.2010 Inhalt Methoden der Gensequenzierung Nutzen genetischer

Mehr

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Bioinformatik

Mehr

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus

2.) Wie lautet in der Genomforschung das Fachwort für Vielgestaltigkeit? a) Polytheismus b) Polymerisation c) Polymorphismus d) Polygamismus Lernkontrolle M o d u l 2 A w i e... A n k r e u z e n! 1.) Welche gentechnischen Verfahren bildeten die Grundlage für das Humangenomprojekt (Mehrfachnennungen möglich)? a) Polymerase-Kettenreaktion b)

Mehr

Genomische Selektion in der Pflanzenzüchtung

Genomische Selektion in der Pflanzenzüchtung Genomische Selektion in der Pflanzenzüchtung Chris-CarolinCarolin Schön 30. März 2012 Hybridzüchtung Population 1 Population 2 Kreuzungen 10.000000 Linieni Prüfung 1 Umwelt Kreuzungen 10.000000 Linen 2.000

Mehr

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005

Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH Anlage zur Akkreditierungsurkunde D-PL-13372-01-00 nach DIN EN ISO/IEC 17025:2005 Gültigkeitsdauer: 26.06.2015 bis 25.03.2017 Ausstellungsdatum: 26.06.2015 Urkundeninhaber:

Mehr

Read Mapping Projektmanagement im So3warebereich SeqAn

Read Mapping Projektmanagement im So3warebereich SeqAn Read Mapping Projektmanagement im So3warebereich SeqAn David Weese April 2010 Inhalt Einführung Reads erzeugen read simulator SWP Teilprojekte Projektplan EINFÜHRUNG 2 nd /Next GeneraGon Sequencing Technologien:

Mehr

Kinderarmut. 1. Kapitel: Kinderarmut in der Welt

Kinderarmut. 1. Kapitel: Kinderarmut in der Welt Kinderarmut 1. Kapitel: Kinderarmut in der Welt Armut gibt es überall auf der Welt und Armut ist doch sehr unterschiedlich. Armut? Was ist das? Woher kommt das? wieso haben die einen viel und die anderen

Mehr

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund

Die Suche nach Genen in Bakteriengenomen. BWInf-Workshop 22.-23. März 2011. Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund Die Suche nach Genen in Bakteriengenomen BWInf-Workshop 22.-23. März 2011 Prof. Dr. Sven Rahmann AG Bioinformatik Informatik XI, TU Dortmund 1 Bioinformatik was ist das? Aufgabe: Analyse (molekular)biologischer

Mehr

Übungsaufgaben Prozentrechnung und / oder Dreisatz

Übungsaufgaben Prozentrechnung und / oder Dreisatz Übungsaufgaben Prozentrechnung und / oder Dreisatz 1. Bei der Wahl des Universitätssprechers wurden 800 gültige Stimmen abgegeben. Die Stimmen verteilten sich so auf die drei Kandidat/innen: A bekam 300,

Mehr

Interview mit Dr. Robinson Ferrara, Facharzt für Gynäkologie und Geburtshilfe, Brustchirurg, Ästhetische Chirurgie, Alzey

Interview mit Dr. Robinson Ferrara, Facharzt für Gynäkologie und Geburtshilfe, Brustchirurg, Ästhetische Chirurgie, Alzey Interview Interview mit Dr. Robinson Ferrara, Facharzt für Gynäkologie und Geburtshilfe, Brustchirurg, Ästhetische Chirurgie, Alzey 1. Mit welchen Wünschen kommen die meisten Patienten in ihre Praxis?

Mehr

Modellierung biologischer. Christian Maidorfer Thomas Zwifl (Seminar aus Informatik)

Modellierung biologischer. Christian Maidorfer Thomas Zwifl (Seminar aus Informatik) Modellierung biologischer Prozesse Christian Maidorfer Thomas Zwifl (Seminar aus Informatik) Überblick Einführung Arten von Modellen Die stochastische Pi-Maschine Warum Modelle Die Biologie konzentriert

Mehr

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra

Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Was sagen mir meine Gene? Individuelle Gendiagnostik Pro und Contra Theo Dingermann und Ilse Zündorf, Frankfurt/Main Wie sehr wir im Gen-Zeitalter angekommen sind, haben wahrscheinlich viele noch gar nicht

Mehr

Hirnödeme bei HAE was Patienten wissen sollten

Hirnödeme bei HAE was Patienten wissen sollten Hirnödeme bei HAE was Patienten wissen sollten Dieser immer stärker werdende Druck... Starke Kopfschmerzen? Bei HAE kann auch ein Hirnödem die Ursache sein. 2 Ein kaum beachteter Zusammenhang Verspannungen,

Mehr

Die Invaliden-Versicherung ändert sich

Die Invaliden-Versicherung ändert sich Die Invaliden-Versicherung ändert sich 1 Erklärung Die Invaliden-Versicherung ist für invalide Personen. Invalid bedeutet: Eine Person kann einige Sachen nicht machen. Wegen einer Krankheit. Wegen einem

Mehr

Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens

Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens Sequenzanalysen in der Molekularpathologie: Grundlagen des Sequenzierens Wolfgang Hulla KFJ-Sital / SMZ-Süd, Wien Grundlagen Historischer Ausgangspunkt Anwendungen und klinische Relevanz Methodik Auswertung

Mehr

Begleittext zum Foliensatz Erbgänge beim Menschen

Begleittext zum Foliensatz Erbgänge beim Menschen Für ein besseres Verständnis der Folien werden vorab einige Begriffe definiert: Gen Genom Allel Ein Gen ist die physikalische und funktionelle Einheit der Vererbung. Biochemisch ist es eine geordnete Abfolge

Mehr

Angebot und Nachfrage: Die Entwicklung von Gentests. Dr. Eva Fisher Geschäftsstelle der Gendiagnostik-Kommission Robert Koch-Institut

Angebot und Nachfrage: Die Entwicklung von Gentests. Dr. Eva Fisher Geschäftsstelle der Gendiagnostik-Kommission Robert Koch-Institut Angebot und Nachfrage: Die Entwicklung von Gentests Dr. Eva Fisher Geschäftsstelle der Gendiagnostik-Kommission Robert Koch-Institut Themen Welche (neuen) genetischen Tests werden heute in der klinischen

Mehr

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien

Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien Implikationen der omics Revolution für die moderne Onkologie- Microarray-unterstützte Diagnose und pharmako-genomic basierende Therapiestrategien III. Interdisziplinärer Kongress JUNGE NATURWISSENSCHAFT

Mehr

molekularen Rinderzucht

molekularen Rinderzucht Möglichkeiten der molekularen Rinderzucht Johann Sölkner Gliederung Einleitung Molekulare Marker Suche nach wichtigen Genen Molekulare Zuchtwertschätzung Auswirkung auf Zuchtprogramme Versprechen der Molekulargenetiker

Mehr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr

Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Klausur zum Modul Molekularbiologie ILS, SS 2010 Freitag 6. August 10:00 Uhr Name: Matrikel-Nr.: Code Nummer: Bitte geben Sie Ihre Matrikel-Nr. und Ihren Namen an. Die Code-Nummer erhalten Sie zu Beginn

Mehr

Espoir PV: Häufig gestellte Fragen. corlife ohg Feodor-Lynen-Str. 23 D-30625 Hannover. Phone: +49 (0)511 563 539 40 Telefax: +49 (0)511 563 539 55

Espoir PV: Häufig gestellte Fragen. corlife ohg Feodor-Lynen-Str. 23 D-30625 Hannover. Phone: +49 (0)511 563 539 40 Telefax: +49 (0)511 563 539 55 Espoir PV: Häufig gestellte Fragen corlife ohg Feodor-Lynen-Str. 23 D-30625 Hannover Phone: +49 (0)511 563 539 40 Telefax: +49 (0)511 563 539 55 info@colife.eu www.corlife.eu Technische Fragen Was ist

Mehr

Stammzellentherapien

Stammzellentherapien Können mit Stammzellen Krankheiten wie Autismus, bzw. das Kanner-Syndrom und Asperger behandelt werden? Diese Vorstellung klingt auf den ersten Blick sehr verlockend, doch was verbirgt sich hinter dem

Mehr

Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer. www.genomaustria.at

Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer. www.genomaustria.at Ein wissenschaftliches und kulturelles Pionierprojekt unter dem Ehrenschutz von Margit Fischer www.genomaustria.at Warum sind wir heute hier? Wir sind heute hier, um über das Thema Erbgut Sequenzierung

Mehr

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14

Evolution II. Molekulare Variabilität. Bachelorkurs Evolutionsbiolgie II WS 2013/14 Evolution II Molekulare Variabilität Bachelorkurs Evolutionsbiolgie II WS 2013/14 Molekulare Variabilität 1) rten der molekularen Variabilität und ihre Entstehung (rten der Mutation) 2) Wie kann man molekulare

Mehr

1. Was ihr in dieser Anleitung

1. Was ihr in dieser Anleitung Leseprobe 1. Was ihr in dieser Anleitung erfahren könnt 2 Liebe Musiker, in diesem PDF erhaltet ihr eine Anleitung, wie ihr eure Musik online kostenlos per Werbevideo bewerben könnt, ohne dabei Geld für

Mehr

Mitteilung an die Medien

Mitteilung an die Medien Mitteilung an die Medien Branford, CT, USA, 29. Januar 2009 Forscher nutzen das 454 Sequencing System bei der Identifizierung Herpesähnlicher Viren in Zusammenhang mit Korallensterben Mit metagenomischen

Mehr

Einführung in die Bioinformatik

Einführung in die Bioinformatik Einführung in die Bioinformatik Kay Nieselt SS 01 8. It s hip to chip - von Microarrays zu personalisierter Medizin WSI/ZBIT, Eberhard Karls Universität Tübingen Das menschliche Genom (~.000.000.000 Basenpaare)

Mehr

Pharmazeutische Biologie Genetik

Pharmazeutische Biologie Genetik Pharmazeutische Biologie Genetik N230-Raum 306 Tel. (069) 798-29650 dingermann@em.uni-frankfurt.de 4. Erbkrankheiten des Menschen Hardy-Weinberg-Gleichgewicht 4. Erbkrankheiten des Menschen Hardy-Weinberg-Gleichgewicht

Mehr

Next Generation Sequencing für die Primärdiagnostik. Focus: Resistenztestung

Next Generation Sequencing für die Primärdiagnostik. Focus: Resistenztestung Next Generation Sequencing für die Primärdiagnostik Focus: Resistenztestung Stefan Niemann Molekulare Mykobakteriologie Forschungszentrum Borstel TTU-TB Deutsches Zentrum für Infektionsforschung Outline

Mehr

Bioinformatik. Margarethe Kyral

Bioinformatik. Margarethe Kyral Bioinformatik Margarethe Kyral Beispiel 1 neuer Krankheitserreger DNA-Sequenzierung Beispiel 1 neuer Krankheitserreger DNA-Sequenzierungsgeräte und -verfahren Beispiel 1 neuer Krankheitserreger Borreliose-Bakterium

Mehr

Ein Rezept für eine Krankheit

Ein Rezept für eine Krankheit Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Bauen wir bessere Mäuse(fallen): Neues Modell für die Huntington-Krankheit

Mehr

Voraussetzungen für die Genomische Selektion beim Pferd

Voraussetzungen für die Genomische Selektion beim Pferd Agrar- und Ernährungswissenschaftliche Fakultät Institut für Tierzucht und Tierhaltung Voraussetzungen für die Genomische Selektion beim Pferd Prof. Dr. Georg Thaller 32. Jahrestagung zur Pferdegesundheit

Mehr

Informatik als Unterrichtsfach am Gymnasium. Renato Renner ETH Zürich

Informatik als Unterrichtsfach am Gymnasium. Renato Renner ETH Zürich Informatik als Unterrichtsfach am Gymnasium Renato Renner ETH Zürich Wie kann ich Musik-Dateien auf mein neues iphone übertragen? Wie kann ich meine digitalen Fotos archivieren? Wie findet Google seine

Mehr

Das internationale Human-Genom Projekt. Stand Ergebnisse Perspektiven

Das internationale Human-Genom Projekt. Stand Ergebnisse Perspektiven Das internationale Human-Genom Projekt Stand Ergebnisse Perspektiven 2003 1953 April, 25 th, 1953 Watson, J.D., and F.H.C.Crick. 1953. Molecular Structure of Nucleic Acids: A Structure for Deoxynucleic

Mehr

ASSEMBLY ALGORITHMS FOR NEXT-GENERATION SEQUENCING DATA

ASSEMBLY ALGORITHMS FOR NEXT-GENERATION SEQUENCING DATA ASSEMBLY ALGORITHMS FOR NEXT-GENERATION SEQUENCING DATA Jason R. Miller*, Sergey Koren, Granger Sutton Ein Vortrag von Sergej Tschernyschkow Friedrich-Schiller-Universität Jena 03. Mai 2010 SERGEJ TSCHERNYSCHKOW

Mehr

Eine Einführung in die inklusive Entwicklungszusammenarbeit

Eine Einführung in die inklusive Entwicklungszusammenarbeit Eine Einführung in die inklusive Entwicklungszusammenarbeit Inklusive Entwicklungszusammenarbeit für Menschen mit geistiger Behinderung und ihre Familien Die Europäische Kommission hat dieses Projekt mit

Mehr

Workshop des WissGrid Fachberater-Teams

Workshop des WissGrid Fachberater-Teams Workshop des WissGrid Fachberater-Teams Virtuelle Forschungsumgebungen aufbauen - mit D-Grid - Communities mit datenlastigen Aufgaben 19. Januar 2011, Göttingen Benjamin Löhnhardt Vortragsinhalte Einleitung

Mehr

Erster Baum genetisch sequenziert Genetische Veränderung geplant - Ökologen warnen vor Gentech- Pflanzen

Erster Baum genetisch sequenziert Genetische Veränderung geplant - Ökologen warnen vor Gentech- Pflanzen Erster Baum genetisch sequenziert Genetische Veränderung geplant - Ökologen warnen vor Gentech- Pflanzen Das erste Genom eines Baumes wurde nach Angaben des Wissenschaftsmagazins Science nun fertig entschlüsselt.

Mehr

In der Region. Für die Region.

In der Region. Für die Region. Zweckverbandsversammlung 2015 Sparkassenkunden nutzen im starken Maße günstige Kreditkonditionen Der Vorstand der Sparkasse Kierspe-Meinerzhagen stellte den Mitgliedern der Zweckverbandsversammlung das

Mehr

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl

Übung II. Einführung, Teil 1. Arbeiten mit Ensembl Übung II Einführung, Teil 1 Arbeiten mit Ensembl Ensembl Genome Browser (Bereitstellung von Vielzeller Genomen) Projekt wurde 1999 initiiert Projektpartner EMBL European Bioinformatics Institute (EBI)

Mehr

Fünf Gedanken und eine Alternative zur Elektronischen Gesundheitskarte (EGK) Neuanfang ev.

Fünf Gedanken und eine Alternative zur Elektronischen Gesundheitskarte (EGK) Neuanfang ev. Fünf Gedanken und eine Alternative zur Elektronischen Gesundheitskarte (EGK) Überblick Die Patientenchipkarte blockiert eine global erfolgreiche Entwicklung eines Teils der deutschen medizinischen Informatik.

Mehr

Das Sparverhalten der Österreicher 2013

Das Sparverhalten der Österreicher 2013 2013 Eine Studie von IMAS International im Auftrag von Erste Bank & Sparkassen Peter Bosek, Privat- und Firmenkundenvorstand Erste Bank Studiendesign Auftraggeber: Erste Bank der oesterreichischen Sparkassen

Mehr

Christian Zahn. Perspektive der Krankenversicherung. bei der Präsentation des Sonderpostwertzeichens. 100 Jahre Reichsversicherungsordnung

Christian Zahn. Perspektive der Krankenversicherung. bei der Präsentation des Sonderpostwertzeichens. 100 Jahre Reichsversicherungsordnung Perspektive der Krankenversicherung bei der Präsentation des Sonderpostwertzeichens 100 Jahre Reichsversicherungsordnung Christian Zahn Vorsitzender des Verwaltungsrats des GKV-Spitzenverbandes Präsentation

Mehr

Präzisions-Gentherapie

Präzisions-Gentherapie Neuigkeiten aus der Huntington-Forschung. In einfacher Sprache. Von Wissenschaftlern geschrieben Für die Huntington-Gemeinschaft weltweit. Gentherapie trifft auf erfolgreiche Stammzelltherapie bei Lebererkrankung

Mehr

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel

Klonierung von S2P Rolle der M19-Zellen. POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Klonierung von S2P Rolle der M19-Zellen POL-Seminar der Biochemie II 13.02.2007 Sebastian Gabriel Inhalt 1. Was ist eine humane genomische DNA-Bank? 2. Unterschied zwischen cdna-bank und genomischer DNA-Bank?

Mehr

Artikel I Änderungen. 1. Im Anhang 1: Modulbeschreibungen für den Masterstudiengang Ökologie und Evolution,

Artikel I Änderungen. 1. Im Anhang 1: Modulbeschreibungen für den Masterstudiengang Ökologie und Evolution, 11. September 2014 Ordnung des Fachbereichs Biowissenschaften der Johann Wolfgang Goethe- Universität für den Masterstudiengang Ökologie und Evolution mit dem Abschluss "Master of Science" (M.Sc.) vom

Mehr

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik

Bioinformatik. Zeichenketten und Stringalgorithmen. Ulf Leser Wissensmanagement in der. Bioinformatik Bioinformatik Zeichenketten und Stringalgorithmen Ulf Leser Wissensmanagement in der Bioinformatik Inhalt dieser Vorlesung Warum Stringmatching? Strings und Matching Naiver Algorithmus Ulf Leser: Algorithmische

Mehr

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Unter Next Generation Sequencing (NGS) werden verschiedene neue Technologien zusammengefasst, die nicht auf kapillar basierenden Sequenzierautomaten beruhen. Das 1990 ins Leben

Mehr

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de

Mehr

Next Generation Gene Sequencing bei Brustkrebs

Next Generation Gene Sequencing bei Brustkrebs Institut für Medizinische Genetik Next Generation Gene Sequencing bei Brustkrebs Prof. Dr. med. Anita Rauch 08.10.2015 Seite 1 Benefit der Krebsfrüherkennung Antilla et al. 2014 08.10.2015 Anita Rauch

Mehr

Social Media Krisen. Marcus Strobel

Social Media Krisen. Marcus Strobel Social Media Krisen Marcus Strobel Aufwärmprogramm Social Media Hass & Liebe zugleich Digitale Visitenkarte Gilt für Personen, Unternehmen & Marken Treiber der Entwicklung Wo stehen wir heute? Das Social

Mehr

Informationen zum Thema Datensicherheit

Informationen zum Thema Datensicherheit Gesundheitskarte AKTUELL Informationen zum Thema Datensicherheit Das medizinische Wissen und damit auch die medizinische Behandlung werden immer spezialisierter. Eine wachsende Zahl von Spezialisten sorgt

Mehr

Nina. 2. Ninas Mutter lebt nicht mit Nina und der Familie zusammen. Warum könnte das so sein? Vermute. Vielleicht ist sie. Möglicherweise.

Nina. 2. Ninas Mutter lebt nicht mit Nina und der Familie zusammen. Warum könnte das so sein? Vermute. Vielleicht ist sie. Möglicherweise. Seite 1 von 6 1. Hier siehst du Bilder von Nina und den Personen, mit denen Nina zusammenwohnt. Schau dir die Szene an und versuche, die Zitate im Kasten den Bildern zuzuordnen. Zu jedem Bild gehören zwei

Mehr